Home

Geneious User Manual

1. GCCATCCTTTTGGGCATGTTGGATCCAGTCGAGAAGGACGATA Translation A 650 660 670 680 house mouse ACAACATGCCTGTGACGGCCCGTGTGGTGAGTCGGAAGGCTGT Translation 690 700 710 720 730 house mouse GTGAATGCTTGAGCCAATACAAGAGGAATATGTACAGTTGTGC Translation gt ORF M cos 1 M exon 2 O mRNA 1 I N source 1 y M Annotations 1 of 5 gt Restriction Site gt Layout y C Complement amp M Translation amp Properties Genetic code Frame Colors mM Translation Standard El aa e 740 750 760 770 Translation 5 Alt click on a sequence position or annotation or select a region to zoom in Alt shift click to zoom out house mouse ATGTTAGAGCAGTGGTTCTCAGCCTTTGGGGTCATGACCCCTT v Statistics 1 596 Length 1 596 Figure 3 4 Translating a CDS Translations can be synchronised between seguences in an alignment with reference to the the MacClade colour scheme individual seguences the alignment the consensus or a specific reference seguence Figure 3 5 shows an example of a DNA alignment coloured by the amino acid translation using 3 1 THE SEQUENCE AND ALIGNMENT VIEWER 65 Alignment View Text View Notes lt a b Er Extract El Reverse Complement 5 Translate P Allow Editing TP Annotation Tools M Save po LEJL l s Colors ACGME By Translatio F Options gt VI Graphs gt Consensus amp
2. e Ligate Sequences lets you ligate two or more fragments with or without overhangs e Insert into Vector allows you to choose a digested fragment or a sequence with two restriction site annotations to use as an insert and insert them into a vector circular sequence Geneious can do the work of working out what cut sites on the vector are compatible with the overhangs on the insert with some additional information from you The following sections explain the more complicated operations in a little more detail 11 1 Find Restriction Sites The option Find Restriction Sites from the Tools Cloning menu or the context menu allows you to find and annotate restriction sites on a nucleotide sequence You can configure the following options Figure 11 1 e Candidate Enzymes lets you select a set of restriction enzymes from which you want to draw the ones to use in the analysis This will always include the option to use all known commercially available restriction enzymes but if your search index is intact then all restriction enzyme set documents from your local database will also be listed see below for how to create such a document e Minimum effective recognition sequence length lets you filter the candidate enzymes to in clude only ones whose recognition sequence has a given minimum effective length For example EcoRI s recognition sequence is 6 nucleotides long GAATIC The effective length takes ambiguities into account s
3. A Fewer Options Restore Defaults Cancel 0K Figure 4 9 Primer design advanced options Primer Picking Weights At the bottom of both the advanced primer and DNA probe options there is a Primer Picking Weights button Clicking this brings up a second dialog containing many more options The purpose of all of these options is to allow you to assign penalty weights to each of the param 100 CHAPTER 4 ANALYSING DATA eters you can set in the options The weight specified here determines how much of a penalty primers and probes get when they do not match the optimal options The higher the value the less likely a primer or probe will be chosen if it does not meet the optimal value Some of the weights allow you to specify a Less Than and Greater Than This is for options which allow you to specify an optimum score such as GC content These weights are used when looking at primers whose value for this option falls below and above the optimum respectively The other weights are applied no matter in which direction they vary For details on individual options in the Primer Picking Weights dialog again hover your mouse over the option to see a short description 4 6 7 More Information The Primer feature in Geneious is based on the program Primer3 http frodo wi mit edu cgi bin primer3 primer3 www cgi Copyright c 1996 1997 1998 1999 2000 2001 2004 Whitehead Institute for Biomedical Research All rights reserved
4. constrained string strinal Text Note x 4nd my poor Fool is hanged No no no life Why should a dog a horse a rat have life Note And thou no breath at all Thou lt come no more Never never never never never Pray you undo this button Figure 2 14 The Notes View 2 8 1 Editing Notes To edit the fields of a note simply click on the field and enter your data Some fields may have constraints which you can edit in the Edit Note Types dialog see 2 8 2 If the data you have 50 CHAPTER 2 RETRIEVING AND STORING DATA entered does not conform to the constraints of the field it will be displayed in red and you will be shown the field s constraints in a tooltip see figure 2 14 Tip To enter a new line in a text field press Shift enter or Ctrl enter When multiple documents are selected the Notes view displays all of the notes belonging to the selected documents When each document has the same value for a note field itis displayed in the viewer If the documents have different values or some of the selected documents do not have a note of that particular type then the field will show that it represents multiple values Changes made to the fields will apply to all selected documents 2 8 2 Editing Note Types To edit your note type click the Add a Note button on the viewer toolbar and select Edit note types This will bring up a window similar to that displayed in figure 2 16 FX Ad
5. z ldentical Journal Title First Author PMID Sequence Resi URLFR Figure 2 2 The document table when browsing the local folders This information is presented in table form Figure 2 2 Selecting a document in the Document Table will display its details in the Document View Panel Selecting multiple documents will show a view of all the selected documents if they are of similar types eg Selecting two sequences will show both of them side by side in the sequence view There are several ways to select multiple documents e Hold Ctrl 8 key on Mac OS X and click to add the document to the current selection e Hold Shift and click to add the document and all documents between it and your previous selection On windows the right mouse button can be clicked and held while moving the mouse to easily select a block of documents The popup menu will appear once the mouse is released so the newly selected documents can quickly be manipulated Double clicking a document in the Document Table displays the same view in a separate win dow To view the actions available for any particular document or group of documents right click Ctrl click on Mac OS X on a selection of them These options vary depending on the type of document The Document Table has some useful features Editing Values can be typed into the columns of the table This is a useful way of editing the information in a document To edit a particular value
6. 2 4 2 UniProt This database is a comprehensive catalogue of protein data It includes protein sequences and functions from Swiss Prot TrEMBL and PIR It has three main components each optimized for a particular purpose 2 4 3 NCBI Entrez databases NCBI was established in 1988 as a public resource for information on molecular biology Geneious allows you to directly download information from nine important NCBI databases and perform NCBI BLAST searches Table 2 1 Table 2 1 NCBI databases accessible via Geneious Database Coverage Genome Whole genome seguences Nucleotide DNA seguences PopSet sets of DNA seguences from population studies Protein Protein seguences Structure 3D structural data PubMed Biomedical literature citations and abstracts Taxonomy Names and taxonomy of organisms SNP Single Nucleotide Polymorphisms Gene Genes The Entrez Genome database This provides views of a variety of genomes complete chromo somes sequence maps with contigs contiguous sequences and integrated genetic and physi cal maps The Entrez Nucleotide database This database in GenBank contains 3 separate components that are also searchable databases EST GSS and CoreNucleotide The core nucleotide database brings together information from three other databases GenBank EMBI and DDBJ These are 36 CHAPTER 2 RETRIEVING AND STORING DATA part of the International collaboration of Sequence Databases
7. Additionally documents imported in any chromatogram or molecular structure format can be re exported in that format as long as no changes have been made to the document 2 2 5 Export to comma separated values CSV file The value displayed in the document table can be exported to csv file which can be loaded by most spread sheet programs When choosing to export in csv format Geneious will also present 2 3 SEARCHING 31 Data type Export format options DNA sequence FASTA Genbank XML Genbank flat Geneious Amino acid sequence FASTA Genbank XML Genbank flat Geneious Protein 3D structure PDB FASTA Geneious Multiple sequence alignment Phylip phy FASTA NEXUS 13 MEGA3 12 Geneious Phylogenetic tree Phylip phy FASTA NEXUS 13 Newick MEGA3 12 Geneious PDF document PDF Geneious Publication EndNote 8 0 Geneious a list of the available columns in the table including hidden ones so you can choose which to export Please note this format cannot be imported currently 2 2 6 Batch Export Batch export takes the selected documents and exports each to its own file Eg Select several chromatograms to export them all to ab1 format files The options for batch export let you specify the format and folder to export to as well as the extension to use Each file will be named according to the Name column in Geneious 2 3 Searching Searching is designed to be as user friendly as possible and the process is
8. Description 4 Categories Coiled coils prediction Predicts coiled coils in amino acid sequences Contig Sorter Sorts sequences in a contig according to the position of CpG Islands Identifies likely CpG islands in a DNA sequence DeCypher Plugin Provides the ability to run various DeCypher server DualBrothers Recombination Detection Detect recombination and EMBOSE Tale Deol le f ha EMBOSS L Install plugin from a gplugin file J D Check for plugin updates now J M Automatically check for updates to installed plugins M Tell me when new plugins are released C Also check for beta releases of plugins Features The set of features available in Geneious can be customized to suit your work Customize Feature Set J Figure 2 18 The plugins preferences in Geneious 2 9 PREFERENCES 55 2 9 3 Appearance and Behavior Here you can change the way Geneious looks and the way it interacts with you Appearance options allow you to change the way the main toolbar and the document table look Behaviour options allow you to change the way newly created documents are handled Such as Whether they are selected straight away and where they should be saved to 2 9 4 Keyboard This section contains a list of Geneious functions and allows you to define keyboard shortcuts to them Shortcuts that are already defined are highlighted in blue Setting shortcuts can help you quickly nav
9. Everybody group due to read only access 146 CHAPTER 12 SERVER DATABASES PRO ONLY 12 4 2 Database Indexing Geneious indexes every document that is added to a server database for searching It is very unlikely that this index will become corrupted But if you are not getting correct search results or if you simply believe the database index has become corrupt somehow the admin of the Everybody group can right click on the top folder of a server database to re index it This will not affect any other users until it is complete however if your database contains many documents it will take a long time Geneious must be left open to re index the database Bibliography 1 SF Altschul W Gish W Miller EW Myers and DJ Lipman Basic local alignment search tool J Mol Biol 215 1990 no 3 403410 18 26 36 2 MO Dayhoff ed Atlas of protein sequence and structure vol 5 National biomedical re search foundation Washington DC 1978 80 3 R Durbin S Eddy A Krogh and G Mitchison Biological sequence analysis Cambridge University Press 1998 82 4 J Felsenstein Confidence limits on phylogenies An approach using the bootstrap Evolution 39 1985 no 4 783 791 88 5 DF Feng and RF Doolittle Progressive sequence alignment as a prerequisite to correct phyloge netic trees J Mol Evol 25 1987 no 4 351 60 83 6 O Gotoh An improved algorithm for matching biological sequences J Mol Biol 162
10. Highlighting gt Annotations 7 gt Layout amp Properties w Complement Translation O Translation Genetic code Invertebrate Mitoc 18 Relative to Alignment TA v Statistics 221 90 6 Length 221 Seguences 116 a Pairwise Identity 90 6 Identical Sites 50 22 6 Frequencies Ds 5 AKS 70 4 129 ARV IAT TRAIN C AGTDATAGTDT A CHEIGATGGDACOGITACTACT CCGA TREN lt OMAAN lt ODA TT EME C AGTDA TAGTDT A THEIGATGGTACOROAG A CUE A MIB c CORMAN Cc TAGAGCo ODA TT ENE C AGTDA TAGTDT A TARDA TG GD TEOROACOACHEAs A TAT CCC GOA CTAGAGC AI ODA OMAN C ACATA TAGANT A TAAGO TC TT C CTA CHANA GTA G TRIMMITCTAGAGCT KATTAA CAGIDATAGIOTA TARDA TC OTTOON c cT ACHRE A TA cAc ca acac cT KATTAN C AGTTA TAGAT A TARDA TC OTTOON ACT ACHRE A TAA GAG T CTAGAGCTI ETET o ana lt lt Alt click on a seguence position or annotation or select a region to zoom in Alt shift click to zoom out Figure 3 5 Colour an alignment by Amino Acid Translation 3 1 9 Statistics This displays some statistics about the sequence s being viewed They correspond to the se quence alignment assembly being viewed or the highlighted part of the sequence alignment assembly The length of the sequence or part of the sequence is displayed next to the Statistics option Residue frequencies This section lists the residues for both DNA and amino acid sequences and
11. Hydrophobicity This is available with protein sequences It displays the Hydrophobicity of the residue at every position or the average Hydrophobicity when there are multiple sequences pl pI stands for Isoelectric point and refers to the pH at which a molecule carries no net elec trical charge The pl plot displays the pl of the protein at every position along the sequence or the average pI when multiple sequences are being viewed Sliding window size This calculates the value of the graph at each position by averaging across a number of surrounding positions When the value is 1 no averaging is performed When the value is 3 the value of the graph is the average of the residue value at that position and the values on either side Chromatogram This is available with chromatogram traces It displays the four traces above the sequence where the peak as detected by the base calling program is at the middle of the base letter When viewing more than one chromatogram or an alignment made from chro matograms each chromatogram can be turned on or off individually using the checkbox s below Note that since the distance between bases as inferred from the trace varies the trace may be either contracted or expanded compared with the raw data Quality This is available with enabled chromatogram traces It displays a quality measure typically Phred quality scores for each base as assessed by the base calling program The quality is shown as a
12. Identity When viewing alignments or assemblies this gives the average percent identity over the alignment This is computed by looking at all pairs of bases at the same column and scoring a hit one when they are identical divided by the total number of pairs Confidence mean When viewing chromatograms this gives the mean of the confidence scores for the currently selected base calls Confidence scores are provided by the base calling pro gram not Geneious and give a measure of quality higher means a base call is more likely to be correct An untrimmed value is also displayed if the selected region contains trims Expected Errors When viewing chromatograms this gives the approximate number of errors that are statistically expected in the currently selected region This is calculated by converting the confidence score for each base call in to the error probability and summing across the region This also has a value for the untrimmed selection if the region contains trims Ungapped Lengths of Sequences Displays the mean standard deviation minimum and maxi mum of the lengths of the sequences Coverage of Bases When viewing a contig assembly this gives the mean standard deviation mininum and maximum of the coverage of each base in the consensus sequence 3 1 10 The sequence viewer toolbar The top of the sequence viewer panel shows a toolbar containing several actions Some of them operate on a part of a sequence or alignment
13. g genelous Geneious 4 8 Biomatters Ltd March 4 2010 Contents 1 Getting Started 11 Downloading amp Installing Geneious lt ososcnes cirios 1 2 Using Geneious FOr Tie first ime o eo ca cs EREDAR ESE KK x Ks e A e ka kea a KK Ka VAR E Ann eee Bee 8 9 2 Retrieving and Storing data 2l Tee as ski KOR S are Oe RE 22 Imports and Exporting AR nce kee Ps ed Bees AR A KA 29 o 4 sa 4 Ka a KIEL E IEA RTK ERED ET Ew ROE Ee Re EE RODS 24 Pablicdatabag ss o lt gt ee HA Phe KK PEKKA AE ta de RS 25 Storing data Your Local Documents ss sa osease eee ees 20 AMS sai a AAA AA AE e E RS 2d Pilternng and Similarity somtia amp oos bk sa ks kka we we Re we eS 2o NOES oi koke kok Pee Rh a wa we Boe Whee ede oe we ae 29 VOOR AM 210 Fenn and Saving ieee IA Oe OLE KUKA eRe eH 3 Document Viewers 21 he Sequence land alignment Viewer ss ee aa ee eee ee dee eee Ha 32 D otplotviewer cies Pee Be PRG 63 VO ODES ARES CREE BOGOR Os E Viewer 2 airea Da slim Baw SRG SE Ee 3 4 Tree viewer ooo doda arere 3 5 The Chromatogram viewer 1 644 sameaa 4 3 6 The PDF document viewer 3 7 The Journal Article Viewer Analysing Data 41 Literahme 224 6 ceapa hal SY have e ees 42 Seguence data lt 1 30 sa 843851 ESA 20 DSO A 4 4 Sequence Almenar 4 5 Building Phylogenetic trees do PCR Primers re only o c se ceres is 47 Contig Assembly Pro only 66 sa ka raskas 48
14. ing you to quickly locate conserved sites in the alignments Highlight ambiguities greys out non ambiguous residues Highlight gaps greys out non gap positions Highlight transitions transversions greys out residues that are not transitions transversions com 62 CHAPTER 3 DOCUMENT VIEWERS pared to the consensus sequence When highlighting transitions transversions it is recom mended you turn on the ignore gaps consensus option or some residues may be wrongly high lighted due the consensus displaying N for sites that contain gaps and non gaps Go to next disagreement agreement transition transversion ambiguity goes to the next highlighted feature as described in the previous section on highlighting Highlighting can be applied with reference to the consensus or a selected reference seguence 3 1 6 Annotations Some protein and nucleotide seguences come with annotations and these can be viewed within Geneious sequence viewer In the presence of annotations the options panel includes an An notations check box Figure 3 3 Uncheck the check box to turn off all annotations Individual annotation types can be turned on or off by using the check boxes next to them gt sequence View Annotations Dotplot Self Text View Notes lt a D Cr Extract Sf Reverse Complement 9 Translate P Allow Editing BWP Annotation f Tools M Save ENO 1 10 20 30 40 50 60 r p Tms lale 003307 HRMISRARSA CT
15. 1982 705 708 80 7 S Guindon and O Gascuel A simple fast and accurate algorithm to estimate large phylogenies by maximum likelihood Syst Biol 52 2003 no 5 696 704 86 8 M Vingron HA Schmidt K Strimmer and A von Haeseler Tree puzzle maximum likelihood phylogenetic analysis using quartets and parallel computing Bioinformatics 18 2002 no 3 502 504 28 9 M Hasegawa H Kishino and T Yano Dating of the human ape splitting by a molecular clock of mitochondrial dna J Mol Evol 22 1985 no 2 160 174 88 10 S Henikoff and JG Henikoff Amino acid substitution matrices from protein blocks Proc Natl Acad Sci US A 89 1992 no 22 10915 10919 80 11 T Jukes and C Cantor Evolution of protein molecules pp 21 32 Academic Press New York 1969 88 12 S Kumar K Tamura and M Nei Mega3 Integrated software for molecular evolutionary ge netics analysis and sequence alignment Brief Bioinform 5 2004 no 2 150 163 31 147 148 BIBLIOGRAPHY 13 DR Maddison DL Swofford and WP Maddison Nexus an extensible file format for sys tematic information Syst Biol 46 1997 no 4 590 621 28 31 87 14 JV Maizel and RP Lenk Enhanced graphic matrix analysis of nucleic acid and protein se guences Proc Natl Acad Sci US A 78 1981 no 12 7665 9 78 79 15 C Michener and R Sokal A quantitative approach to a problem in classification Evolution 11 1957 130 162 86 87
16. Cost Matrix 65 similarity 5 0 4 0 B Gap open penalty B Gap extension penalty 3 8 Alignment type Global alignment with free end gaps A Automatically determine sequences direction Build guide tree via alignment faster Refinement Options Refinement iterations 211 gt Restore Defaults Cancel Ca Figure 4 3 The multiple alignment window You can also do a multiple alignment via translation and back as with pairwise alignment 4 4 3 Sequence alignment using ClustalW Pro only ClustalW is a widely used program for performing seguence alignment 24 23 If you have ClustalW installed your computer Geneious pro allows you to run ClustalW directly from inside the program without having to export or import your seguences If you do not have ClustalW or are unsure if you do you should attempt to perform a ClustalW alignment without specifying a location Geneious will then present you with options includ ing details on how to download ClustalW and will offer to automatically search for ClustalW on your hard drive To perform an alignment using ClustalW select the seguences or alignment you wish to align and select the Alignment button from the Toolbar At the top of the alignment options win dow there are buttons allowing you to select the type of alignment you wish to do Choose ClustalW here and the options available for a ClustalW alignment will be displayed The options are e C
17. This database also contains Ref Seg records which are NCBI curated non redundant sets of sequences The Entrez Popset database This database contains sets of aligned seguences that are the result of population phylogenetic or mutation studies These alignments usually describe evolution and population variation The PopSet database contains both nucleotide and protein seguence data and can be used to analyze the evolutionary relatedness of a population The Entrez Protein database This database contains seguence data from the translated coding regions from DNA seguences in GenBank EMBL and DDBJ as well as protein seguences sub mitted to the Protein Information Resource PIR SWISS PROT Protein Research Foundation PRF and Protein Data Bank PDB seguences from solved structures The Entrez Structure database This is NCBI s structure database and is also called MMDB Molecular Modeling Database It contains three dimensional biomolecular experimentally or programmatically determined structures obtained from the Protein Data Bank The PubMed database This is a service of the U S National Library of Medicine that includes over 16 million citations from MEDLINE and other life science journals This archive of biomed ical articles dates back to the 1950s PubMed includes links to full text articles and other related resources with the exception of those journals that need licenses to access their most recent issues Entrez Tax
18. first click on the document and then click on the column which you want to edit Enter the appropriate new information and press enter Certain columns cannot be edited however eg the NCBI accession number 18 CHAPTER 2 RETRIEVING AND STORING DATA Copying Column values can be copied This is a quick method of extracting searchable infor mation such as an accession number To copy a value right click Ctrl click on Mac OS X on it and choose the Copy name option where name is the column name Sorting All columns can be alphabetically numerically or chronologically sorted depending on the data type To sort by a given column click on its header If you have different types of documents in the same folder click on the Icon column to sort then according to their type Managing Columns You can reorder the columns to suit Click on the column header and drag it to the desired horizontal position You can also choose which columns you want to be visible by right clicking Ctrl click on Mac OS X on any column header or by clicking the small header button in the top right corner of the table This gives a popup menu with a list of all the available columns Clicking on a column will show hide it Your preference is remembered so if you hide a column it will remain hidden in all areas of the program until you show it again As well as items to show hide any of the available columns there are a few more options in this popup men
19. gives rise to a Greedy consensus tree In constructing a Greedy consensus tree clades are first ordered according to the number of times they appear i e the amount of support they have then the consensus tree is constructed progressively to include all those clades whose support is above the threshold and that are compatible with the tree constructed so far Note The above definitions apply to rooted trees The same principles can be applied to un rooted trees by replacing clades with splits Each branch edge in an unrooted tree corre sponds to a different split of the taxa that label the leaves of this tree 4 5 7 Sort topologies This will produce one or more trees summarizing the results of resampling The frequency of each topology in the set of original trees is calculated and the topologies are sorted by their frequency A number of these topologies based on the topology threshold will be output as summary trees The summary trees have branch lengths that are the average of the lengths of the same branch from trees with the same topology The topology threshold determines what percentage of the original tree topologies must be represented by the summarizing topologies The most common topology will always be output as the first summary tree If the frequency of this does not meet the threshold then the next most frequent topology will be added and so on until the total frequency of the topologies reaches
20. remove them from the sequence s completely This can be undone in the Sequence View before the sequences are saved e Remove existing trimmed regions from sequences This is only available when there are already trimmed regions on some of the sequences This will remove the existing trimmed regions from the sequences permanently no new trimmed regions are calcu lated e Screen for vectors Screens the sequences against UniVec to locate any vector contam ination and trim it This uses an implementation similar to NCBI s VecScreen to detect contamination http www ncbi nlm nih gov projects VecScreen e Error Probability Limit Available for chromatogram documents which have quality confidence values The ends are trimmed based on these quality values using the modified Mott algorithm Richard Mott personal communication This results in the longest pos sible un trimmed region with an error probability no more than the limit specified e Maximum low quality bases Specifies the maximum number of low quality bases that can be in the untrimmed region Low Quality is normally defined as confidence of 20 or less This can be adjusted on the Sequencing and Assembly tab of Preferences Maximum Ambiguities Finds the longest region in the sequence with no more N s than the maximum ambiguous bases value and trims what is not in this region This should be used when sequences have no quality information attached e Trim 5 End and Tr
21. 4 nucleotides 1 per match CCGC 3 1 4 0 2 nucleotides 1 per match AASCGTT 6 0 2 nucleotides 1 per match GGATC 4 5 5 0 1 nucleotide 1 per match Y GGCCR 5 0 4 nucleotides 1 per match R AATTY 5 0 4 nucleotides 1 per match CTGAAG 16 14 6 0 3 2 nucleotides 1 per match CAC GTG 6 0 blunt 1 per match GR CGYC 5 0 5 2 nucleotides 1 per match CACNNN GTG 6 0 3 3 nucleotides 1 per match GT AC 4 0 blunt 1 per match C Only consider enzymes with palindromic recognition seguence Restriction enzyme information was obtained from rebase a free database Save Selected Enzymes A Fewer Options Restore Defaults Figure 11 1 Find Restriction Sites options dialog with extended options showing 11 3 INSERT INTO VECTOR Digest into fragments Digest using O Annotated cut positions Enzyme set enzymes from lab fridge 6 Minimum effective recognition seguence length 32 nucleotides lto times 6 enzymes selected Recognition Segu Effective Length GCGAT CGC 8 0 CCTCAGC 5 2 7 0 GC GGCCGC 8 0 11 13 CAANNNNNG 7 0 GGCCGG CC 8 0 RTGCAGCAY 7 0 A Fewer Options Restore Defaults Figure 11 2 Digest into fragments options dialog with extended options showing 11 3 Insert into Vector Overhang 5 2 nucleotides 3 3 nucleotides 3 4 nucleotides S 2 nucleotides S 4 nucleotides blunt 1 per match 1 per match 1 per match 2
22. 91 16 SB Needleman and CD Wunsch A general method applicable to the search for similarities in the amino acid sequence of two proteins J Mol Biol 48 1970 no 3 443 53 79 80 86 103 17 C Notredame DG Higgins and J Heringa T coffee A novel method for fast and accurate multiple sequence alignment J Mol Biol 302 2000 no 1 205 217 26 18 RJ Roberts T Vincze J Posfai and D Macelis Rebase enzymes and genes for dna restriction and modification Nucl Acids Res 35 2007 D269 D270 133 19 F Ronquist and JP Huelsenbeck Mrbayes 3 Bayesian phylogenetic inference under mixed models Bioinformatics 19 2003 no 12 1572 4 86 20 N Saitou and M Nei The neighbor joining method a new method for reconstructing phyloge netic trees Mol Biol Evol 4 1987 no 4 406 25 86 87 91 21 TF Smith and MS Waterman Identification of common molecular subsequences Journal of Molecular Biology 147 1981 195 197 79 80 22 K Tamura and M Nei Estimation of the number of nucleotide substitutions in the control region of mitochondrial dna in humans and chimpanzees Mol Biol Evol 10 1993 no 3 512 526 88 23 JD Thompson TJ Gibson F Plewniak F Jeanmougin and DG Higgins The clustal x windows interface flexible strategies for multiple sequence alignment aided by quality analysis tools Nucleic Acids Res 25 1997 no 24 4876 4882 24 26 28 83 84 24 JD Thompson DG Higgins
23. Ctrl 3 Z All operations are under the main Edit menu Selecting a region enables the Annotations button as well which opens an annotation en try dialog Enter an annotation name and select a existing type or type a new one Click on More Options to enter additional properties for that annotation Double click on an existing annotation to edit it or right click Ctrl click on Mac OS X to display a pop up menu to delete annotations You can also copy an annotation from one seguence to another from the pop up menu When editing an alignment it is possible to select a region which may span several seguences and drag it to the left or right Dragging will either move residues over existing gaps or open new gaps when necessary Dragging a selection consisting entirely of gaps moves the gaps to the new location To guickly select a single residue double click on it Triple clicking will select a block of residues within a single seguence Ouadruple clicking selects a block of residues in multiple seguences The Shift and Ctrl Alt Option on a Mac keys can be combined with the keyboard arrow keys to select seguence and alignment regions The Shift key extends the current selection and holding down the Ctrl Alt Option on a Mac key while pressing the keyboard arrow is eguivalent to pressing it 10 times These can be used together For example in an alignment if you have a region of one seguence selected and would like to select
24. Dotplot Self Text View Notes G db Er Extract EF Reverse Complement 4 Translate g Allow Editing WP Annotation X Tools M Save a ele 26 eE sso 600 650 700 A E N Colors ACGT x D gt M Graphs exon 3 Mm 1 Cys peroxiredoxin protein mRNA y Annotations 5 gt M Restriction Site gt ORF 800 850 900 950 1 000 eh ce CE Se eS ee t IM aT N M cps 1 C Yon G M mRNA 1 III mM source 1 o 1 050 1 100 1 150 1 200 1 250 Layout amp Properties gt Complement amp Translation source Mus musculus exon 4 nes 1 Cys peroxiredoxin protein mRNA v Statistics 1 596 Lo Frequencies A 413 25 9 1 300 1 350 1 400 1 450 1 500 C 342 21 4 man TAO ee E ue III en E L G 370 23 2 T 471 29 5 GC 712 44 6 gt Alt click on a sequence position or annotation or select a region to zoom in Alt shift click to zoom out Figure 3 1 A view of an annotated nucleotide sequence in Geneious Hold the zoom key and turn the scroll wheel on your mouse if you have one to zoom in and out e Hold the zoom key and click on an annotation to zoom to that annotation You can also pan in the Sequence Vlew by holding Ctrl Alt 88 Alt on Mac OS X and clicking on the sequence and dragging 3 1 2 Circular View When a circular sequence is selected the default view is to display the sequence as circular The view can be rotated by using the scrollbars Even though a sequence is circula
25. If you use the primer design feature of Geneious for publication we request that you cite primer3 as Steve Rozen and Helen J Skaletsky 2000 Primer3 on the WWW for general users and for biologist programmers In Krawetz S Misener S eds Bioinformatics Methods and Protocols Methods in Molecular Biology Humana Press Totowa NJ pp 365 386 Source code available at http fokker wi mit edu primer3 Further information on the functionality of the primer design feature can be found in the primer3 documentation available here http frodo wi mit edu cgi bin primer3 primer3 www help cgi Please note that some controls have been changed renamed or re moved from Geneious but most of the primer3 functionality is available 4 7 Contig Assembly Pro only Contig assembly or seguence assembly is normally used to merge overlapping fragments of a DNA seguence into a contig which can be used to determine the original seguence The contig essentially appears as a multiple seguence alignment of the fragments After some manual editing of the contig to resolve disagreements between fragments which result from read errors the consensus seguence of the contig is extracted as the seguence being reconstructed Contig assembly is also used to align a large number of reads of the same seguence from different individuals This is done to find small differences between reads or SNPs Single Nucleotide Polymorphisms In this type of analysis the cons
26. PRIMERS PRO ONLY 95 For each of these specific reasons for rejection are listed eg Tm too high or Unaccept able product size along with a percentage which expresses how many of the candidate primers or probes were rejected for this reason After examining the details you can choose take no action or continue and annotate the primer and or DNA probes on the sequences which were successfully designed for 4 6 2 Primer Database The Primer Database consists of all the oligonucleotide documents that exist in your Local or Server databases The oligonucleotide Y document type is a short nucleotide sequence representing either a primer or a probe The text view lists the primer characteristics Tm GC etc These properties can be shown in the document table Tm is shown by default but you can turn on others by right clicking on the table header Oligo sequences are created via one of the following methods e Extract a primer probe annotation from a sequence e Select Sequence New Sequence from the menu and choose Primer or Probe as the type of the new sequence e Select one or more existing primer sequences maybe ones imported from a file then click Primers Convert to Oligo to transform them into oligo type sequences If you select a target sequence and go to Test Primers or Design Primers Design With Existing Geneious will find all oligo sequences in your data
27. The sequence logo graph has an option to Weight by quality This is very useful for identifying low quality regions and resolving conflicts G Extract g Reverse Complement Translate P Allow Editing Annotation Tools M Save a 0 1 200 400 600 800 1 000 1 200 1 400 1 612 E CL__Q___EEEE __QOEQCQCE0EEA_A EEAEEEGEOEA AS Consensus DEE eee o o o q O o a Figure 4 12 The overview of a contig Finding disagreements or SNPs To easily identify bases which do not match the consensus turn on Highlight Disagreements in the consensus section of the sequence viewer options When this is on any base in the sequences which matches the consensus at that position is grayed out and bases not matching are left colored With this on you can quickly jump to each disagreement by pressng Ctrl D 38 D on Mac OS X or by clicking the Next Disagreement button in the sequence viewer option panel to the right Each disagreement can then be examined or resolved You can also use this feature If you have aligned to a reference sequence and you are interested in finding differences between each sequence and the reference or SNPs 4 8 RESULTS OF ANALYSIS 107 4 7 5 Editing Contigs Editing a contig is exactly the same as editing an alignment in Geneious After selecting the contig click the Edit button in the sequence viewer and you can modify insert and delete Characters like in a standard text editor Edit
28. There are several ways to make such a selection e Mouse dragging Click and hold down the left mouse button at the start position and drag to the end position By using the Ctrl Windows Linux or Mac keys it is possible to select multiple regions of a seguence or alignment e Select from annotations When annotations are available click on any annotation to select the annotated residues As with mouse dragging multiple selections are supported e Click on sequence name This will select the whole sequence e Select all Use the keyboard shortcut Ctrl A to select everything in the panel The available actions are Extract Extract the selected part of a seguence or alignment into a new document 3 1 THE SEQUENCE AND ALIGNMENT VIEWER 67 Reverse Complement Reverse sequence direction and replace each base by its complement This is available only for nucleotide sequences Translate Translate DNA into protein Clicking on this choice brings up a list of genetic codes that can be used Choose the appropriate one and click OK This is available only for nucleotide sequences Allow Editing Annotations Tools and Save 3 1 11 Editing sequences and alignments To edit sequence s or an alignment click the Allow Editing toolbar button After selecting a residue or a region you can either type in the new contents or use any of the standard editing operation such as Copy Ctrl 36 C Cut Ctrl 8 X Paste Ctrl 36 V and Undo
29. Wrap sequence and deselect Colors before printing Wrapping prints the sequence as seen in the sequence viewer and the font size is chosen to fill the horizontal width of the page 3 2 Dotplot viewer This is a special viewer that appears when two sequences are chosen A dotplot compares two sequences to find regions of similarity Each axis X and Y on the plot represents one of the sequences being compared Figure 3 6 For more information on dotplots see section 4 3 3 3 3D structure viewer For molecular structure documents such as PDB documents this displays an interactive three dimensional view of the structure 3 3 1 Structure View Manipulation e Click and drag the mouse to rotate the structure e Hold the Alt or Shift key then click and drag to zoom in out Hold the Ctrl key then right click and drag to pan or if you are using a Mac click and hold press Ctrl and Alt Option then drag to pan 3 3 3D STRUCTURE VIEWER 69 Sequence View Dotplot Annotations Lengths Graph Notes a pygmy chimpanzee mutated i 1000 2 27 Gx 2 Colors Classic 143 Minimap Display M Reverse complement E up ee 8 Pairwise alignment path a E Data Source 5 High Sensitivity Slow W gt 5 Score Matrix Probabilistic 2 a Window Size 20 1 000 Threshold 50 E Based on the EMBOSS tool dotmatcher Tile Size 10 000 Figure 3 6 A view of dotplot of two sequences
30. acid substitutions insertions and deletions A sequence alignment is an attempt to determine regions of homology in a set of sequences It consists of a table with one sequence per row and with each column containing homologous residues from the different sequences i e residues that are thought to have evolved from a common ancestral nucleotide amino acid If it is thought that the ancestral nucleotide amino acid got lost on the evoluationary path to one descendant sequence this sequence will show a special gap character in that alignment column 4 4 1 Pairwise sequence alignments There are two types of pairwise alignments local and global alignments A Local Alignment A local alignment is an alignment of two sub regions of a pair of sequences 21 This type of alignment is appropriate when aligning two segments of genomic DNA that may have local regions of similarity embedded in a background of a non homologous sequence A Global Alignment A global alignment is a sequence alignment over the entire length of two or more nucleic acid or protein sequences In a global alignment the sequences are assumed to be homologous along their entire length 16 Scoring systems in pairwise alignments In order to align a pair of sequences a scoring system is required to score matches and mis matches The scoring system can be as simple as 1 for a match and 1 for a mismatch between the pair of sequences at any given site
31. as pseudoreplicates is then used to build an individual phylogenetic tree A consensus tree can then be constructed by combining information from the set of generated trees or the topologies that occur can be sorted by their frequency see below 4 Bootstrapping is the statistical method of resampling with replacement To apply bootstrapping in the context of tree building each pseudo replicate is constructed by randomly sampling columns of the original alignment with replacement until an alignment of the same size is obtained 4 4 5 BUILDING PHYLOGENETIC TREES 89 Jackknifing is a statistical method of numerical resampling based on deleting a portion of the original observations for each pseudo replicate A 50 jackknife randomly deletes half of the columns from the alignment to create each pseudo replicate 4 5 6 Consensus trees A consensus tree provides an estimate for the level of support for each clade in the final tree It is built by combining clades which occurred in at least a certain percentage of the resampled trees This percentage is called the consensus support threshold A 100 support threshold results in a Strict consensus tree which is a tree where the included clades are those that are present in all the trees of the original set A 50 threshold results in a Majority rule consensus tree that includes only those clades that are present in the majority of the trees in the original set A threshold less that 50
32. because of a recognition sequence length constraint or because you have selected a subset of the table rows yourself you can save the currently selected enzymes into a separate document by clicking Save Selected Enzymes The document will be created in the current folder in your local database and this set will then beavailable in the Candidate Enzymes option in this and all future analyses until the document is deleted You can choose a custom name for the document such as Lab Fridge or Enzymes in pBlueScript II SK multiple cloning site After configuring your options click OK to start the analysis and annotate the restriction sites on the sequence or Cancel to abort 11 2 Digest into fragments The option Digest into fragments from the Tools Cloning menu or the context menu allows you to generate the nucleotide sequences that would result from a digestion experiment You can digest multiple nucleotide sequences at a time If the digestion results in overhangs these will be recorded as annotations on the fragments e If you have selected only one nucleotide sequence document and it has annotated re striction sites you can select Digest using Annotated cut positions to cut the document on these sites When this option is selected the options to filter the enzymes by their effec tive recognition sequence length or number of hits are disabled However if you select a subset of the enzymes under More Options only the cut sites from
33. clicking Click Invite to create this new chat session 132 CHAPTER 10 COLLABORATION PRO ONLY Accepting or Declining an Invitation to Chat When one of your contacts invites you to chat a dialog will appear asking you to accept or decline the chat invitation Clicking Accept will open a chat window that will allow you to chat with the contact who invited you and with all other contacts that were invited If you decline that invitation and enter a reason optional this reason will be displayed to everyone in the chat Sending and Viewing Messages in the Chat The chat window displays your own and your contacts previous messages You can enter new messages in the field at the bottom These messages will only be sent and become visible to your contacts once you click Send or press the Enter key To leave the chat simply close the Chat Window 10 5 3 Setting up and running your own Jabber server Setting up your own Jabber server is simple and means that your documents will never leave your local network This means that you will not have any problems with firewalls achieve much greater download speeds and it provides an extra security layer for the confidentiality of your documents in case it is not sufficient for you that the communication with our Jabber server is encrypted and that we do not log or share your data If you wish to set up and run your own Jabber server we recommend using Wildfire from Ig nite Realtime htt
34. counted as fractional support for each nucleotide in the ambiguity set A and G in this case thus e g two rows with R are counted the same as one row with A and one row with G When more than one nucleotide is necessary to reach the desired threshold this is represented by the best fit ambiguity symbol in the consensus for protein sequences this will always be an X In the case of ties either all or none of the involved residues will be selected Hence an alignment column with only As and Gs in equal number will be represented as an R in the consensus sequence regardless of the consensus threshold When ignore gaps is checked the consensus is calculated as if each alignment column consisted only of the non gap characters otherwise the gap character is treated like a normal residue but mixing a gap with any other residue in the consensus always produces the total ambiguity symbol N and X for nucleotides and amino acids respectively When the aligned sequences contain quality information in the form of chromatograms you can select Highest Quality to calculate a majority consensus that takes the relative residue quality into account When Highlight disagreements is checked the residues in the alignment that are identical to the consensus state for that column are grayed out This allows you to quickly locate variable sites in the alignment Similarly Highlight agreements greys out residues that are not indentical to the consensus allow
35. each group is assembled separately If a reference sequence is specified it is used for all groups eg For the names A03 1 ab1 A03 2 ab1 B05 1 ab1 B05 2 ab1 etc where A03 and B05 are the identifiers you would choose Assemble by 1st part of name separated by full stop e Assembly method Specifies a trade off between the time it takes to assemble and the accuracy of the assembly Higher sensitivity is likely to result in more reads being assem bled 102 CHAPTER 4 ANALYSING DATA e Assemble to reference Select a sequence to use as the reference See section 4 7 2 Trim Sequences Select how to trim the ends of the sequences being assembled See section 4 7 3 e Save assembly report Instead of displaying the results of the assembly in a dialog the results are saved in a separate report document alongside the contig s This lists which fragments were successfully assembled and which contig they went in to along with a list of unassembled fragments Advanced Options Click More Options e Save results in a new subfolder named If selected all results of the assembly will be saved to a new subfolder inside the one containing the fragments This folder will always only contain the assembly results from the one most recent assembly it creates a new folder each time it is run Alignment Options Penalties and scores used when aligning the fragments these nor mally don t need to be changed Other advance
36. few seconds the compressed file containing all the files needed to run Custom BLAST will start downloading You can click Pause to pause the download You can add and search Custom BLAST databases as soon as it has finished downloading and extracting If you shut down Geneious with the file partially downloaded you will need to start downloading it again from the beginning 7 Set Up Search Services Service Custom BLAST W Custom BLAST is not set up Database Location C Documents and Settings matthew Geneious4 5 BLAST Let Geneious do the setup click OK to start a Setup Options 7 Custom BLAST Setup Geneious is downloading the required files You may continue to use Geneious Downloaded 1 805 of 11 530 MB 15 65 Approximately 59 seconds remaining b Downloading Figure 5 1 Setting Up Custom BLAST 5 1 3 Adding Databases Now that you have set up the executables it is time to add databases to your BLAST Adding FASTA databases To create a database from the sequences in a FASTA file go to Tools Add Remove Databases Add Seguence Database and select Custom BLAST from the Service drop down box Choose to Create from file on disk and then click Browse to navigate to the FASTA file that contains 5 1 SETTING UP 111 7 Add Sequence Database Service Custom BLAST Database Name My Database O Use 1 selected seguences Contents 2 Create from file on disk C MyDataba
37. global alignment is appropriate However if the relatedness of the sequences is unknown or they are expected to share only small regions of similarity such as a common domain then a local alignment is more appropriate An efficient algorithm for global alignment was described by Needleman and Wunsch 16 and their algorithms was later extended by Gotoh to model gaps more accurately 6 For local alignments the Smith Waterman algorithm 21 is the most commonly used See the references provided for further information on these algorithms Pairwise alignment in Geneious A dotplot is a comparison of two sequences A pairwise alignment is another such comparison with the aim of identifying which regions of two sequences are related by common ancestry and which regions of the sequences have been subjected to insertions deletions and substitu tions The options available for the alignment cost matrix will depend on the kind of sequence e Protein sequences have a choice of PAM 2 and BLOSUM 10 matrices e Nucleotide sequences have choices for a pair of match mismatch costs Some scores distinguish between two types of mismatches transition and transversion Transitions A G C gt T generally occur more frequently than transversions Differences in the ratio of transversions and transversions result in various models of substitution When applicable Geneious indicates the target sequence similarity for the alignment scores i e th
38. holding the mouse button down drag them over to the desired folder and release If you dragged documents from one local folder to another this action will move the documents so that a copy of the document is not left in the original location In external databases such as NCBI the documents will be copied leaving one in its original location Drag and copy While dragging a document over to your folder hold the Ctrl key Alt Option key on Mac OS X down This places a copy of the document in the target folder while leaving a copy in the original location This is useful if you want copies in different folders Folders themselves can also be dragged and dropped to move them but they cannot be copied The Edit menu Select the document and then open the Edit menu on the menu bar Click on Cut Ctrl X 3 X or Copy Ctrl C 3 C Select the destination folder and Paste Ctrl V 36 V the document into it 2 5 2 Searching your Local folders The Services Panel allows you to browse your Local folder hierarchy Next to each folder name in the hierarchy is the number of documents it contains in brackets When the Local folder or a sub folder is collapsed minimized the brackets next to the folder shows how many files are contained in that folder as well as all of its sub folders In addition if some of the documents in a folder are unread the number of unread documents will also appear in the brackets You can sea
39. icon and the create button You now need to specify a set of search criteria in the exact same way as you do for search the database to search search frequency and the folder you wish the agent to deliver its results to The search frequency may be specified in minutes hours days or weeks You can only use whole numbers Selecting Only get documents created after today will cause the agent to check what docu ments are currently available when the agent is created Then when the agent searches it will only get documents that are new since it was created e g If you have already read all publi cations by a particular author and you want the agent to only get publications released in the future Alternatively you can click the Create Agent button which is available in some advanced search panels This will use the advanced search options you have entered to create the agent 46 CHAPTER 2 RETRIEVING AND STORING DATA The easiest way to organize your search results is to create a new folder and name it appropri ately You can do that by navigating to the parent folder in the Deliver to box and click New Folder or by creating a new folder beforehand 1 Right click Ctrl click on Mac OS X on the Sample Documents or Local folders This brings up a popup menu with a New Folder option 2 Create a new folder and name it according to the contents of the search For example type CytB if s
40. in volves removing sequences from the alignment one at a time and then realigning the removed sequence to a profile of the remaining sequences The number of times each sequence is re aligned is determined by the refinement iterations option in the multiple alignment window The resulting alignment is placed in the folder containing the sequences aligned A profile is a matrix of numbers representing the proportion of symbols nucleotide or amino acid at each position in an alignment This can then be pairwise aligned to another sequence or alignment profile When pairwise aligning profiles mismatch costs are weighted propor tional to the fraction of mismatching bases and gap introduction and gap extension costs are proportionally reduced at sites where the other profile contains some gaps In some cases building a guide tree can take a long time since it requires making a pairwise alignment between each pair of sequences The build guide tree via alignment option may speed this part by taking a different route First make a progressive multiple alignment using a random ordering and use that alignment to build the guide tree Notice that while this typically speeds up the process that may not be the case when the sequences are very distant genetically 84 CHAPTER 4 ANALYSING DATA OOO Alignment A Geneious Alignment MUSCLE Alignment Translation Align ClustalW Alignment Consensus Align Profile Align a Mauve Genome
41. in Geneious 3 D structure Sequence View Text View Notes MY Reset Color 2 Style ky Atoms f Bonds 6 Effects 2 Save mo N 2 Eu IM 3 MET Ms cu A SALA Q 6 GLN H 7 HIS A 8 ALA Mo eu 3 10 Lys IM 11 MET Ma Expand All Collapse All To rotate click and drag To zoom hold shift key while dragging To pan hold shift then double click and drag vrvrvrvrvrvrovrvyryvyy Figure 3 7 A view of a 3D protein structure in Geneious 70 CHAPTER 3 DOCUMENT VIEWERS 3 3 2 Selection Controls To the right of the structure are controls that let you control the selected part of the structure If the structure you are viewing contains more than one model the model combo box will you choose between them The select button lets you select all none or the nonselected region of the structure as well as by element group type or secondary structure The highlight selected checkbox lets you select whether to highlight the selected atoms in the structure view The structure tree shows the atoms in the structure in a tree format Click on regions in the tree to select thoses regions You can also Shift click and Ctrl click to select mutliple regions at once The command box lets you type in arbitrary jmol scripting commands To see some exam ples select one of the pre populated options in the box s drop down For a complete de scription of the commands you can use see http www stolaf edu academics chema
42. of comparison However substitutions inser tions and deletions occur at different rates over evolutionary time This variation in rates is the result of a large number of factors including the mutation process genetic drift and natural selection For protein sequences the relative rates of different substitutions can be empirically determined by comparing a large number of related sequences These empirical measurements can then form the basis of a scoring system for aligning subsequent sequences Many scoring 80 CHAPTER 4 ANALYSING DATA systems have been developed in this way These matrices incorporate the evolutionary prefer ences for certain substitutions over other kinds of substitutions in the form of log odd scores Popular matrices used for protein alignments are BLOSUM 10 and PAM 2 matrices Note The BLOSUM matrix is a substitution matrix The number of a BLOSUM matrix indicates the threshold similarity between the sequences originally used to create the matrix BLO SUM matrices with higher numbers are more suitable for aligning closely related sequences When aligning protein sequences in Geneious a number of BLOSUM and PAM matrices are available Algorithms for pairwise alignments Once a scoring system has been chosen we need an algorithm to find the optimal alignment of two sequences This is done by inserting gaps in order to maximize the alignment score If the sequences are related along their entire sequence a
43. open Internet protocol called XMPP or Jabber it allows you to maintain a list of contacts so that you see who is online when you sign on yourself You can then share documents with your online contacts and browse and work with their documents in return The list of contacts is stored on the server so you can easily access an account including its contacts both at work and on your private computer Collaboration can work with any existing Jabber service such as Google Talk but we recom mend using the Geneious default talk geneious com You can even access several Jabber accounts at the same time which is particularly convenient if you wish to set up and run your own Jabber server section 10 5 3 This chapter shows you how to e Create a new collaboration account e Search for and add contacts to your account Share local folders with your contacts e Search your contacts as you would an online database e Set up and run your own Jabber server 10 1 Managing Your Accounts When you start Geneious you will see the empty Collaboration service in the Services Panel and the Collaboration menu at the top You can open the Add New Account dialog by either 125 126 CHAPTER 10 COLLABORATION PRO ONLY right clicking Ctrl click on Mac OS X on Collaboration in the Services Panel and clicking Add New Account in the popup menu or by selecting the same option from menu at the top 10 1 1 Add New Account In this dialog you are given
44. shaded bar graph overlaid on top of the chromatogram Note that those scores represent an estimate of error probability and are on a logarithmic scale the highest bar represents a one in a million 10 probability of calling error while the middle represents a 3 1 THE SEQUENCE AND ALIGNMENT VIEWER 61 probability of only a one in a thousand 1073 Coverage This is available on sequence alignments and contigs The height of the graph at each position represents the number of sequence which have a non gap character at that position If the selected contig was created using Geneious and it contains sequences in both directions then color coding is used to indicate whether each position is covered by reads in both direc tions Green is used for regions with reads in both directions and yellow is used for regions with reads in one direction only 3 1 5 Consensus amp Highlighting Pro only This option is available when viewing alignments When checked the viewer displays the consensus sequence with the aligned sequences The consensus sequence has the same length and shows which residues are conserved are always the same and which residues are vari able A consensus is constructed from the most frequent residues at each site alignment col umn so that the total fraction of rows represented by the selected residues in that column reaches at least a specified threshold IUPAC ambiguity codes such as R for an A or G nu cleotide are
45. the compressed file containing all the files needed to run COGS BLAST will start downloading You can click Pause to pause the download Once all the files have finished downloading aned setting up you will need to close the dialog If you shut down Geneious with a file partially downloaded you will need to start downloading it again from the beginning Files completely downloaded will not need to be downloaded again 6 2 BLASTing COGs Select any sequence in the document table right click it and select Sequence Search Select the COGS database from the database drop down box and Geneious will give you several options for your blast see Figure 6 2 Number of hits to fetch allows you to fetch results for 6 2 BLASTING COGS 115 the best n hits for your sequence You can choose to download COGs sequence from NCBI with full annotations or to load them without annotations from the COGs database file Finally you have the option of retrieving the sequences for your hits the entire COG for each hit or to just display information about the hits Once you have made your choices click OK If you have selected a Nucleotide sequence Geneious will give you options to translate it at this point 7 Sequence Search pygmy chimpanzee nucleotide Query Use selected alignments for profile searct Enter unformatted or FASTA sequence C Subsequence Database COGs v Y Add Remove Databases x Program COGs BLAST N
46. the options of creating a new account on the server or entering the details for an existing account e g if you want to access an account from an additional com puter If you choose to create a new account Geneious will attempt to automatically register your account on the server at the end of this process Add New Account Create a new account on the server O This account already exists just connect Username Password Confirm password Email address optional C Connect every time I run Geneious Y More Options Figure 10 1 Add New Account dialog box Choose a username and password now Enter your password twice for a new account You can also optionally add an email address Biomatters will need this if you require support regarding e g reset of password or deletion of accounts More Options You can change some of the defaults for new and exiting accounts e Account Name is the name displayed in the Services Panel for this account It defaults to your username if nothing is entered e Server is the server your account connects to default talk geneious com e Jabber Service Name is required by some other Jabber service providers such as Google Talk Don t enter anything here unless you know what you are doing e Port Number for Jabber servers running on a non standard port default 5222 10 1 MANAGING YOUR ACCOUNTS 127 gt Add New Account Create a new account on th
47. the same region in all seguences then you could press Ctrl up until you reach the first seguence and then press Ctrl Shift down and few times until all seguences are selected Seguences can be reordered within an alignment by clicking the seguence name and dragging Seguences can be removed from an alignment by right clicking Ctrl click on Mac OS X on the sequence name and choosing the remove sequence option Alternatively select the entire sequence by clicking on the sequence name and press the delete key 68 CHAPTER 3 DOCUMENT VIEWERS To delete a region of an alignment select the region and press the delete or backspace key Normally this will move residues on the right into the deleted area By holding down the Alt key while deleting residues on the left will be moved into the deleted area instead After editing is complete click Save to permanently save the new contents 3 1 12 The Pop up menu in the sequence viewer The toolbar actions are available via a pop up menu as well Right click Ctrl click on Mac OS X on any sequence partly highlighted sequence or annotation to show the various options The pop up menu contains the Copy residues action keyboard Ctrl C to copy the selected residues to the system clipboard 3 1 13 Printing a sequence view To print a sequence view go to File Print and click OK The view is printed without the options panel It is recommended to turn on
48. the sequence Compress annotations This option reduces the vertical height of the annotations on dis play This reduces the space occupied by annotations by allowing them to overlap and increases the amount of the sequence displayed on the screen Hide excessive labels This will reduce screen clutter by removing annotation labels which are too frequent Finally you can control the size of fonts for bases labels names and numbering 3 1 8 Complement amp Translation When viewing nucleotide sequences Geneious offers complement and protein translation op tions Translations can be selected per reading frame using a range of genetic codes They can also be created relative to selection or annotations such as CDS Figure 3 4 64 CHAPTER 3 DOCUMENT VIEWERS Sequence View Annotations Dotplot Self Text View Notes lt a b Extract X Reverse Complement SP Translate AllowEditing MP Annotation X Tools HM Save 440 450 460 470 house mouse TCCTTGGCTTGCAGAGTGGTATTCTCAGCTTGGTGAGATGCAG Translation 480 490 500 510 house mouse AGACAGACCCGTGTCAGCTTTAAGAGTCCATCCCCTTTTCTCT Translation ee HO mO CR Y Per site log odds ratio 520 530 540 550 house mouse TGTTTAAGGACATCAATGCTTACAATGGTGAAACACCCACGGA Translation bN N A 560 570 580 590 600 house mouse AAAGTTGCCATTTCCCATCATTGATGATAAGGGCAGGGACCTT Translation 610 620 630 640 house mouse
49. the threshold value A topology threshold of 0 will result in only the most common topology being output a thresh old of 100 will result in all topologies being output 90 4 5 8 Tree building in Geneious CHAPTER 4 ANALYSING DATA Geneious can build a phylogenetic tree for a set of seguences using pairwise genetic distances To build a tree select an alignment or a set of related seguences all DNA or all protein in the Document table and click the Tree icon or choose this option from the Tools menu epo Geneious Tree Builder Tree Consensus Tree Builder f PAUP Genetic Distance Model Tamura Nei Tree build Method Neighbor Joining E Outgroup No Outgroup 3 Pairwise distances will be obtained from the multiple seguence alignment This may reduce accuracy slightly but will produce results faster Consensus Tree Options Resampling Method Random Seed Number of replicates Support Threshold Topology Threshold Restore Defaults C Resample tree Bootstrap 889 076 100 Create Consensus Tree Sort Topologies 50 0 Save raw trees Cancel 0K Figure 4 4 Tree building options in Geneious Tree building from an alignment If you are building a tree from an alignment the following options are seen in the tree window If you select a tree document which contains an alignment then the alignment will simply be extracted from the tree and used in the tree building proces
50. these enzymes will be considered this can easily be used for the same effect by sorting by columns and then selecting a range of rows in the rare cases when it is needed Otherwise if you select Digest using Enzyme Set the digestion operation includes finding the restriction sites first but without generating the annotations Therefore the options are the same as for Find Restriction Sites which is discussed in section 11 1 136 CHAPTER 11 CLONING PRO ONLY Find Restriction Sites Candidate Enzymes Commercially Available Enzymes 632 W Minimum effective recognition sequence length nucleotides L Only include enzymes that match 1 to 2 times Exclude enzymes cutting between residues 23418 1264 A v 629 enzymes selected Recognition Effective Len Overhang TTA TAA 6 0 blunt 1 per match CACCTGC 4 8 7 0 5 4 nucleotides 1 per match GACNNNN NN 6 0 3 2 nucleotides 1 per match AGG CCT 6 0 blunt 1 per match GACGT C 6 0 3 4 nucleotides 1 per match CC TCGAGG 8 0 5 4 nucleotides 1 per match TGC GCA 6 0 blunt 1 per match ACCTGC 4 8 6 0 5 4 nucleotides 1 per match G GTACC 6 0 5 4 nucleotides 1 per match G GYRCC 5 0 5 4 nucleotides 1 per match CCANNNN NTGG 6 0 3 3 nucleotides 1 per match CCGCTC 3 3 6 0 blunt 1 per match GT MKAC 5 0 5 2 nucleotides 1 per match CG CG 4 0 blunt 1 per match T CCGGA 6 0 5
51. using this method without assuming a molecular clock 20 45 3 UPGMA This clustering method is based on the assumption of a molecular clock 15 It is appropriate only for a guick and dirty analysis when a rooted tree is needed and the rate of evolution is does not vary much across the branches of the tree 4 5 4 Distance models or molecular evolution models for DNA seguences The evolutionary distance between two DNA seguences can be determined under the assump tion of a particular model of nucleotide substitution The parameters of the substitution model define a rate matrix that can be used to calculate the probability of evolving from one base to another in a given period of time This section briefly discusses some of the substitution models available in Geneious Most models are variations of two sets of parameters the eguilibrium freguencies and relative substitution rates Equilibrium frequencies refer to the background probability of each of the four bases A C G T in the DNA sequences This is represented as a vector of four probabilities 74 nc 7G mr that sum to 1 Relative substitution rates define the rate at which each of the transitions A gt G C T and transversions A C A gt T C e G G T occur in an evolving sequence It is represented 88 CHAPTER 4 ANALYSING DATA as a 4x4 matrix with rates for substitutions from every base to every other base Additionally gaps are not penalized when using th
52. we nw Slaw Bee oe eee ee ee bes 123 124 125 125 128 130 130 131 133 134 135 137 140 CONTENTS Chapter 1 Getting Started One of the best ways to get an introduction to Geneious its features and how to use them is to watch our online video demonstration http www geneious com demonstration 1 1 Downloading amp Installing Geneious Geneious is free to download from http www geneious com download This down load includes both Geneious Basic free for academic use and Geneious Pro If you are using Geneious for the first time you will be offered a free trial of the Pro features If you have already purchased a license you can enter it when Geneious starts up to activate the Pro features To download Geneious click on the internet address above or type it in to your internet browser to open the Geneious download page then choose your operating system and click Download Geneious Geneious is available for Windows Mac OS 10 4 Linux and Solaris Once Geneious has downloaded double left click on the Geneious icon to start installing the program While this is happening you will be prompted for a location to install Geneious Please check that you are satisfied with the location before continuing If you are using Mac OS X then you will only have to double click on the disk image that is downloaded then drag the Geneious application to your Applications folder 1 1 1 Choosing where to store your data Whe
53. 12 SERVER DATABASES PRO ONLY 12 2 Setting up After a database is set up correctly multiple users can connect to it and use it as their storage location just as if they were using their own local database Follow these steps to set up your database for use with Geneious e Install a supported database management system if you do not already have one e Create a new database with your desired name Make sure that you have a user that has rights to create tables e Use the Connect to a database button to connect to your database If the database has not been set up usually the case if you are following these instructions Geneious will detect this and set up the database This will only succeed if you have permission to create tables on the database e Make sure any other users of the database have SELECT INSERT UPDATE and DELETE rights otherwise they will not be able to use the Server Database as intended There are two ways you can use your database with multiple users The simple way is just to use the server database as a shared local database If this is all you want then you are now done with setup Alternatively you may want to restrict access to particular folders with groups and roles To do this please refer to section 12 4 1 Your database should now be ready to use with Geneious Now all users can connect to the database by clicking on Server Databases in the service tree and then clicking Connect to a setup d
54. 6 PCR PRIMERS PRO ONLY 99 Picking Parameters The advanced options section has two tabs which are available depending on the task you have chosen The Primer section is available if one of Forward Primer or Reverse Primer is being designed or tested and DNA Probe is available if DNA Probe is being designed or tested These two sections are quite similar the DNA probe section has a subset of the options available in the primer section This is because primers are usually chosen in pairs and so several options can be set for how pairs are chosen Most of the options are used to set absolute limits on properties of primers and probes such as melting point and GC content Optimum values can also be specified For details on individual options hover your mouse over them and a popup box will describe the function of the option During testing many of the absolute limit options are disabled however optimal values can still be set Maximum degeneracy 1 C Inverse PCR Size Min 18 Optimal 20 gt Max 27 Tm Min 57 Optimal 60 gt Max 63 7 GC Min 20 Optimal 50 7 Max 80 2 Product Tm Min 0 E Optimal 0 8 Max 0 8 Max Tm Difference 100 8 CC Clamp 0 8 Max Hairpin Score 8 8 Max Primer Dimer Score 3 8 Max Poly X s Max 3 Stability ge Allow primers inside target with penalty o Primer Picking Weights Tm Calculation Settings
55. 7 HLA A gene a 100 DDii I I i CHLACA gt Cursor before base 1 271 original base 1 271 b Annotations Transfered to Alignment Figure 2 10 Document After Full Sequence Download 41 42 CHAPTER 2 RETRIEVING AND STORING DATA Table 2 4 Geneious document types Document type Geneious Icon Nucleotide sequence Protein sequence Phylogenetic tree 3D structure Sequence alignment Chromatogram SE LROR Journal articles PDF y gt Other documents ments have been copied or moved to one of your local folders In Geneious you can create new folders rename existing folders delete and export folders All these choices are available by either right clicking on the folder clicking on the action menu Mac OS X or by holding down the Ctrl button and clicking Mac OS X Also in Mac OS X you can also use the plus and minus buttons located at the bottom of the service panel to create and delete folders 2 5 1 Transferring data It is quick and easy to transfer data to your local folders from either a Geneious database search or from your computer s hard drive Please check you have already set up your destination folders before continuing Moving documents from Geneious searches to your Local folders There are a number of ways to do this 2 5 STORING DATA YOUR LOCAL DOCUMENTS 43 Drag and drop This is guickest and easiest Select the documents that you want to move Then while
56. A phylogenetic tree describes the evolutionary relationships amongst a set of sequences They have a few commonly associated terms that are depicted in Figure 3 9 and are described below Branch length A measure of the amount of divergence between two nodes in the tree Branch lengths are usually expressed in units of substitutions per site of the sequence alignment 4 5 BUILDING PHYLOGENETIC TREES 87 Nodes or internal nodes of a tree represent the inferred common ancestors of the sequences that are grouped under them Tips or leaves of a tree represent the sequences used to construct the tree Taxonomic units These can be species genes or individuals associated with the tips of the tree A phylogenetic tree can be rooted or unrooted A rooted tree consists of a root or the common ancestor for all the taxonomic units of the tree An unrooted tree is one that does not show the position of the root An unrooted tree can be rooted by adding an outgroup a species that is distantly related to all the taxonomic units in the tree A common format for representing phylogenetic trees is the Newick format 13 4 5 2 Neighbor joining In this method neighbors are defined as a pair of leaves with one node connecting them The principle of this method is to find pairs of leaves that minimize the total branch length at each stage of clustering starting with a star like tree The branch lengths and an unrooted tree topology can quickly be obtained by
57. NVSVVHCTNLMNTTVTTGLLINGSYSENRT OIWOK gt Chicken CTACCCCCCTAAAACACTTTGAAGCCTGATCCTCACTA CTGT CATCTTAA FASTO format FASTO format stores seguences and Phred gualities in a single file GenBank files Records retrieved from the NCBI webiste http www ncbi nlm nih gov can be saved in a number of formats Records saved in GenBank or INSDSeg XML formats can be imported into Geneious Geneious format The Geneious format can be used to store all your local documents note types and program preferences A file in Geneious format will usually have a geneious extension ora xml extension This format is useful for sharing documents with other Geneious users and backing up your Geneious data 2 2 IMPORTING AND EXPORTING DATA 27 Geneious Education format This is an archive containing a whole bundle of files which together comprise a Geneious ed ucation document This format can be used to create assignments for your students bioinfor matics tutorials and much more See chapter 9 for information on how to create such files GFF format The GFF format contains sequence annotation information and optional sequences You can use a GFF file to annotate existing sequences in your local database import entirely new se quences or import the annotations onto blank sequences MEGA format The MEGA format is used by MEGA Molecular Evolutionary Genetics Analysis Molecular structure Geneious imports a range of molecu
58. New Sequence create a new nucleotide or protein sequence from residues that you can paste or type in Extract Region Reverse Complement Translate see section 3 1 6 for details Sometimes a selection in the sequence viewer is required before performing these Find ORFs Finds all open reading frames in a sequence and annotates them Trim Ends See section 4 7 3 Change Residue Numbering changes the original residue numbering of the selected sequence Convert between DNA and RNA changes all T s in a sequence to U s or vice versa de pending on the type of the selected sequence Once this is performed click Save in the Sequence View to make the change permanent 2 2 IMPORTING AND EXPORTING DATA 23 Collaboration Menu Pro only This contains actions that can be performed with Collaboration accounts which allow you to share you work with other Geneious users Help Menu This consists of the standard Help options offered by Geneious 2 2 Importing and exporting data Geneious is able to import raw data from different applications and export the results in a range of formats If you are new to bioinformatics please take the time to familiarize yourself with this chapter as there are a number of formats to be aware of 2 21 Importing data from the hard drive to your Local folders To import files from local disks or network drives click File Import From file This will open up a file dial
59. Pfam A full If your internet connection is slow or you have a low data cap you may want to download the databases elsewhere and then transfer them to your computer You may also consider down loading all databases except Pfam A full 7 2 Pfam Document Types There are three special document types used for Pfam data AN 3 Pfam sequence documents are based on UniProt sequences They contain all the informa tion from the UniProt sequence plus information on the Pfam domains in the sequence You can view the domains as annotations in the sequence view or on their own from the domain view Domain documents contain information about Pfam A full Pfam A seed and Pfam B do mains This includes general information about the domain references visible in the reference view and the alignment for the domain I Clan documents contain information about a clan including general information refer 7 3 PFAM OPERATIONS 119 ences visible in the reference view and a list of the domains which are members of this clan 7 3 Pfam Operations There are a number of special operations available to Pfam documents and UniProt seguences To take advantage of these operations you will need to have the Pfam databases set up The following Pfam operations are available e Create Pfam Sequence creates a Pfam sequence document from a UniProt sequence You can view the domain information in a Pfam sequence document using the Domain Viewer This opera
60. Results of analysis lt 104 Ce suis ka Custom BLAST Pro only U SEI A COGs BLAST Pro only GL beting Up ce IE Ge BELASTE COGE oo rise ne ad Pfam Pro only 7 1 Setting up the Pfam databases 12 Piam Document Teper oe ee ee ls OR 73 Vint Upertone ceresc hee bon RoR ES Smart Folders Pro only Geneious Education Pro only CONTENTS 109 E Bbw a eld wake amp 109 113 bse ey ate hoe dee aie eh TAB 113 pas E e 114 117 La AE OO dae s 117 TK RAM n Bee ee Meet i 118 be De le ts RA 119 121 123 CONTENTS 10 11 12 91 A MISA 0 oi ios AAN A AS TE Answernpatulorial ike ea OE EH ATAR Auk alo Collaboration Pro only 101 Managing Your Account sas logia ESS Vs Ks 10 2 Managing Your COR eons osta a eee Bers KUIN eS eS VIS Sharning ICE p X Roa ai AR ADI EA A Nt RI Oo REAR OH 10 4 Browsing Searching and Viewing Shared Documents WII os amp s st PRE IKE RE A AT X Keti ee Sao Cloning Pro only 11 1 Find Restrichon SHGs o ee scs c ro aa A wt MIKS Bk AK akat ck BY 11 2 Digestinto fragments o eors me do PES OES k Oe OE RE OS 113 Insertit Vector oeo 2000000 uns Ae Ea Oe yk Pw y TIA Gateway CACM e 620488805 e RHE K Ee ee OE Oe ee RE EH Server Databases Pro only 121 Supported Database Systemie gt cio EEE EO KwK LEE SUNIN M da ee ee Seg oe eo Se E CEES A 2 eS 12 3 Removing a server database na SSSR ESE EKER AN aa 124 Admins tahon os oscar BE
61. STA sequence v C Subsequence 3 l Nucleotide Query L Database nr GenBank RefSeq EMBL DDBJ and PDB v Add Remove Databases Program Megablast fast high similarity matches DNA W Figure 2 7 Sequence Search Options clicking on the red square labelled Stop See Figure 2 8 Sources A Stop 48 9 complete NCBI estimates 5 seconds remaining 0 of O selected 5 Local 0 a gt Sample Documents 0 F 3D Structures 5 i Alignments 6 F Contig Assembly 5 Be 48 9 complete D Nudeotide Documents 9 NCBI estimates 5 seconds remaining 5 Plasmids from NEB 27 io Protein Documents 5 5 Restriction Enzymes 4 gt Tree Documents 4 P Searches 0 e Iv p fir Megablast pygmy chimpanzee 1 0 Figure 2 8 Sequence Search in Progress Once the search has completed the results can be moved to your local database at your conve nience If your query sequence was annotated then any annotations that cover the hit region will be transfered to the BLAST hit document You can also download the full database sequence that corresponds to a BLAST hit To retrieve the full sequence select a BLAST alignment and go to File Download Documents or click the Download Full Sequence s button located above the viewer tabs The full sequence will be available in the Sequence View tab once the download has completed In addition the annotations f
62. Siblings Color Nodes T Font Save EN O z Sea Turtle Startin x General parrow Warbl ater USES Chicken Ostrich Sandgrouse Spoonbill Zoom Ibis Moa Salamander rog E Trout Expansion O Loach Carp p tahorse Info Orma pan Chimpanzee x Layout Human rm Monkey oon 1 a Root Length Q Lemur Armadillo Mouse Curvature O Chipmunk ipmun Rhinoceros C Align Taxon Labels Panda Woes gt Formatting Raccoon fraia s v M Show Tip Labels z Dhole a eal 5 Puma Tiger Display Names relle AT Ha n Whale Significant Digits 4 B Dolphin O th Warnes Set font sizes in the toolbar above 0 04 4 gt l Show Node Labels v Figure 3 8 A view of a phylogenetic tree in Geneious There are a number of options for the tree viewer 3 4 1 Current Tree If you are viewing a tree set this option will be dispalyed Select the tree you want to view from the list 3 42 General General has 3 buttons showing the different possible tree views rooted circular and un rooted The Zoom slider controls the zoom level of the tree while the Expansion slider 72 CHAPTER 3 DOCUMENT VIEWERS expands the tree vertically in the rooted layout 3 43 Info For a consensus tree the info box displays the consensus method used to build the tree For a topology it also shows what percentage of the original trees have the topology of the displayed tree 3 4 4 Layout This has different options depe
63. TTCATGGG GAAGCAGA TTGGGTACC Ce 3 Sally TTCTTTCATGGGMMEIGAAGCAGA TTTGGGTACC D 4 Bob TTCTTTCATGGG GHAGA TTTGGGTACC De 5 jane TTCTTTCATGGGGMAMAGGCAGAMITTTGGGTACC lt i gt Alt click on a sequence position or annotation or select a region to zoo GAAGCAGA The sequence view lets you zoom in to view individual residues or zoom out to view an entire sequence and all its annotations Buttons for controlling zoom are positioned at the top of the options panel on the right of the sequence view You can also hold Alt and turn the mouse wheel up down to zoom in out or click to zoom in and hold Alt and Shift then click to zoom out Selecting and Editing Selection and editing in the seguence viewer is very similar to standard text editing and word processing programs Click and drag to select a region You can drag up and down to select and edit across multiple sequences in an alignment Clicking the Edit huttan entare edit mode and D Geneious Service Panel allows you to access e Your Local Documents o and Taxonomy o An EMBL database Uniprot e Your contacts Geneious databases Figure 2 1 Geneious main window NCBI databases Gene Genome Nucleotide PopSet Protein Pubmed SNP Structure You can view options for any selected service with the right mouse button or by clicking the Options button at the bottom of the Service Panel in Mac OS X 2 12 The Do
64. To align all the sequences click on the Alignment button in the toolbar Click OK to accept the default alignment settings When the alignment has finished a new alignment document will be added to the current folder and selected The alignment will be displayed in the sequence viewer If the alignment is not displayed make sure the alignment is selected lin the Document Table and that the Document Viewer is set to Sequence View If you are using Geneious Pro there lis also an option to perform the alignment using ClustalW or IMUSCLE two widely used alignment programs or via a translation jalignment where DNA sequences are laligned by their translated amino acid sequences Figure 1 3 The Help Panel 1 2 5 The Toolbar The toolbar gives quick access to commonly used features in Geneious including the Search for documents by keywords Agents that search databases for new content even while you sleep Sorting sequences by similarity pairwise or multiple sequence Alignment Tree building and Help For more information on the toolbar see section 2 1 5 1 3 TROUBLESHOOTING 11 Ga A 7 fe se 3 Back Forward Seguence Search Sort Agents Alignment Tree Assembly Primers Cloning v Show Labels Sources v Large Icons v Local 0 Name Description D 454 Data 6 DCN gene Homo sapiens decorin DCNY lt Back v Sample Documents 0 A house mouse gene Mus musculus 1 Cys per
65. WTSCTSIS PCSTSCPPSP AAPTEERRRS BPOORRRPSS SPNRRURGW LP JLP 4 P Jl US20 gene TT Colors ARND B gt M Graphs Hydrophobicity y Mile it Maiinis Eco ll gt gt a ot A alia 70 80 90 100 110 120 003307 TSPCPTRSINI YKRRWGAPOR HCAETVATHO RMBADEWFKK FTUWORVYAT M region mmm Tra lon iQ Hydrophobiciy mailiin ii E i liali a a A i E Name US20 Protein E source 1 FEFORATST OSUFVHOr oNaurommny sr rm mmek 1YPti Protein Layout amp Properties vw M Annotations 12 of 13 M Gene 1 G 4 Protein 1 ii 003307 W A 9030 y Layout x Residues MRVISRARSACTWTSCTSLS Wrap sequence gene US20 Linear view on circular sequences Hydrophobicky N linked GIcNAc Potential N linked CIN product Transmembrane protein HWLF3 E N NCBI Feature Key Protein Spaces every 10 residues 190 200 210 220 A p PP A 0 4 a E 003307 FEYBUANSE AAHTOMCSES RMIVGSYWNT HANPIESTTGH ATHGGRDRRR WKCESCWYNMI O Hide residues v Properties Transmembrane region 3 M Show Name HN memb n Transmemb Hydrophobicity Milo malls gt De AS es 250 260 270 280 290 300 4 Q03307 MEUSFETEA USDADWEOKN VMTHCAFSIS FFEGIGAYDS EMWIFFCPPN OCIRHAWCHY 2 N Outline residues when zoomed out Mouse over residue 95 N Asn Asparagine M Show residue numbers Y Show original residue numbers Figure 3 3 The annotations options in the sequence viewer Hide all Show all These buttons can be used to turn off and on al
66. _001870 Simian Human immunodeficiency virus complete genome Ed NC_001722 Human immunodeficiency virus 2 complete genome Ed NC_001664 Human herpesvirus 6 complete genome i La no n mli matte mins kt 1 Figure 2 4 The Search tab of the Document Table 2 3 1 Advanced Search options To access advanced search click the More Options button inside the basic search panel To return to basic search click the Fewer Options button Switching between advanced and basic will not clear the search results table This feature provides more search options to select from Geneious allows you to search with a range of criteria however these depend on the database being searched All the fields in the NCBI public databases can be searched in any combination Each database has a specific list of fields and it is important to familiarize yourself with these fields to make full use of the Advanced Search The fields available for a search can be found in the left most drop down box after enabling the advanced search options Note When searching the Genome database the documents returned are only summaries To download the whole genome select the summary s of the genome s you would like to download and the click the Download button inside the document view or just above it There are also Download items in the File menu and in the popup menu when document summary is right clicked Ctrl click on Mac OS X The size of the
67. ad it 2 9 PREFERENCES 53 Also check for beta version of Geneious Enable this to also have Geneious alert you when new beta versions are released A beta version is a version that is released before the official release for the purposes of testing It may therefore be less stable than official releases Max memory available to Geneious allows you to enter how many megabytes of your com puters memory you wish to allow Geneious to use Search History This clears all the previously searched words in Geneious After this the auto completion drop box will be empty Connection settings These are described in the troubleshooting section of the manual 2 9 2 Plugins and Features The Plugins and Features tab Figure 2 18 lets you manage downloadable plugins and change the features available in Geneious e Available Plugins Lists all plugins which are currently available for download from the Geneious website which aren t already installed Each plugin is listed with a status which can be a star for exciting plugins New Pro Only or Beta Click the Info button to read more about the plugin or click the Install button to download the plugin and install it e Installed Plugins Lists all plugins you currently have installed Click the uninstall but ton next to a plugin to remove it e Install plugin from a gplugin file If you have downloaded a plugin from our website or obtained one from another source usually in gp
68. also for alignments and assemblies It gives the frequency of each nucleotide or amino acid over the entire length of the sequence including gaps If there are gaps then a second percentage frequency is calculated ignoring gap characters The G C content for nucleotide sequences is shown as well for easy reference The following statistics are available when viewing protein sequences Molecular Weight Calculates the molecular weight of the protein using the following values for the amino acids A 71 0788 R 156 1875 N 114 1038 D 115 0886 C 103 1388 E 129 1155 O 128 1307 G 57 0519 H 137 1411 1 113 1594 L 113 1594 K 128 1741 M 131 1926 F 147 1766 P 97 1167 S 87 0782 T 101 1051 W 186 2132 Y 163 1760 V 99 1326 U 150 0388 O 237 3018 Isoelectric Point Calculates the isoelectric point of the protein as per this method but using the following values for the amino acids D 3 9 E 4 1 C 8 5 Y 10 1 H 6 5 K 10 8 R 12 5 Extinction Coefficient Calculates the extinction coefficient of the protein as per this paper using the following values for the amino acids and assuming all cysteines are paired in a disulfide 66 CHAPTER 3 DOCUMENT VIEWERS bridge making cystine C 62 5 only counting up to an even number W 5500 Y 1490 The following statistics are available when viewing multiple sequences Identical sites When viewing alignments or assemblies this gives the percentage of columns in the alignment for which all sequences are identical Pairwise
69. and TJ Gibson Clustal w improving the sensitivity of progres sive multiple sequence alignment through sequence weighting position specific gap penalties and weight matrix choice Nucleic Acids Res 22 1994 no 22 4673 4680 24 28 84
70. article pu Sequence Annotations sequence Sequence Length Residue lengt Sequence Residues Size Size of the document Summary summary of a document a URL A url link to the published article v T sselect a document from the pane nber of Nodes cation date on text seguence Med ID of the article Figure 2 11 Searching the local documents on a user defined field Similarity BLAST like searching It is possible to search your local documents not only for text occurrences but by similarity to sequence fragments Click the small arrow at the bottom of the large T to the left of the search dialog select Nucleotide similarity search or Protein similarity search and enter the sequence text Geneious will try to guess the type of search based on the text so that simply entering or pasting a sequence fragment may change the search type automatically The search locates documents containing a similar string of residues and orders them in de creasing order of similarity to the string The ordering is based on calculating an e value for each match You can read more about the e value in subsection 2 4 4 For the search to be successful you need to specify a minimum of 11 nucleotides and 3 amino acids Note that search times depend on the number and size of your sequence documents and so may take a long time to complete 2 5 3 Checking and changing the loca
71. ases Geneious Geneious Education tutorial zip Tutorial assignment etc Geneious GFF gff Annotations Sanger Artemis MEGA meg Alignments MEGA Molecular structure pdb mol xyz cml gpr hin nwo 3D molecular structures 3D structure databases and programs Newick tre tree etc Phylogenetic trees PHYLIP Tree Puzzle PAUP ClustalX Nexus nxs nex Trees Alignments PAUP Mesquite MrBayes amp MacClade PDB pdb 3D Protein structures SP3 SP2 SPARKS Protein Data Bank PDF pdf Documents presentations Adobe Writer ATEX Miktex Phrap ACE ace Contig assemblies Phrap Consed PileUp msf Alignments pileup gcg PIR NBRF pir Seguences alignments NBRF PIR Oual gual Ouality file Associated with a FASTA file Raw seguence text seq Sequences Any file that contains only a sequence Rich Sequence Format rsf Sequences alignments GCGs NetFetch Sequence Chromatograms abl scf Raw sequencing trace amp sequence Sequencing machines Vector NTI sequence gb gp Nucleotide amp protein sequences Vector NTI Vector NTI AlignX alignment apr Alignments Vector NTI AlignX Vector NTI Archive ma4 pa4 0a4 Nucleotide amp protein sequences ea4 ca6 enzyme sets and publications Vector NTI Vector NTI ContigExpress cep Nucleotide seguence assemblies Vector NTI Vector NTI database VNTI Database Nucleotide amp protein seguences enzyme sets and publications Vector NTI CLUSTAL format The Clustal format i
72. atabase This will bring up a dialog for the user to enter in the database details 12 2 1 Supplying your own Database Driver Server databases were designed with the supported databases in mind and packaged with database drivers for them However Geneious allows you to supply your own jdbc database driver if you want to You may want to do this because you have an updated driver or because you have a driver for an unsupported database It is not guarnteed that Server Databases will work with another database system if you provide its driver but it is likely that it will To supply your own driver open up the dialog you would normally use to connect to a database Then click the More Options button 12 3 REMOVING A SERVER DATABASE 145 12 3 Removing a server database To remove a server database simply right click on its top folder and choose Remove database 12 4 Administration The typical user will not have to do any administration this section is for those in charge of the database 12 4 1 Groups and Roles Server databases support user groups and roles for managing access to documents This means that you can restrict access of folders to privelleged people How it works is that each folder in Geneious belongs to a group Users can belong to any number of groups and have a specified role within that group The three roles are e View allows the user to view the contents of folders e Edit allows the
73. ated in all reading frames e tblastx Compares the six frame translations of a nucleotide query sequence against the six frame translations of a nucleotide sequence database Please note that the tblastx program cannot be used with the nr database on the BLAST Web page because it is too computationally intensive Geneious is able to run NCBI BLAST on many different databases Some of these databases are non redundant in order to reduce duplicate hits You can submit either a raw sequence or Genbank accession number into NCBI BLAST and receive a summary of results for each hit This summary contains the bit score e value identity and the stretch of the query sequence and hit sequence that match The databases that can be searched are shown in the following tables You can quickly and easily BLAST against any of these databases using any of the available BLAST programs via the Sequence Search operation This operation can be accessed by going to the Tools menu or by right clicking Ctrl click on Mac OS X on a sequence document and choosing Sequence Search This will bring up the sequence search options Geneious gives you the option of searching against a database using either your currently se lected sequence documents or a sequence you enter manually If you choose to enter your 38 CHAPTER 2 RETRIEVING AND STORING DATA Table 2 2 Nucleotide sequence searches in the BLAST databases Database Nucleotide searches nr All non re
74. aw trees If this is turned on then all of the trees created during resampling will be save in the resulting tree document The number of raw trees saved will therefore be egual to the number of samples Creating a consensus tree of existing trees If you select a tree set document and choose Tree then the Consensus option will be available at the to of the tree builder options This will create a consensus tree using the trees already in the document no resampling will be performed and it will be added to the tree document A new document will not be generated The only option available here is the consensus support threshold 4 6 PCR Primers Pro only Geneious provides several operations that work with PCR Primers and DNA or hybridisation probes PCR Primers and DNA or hybridisation probes can be designed for or tested on ex isting nucleotide sequences A PCR product can be extracted from a sequence that has been 92 CHAPTER 4 ANALYSING DATA annotated with both a forward and a reverse primer 5 extensions consisting of restriction enzymes or arbitrary seguence may also be added to primer documents In addition Geneious can determine the primer characteristics for a primer sized seguence and convert it into a primer Characteristics can also be determined for any number of primer sized selections made in the Seguence View To use any one of these primer operations simply select the appropriate nucleotide seguences and either se
75. base and offer them as options in the list of oligo sequences with no need to select them along with the target sequence before starting the operation The note type Primer Info can be used to note the fridge location etc of a particular primer 4 6 3 Test Primers Primers and probes can also be quickly tested against large numbers of sequences to see which ones the primers will bind to By default this will only find sequences that match the primers exactly To test primers select the target sequences you want to test for compatibility with primers and choose the same Primers action from the menu and go to Test Primers in the popup menu that appears Any oligo sequences that are in your local folders will be available as candidate primers but you can also select any other short sequences or sequences containing annotated primers along with the target before clicking on Test Primers to have these available for testing 96 CHAPTER 4 ANALYSING DATA 800 Test Primers Primer design uses Primer3 Please cite Primer3 if you publish results O Test primers and probes on selected seguences Y Forward Primer 1st forward primer from Plas V Reverse Primer 1st reverse primer from Plas DNA Probe 1st forward primer from Plas Test all possible pairs of selected primers on all selected non primer sequences Region Input Options 57 C Included Region ilk To 180 e M Target Region 1 8 To 180 8 M Product Size Be
76. ce and alignment Viewer The Sequence view tab in the Document Viewer panel is available for Nucleotide sequences Protein sequences Alignments and 3D structure documents If an alignment is selected this will be called Alignment View or Contig View if a contig is selected The options available are grouped under headings Zoom level Colors Graphs Consensus Highlight ing Annotations Layout amp Properties Complement Translation and Statistics The presence of these options varies with the kind of sequence data being viewed 3 1 1 Zoom level The plus and minus buttons increase and decrease the magnification of the sequence by 50 or by 30 if the magnification is already above 50 zooms in to fit the selected region in the available viewing area P zooms to 100 The 100 zoom level allows for comfortable reading of the sequence Ra es zooms out so as to fit the entire sequence in the available viewing area Zooming can also be quickly achieved by holding down the zoom modifier key which is the Ctrl key on Windows Linux or the Alt Option key on Mac OS X and clicking When the zoom key is pressed a magnifying glass mouse cursor will be displayed e Hold the zoom key and left click on the sequence to zoom in e Hold the zoom key and Shift key to zoom out 57 58 CHAPTER 3 DOCUMENT VIEWERS Sequence View Annotations
77. ces panel and right click Ctrl click on Mac OS X This will pop up a menu Clicking on New folder opens a dialog that will prompt you to name the folder The named folder is then created as a sub folder of the folder that you originally right clicked on Important Search results will be lost when you exit Geneious unless the downloaded docu 2 5 STORING DATA YOUR LOCAL DOCUMENTS Alignment View Sequence View Dotplot Dotplot Self Text View Notes lt db Extract E Reverse Complement 5 Translate Edit WN Annotation HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference 772 SES 1 156 1 43 1 193 386 57 Ee A se EXE KE HLA A CDS n PHLA Agene W N unan fl Mm N HLACA isc HLA A isis HLA A difference HLA A misc HLA A difference HLA A differen HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference HLA A difference HLA A differenc Cursor before base 1 435 a Complete Database Seguence Alignment View Sequence View Dotplot Dotplot Self Text View Notes lt db GC extract Reverse Complement SY Translate PF Edit MP Annotation 3 234 468 702 26 1 24 Consensus Identity TSn RSS 0 A 1 234 468 702 36 1 27 A A n lpha 1 e alpha 2e Salpha3e tr peptide Ce pygmy chimpanzee BC003069 235 46s 702 37 1 2
78. cloning site Bases to inclusive Entire sequence Candidate Enzymes Enzymes annotated on insert NotI EcoRI Enzyme set Cut vector with EcoRI and NotI w Product insert index 689 693 1793 1797 forward strand GAATTC ow GG GG HS S reverse strand CTTAAG ep 115 fey fe 17 Le l l vector index 3202 3206 3240 3244 C Keep fragments which are not part of the product Figure 11 3 Insert into Vector options dialog 11 3 INSERT INTO VECTOR 139 11 3 1 Insert Options You cannot alter the insert used in the operation from the options but you can select what direction to insert in forward or reverse If the insert fragment has complementary overhangs or is blunt at both ends you can also choose to insert in both directions In this case two product documents will be created one for the insert in each direction The insert options also present a diagram showing the bases at each end of the insert fragment 11 3 2 Vector Options e Polylinker region to cut within These options let you choose what region within the vector sequence to look for enzymes to cut within Geneious will examine the vector sequence for enzymes that have cut sites within this region and none outside it You can specify the polylinker in the following ways Annotation If the vector has one or more polylinker annotations annotated on it you can choose to use the interval covered by one such p
79. connected Also you will not be able to see a contact s online status until that contact has approved your reguest to do so 10 2 1 Add Contact Select your account in the Services Panel and choose Add Contact from the menu at the top or right click Ctrl click on Mac OS X on your account in the Services Panel and choose the same option You will see a simple dialog with one field Jabber ID A Jabber ID looks like an email address and has a similar function It uniguely identifies some other Geneious users account You can enter a contact s Jabber ID directly into this field if you know it To see your own Jabber ID hover your mouse over your account in the Services Panel and it will appear in a tool tip If the server supports it you should also see a Search For Contact link Click this to go to the next dialog 10 2 MANAGING YOUR CONTACTS 129 Add Contact to myaccount Jabber ID e g user name talk geneious com Search For Contact Figure 10 3 Add Contact dialog box Here you will see a box for a search string and some checkboxes indicating what you are searching on Enter all or part of the name or email of the contact you want and click the Search button If any rows are returned in the results table you will be able to select one or entries and add them as contacts Add Contact to myaccount Username Name v Email A Enter Contact ID dd alecta Figure 10 4 Add New Contact dialog box i
80. cuments Table The Document Table displays your search results or your stored documents While search results usually contain documents of a single type a local folder may contain any mixture of documents whether they are seguences publications or other types If you cannot see all of the columns in the document table you may want to close the help panel to make more room 2 1 THE MAIN WINDOW 17 Name Summary Ei Aves yt i atnl n dn Science Roman Biek 16439664 http ww history of its carnivore host Population genetic estimation of the loss of genetic diversity A Population genetic estimation during horizontal transmission of HIV 1 BMC Evol Biol Charles T T 16556318 http ww J Relaxed phylogenetics and da EEN sn ea ekg Pyaar PLoS Biol Alexei Dru 16683862 http bic JA modified cc cd11 M13F C05 modified cc cd11 M13F CO5 022 ab1 Length 597 GCTCACCA JA cc_cd11_M13F_C05_022 ab1 cc cdll M13F C05 022 ab1 Length 597 gctsacgatgc MA modified cc_cd12_M13F_DOS modified cc_cd12_M13F_D05_021 ab1 Length 618 GCTSCGATG A Nucleotide alignment 6 Alignment of 2 sequences cc_cd11_M13F_C05_022 ab1 82 8 E New nucleotide sequence New nucleotied sequence A new nucleotide sequence entered ACGATCAC K 1996YangGeneticsv144p194 1996YangGeneticsv144p1941 pdf 3 tree txt tree txt 4 tips a fa tree3 txt tree3 txt 1 Trees
81. d aNote M COGs Note Edit note types Figure 2 15 Edit Note Types 7 Edit Note Types Existing Note Types Name Source Description Describes the source of a document constrained Source Name dp Date Acquired Modified from original Date Modified v Text True False Whole Number Decimal Date Drop down list n db Create Note Type Delete Note Type Figure 2 16 The Edit Note Types window 2 8 NOTES 51 Creating Note Types Geneious does not restrict you to the note types that it comes with You can create your own note types to store any information you want To create a new note type click on the Create Note Type button in the left hand panel of the Edit Note Types window This creates a new note type with one empty field and displays it in the panel to the right Note The Note Type Name and Note Type Description fields distinguish your Note type from other user defined note types They do not have any constraints Here are some examples of Note Types Name Description Protein size Size of the protein in kDa Tree building method Method used to build tree UPGMA Neighbor joining Next you need to decide what values your Note Type will store by specifying its fields Field name This defines what the field will be called It will be displayed alongside columns such as Description and Creation Date in the Documents Table You can have more tha
82. d move folders and Import Export options Edit Menu Here you will find common editing functions including Cut Copy Paste Delete and Select All These are useful when transferring information from within documents to other locations or exporting them This menu also contains Find in Document Find Next and Find Previous options Find can be used to find text or numbers in a selected document This is useful when looking for annotated regions or a stretch of bases in a sequence This opens a Find Dialog The shortcut to this is Ctrl F Next finds the next match for the text specified in the Find dialog The shortcut keys are F3 or Ctrl G Geneious then allows you to choose another document and continue searching for the same search word Prev finds the previous match The shortcut keys for this are Ctrl Shift G or Shift F3 View Menu This contains several options and commands for changing the way you view data in Geneious 2 1 THE MAIN WINDOW 21 Back Forwards and History allow you to return to documents you had selected previously Search is discussed in section 2 3 Agents are discussed in section 2 6 Next unread document selects the next document in the current folder which is unread Table Columns contains the same functionality as the popup menu for the document table header See section 2 1 2 for more details Viewers co
83. d options depend on the assembly method selected These are fully documented if you hover the mouse over them in Geneious Thorough slow assembly advanced options include Minimum Overlap The minimum overlap in nucleotides between a sequence and any sequence in the contig required for the sequence to be included in the contig Overlap Identity The minimum identity in percent of the overlap region between a sequence and any sequence in the contig required for the sequence to be included in the contig Choose the options you require and click OK to begin assembling the contig Once complete one or more contigs may be generated If you got more contigs than you expect to get for the se lected sequences then you should try adjusting the options for assembly It is also possible that no contigs will be generated if no two of the selected sequences meet the overlap requirements Note The orientation of fragments will be determined automatically and they will be reverse complemented where necessary If you already have a contig and you want to add a sequence to it or join it to another contig then just select the contig and the contig sequence and click assembly as normal Click More Options in the assembly options to display the Alignment parameters Here you can change the parameters used by Geneious when aligning fragments together For sequences which are lower quality or contain many errors the gap penalty should be decreased and th
84. dge We develop extensions for exponentially growing population size and joint estimation of substitution model parameters We illustrate some of the important features of this approach on a genealogy of HIV 1 envelope env partial seguences PMID 12136032 Figure 3 10 Viewing bibliographic information in Geneious 76 CHAPTER 3 DOCUMENT VIEWERS Chapter 4 Analysing Data 4 1 Literature Geneious allows you to search for relevant literature in NCBI s PubMed database The results of this search are summarized in columns in the Document Table and include the PubMed ID PMID first and last authors URL if available and the name of the Journal When a document is selected the abstract of the article is displayed in the Document Viewer along with a link to the full text of the documentif available and a link to Google Scholar both below the author s name s Note If the full text of the article is available for download in PDF format it can also be stored in Geneious by saving it to your hard drive and then importing it This will allow full text searches to be performed on the article As well as the abstract and links Geneious also shows the summary of the journal article in BibTex format in a separate tab of the Document Viewer This can be imported directly into a ATEX document when creating a bibliography Alternatively a set of articles in Geneious can be directly exported to an EndNote 8 0 compatible format This is usua
85. dundant GenBank EMBL DDBJ PDB sequences no EST STS GSS or HTGS sequences genome Genomic entries from NCBI s Reference Sequence project est Database of GenBank EMBL DDBJ seguences from EST Divisions est human Human subset of est est mouse Mouse subset of est est others Non Human non mouse subset of est gss Genome Survey Seguence includes single pass genomic data exon trapped seguences and Alu PCR seguences htgs Unfinished High Throughput Genomic Seguences phases 0 1 and 2 finished phase 3 HTG seguences are in nr pat Nucleotide seguences derived from the Patent division of GenBank PDB Seguences derived from the 3D structures of proteins from PDB month All new updated GenBank EMBL DDBJ PDB seguences released in the last 30 days RefSeg NCBI curated non redundant sets of seguences dbsts Database of GenBank EMBL DDBJ seguences from STS Divisions chromosome A database with complete genomes and chromosomes from the NCBI Reference Sequence project wes A database for whole genome shotgun sequence entries env_nt This contains DNA sequences from the environment i e all organisms put together Table 2 3 Protein sequence searches in the BLAST databases Database Protein searches env_nr Translations of sequences in env_nt month All new updated GenBank coding region CDS translations PDB SwissProt PIR released in last 30 days nr All non redundant GenBank coding region CDS translations PDB SwissProt PIR PRF pat Pro
86. e mismatch score should be increased 4 7 CONTIG ASSEMBLY PRO ONLY 103 The algorithm Sequence assembly in Geneious uses a simple greedy algorithm which is very similar to that used in its multiple sequence alignment 1 Determine all pairwise distances using BLAST like search 2 If using the thorough sensitivity option reject pairs who s hit is not at least as long as the minimum overlap length 3 Progressively align using Needleman Wunsch 16 for thorough sensitivity or a quicker heuristic for less sensitive options the highest scoring pairs reverse complementing if necessary appending sequences to contigs and joining contigs where necessary Reject alignments which do not meet overlap requirements if using the thorough sensitivity setting 4 7 2 Assembly to a reference sequence Assembling to reference is used when you have known sequence and you wish to compare a number of reads of the same sequence with it to locate differences or SNPs To perform assembly to a reference sequence select the sequences and the reference sequence and click Assembly Choose the name of the sequence you wish to use as the reference in the Align to referencce option and click OK One contig will be produced at most and this will display the reference sequence at the top of the alignment view with all other sequences below it See section 4 7 4 for details on identifying differences or SNPs When aligning to reference the sequences are not ali
87. e Geneious Tree Builder Comparisons in volving any gaps are ignored when calculating the distance matrix Jukes Cantor This is the simplest substitution model 11 It assumes that all bases have the same equilibrium base frequency i e each nucleotide base occurs with a frequency of 25 in DNA sequences and each amino acid occurs with a frequency of 5 in protein sequences This model also assumes that all nucleotide substitutions occur at equal rates and all amino acid replacements occur at equal rates HKY The HKY model 9 assumes every base has a different equilibrium base frequency and also assumes that transitions evolve at a different rate to the transversions Tamura Nei This model also assumes different equilibrium base frequencies In addition to distinguishing between transitions and transversions it also allows the two types of transitions A gt G and CT to have different rates 22 4 5 5 Resampling Bootstrapping and jackknifing Resampling is a statistical technique where a procedure such as phylogenetic tree building is repeated on a series of data sets generated by sampling from one original data set The results of analyzing the sampled data sets are then combined to generate summary information about the original data set In the context of tree building resampling involves generating a series of sequence alignments by sampling columns from the original sequence alignment Each of these alignments known
88. e agent is currently searching this can be clicked to stop the search e Edit Click this to change an agent s database search criteria destination or search in terval e Delete Delete the agent permanently Any documents retrieved by the agent will re main in your local documents 2 7 Filtering and Similarity sorting The Filter allows you to instantly identify documents in the document table matching chosen keywords It is located in the top right hand corner of the Main Toolbar Type in the text you are searching for and Geneious will display all the documents that match this text and hide all other documents in the Document Table To view all the documents in a folder clear the Filter box of text or click the button The Sort button in the toolbar provides two actions in a popup menu Sort by similarity is available when a single seguence document is selected in the Document Table It will rank all other seguences by their similarity to the selected seguence The most similar seguence is placed at the top and the least similar seguence at the bottom This also produces an E value column describing how similar the seguences are to the selected one The Remove Sort by Similarity action will remove the E value column and return the table to its previous sorting 2 7 1 Filtering on the fly Filtering can be used while searching for documents via public databases filtering data as it is being downloaded Typ
89. e amount of similarity between the sequences for which those scores are optimal Both protein and nucleotide pairwise alignments have choices for gap open gap exten sion penalties costs Unlike many alignment programs these values are not restricted to 4 4 SEQUENCE ALIGNMENTS 81 8009 Alignment A Geneious Alignment MUSCLE Alignment Translation Align ClustalW Alignment Consensus Align f Profile Align a Mauve Genome Cost Matrix 65 similarity 5 0 4 0 Gap open penalty 8 Gap extension penalty 3 2 Alignment type Global alignment with free end gaps B l Automatically determine sequences direction Restore Defaults Cancel 0K Figure 4 1 Options for nucleotide pairwise alignment integers in Geneious The score of a pairwise alignment is matchCount matchCost mismatchCount mismatchCost For each gap of length n a score of gapOpenPenalty n 1 gapExtensionPenalty is subtracted from this Where e gapOpenPenalty The gap open penalty setting in Geneious e gapExtensionPenalty The gap extension penalty setting in Geneious e matchCost The first number in the Geneious cost matrix e mismatchCost The second number in the Geneious cost matrix e matchCount The number of matching residues in the alignment e mismatchCount The number of mismatched residues in the alignment When doing a Global alignment with free end gaps gaps at either end of the alignment are not p
90. e called index html it will be treated as the main page Geneious will follow all hyperlinks between the pages and external hyperlinks beginning with http will be opened in the user s browser If you want to include figures and diagrams in the pages just put the image files in the folder and reference them with lt img gt tags like a normal HTML document supported image formats are GIF JPG and PNG If you want to include Geneious documents in your tutorial simply place them in the folder as above and they will automatically be imported into Geneious with the tutorial If you want to link to them from the tutorial pages create a hyperlink pointing to the file in the HTML document For example to create a link to the file sequence fasta in your tutorial folder use the HTML lt a href sequence fasta gt click here lt a gt To open more than one document from a link separate the filenames with the pipe character for ex ample lt a href sequence fastalsequence2 fasta gt click here lt a gt Note that geneious files must contain only one document to be imported automatically with the tutorial N You can add a short one line summary by writing your summary in a file called summary txt case sensitive and putting it in the tutorial folder Make sure that the entire summary is on the first line of the file as all other lines will be ignored Once you have all your files together put the contents of the folder i
91. e current display for any document viewer This includes the sequence viewer tree view dotplot and text view 2 10 1 Printing Choose print from the file menu The following options are available Portrait or landscape Controls the orientation of the page Scale Can be used to decrease or increase the size of everything in the view while still printing within the same region of the page For many types of document views this will cause it to wrap to the following line earlier usually requiring more pages Size Controls the size the printed region on the paper Effectively increasing the size reduces the margins on the page 2 10 2 Saving Images Choose save to image file from the file menu The following options are available Size Controls the size of the image to be saved Depending on the document view being saved these may be fixed or configurable For example with the sequence viewer if wrapping is on you are able to choose the width at which the sequence is wrapped but if wrapping is off both the width and height will be fixed Format Controls image format Vector formats PDF and SVG have the advantage over raster formats PNG and JPG that they don t become pixelly when magnified Vector formats are only available in the pro version Resolution Only applies to raster formats PNG and JPG and is used to increase the number of pixels in the saved image Chapter 3 Document Viewers 3 1 The Sequen
92. e in the appropriate text in the Filter Box and only those documents that match both the original criteria as specified by the search terms and the Filter text will be displayed This is an effective way of filtering within your search results 2 8 Notes Notes allow you to add arbitrary information to any of your local documents and any Notes that you add can be treated as user defined fields for use in sorting searching and filtering your documents 2 8 NOTES 49 Where can I add Notes You can add a note to any of your local documents including molecular seguences phyloge netic trees and journal articles You cannot add notes to search results from NCBI or EMBL etc until the documents are copied into one of your local folders The Notes View All documents have a Notes tab in the document viewer panel Click on the tab to display the Notes view which will show you all the notes that are attached to your selected document s To add a note to your document select the Add a Note button on the toolbar and then choose from the available note types Selecting a note type will create an empty note of that type To fill the note just start typing values into the fields Dotplot View Seguence View Notes PR Add a Note E Save io Source x Source Name Sample DNA Date Acquired Modified From original This field must conform to the following constraints O must begin with z constrained
93. e is less than one pixel then the height is the average of the information over multiple sites When gaps occur at at some sites the height is scaled down further to be proportional in height to the number of non gap residues 60 CHAPTER 3 DOCUMENT VIEWERS I Alignment View Text View Notes lt b E Extract amp Reverse Complement Translate Allow Editing Y Annotation Tools gt gt IRO 1 10 20 a 1 na deny k Nv l PA EJ LAE Ce 1 Adam TTCTTTCCTAGG GAAGCAGA TT Colors ACGT B De 2 Harry TTCTTTCATGGG GAAGCAGA T amp 3 Saly TTCTTTCATGGGCACGAAGCAGA TT Y M Graphs X4 Bobb TTCTTTCATGGG GAAGA TT le 5 jane TTCTTTCATGGGGAACAGGCAGATTT 30 40 50 Highlight coverage below Identity ma mm o l Sequence Logo 1 Adam TGGGTACCTTGACTCA 2 Harry TGGGTACC ACCCAAG M Identity amp 3 Saly TGGGTACC ACCCAAG e 4 Bob TGGGTACC ACCCAAGTATTGACT Sliding window size Ce 5 Jane A ACCCAAGTATTGACI gt M Consensus amp Highlighting dencty NAAA C Coverage 30 E o O un a gt lt gt a gt Be 1 Adam CCCATCAACAACGATCCGCTATG 1 VI Restriction Site Y De 2 Harry CCCATCAACAA CCGCTATG gt Y ORF COOCAMORDORAA cocamame Alt click on a sequence position or annotation or select a region to zoom in Alt shift click to zoom out Figure 3 2 The identity graph for an alignment of nucleotide sequences
94. e server O This account already exists just connect Username Password Confirm password Email address optional Account Name Server Jabber Service Name Port Number A Fewer Options C Connect every time I run Geneious talk geneious com 5222 Figure 10 2 Add New Account dialog box with More Options 128 CHAPTER 10 COLLABORATION PRO ONLY 10 1 2 Edit Account Details This option from the Collaboration menu or your account s context menu allows you to change the configuration you made when creating the account If you change your password Geneious will attempt to change it on the server the next time you connect For this purpose Geneious internally remembers your previous password as well so that it can still connect if you have entered your new password while disconnected 10 1 3 Connect Disconnect As all other collaboration related commands options for connecting to or disconnecting from your account are available both in the Collaboration menu and your account s context meu right click or on Ctrl click on Mac OS X on your account 10 1 4 Delete Account This option deletes your account configuration from Geneious Currently there is no option for deleting an account on the server 10 2 Managing Your Contacts Once you have an account and are connected you can start adding contacts You will not be able to add contacts while an account is dis
95. e two ways to do this e Shortcut keys Ctrl Shift P Windows Linux 38 Shift P Mac OS X e Tools Menu Preferences 5 This opens the Preferences Click on the General tab There are five options in the drop down options under Connection settings Figure 1 6 e Use direct connection Use this setting when no proxy settings are required e Use browser connection settings This allows Geneious to automatically import the proxy settings This may not work with all web browsers e Use HTTP proxy server This enables two text fields Proxy host and Proxy port This information is in your browser s connection settings Use this if your proxy server is an HTTP proxy server Please see step 3 1 3 TROUBLESHOOTING 13 e Use SOCKS proxy server Autodetect Type This enables two text fields Proxy host and Proxy port This information is in your browser s connection settings Use this if your proxy server is a SOCKS proxy server Please see step 3 e Use auto config file This enables one text field called Config file location These details can also be found in your browser s settings 6 Set the proxy host and port settings under the General tab to match those in your browser 7 If your proxy server requires a username and password you can specify these by clicking the Proxy Password button directly below Note If you are using any other browser and cannot find the proxy settings please email us at
96. earching for cytochrome b complex 3 Once created select the new folder You can now select the Create or Create and Run The agent will then be added to the list in the agent dialog and it will perform its first search if you clicked Create and Run Otherwise it will wait until its next scheduled search eno Create Agent Search Database PubMed Match all of the following Deliver To Local 0 El O New Folder Search every 1 Days 84 Make destination folder a smart folder Only get documents created after today Cancel Create Create and Run Figure 2 13 The Create Agent Dialog 2 6 AGENTS 47 2 6 2 Checking agents Once you have created one or more agents Geneious allows you to quickly view their status in the agents window which is accessible from the toolbar Your agents details are presented in several columns Enable Action Status and Deliver To Enable This column contains a check box showing whether the agent is enabled Action This summarizes the user defined search criteria It contains 1 Details of the database accessed For example Nucleotide and Genome under NCBL 2 The search type the Agent performed i e keyword 3 The words the user entered in the search field for the Agent to match against Status This indicates what the Agent is currently doing The status will be one of the following e Next search in x ti
97. enalized when determining the optimal alignment This is especially useful if you are aligning sequence fragments that overlap slightly in their starting and ending positions e g when using two slightly different primer pairs to extract related sequence fragments from different samples You can also do a Local Alignment if you want to allow free end overlaps rather than just free end gaps in one alignment If you are aligning nucleotide sequences you will also have the option of doing your alignment by translation and back To view the options for translation alignment click the More Options 82 CHAPTER 4 ANALYSING DATA button that the bottom of the alignment dialog The translation alignment options will appear Here you can set the genetic code and translation frame for the translation as well as the cost matrix gap open penalty and gap extension penalty for the alignment If you want to set the alignment type global or local or choose to automatically determine the sequences direction do it in the main section of the dialog 8 00 Alignment A Geneious Alignment MUSCLE Alignment f Translation Align ClustalW Alignment Consensus Align Profile Align a Mauve Genome Genetic code Standard KH Translation frame ol Protein alignment options Geneious Alignment Cost Matrix Blosum62 A Gap open penalty 12 lt gt lar Gap extension penalty 32 Alignment type Global alignment w
98. ensus seguence of the contig is 4 7 CONTIG ASSEMBLY PRO ONLY 101 not the interesting part the differences between fragments is This can also be done against a known reference sequence when differences between each of the fragments and the reference are of interest 4 7 1 Assembling a Contig To assemble a contig firstly select all of the seguences and or contigs you wish to assemble along with the reference seguence if you want to use one in the document table then click Assembly in the toolbar in the Tools menu or in the popup menu right click Ctrl click on Mac OS on the documents The basic options for contig assembly will then be displayed eno Assembly C Assemble to reference Fragment2 C Assemble by ist part of name seperated by Hyphen M Assembly Method Thorough Slowest B Trim Sequences Use existing trim regions O Remove existing trim regions from sequences O Re trim sequences Options O Do not trim discard trim annotations C Save assembly report C Save results in a new subfolder named Assemblies M More Options Cancel Figure 4 10 Basic assembly options The options available here are as follows e Assemble by aka Assemble by Name If you have selected several groups of fragments which are to be assembled separately you can specify a delimiter and an index at which the identifier can be found in all of the names Sequences are grouped according to the identifier and
99. gned to each other in any way each of them is instead aligned to the reference sequence independently and the pairwise alignments are combined into a contig The high medium and low sensitivity options perform a fine tuning step after the initial assembly to make reads which overlap from the initial assembly stage align better to each other If you just wish to use a reference sequence to help construction of the contig then you should select all sequences and the reference but choose None for Align to reference 4 73 Trimming Trimming low quality ends of seguences is normally performed before assembling a contig This is because the noise introduced by low guality regions and vector contamination can pro duce incorrect assemblies The easiest way to trim seguences is at the assembly step Select the trim options you wish to use in the Assembly options and click OK The seguences will be trimmed and assembled in 104 CHAPTER 4 ANALYSING DATA one operation This means you cannot view the trimming that Geneious uses before assembly is performed but the trimmed regions will still be available and adjustable after assembly is complete Trimmed annotations are ignored when calculating the consensus sequence for a contig So although the trimmed regions are visible they do not affect the results of assembly at all Sequence trimming can be performed before assembly by selecting the sequences you wish to trim and selecting Tools TrimE
100. gressive pairwise alignment methods The most popular and time efficient method of multiple sequence alignment is progressive pairwise alignment The idea is very simple At each step a pairwise alignment is performed In the first step two sequences are selected and aligned The pairwise alignment is added to the mix and the two sequences are removed In subsequent steps one of three things can happen Another pair of sequences is aligned e A sequence is aligned with one of the intermediate alignments e A pair of intermediate alignments is aligned This process is repeated until a single alignment containing all of the sequences remains Feng amp Doolittle were the first to describe progressive pairwise alignment 5 Their algorithm used a guide tree to choose which pair of sequences alignments to align at each step Many variations of the progressive pairwise alignment algorithm exist including the one used in the popular alignment software ClustalX 23 Multiple sequence alignment in Geneious Multiple sequence alignment in Geneious is done using progressive pairwise alignment The neighbor joining method of tree building is used to create the guide tree As progressive pairwise alignment proceeds via a series of pairwise alignments this function in Geneious has all the standard pairwise alignment options In addition Geneious also has the option of refining the multiple sequence alignment once it is done Refining an alignment
101. he Create Agent dialog choose the Agents button from the toolbar and then select Create from the agents dialog Choose a folder for the agent or create a new one and make sure that the Make destination folder a smart folder checkbox is checked When a folder is turned into a smart folder it is given a subfolder called reject At first all the documents delivered by the agent will be put in this folder Drag the documents that you want to keep into the main folder and future documents delivered by the agent will be compared to the accepted and the reject documents and stored in one or other of the two folders appropriately Make sure that you leave documents in the reject folder as smart folders need negative examples to build an accurate comparison model Note that unread documents in the main folder will not be compared while all documents in the reject folder will be 121 122 CHAPTER 8 SMART FOLDERS PRO ONLY Chapter 9 Geneious Education Pro only This feature allows a teacher to create interactive tutorials and exercises for their students A tutorial consists of a number of HTML pages and Geneious documents The student edits the pages and documents to answer the tutorial questions and then exports the tutorial to submit for marking 9 1 Creating a tutorial The backbone of Geneious Tutorials are the HTML documents Simply create your documents and place them together in a folder If you make a pag
102. hically or as plain text Many document viewers allow you to customize settings such as zoom level color schemes layout and annotations nucleotide and amino acid sequences three different layouts branch and leaf labeling tree documents and many more When viewing journal articles this panel in cludes direct link to Google Scholar All these options are displayed on the right hand side of the panel Figure 1 2 For more information see section 2 1 3 Giemviews BibTex Notes Estimating mutation parameters population history and genealogy mporally spe nce data EI a Nucleotide sequence b Journal Article c Phylogenetic tree Figure 1 2 Three document viewers 10 CHAPTER 1 GETTING STARTED 1 2 4 The Help Panel The Help Panel has two sections Tutorial and Help The tutorial gives you hands on experience with some of the most popular features of Geneious The Help section displays a short description of the currently selected service or document viewer This panel can be closed at any time by clicking the button in its top corner or by toggling the Help button in the Toolbar If you are new to Geneious working through the tutorial is a great way to familiarize yourself with Geneious o Help lt Return to contents Sequence alignment If the sequences you just imported lare not selected select them all now
103. his one The information in the BibTex screen can be exported for use in TEX documents Text View BibTeX Notes 5 y y Estimating mutation parameters population history and genealogy simultaneously from temporally spaced sequence data Drummond AJ Nicholls GK Rodrigo AG amp Solomon W School of Biological Sciences University of Auckland 1001 Auckland New Zealand alexei drummond amp zoology oxford ac uk Genetics 2002 161 1307 20 Google Scholar Molecular sequences obtained at different sampling times from populations of rapidly evolving pathogens and from ancient subfossil and fossil sources are increasingly available with modern sequencing technology Here we present a Bayesian statistical inference approach to the joint estimation of mutation rate and population size that incorporates the uncertainty in the genealogy of such temporally spaced sequences by using Markov chain Monte Carlo MCMC integration The Kingman coalescent model is used to describe the time structure of the ancestral tree We recover information about the unknown true ancestral coalescent tree population size and the overall mutation rate from temporally spaced data that is from nucleotide seguences gathered at different times from different individuals in an evolving haploid population We briefly discuss the methodological implications and show what can be inferred in various practically relevant states of prior knowle
104. igate through Geneious without using the mouse and also allows you to redefine shortcuts to ones you may be familiar with from other pro grams Double click on a function to bring up a window to enter your new keyboard shortcut If you use one that is already assigned Geneious will tell you what function currently has that shortcut 2 9 5 Sequencing This tab has options for the management of trace files and assemblies e Confidence Set the threshold values of base call confidence used to determine if a base call is low medium or high quality This affects the binning parameters described below as well as the Confidence color scheme in the Sequence View e Sequence binning options Specifies the requirements for individual traces to be binned as medium or high quality overall To see the Bin for a trace turn on the Bin column under Table Columns in the View menu e Assembly binning options Specifies the requirements for assembly documents to be binned as medium or high quality overall To see the Bin for an assembly turn on the Bin column under Table Columns in the View menu e Track binning history in notes When turned on a note will be added to traces when they are trimmed see the Notes view tab This note will then updated every time the trace is re trimmed maintaining a history of the trimming 56 CHAPTER 2 RETRIEVING AND STORING DATA 2 10 Printing and Saving Images Geneious allows you to print or save as an image th
105. im 3 End These can be set to specify trimming of only the 3 or 5 end of the sequence A minimum amount that must be trimmed from each end can also be specified e Maximum length after trim If the untrimmed region is longer than the specified limit then the remainder will be trimmed from the 3 end of the sequence until it is this length 4 7 4 Viewing Contigs Contigs in Geneoius are viewed and edited in exactly the same way as alignments There are several features in the sequence viewer which are worth taking special note of when viewing contigs e The consensus sequence is normally of particular interset and this is always displayed at the top of the sequence view labeled Consensus 106 CHAPTER 4 ANALYSING DATA e When all sequences in a contig or alignment have quality information attached then you can select the Highest Quality consensus type This almost removes the need for manually editing the contig because this consensus chooses the base with the highest total quality at each position e There is a Quality color scheme which is selected by default for alignments of all chro matograms This assigns a shade of blue to each base based on its quality Dark blue for confidence lt 20 blue for 20 40 and light blue for gt 40 The consensus is also colored with this scheme where the confidence of a given base in the consensus is equal to the maximum confidence from the bases at that site in the alignment e
106. ing of contigs is done to resolve conflicts between fragments before saving the final con sensus The normal procedure for this is to look through the disagreements in the contig as described above and change bases which you believe are bad calls to be the base which you believe is the correct call This is often decided by looking at the quality for each of the bases and choosing the higher quality one Geneious can do this automatically for you if you use the Highest Quality consensus Bases in the consensus sequence can also be edited which will update every sequence at the corresponding position to match what is set in the consensus X AA JAN LA 7 Ce 2 Fragmen CTGAGGAG s JA MA X JA PININ A AMOO KNN MUA J Ce 3 Fragmen AGGAGGAACACCEGTGGC TIIVIIT LIST CTGGGAAATAACTEACGCTGAGGACCGAAAGCCET GET 2 v lt Figure 4 13 Highlight disagreements and edit to resolve them 4 7 6 Saving the Consensus Once you are satisfied with a contig you can save the consensus as a new sequence by clicking on the name of the consensus sequence in your contig and clicking the Extract button 4 8 Results of analysis All analysis results are deposited in the currently selected folder If no local folder is selected then you will be prompted for a local folder This applies to sequence alignments phylo 108 CHAPTER 4 ANALYSING DATA genetic
107. ion points in the inser tion The parts of the ligation points belonging to the vector appear in bold in this diagram Below this is a checkbox where you can choose whether to Keep fragments which are not part of the product If this box is checked a document will be created representing the fragment removed from the vector if any If the insert fragment was produced from a sequence with two restriction site annotations the fragments on either side of the restriction site annotations will also be kept 11 4 Gateway Cloning Geneious contains three operations to assist with Gateway cloning Gateway is a registered trademark of Invitrogen Corporation 11 4 1 Add AttB Sites This operation allows you to add AttB sites to a PCR product It will work on the following types of document e A PCR product AttB sites will be appended to the PCR product e A document with primer binding sites annotated If there is more than one pair Geneious will ask you which pair to use The PCR product will be extracted and AttB sites ap pended e Any other nucleotide document The AttB operation will perform primer design on the document then extract the PCR product and add AttB sites 11 4 2 BP Reaction This operation will create an entry clone from a donor vector Vector with AttP sites and either an expression clone Vector with AttB sites or a PCR product with AttB sites as produced by the Add AttB Sites reaction The resulting entry clone wi
108. ith free end gaps Ym an lt Figure 4 2 Options for nucleotide translation alignment 4 4 2 Multiple sequence alignments A multiple sequence alignment is a comparison of multiple related DNA or amino acid se quences A multiple sequence alignment can be used for many purposes including inferring the presence of ancestral relationships between the sequences It should be noted that protein sequences that are structurally very similar can be evolutionarily distant This is referred to as distant homology While handling protein sequences it is important to be able to tell what a multiple sequence alignment means both structurally and evolutionarily It is not always possible to clearly identify structurally or evolutionarily homologous positions and create a single correct multiple sequence alignment 3 Multiple sequence alignments can be done by hand but this requires expert knowledge of molecular sequence evolution and experience in the field Hence the need for automatic mul tiple sequence alignments based on objective criteria One way to score such an alignment would be to use a probabilistic model of sequence evolution and select the alignment that is most probable given the model of evolution While this is an attractive option there are no efficient algorithms for doing this currently available However a number of useful heuristic algorithms for multiple sequence alignment do exist 4 4 SEQUENCE ALIGNMENTS 83 Pro
109. itioning on resolving phylogenies in a Bayesian framework LA Tree measures and the numb A Molecular phylogeny of coleoi Figure 2 6 Advanced Search 2 3 2 Autocompletion of search words Geneious remembers previously searched keywords and offers an auto complete option This works in a similar way to Google or predictive text on your mobile phone If you click within the search field a drop down box will appear showing previously used options 2 4 Public databases Geneious allows you to search several public databases in the same way that you can search your local documents The search process is described in section 2 3 Geneious is able to communicate with a number of public databases hosted by the National Centre for Biotechnology Information NCBI as well as the UniProt and Pfam databases You can access these databases through the web at http www ncbi nlm nih gov http www uniprot org and http www sanger ac uk Software Pfam respectively These are all well known and widely used storehouses of molecular biology data When viewing data from a public database such as NCBI the data can not be modified This is demonstrated by the small padlock icon which appears in the status bar When this icon is 2 4 PUBLIC DATABASES 35 present items cannot be added or removed from the table and they cannot be modified in any way To modify an item you must first move it to your local folders 2 4 1 Pfam See chapter 7
110. itrary candidate set of restriction en zymes and the desired number of matches so that you can e g identify enzymes that cut only once or twice as well as a region enzymes may not cut within After running the analysis the position of the matching enzymes recognition sequence and the sites where they cut will be visible on the seguence as annotations and you will be able to see a table of all fragment start and end positions and their lengths and of all restriction enzymes involved These tables can be exported as csv files for subseguent processing with other software such as e g Microsoft Excel Like many restriction enzymes EcoRI is methylation dependent and cuts only if the second A in the recognition seguence is not methylated to N6 methyladenosine 2The restriction enzyme information included in Geneious was obtained from Rebase 18 available for free at http rebase neb com 133 134 CHAPTER 11 CLONING PRO ONLY e Digest into fragments allows you to generate the actual fragments that would be created in a digestion experiment using restriction enzymes When running a digestion experi ment you can choose to either use the restriction sites already annotated to the sequences or a subset that corresponds to only some specific enzymes or you can let Geneious de termine the cut sites for any candidate enzymes The latter option finds the cut sites for the candidate enzymes and generates the fragments in a single step
111. its clade Double click the node to collapse un collapse the clade in the view Once you have selected a clade in the view you may edit the tree see below 3 4 7 The Toolbar The buttons on the toolbar along the top of the viewer allow you to edit the tree If you are viewing a tree made from an alignment the View Sequences button allows you view the selected nodes in the sequence viewer The Root button allows you to re root the tree on the selected node The Swap Siblings button allows you to swap the position of the sibling clades of the selected node 3 5 The Chromatogram viewer This viewer is hidden by default in Geneious To turn it on select Tools Preferences then enable it on the Plugins tab The Chromatogram viewer provides a graphical view of a the output of a DNA sequencing machine such as Applied Biosystems 3730 DNA analyzer The raw output of a sequencing machines is known as a trace a graph showing the concentration of each nucleotide against sequence positions The raw trace processed by a Base Calling software which detects peaks in the four traces and assigns the most probable base at more or less even intervals Base calling may also assign a quality measure for each such call typically in terms of the expected probability of making an erroneous call Sequence Logo When checked bases letters are drawn in size proportional to call quality where larger implies better quality or sma
112. l annotations on the sequence 3 1 7 Layout amp Properties Layout amp Properties has various options controlling the look of the sequence 3 1 THE SEQUENCE AND ALIGNMENT VIEWER 63 Wrap sequence This wraps the sequences in the viewing area Linear view on circular seguences This forces circular seguences to be shown linearly Spaces every 10 residues If you are zoomed in far enough to be able to see individual residues then an extra white space can be seen every 10 residues when this option is selected Hide residues Hides the residues bases of the sequence and just leaves the annotations visible Show Name Show or hide sequence and graph names inside the sequence viewer panel Show residue numbers This toggles the display of the residue position number above the sequence residues Show original sequence positions This toggles the display of the residue position numbers for the original sequence on a per sequence basis It is only available for alignment docu ments and sequences that were extracted from other sequences Outline residues when zoomed out This adds a fine line around the sequence which can help with clarity and printing You can also adjust the appearance of annotations Labels This option changes how labels are displayed Inside Outside Inside or Outside and None Overlay on bases when zoomed out When only a single annotation covers a region it will be placed on top of
113. lar structure formats These formats support showing the locations of the atoms in a molecule in 3D PDB format files from the Research Collaboratory for Structural Bioinformatics RCSB Protein Database e mol format files produced by MDL Information Systems Inc e xyz format files produced by XMol e cml format files in Chemical Markup Language e gpr format ghemical files e hin format files produced by HyperChem e nwo format files produced by NWChem Newick format The Newick format is commonly used to represent phylogenetic trees such as those inferred from multiple seguence alignments Newick trees use pairs of parentheses to group related taxa separated by a comma Some trees include numbers branch lengths that indicate the 28 CHAPTER 2 RETRIEVING AND STORING DATA distance on the evolutionary tree from that taxa to its most recent ancestor If these branch lengths are present they are prefixed with a colon The Newick format is produced by pro grams such as PHYLIP PAUP ClustalW 24 ClustalX 23 Tree Puzzle 8 and PROTML Geneious is also able to read trees in Newick format and display them in the visualization win dow It also gives you a number of display options including tree types branch lengths and labels Nexus format The Nexus format 13 was designed to standardize the exchange of phylogenetic data in cluding sequences trees distance matrices and so on The format is composed of a
114. lect Primers from the Tools menu or right click Ctrl click on Mac OS X on the document s and select Primers A popup menu will appear showing the operations valid for your current selection 4 6 1 Design Primers The Primer Design dialog which is then displayed contains two main areas 60 Design Primers Select Task Design New y Design with Existing Primer design uses Primer3 Please cite Primer3 if you publish results y M Forward Primer DNA Probe mM Reverse Primer Region Input Options F L Included Region 1 To 300 4 M Target Region il 8 To 300 8 Product Size Between 100 8 And 3001 8 C Optimal Product Size 1 Number of Pairs to Generate 5 8 2 More Options Cancel OK Figure 4 5 The primer design dialog Task Two tasks are available Design New or Design with Existing Design New designs a pair of forward and reverse primers You can specify if you wish to design with or without a matching probe Design with Existing can design a partner primer to match an existing one 4 6 PCR PRIMERS PRO ONLY 93 for example a reverse primer for a forward or vice versa It also allows you to design a probe to match a pair of primers If any documents were selected which either are primer sequences or contain primer annota tions then these will be made available for selection as primers in a drop down box Selected sequences are treated as primer or probe seque
115. ll have AttL sites annotated 11 4 3 LR Reaction This operation will create an expression clone from a destination vector Vector with AttR sites and an entry clone Vector with AttL sites The resulting entry clone will have AttB sites 11 4 GATEWAY CLONING 141 annotated 142 CHAPTER 11 CLONING PRO ONLY Chapter 12 Server Databases Pro only By using server databases Geneious can store your documents in your favorite relational SQL database rather than on the file system This means that multiple users can concurrently use the same synchronized storage location without any problems A server databases can be used for everything a local database is used for This includes col laboration and smart agents Take note that unread status agents and shared folders belong to individual users rather than the database For example Bob may see a document as unread but Joe will see that same document as read if he has read it 12 1 Supported Database Systems To use a database as a server database Geneious requires that it support transactions with an isloation level set to SERIALIZABLE Supported databases systems include Microsoft SOL Server PostgreSOL Oracle and MySOL It is possible to use other database systems if you provide the database driver see section 12 2 1 Server Databases have been tested using e Microsoft SOL Server 2005 Express e PostgreSQL 7 4 e Oracle 10g Express Edition e MySQL 5 143 144 CHAPTER
116. ller chance of error Note that the scale is logarithmic the largest base represents a one in a million 1074 or smaller probability of calling error while half of that represents a probability of only a one in a thousand 1073 Mark calls Draw a vertical line showing the exact location of the call made by the base calling software Layout Options controlling layout and view Those include X and Y axis scaling size of largest base letter when Seguence logo is on and minimum size of base letter to prevent bases of low guality becoming unreadable 3 6 THE PDF DOCUMENT VIEWER 75 3 6 The PDF document viewer To view a pdf document either double click on the document in the Documents Table or click on the View Document button This opens the document in an external PDF viewer such as Adobe Acrobat Reader or Preview Mac OS X On Linux you can set an environmental variable named PDFViewer to the name of your external PDF viewer The default viewers on Linux are kpdf and evince 3 7 The Journal Article Viewer This viewer provides two tabs Text View and BibTex Text view displays the journal article details including the abstract The text contains a link to the original article through Google Scholar below the title and authors Figure 3 10 BibTex is the standard TEX bibliog raphy reference and publication management data format ATEX is a common program used to create formatted documents including t
117. llowing you to select the type of alignment you wish to do Choose Profile Align or Consensus Align here and the options available for your chosen alignment will be displayed Profile Alignment is performed by creating a profile of each alignment sequence and then aligning those using the Needleman Wunsch 16 global pairwise alignment algorithm Profiles are described in the multiple alignment section 4 4 2 Consensus Alignment operates in a similar way to profile alignment except it generates a consensus sequence for each alignment instead of a profile Consensus alignment allows you to choose which align ment algorithm to use for aligning the consensus sequences All of the pairwise and multiple alignment algorithms are available The consensus sequence used for each alignment is a 100 consensus with gaps ignored 4 5 Building Phylogenetic trees Geneious provides some basic phylogenetic tree reconstruction algorithms for a preliminary in vestigation of relationships between newly acquired sequences For more sophisticated meth ods of phylogenetic reconstruction such as Maximum Likelihood and Bayesian MCMC we recommend specialist software such as MrBayes 19 and PhyML 7 which are available as a plugins to Geneious These can be downloaded from the plugins page on our website Geneious implements the Neighbor joining 20 and UPGMA 15 methods of tree reconstruc tion 4 5 1 Phylogenetic tree representation
118. lly done when creating a bibliography for Microsoft Word documents 4 2 Sequence data Basic techniques such as dotplots and pairwise alignments can be used to study the relation ships between two sequences However as the number of sequences increases methods for determining the evolutionary relationships between them become more complicated When analyzing more than two sequences there are some common steps to determine the ancestral relationships between them The following sections outline the basic tools for prelim 77 78 CHAPTER 4 ANALYSING DATA inary sequence analysis dotplots sequence alignment and phylogenetic tree building 4 3 Dotplots A dotplot compares two sequences against each other and helps identify similar regions 14 Using this tool it can be determined whether a similarity between the two sequences is global present from start to end or local present in patches The Geneious dotplot offers two different comparison engines based on the EMBOSS dottup and dotmatcher programs The former is much faster but less sensitive than the latter More information on these programs can be found by going to http emboss sourceforge net When viewing a pairwise alignment you can activate the path which shows where the pair wise alignment runs through the dotplot Also for nucleotide comparisons you can show the reverse complement 4 3 1 Viewing Dotplots To view a dotplot in Geneious select two nucleotide
119. lugin format you can install it by clicking this button or by dragging the plugin file in to Geneious e Check for plugin updates now Checks if there are any new versions available for the plugins you have installed e Automatically check for updates to installed plugins If checked Geneious will check for new versions of your installed plugins each time the program is started Tell me when new plugins are released Changes the way the program notifies you about new plugin releases e Also check for beta releases of plugins Plugins are sometimes initially released as a beta for the purposes of testing before the officially release Check this to be notified about the release of beta plugins e Customize feature set Click this to see a list of all features in Geneious Any number of these can be turned off by un checking the Enabled box next to each feature You might like to turn of the Tree Builder and Tree Viewer plugins if you don t do phylogenetics for example CHAPTER 2 RETRIEVING AND STORING DATA General Appearance and Behavior Keyboard NCBI Sequencing JI Plugins Plugins are downloadable modules which add new functionality to Geneious Available Plugins 4 Description Categories YY Green Button Run analyses on the NZSC supercomputing cluster from Supercomput Install Info PhyML Maximum Likelihood tree building for alignments Please cite Phylogenetics Install Info Installed Plugins
120. lustalW Location This should be set to the location of the ClustalW program on your computer Enter the path to it in the text field or click the Browse button to browse for the location If the location is invalid and you attempt to perform an alignment Geneious 4 4 SEQUENCE ALIGNMENTS 85 will tell you and offer the options detailed above for getting or finding ClustalW e Cost Matrix Use this to select the desired cost matrix for the alignment The available options here will change according to the type of the sequences you wish to align You can also click the Custom File button to use a cost matrix that you have on your computer the format of these is the same as for the program BLAST e Gap open cost and Gap extend cost Enter the desired gap costs for the alignment e Free end gaps Select this option to avoid penalizing gaps at either end of the alignment See details in the Pairwise Alignment section above e Preserve original sequence order Select this option to have the order of the sequences in the table preserved so that the alignment contains the sequences in the same order e Additional options Any additional parameters accepted by the ClustalW command line program can be entered here Refer to the ClustalW manual for a description of the avail able parameters You can also do a clustal alignment via translation and back as with pairwise alignment After entering the desired options click OK and C
121. lustalW will be called to align the selected sequences or alignment Once complete a new alignment document will be generated with the result as detailed previously 4 4 4 Sequence alignment using MUSCLE Pro only MUSCLE is public domain multiple alignment software for protein and nucleotide sequences MUSCLE stands for multiple sequence comparison by log expectation See http www drives com musclef To perform an alignment using MUSCLE select the sequences or alignment you wish to align and select the Alignment button from the Toolbar At the top of the alignment options win dow there are buttons allowing you to select the type of alignment you wish to do Choose MUSCLE here and the options available for a MUSCLE alignment will be displayed For more information on muscle and its options please refer to the original documentation for the program http www drive5 com muscle muscle html 4 4 5 Combining alignments and adding sequences to alignments Two alignment methods are available in Geneious which allow you to align two alignments together and create a single alignment and align a new sequence in to an existing alignment These are Profile Alignment and Consensus Alignment 86 CHAPTER 4 ANALYSING DATA To perform either of these select the sequences or alignment you wish to align and select the Alignment button from the Toolbar At the top of the alignment options window there are buttons a
122. me eg 18 hours The agent is waiting until its next scheduled search and it will search when this time is reached e Searching These are shown in bold The agent is currently searching e Disabled The agent will not perform any searches e Service unavailable The agent cannot find the database it is scheduled to search This will happen if the database plugin has been uninstalled or if for example the Collabora tion contact is offline currently e No search scheduled The agent is enabled but doesn t have a search scheduled To correct this click the Run now button in the agent dialog to have it search immediately and schedule a new search Deliver To This names the destination folder for the downloaded documents This is usually your Local Documents or one of your local folders Note If you close Geneious while an agent is running it will stop in mid search It will resume searching when Geneious is restarted Also all downloaded files are stored in the destination folder and are marked unread until viewed for the first time 2 6 3 Manipulating an agent Once an agent has been set up it can be disabled enabled edited deleted and run All these options are available from within the Agents dialog 48 CHAPTER 2 RETRIEVING AND STORING DATA e Enable or disable an agent by clicking the check box in the Enable column e Run Now Cause the agent to search immediately e Cancel If th
123. n Geneious first starts up you will be asked to choose a location where Geneious will store all of your data The default is normally fine but you may like to store your data on a network or USB drive so you can access it from other computers To store your data on a different drive simply click the Select button in the welcome window and choose an empty folder on your 8 CHAPTER 1 GETTING STARTED drive where you would like to store your data The data location can also be changed later by going to the General tab under Tools Preferences in the menu and changing the Data Storage Location option Geneious will offer to copy your existing data across to the new location if appropriate 1 1 2 Upgrading to new versions To upgrade existing Geneious installations simply download and install the new to the same location This will retain all your data 1 2 Using Geneious for the first time Figure 1 1 shows the main Geneious window This has six important areas or panels lt gt 8 Back Forward Sequence Search DeCypher Agents A Search ek e Judo a Alignment Tree Assembly Primers Cloning Help D Tree Documents 4 P Searches 0 G Server Databases Collaboration v 2 NCBI 2 BLAST Gene B Genome 2 Nucleotide 2 PopSet B Protein PubMed 2 snp R Structure Taxonomy v P Pfam Not set up Bp Domains amp UniProt b Ex
124. n a zip file with the exten 123 124 CHAPTER 9 GENEIOUS EDUCATION PRO ONLY sion tutorial zip Be careful not to put subfolders in your zip file as these are not supported 9 2 Answering a tutorial Import the tutorial document into Geneious use File Import From file The tu torial document and any associated geneious documents will be imported into the currently selected folder The tutorial itself will be displayed in the help pane on the right hand side of the Geneious window If you accidentaly close the help pane you can display it by choosing Help from the Help menu If the tutorial requires you to enter answers click the edit button at the top of the tutorial window and type your answer in to the space provided Click the save button when you are done If the tutorial has a link to a Geneious document when you click the link the document will be opened in the document viewer Any changes you make to this document will be preserved when you export the tutorial When you have finished the tutorial export it by selecting the tutorial document and choosing File Export Selected Docuemnts from the main menu Make sure that Geneious Tutorial File is selected as the filetype and then give it a name and click Export Chapter 10 Collaboration Pro only Collaboration allows Geneious pro users to share the products of their research and work with each other Based on an
125. n one Field in a single Note Type to add or remove a field from the note type click the or buttons to the right of the field Field type This describes the kind of information that the column contains such as Text Integer and True False The full list of choices in Geneious is shown in figure 2 16 Constraints These are limiting factors on the data and are specific to each field type For ex ample numbers have numerical constraints is greater than is less than is greater or egual to and is less or egual to These can be changed to suit The constraints for each field can be viewed by clicking the View Constraints button next to the field This will show a pop up menu with the constraints you have chosen see figure 2 17 2 Constraints for constrained string beonswith NE Figure 2 17 The Edit Constraints window 52 CHAPTER 2 RETRIEVING AND STORING DATA Using Note Types The main purpose of Notes is to add user defined information to Geneious documents How ever Notes and Note Types can be searched for and filtered as well Also documents can be sorted according to the values of an added Note Searching Once a Note Type is defined and a Note of that type added it is automatically added to the standard search fields These are listed under the Advanced Search options in the Document Table From then on you can use them to search your Local Documents If you have more than one Field Type for a Note T
126. n searching mode Your new contact will appear immediately in your contact list however you will not be able to tell whether your new contact is online until they accept you as a contact Similarly you will occasionally see a dialog box pop up asking you Allow user name talk geneious com as contact This is another Geneious user attempting to add you as a contact in this manner Your contact will appear grey in your contact list when they are offline If your contact is online they will appear blue A contact online in Geneious will have the orange Geneious G behind them A contact online in some other program like a chat client whill have a speech bubble behind them 130 CHAPTER 10 COLLABORATION PRO ONLY 10 2 2 Rename Contact This option allows you to change the name that you know another contact by This is the name the contact will appear under in the contact list and in chats itis only visible to you Rename Contact 9 Name For blah blah Geneious User Figure 10 5 Rename Contact dialog box 10 2 3 Remove Contact If you no longer wish to share documents with a contact you can remove that contact by right clicking Ctrl click on Mac OS X the contact in the Services panel and selecting Remove Contact This deletes you from their contact list as well If you find that a contact has disappeared from your list this may be the reason 10 3 Sharing Documents Select one of your local folde
127. nces if they are 150bp in length or less Region Input Options These options allow you to specify what part of a sequence you wish to amplify Most options are optional and can be enabled or disabled with the associated check boxes beside them If you have selected a region in the sequence before opening the primer dialog then this region will automatically be used for Included Region and Target Region All of these are expressed in base pairs from the beginning of the sequence and are as follows e Included Region Specifies the region of the sequence within which primers are allowed to fall This must surround the target region and allows you to choose a small region on either side of the target in which primers must lie Target Region Specifies which region of the sequence you wish to amplify and unless the advanced options allow otherwise the left and reverse primers must fall somewhere outside this region e Product Size Specifies the range of sizes which the product of a primer pair can have The product size is the distance in bp between the beginning of the left primer to the end of the reverse primer Optimal Product Size Specifies the preferred size of the product Setting this will mean primer pairs that have a product size close to this will be chosen over those that do not Warning Setting these options can cause the primer design process to take considerably longer to complete The final option in this section is Numbe
128. nches of the tree Show node labels This refers to labels on the internal nodes of the tree Show branch labels This refers to the branches of the tree Fach of the three above options has fields that you can set to customise what the labels display e Display allows you to select what information the labels display Branch Labels have fixed settings but you can select what the Tip Labels display either Taxon Names Node Heights Seguence Names or a number of other options depending on the tree you are viewing If you are viewing a consensus tree you can also display consensus support as a percentage on node labels e You can use Font to change the size of the labels The tree viewer will shrink the font size of some labels if they cannot all fit in the available space Minimum Size specifies the minimum size that the tree viewer is allowed to shrink the label font to Significant Digits sets how many digits to display if the value the node is displaying is numeric Show scale bar This displays a scale bar at the bottom of the tree view to indicate the length of the branches of the tree It has three options Scale range font size and line weight Setting the scale range to 0 0 allows the scale bar to choose its own length otherwise it will be the length that you specify 74 CHAPTER 3 DOCUMENT VIEWERS 3 4 6 Node Interaction You may click on a node in the tree viewer to select the node and
129. nding on the layout that you select above Root Length Sets the length of the visible root of the tree Rooted and Circular views e Curvature Adds curvature to the tree branches Rooted view only e Align Taxon Labels Aligns the tip labels to make viewing a large tree easier Rooted view only Root Angle Rotates the tree in the viewer Circular and Unrooted views e Angle Range Compresses the branches into an arc Circular view only 3 4 5 Formatting There are a range of formatting options Transform branches allows the branches to be equal like a cladogram or proportional Leaving it unselected leaves the tree in its original form Ordering orders branches in increasing or decreasing order of length but within each clade or cluster Show root branch displays the position of the root of the tree has no effect in the unrooted layout Line weight can be increased or decreased to change the thickness of the lines representing the branches Auto subtree contract automatically contracts subtrees when there is not enough space on screen to display them nicely Show selected subtree only shows only the part of the tree that is selected or the entire tree if there is no selection If you are unfamiliar with tree structures please refer to Figure 3 9 for the following options 3 4 TREE VIEWER 73 Root Branch Node Tip Figure 3 9 Phylogenetic tree terms Show tip labels This refers to labels on the tips of the bra
130. nds This will add Trimmed annotations to the se quences which are ignored in the construction of a contig When performing Assembly from sequences which have been annotated in this way select Use Existing Trim Regions Trimmed annotations can also be created manually using the annotation editing in the sequence viewer If you create annotations of type trimmed and save them then Geneious will treat them the same as ones generated automatically and they will be ignored during assembly Trimmed annotations can also be modified in this way before or after assembly Trimming options e0 Trim Ends O Annotate new trimmed regions ignored by assembly and consensus Remove new trimmed regions from sequences O Remove existing trimmed regions from sequences M Screen for vectors UniVec High sensitivity E Minimum BLAST alignment score 16 8 C Error Probability Limit 0 05 1 Maximum low quality bases o mM Maximum ambiguities ol B M Trim 5 End At least O 17 bp M Trim 3 End At least 0 bp Maximum length after trim 1 000 Trim excess from 3 end Figure 4 11 Trimming options Annotate new trimmed regions Calculate new trimmed regions and annotate them the 4 7 CONTIG ASSEMBLY PRO ONLY 105 trimmed regions will be ignored when performing assembly and calculating the consen sus sequence e Remove new trimmed regions from sequences Calculate new trimmed regions and
131. ntains a list of available document viewers Clicking one will select the view if it is available on the currently selected documents Open document in new window Opens a new window with a view of the currently selected document s Expand document view expands the document viewer panel in the main window out to fill the entire main window Selecting this again to return to normal Document Windows Lists the currently open document windows Selecting one from this menu will bring that document window to the front Tools Menu Alignment see section 4 4 Tree see section 4 5 Assembly see section 4 7 Primers see section 4 6 Cloning see section 11 Sequence Search Perform a sequence search such as NCBI Blast using the currently selected sequence as the query See section 2 4 4 Add Remove Databases see section 5 1 3 Pfam see section 7 Linnaeus Blast Perform a blast search and display the results using the Linnaeus viewer Evolutionary trees are built for hits within the same species These are then displayed inside boxes nested according to the NCBI taxonomy 22 CHAPTER 2 RETRIEVING AND STORING DATA Extract Annotations Search the selected sequences or alignments for annotations which match certain criteria then extract all of the matching annotations to separate sequence documents Includes the option to concatenate all matches in each se
132. number of blocks such as TAXA TREES and CHARACTERS Each block contains pre defined fields Geneious imports and exports files in Nexus format and can process the information stored in them for analysis PDB format Protein Databank files contain a list of XYZ co ordinates that describe the position of atoms in a protein These are then used to generate a 3D model which is usually viewed with Rasmol or SPDB viewer Geneious can read PDB format files and display an interactive 3D view of the protein structure including support for displaying the protein s secondary structure when the appropriate information is available PDF format PDF stands for Portable Document Format and is developed and distributed by Adobe Systems http www adobe com It contains the entire description of a document including text fonts graphics colors links and images The advantage of PDF files is that they look the same regardless of the software used to create them Some word processors are able to export a document into PDF format Alternatively Adobe Writer can be used Currently you can use Geneious to read store and open PDF files and future versions will have more options for storing and manipulating PDF Phrap Ace files Ace is the format used by the Phrap Consed package created by the University of Washington Genome Center This package is used mainly to assemble sequences 2 2 IMPORTING AND EXPORTING DATA 29 PileUp format The PileUp fo
133. nvironmental samples 44 eny_nt Environmental samples DNA est Expressed sequence tags DNA est_human Human expressed sequence tags DNA est mouse Mouse expressed sequence tags DNA est_others Non Mouse non Human est DNA gss Genome Survey Sequence DNA htgs Unfinished High Throughput Genomic Sequences DNA Month New or revised in the last 30 days 44 or DNA nr GenBank RefSeq EMBL DDB and PDB 44 or DNA pat Patent division of GenPept 44 or DNA pdb Sequences derived from PDB structures 44 or DNA genome Reference genomic sequences DNA refseg protein NCBI Reference Sequence Project AA SwissProt Last major release of the SWISS PROT 44 was Whole genome shotgun sequence entries DNA My Database DNA v Megablast fast high similarity matches DNA W 2 More Options Figure 5 3 Searching a Custom BLAST database w Add Remove Databases Chapter 6 COGs BLAST Pro only COGs BLAST allows you to BLAST against the COGs database http www ncbi nlm nih gov COG Geneious will BLAST your sequence against the COGs database identify which COG the sequence is most likely to reside in and give you information about the COG 6 1 Setting Up To set up the COGs database you first need to set up Custom BLAST on your computer see the section on Custom BLAST Once you have set up Custom BLAST you need to set up the COGs database files 6 1 1 D
134. o zoom in out or click to zoom in and hold Alt and Shift then click to zoom out Selecting and Editing Selection and editing in the sequence viewer is very similar to standard text editing and word processing programs Click and drag to select a region You can drag up and down to select and edit across multiple sequences in i an alignment Clicking the Edit Figure 1 1 The main window in Geneious 1 2 USING GENEIOUS FOR THE FIRST TIME 9 1 2 1 The Sources Panel The Sources Panel contains the service Geneious offers for storing and retrieving data These in clude your local documents including sample documents Server Databases UniProt NCBI Pfam and Collaboration All these services will be described in detail later in the manual For more information see section 2 1 1 1 2 2 The Document Table The Document Table displays summaries of downloaded data such as DNA sequences protein sequences journal articles sequence alignments and trees By clicking on the search icon you can search data for text or by sequence similarity BLAST You can enter a search string into the Filter box located at the right side of the toolbar this will hide all documents that do not contain the search string For more information see section 2 1 2 1 2 3 The Document Viewer Panel The Document Viewer Panel is where sequences alignments trees 3D structures journal ar ticle abstracts and other types of documents can be shown grap
135. o that e g the sequence YS only has an effective length of 1 it is a better measure for the expected number of hits in a random sequence of fixed length because YS matches CC CG TC and TG On a random sequence with uniform nucleotide distribution it would match approximately once every nucleotide as would a recognition sequence of length 1 hence the effective length of YS is 1 e Only include enzymes that match X to Y times lets you filter the results once the restriction sites have been identified If checked this option will discard all restriction sites for en zymes whose recognition sequence matches less than X or more than Y times If you set X to be 0 when this operation is complete it will report which candidate enzymes matched 0 times 11 2 DIGEST INTO FRAGMENTS 135 e Exclude enzymes cutting between residues lets you annotate only enzymes which do not cut within a certain range e If you select to show More Options a table of all enzymes in your candidate set filtered by the effective recognition sequence length constrained when active will be displayed Only the enzymes selected in this table will be considered in the analysis initially all rows are selected You can click on the column headers to sort the table ascending or descending by that column and you can Shift click and Ctrl click to select a range of rows and to toggle the selection of a row respectively e If not all candidate enzymes are currently selected
136. og Select one or more files and click Import If Geneious automatic file format detection fails select the file type you wish to import Figure 2 3 The different file types are described in detail in the next section File name Import Cancel Files of type ci a 7 3 D structure documents pdb mol scm gpr hin nwo ace PHRAP File Format ace ace 1 txt Chromatogram ab abi ab1 scf Clustal aln DNA Strider str DNAStar seg pro Endnote 8 0 or 9 0 xml Fasta Autodetect fasta fas fa mpfa fna fsa txt Figure 2 3 File import options 24 CHAPTER 2 RETRIEVING AND STORING DATA 2 2 2 Data input formats Geneious version 4 8 can import the following file formats Format Extensions Data types Common sources Clustal aln Alignments ClustalX CSFASTA csfasta Color space FASTA ABI SOLID DNAStar seq pro Nucleotide amp protein sequences DNAStar DNA Strider str Seguences DNA Strider Mac program ApE Embl UniProt emb swp Seguences Embl UniProt Endnote 8 0 XML xml Journal article references Endnote Journal article websites FASTA fasta fas etc Seguences alignments PAUPX ClustalX BLAST FASTA FASTO fastg fasg Seguences with guality Solexa Illumina GCG seq Sequences GCG GenBank gb xml Nucleotide amp protein sequences GenBank Geneious xml geneious Preferences datab
137. olylinker annotation directly Bases Used to explicitly specify the range of bases to use Entire sequence Used to specify that you can cut anywhere within the sequence e Candidate Enzymes These options let you choose which enzymes to look for on the vector sequence Enzymes annotated on insert This option lets you use only the enzymes used to cut the insert fragment Enzyme set This option lets you use the enzymes from a predefined enzyme set eg the enzyme set you have created containing the enzymes you have in your lab e Cut vector with Whenever you change the options for the polylinker or candidate en zymes Geneious will recalculate the compatible enzymes on the vector It will look for enzymes which meet one of the following conditions in addition to cutting only within the polylinker and belonging to enzymes from the candidate enzyme set 1 A single enzyme which cuts the vector once such that the insert can be inserted in the gap Possible only when the insert has complementary cut sites 2 A single enzyme which cuts the vector twice such that the insert can be inserted into the gap vacated by the fragment between the two cut sites 3 Two enzymes which each cut the vector once such that the insert can be inserted into the gap vacated by the fragment between the two cut sites 140 CHAPTER 11 CLONING PRO ONLY 11 3 3 Other Options The Product section of the options displays a diagram showing the ligat
138. onomy This database contains the names of all organisms that are represented in the NCBI genetic database Each organism must be represented by at least one nucleotide or protein seguence Entrez Gene Entrez Gene is NCBI s database for gene specific information It does not include all known or predicted genes instead Entrez Gene focuses on the genomes that have been completely seguenced that have an active research community to contribute gene specific in formation or that are scheduled for intense seguence analysis Entrez SNP In collaboration with the National Human Genome Research Institute The Na tional Center for Biotechnology Information has established the dbSNP database to serve as a central repository for both single base nucleotide subsitutions and short deletion and insertion polymorphisms The scope and depth of these databases make them critical information sources for molecu lar biologists and bioinformaticians alike However a library is only as good as its librarian Geneious is your librarian allowing you to search for filter and store only the data that you care about 2 4 4 Accessing NCBI BLAST through Geneious BLAST 1 stands for Basic Local Alignment Search Tool It allows you to guery the NCBI seguence databases with a seguence in order to find entries in the public database that contain 2 4 PUBLIC DATABASES 37 similar sequences When BLAST ing you are able to specify either nucleotide or protein
139. or protein sequences in the Document Table and select Dotplot Viewer in the Document Viewer Panel Figure 3 6 The Dotplot Viewer allows you to zoom in and out and to customize sensitivity of the comparison If a single nucleotide or protein sequence is selected then the dotplot is also available In this case it shows a comparison of the sequence to itself The dotplot comparison of two sequences is drawn from top left to bottom right in and offers a selection of different color schemes There is also a minimap available which aids navigation of large dotplots by showing the overall comparison and a box indicating where the dotplot window sits 4 3 2 Interpreting a Dotplot e Each axis of the plot represents a sequence e A long largely continuous diagonal indicates that the sequences are related along their entire length e Sequences with some limited regions of similarity will display short stretches of diagonal lines e Diagonals on either side of the main diagonal indicate repeat regions caused by duplica tion 4 4 SEQUENCE ALIGNMENTS 79 e A random scattering of dots reflects a lack of significant similarity These dots are caused by short sub sequences that match by chance alone For more information on dotplots refer to the paper by Maizel z Lenk 14 4 4 Sequence Alignments Over evolutionary time related DNA or amino acid sequences diverge through the accumula tion of mutation events such as nucleotide or amino
140. ords for the manually curated domains in Pfam A and the full alignment alignment of all occurrences of this domain in UniProt sequences for each domain 117 118 CHAPTER 7 PFAM PRO ONLY 3 Pfam B 59 MB contains records for the automatically generated domains in Pfam B taken from PRODOM 4 Pfam C 69 KB contains records for Pfam clans families of similar domains 5 swisspfam 132 MB contains data on the domain architecture of UniProt seguences 7 1 1 Downloading the Pfam databases yourself If you want you can download or otherwise acguire the Pfam databases outside of Geneious You will need to let Geneious know where to look for the files once you have done this To do this select the Pfam service Click the Change Database Location and browse to the location of the databases 7 1 2 Downloading the Pfam databases through Geneious Geneious provides a download manager to help you download the Pfam files To use it select the Pfam Service Click the Let Geneious do it button Then click the Start button After a few seconds the first database will start downloading You can click Pause to pause the download You can search a database as soon as it has finished downloading and its contents have been verified If you shut down Geneious with a file partially downloaded you will need to start downloading it again from the beginning The Pfam databases total around 4 GB in size most of which comes from
141. ou haven t used Geneious before 2 1 5 The Toolbar The toolbar contains several icons that provide shortcuts to common functions in Geneious You can alter the contents of the toolbar to suit your own needs The icons can be displayed small or large and with or without their labels The Help icon is always available The Back and Forward options help you move between previous views in Geneious and are analogous to the back and forward buttons in a web browser The V option shows a list of previous views The other features that can be accessed from the toolbar are described in later sections 20 CHAPTER 2 RETRIEVING AND STORING DATA The toolbar can be customized by right clicking Ctrl click on Mac OS X on it This gives a popup menu with the following options e Show Labels Turn the text labels on or off e Large Icons Switch between large and small icons e A list of all available toolbar buttons Selecting deselecting buttons will show hide the buttons in the toolbar 2 1 6 Status bar Below the Toolbar there is a grey status bar This bar displays the status of the currently selected service For example when you are running a search it displays the number of matches and the time remaining for the search to finish 2 1 7 The Menu bar File Menu This contains some standard File menu items including printing and Exit on Windows It also contains options to create rename delete share an
142. ownloading the COGs BLAST files yourself If you want you can download or otherwise acquire the COGs BLAST database files outside of Geneious You can download them from here ftp ftp ncbi nih gov pub COG COG The files you need are e myva e myva gb e whog Save these files to a local folder Now go to Tools Add Remove Databases gt Add Sequence Database and select Custom BLAST using the Service drop down box Choose to Create from file on 113 114 CHAPTER 6 COGS BLAST PRO ONLY 7 COGs Setup Geneious is downloading the required files You may continue to use Geneious whog ELLE ELLE EE LLL Finished setting up myva gb LLL EE EEE LLL Finished setting up myva Downloaded 1 292 of 61 320 MB 2 10 Approximately 3 minutes 25 seconds remaining Figure 6 1 The Cogs BLAST Download Manager disk and click Browse Navigate to the file myva and click OK make sure that the protein database option is checked Now copy the other two files that you downloaded into the data folder inside your Custom BLAST folder 6 1 2 Downloading the COGs BLAST databases through Geneious Geneious provides a download manager to help you download and set up the COGs BLAST database To use it go to Tools Tools Add Remove Databases Set Up Search Services and select COGS BLAST from the Service drop down box Make sure Let Geneious do the setup is checked Then click OK After a few seconds
143. oxir History 3D Structures 5 house mouse gene 2 Mus musculus 1 Cys peroxit gt Forward Alignments 6 Insert Sequence An insert seguence with rest 5 Connect Disconne 5 Contig Assembly 6 A Plasmid Vector Shuttle vector pMQ91 comp A New Seguence 2 Genomes 4 Possum PopSet Genetic structure of the wesi E Import Linnaeus Blast 1 PSA Primer A primer oligonucleotide v Divider 31 Nucleotide Documents 9 amp pygmy chimpanzee Pan paniscus clones kia192 X Search Plasmids from NEB 27 A WNTI gene WNT1 wingless type MMTV amp S h 2 Protein Documents 5 eguence Searc Restriction Enzymes 4 v Sort 5 Tree Documents 4 DeCypher Searches 0 v amp Agents B Server Databases amp Do Not Disturb Mo Collaboration v Divider 32 v 2 NCBI Sequence View _ v Alignment SB Lengths Graph ee Figure 1 4 The Toolbar 1 2 6 The Menu Bar The Menu Bar has seven main menus File Edit View Tools Sequence Collabora tion Help and Pro For details on the menu bar see section 2 1 7 1 2 7 Popup Menus Many actions can be quickly accessed for data items services and sometimes selections in a viewer via popup menus also known as context menus To invoke a popup menu for an item simply right click Ctrl click on Mac OS X The popup menu will contain the actions which are relevant to the item you clicked 1 3 Tro
144. p www igniterealtime org projects wildfire index jsp which is available for free under the GNU General Public License ht tp www gnu org copyleft gpl html Install and start the server on one computer and then enter that com puter s name or address in the Server field under More Options when creating a new account Please note that Biomatters cannot provide any further support for setting up and managing your Jabber server except possibly under a contracting agreement Chapter 11 Cloning Pro only Restriction Enzymes cut a nucleotide sequence at specific positions relative to the occurrences of the enzyme s recognition sequence in the sequence For example the enzyme EcoRI has the recognition sequence GAATTC and cuts both the strand and the antistrand sequence after the G inside the recognition sequence leaving a single stranded overhang sticky end overhang GAATTC CTTAAG The cloning features in Geneious allow you to identify candidate Restriction Enzymes for your experiments and to determine in silico where they would cut your nucleotide sequences and which fragments they would produce It also lets you ligate fragments and insert a fragment into a vector If you select a nucleotide sequence restriction analysis is available under the menu item Tools Restriction Analysis and in the context menu right click on the sequence or Ctrl click on Mac OS X e Find Restriction Sites allows you to specify an arb
145. per match 1 per match 1 per match 137 The option Insert into Vector from the Tools Restriction Analysis menu or the context menu allows you to take an insert and insert it into a vector The insert must be one of the following e A fragment which has already been digested This fragment cannot have any restriction site annotations on it The entire fragment will be inserted into the vector Overhangs will be taken into account e A sequence with two restriction annotations The fragment resulting from digesting this sequence and discarding the fragments from the ends will be inserted into the vector The vector must be a circular sequence You do not need to annotate the restriction sites used to cut the vector in advance the Insert into Vector operation will do that for you This operation cannot deal with some aspects of molecular cloning such as triple ligation and the blunting or filling in of overhangs If you want to do a cloning operation outside the scope of this operation you will need to annotate restriction sites on the sequences involved digest the fragments modify them in the sequence viewer if necessary and then ligate them back together as a set of discrete steps 138 CHAPTER 11 CLONING PRO ONLY Insert into Vector Insert Insert forward 0 Insert reverse 689 693 1793 1797 forward strand AATTC reverse strand G Vector Polylinker region to cut within Annotation multiple
146. pps jmol docs 3 3 3 Display Menu At the top of the viewer is the display menu Here you can modify the appearance of the structure Reset lets you reset the position of the structure reset the appearance of the structure to the default or reset the appearance of the structure to its appearance when it was last saved Color lets you change the color scheme of the selected region of the atom Style lets you change the style of the selected region of the molecule eg to spacefill or cartoon view Atoms lets you hide atoms or change their size in the selected region of the molecule You can also choose whether to show hydrogen atoms and atom symbols Bonds lets you hide bonds or change their size in the selected region of the molecule Covalent ionic bonds hydrogen bonds and disulfide bonds can be affected separately Effects lets you toggle spin antialiasing stereo and slabbing effects for the whole molecule Save saves the current appearance of the molecule 3 4 TREE VIEWER 71 3 4 Tree viewer The tree viewer provides a graphical view of a phylogenetic tree Figure 3 8 When viewing a tree a number of other view tabs may be available depending on the information at hand The Sequence View tab will be visible if the tree was built from a sequence alignment using Geneious The Text View shows the tree in text format Newick Tree View Alignment View Text View Notes ei Root Ed Swap
147. ption to this rule occurs with PDF documents where the user needs to either click the View Document button or double click to view it Some document types such as sequences trees and structures have an options panel occupying the right of the document viewer The options in the options panel have an arrow which can be used to expand or hide a group of related options See the next section on document viewers for more information about operating the various viewers in Geneious Most viewers have their own small toolbar at the top of the document viewer panel This always has three buttons on the far right e Expand Document View which expands the viewer panel out to fill the entire main window Clicking again will return the viewer to normal size e Open Document in New Window will open a new view of the selected document in a new separate window e Help opens the Help Panel and displays some short help for the current viewer 2 1 4 The Help Panel The Help Panel has a Help tab and a Tutorial tab The Help tab provides you information about the service you are currently using or the viewer you are currently viewing The help displayed in the help tab changes as you click on different services and choose different viewers The Tutorial is aimed at first time users of Geneious and has been included to provide a feel for how Geneious works It is highly recommended that you work through the tutorial if y
148. quence into one sequence document Useful for extracting a certain gene from a group of genomes Strip Alignment Columns creates a new alignment document with some columns for example all identical columns or all columns containing only gaps stripped Concatenate Sequences or Alignments Joins the selected sequences or alignments end on end creating a single sequence or alignment document from several After selecting this operation you are given the option to choose the order in which the sequences or alignments are joined You can also choose whether the resulting document is linear or circular and if one or more of the component sequences was an extraction from over the origin of a circular sequence you can choose to use the numbering from that sequence thus producing a circular sequence with its origin in the same place as the original circular sequence Overhangs will be taken into account when concatenating Generate Consensus Sequence Generates a consensus sequence for the selected se quence alignment and saves it to a separate sequence document After selecting this operation you are given options for choosing what type of consensus sequence you wish to generate see section 3 1 5 for more details on the options Preferences see section 2 9 2 1 8 Sequence Menu This contains several operations that can be performed on Protein and Nucleotide sequences as well as Sequence Alignments in some cases
149. r you can force it to display as a linear sequence using the Linear view on circular sequence checkbox under the Layout section of Layout amp Properties 3 1 3 Colors The colors option controls the coloring of the sequence nucleotides or amino acids Color ing schemes differ depending on the type of sequence For example the Polarity and Hy drophobicity coloring schemes are available only for Protein sequences 3 1 THE SEQUENCE AND ALIGNMENT VIEWER 59 Similarity Color Scheme The similarity scheme is used for quickly identifying regions of high similarity in an alignment In order for a column to be rendered black 100 similar all pairs of sites in the column must have a score according to the specified score matrix equal to or exceeding the specified thresh old So for example if you have a column consisting of only K Lysine and R Arginine and are using the Blosum62 score matrix with a threshold of 1 then this column will be colored entirely black because the Blosum62 score matrix has a value of 2 for K vs R If you raised the threshold to 3 then this column would no longer be considered 100 similar If the column consisted of 9 K s and 1 R then continuing with the threshold value of 3 the 9 K s which make up 90 of the column would now be colored the dark grey 80 100 range while the single R would remain uncolored If instead the column consisted of 7 K s and 3 R s still with
150. r add your own sequence or select from avail able restriction sites These extensions will not change the binding region of the primer and will be ignored when primer testing is conducted against potential target sequences If the primer is annotated onto a sequence following testing the extension sequence is shown in the list of the annotation s qualifiers If the primer or a PCR product is extracted from this annotation the result will include the extension 4 6 6 Advanced Options The parameters which are used to pick primers and DNA probes are highly customisable through the advanced options section of the primers dialog To access this select part of a sequence for testing or designing and select Primers from the menu as detailed above Now click the More Options button and the advanced options will appear below the standard options 98 CHAPTER 4 ANALYSING DATA 150 160 170 180 100 200 210 220 230 240 VODUGCCUGGAULAGCCAGGOS ACACACAAGACAAGC CCACUAUCUCAUUVAAUCUUUACAACUCUCUUGCAAG GUUC CCUG CUUGUG ARAAVA CAUCA gt DCN exon 3a DCN_F primer Name DCN_F primer Type primer_bind Created by primer3 5 sa sa su Length 22 ye eve eve deeuvoeaeaavuuve evo od cuce MESrYak 155 gt 176 tecac GC 59 09 m A a5 Hairpin 5 0 A Primer Dimer 0 0 D Monovalent Salt Concentration 50 0 EDivalent Salt Concentration 0 0 a DNTP Concentration 0 0 Product Size 1286 0 Pair Hairpin 6 0 E 400 410 220 ie
151. r of Pairs to Generate which specifies how many candidate pairs of primers and DNA probes to generate and is compulsory Setting this to 1 will give you only the primer pair which was considered best by the set parameters Output from Primer Design Once the task and options have been set click the OK button to design the primers A progress bar may appear for a short time while the process completes When complete each of the sequences will have the designed primers and probes added to them as sequence annota tions The annotations will be labelled with their rank compared to the other primers eg 1st 94 CHAPTER 4 ANALYSING DATA 2nd where 1st is the best and what type they are Forward primer Reverse primer or DNA probe Primers will be coloured green and probes red Detailed information such as melting point tendency to form primer dimers and GC content can be seen by hovering the mouse over an annotation The information will be presented in a popup box Alternatively double clicking on an annotation will display its details in the annotation editing dialog The best way to save a primer or DNA probe for further testing or use is to select the annotation for that primer and click the Extract button in the sequence viewer This will generate a separate short sequence document which just contains the primer sequence and the annotation so it retains all the information on the primer In the case of the reverse primer it
152. rch the Local folder and sub folders the same way you search the public databases by clicking on the Search icon If you have defined a new type of note in Geneious and a Note has been added it will also be added to the Advanced Search criteria Look at an example of a new Note type called Protein size which takes a text value for the protein in kDa kiloDaltons see Figure 2 11 Important You must use quotation marks if and blank spaces are part of your search criteria No guotation marks lead to unreliable results Wild card searches When you are looking for all matches to a partial word use the asterisk For example typing oxi would return matches such as oxidase oxidation oxido reductase and oxide This is useful for performing generic searches You can also place the asterisk in the middle of the word but not at the beginning This feature is available only for local documents 44 CHAPTER 2 RETRIEVING AND STORING DATA Match all E of the following Any Field a contains i Document type geneious document type E Value First Author The article principal author tluc CID The ger Height T Molecule Type The molecule type of the seguence Name name of a document No nodes N No tips Number of tips Organism Organism The organism of the sequence PDB name Name in PDE PMID The P Protein Size Publication Date The
153. rmat is used by the pileup program a part of the Genetics Computer Group GCG Wisconsin Package PIR NBRF format Format used by the Protein Information Resource a database established by the National Biomedical Research Foundation Qual file Quality file which must be in the same folder as the sequence file FASTA format for the quality scores to be used Raw sequence format A file containing only a sequence Rich Sequence format RSF Rich Sequence Format files contain one or more sequences that may or may not be related In addition to the sequence data each sequence can be annotated with descriptive sequence information Sequence Chromatograms Sequence chromatogram documents contain the results of a sequencing run the trace and a guess at the sequence data base calling Informally the trace is a graph showing the concentration of each nucleotide against sequence positions Base calling software detects peaks in the four traces and assigns the most probable base at more or less even intervals Vector NTI formats Geneious supports the import of several Vector NTI formats 30 CHAPTER 2 RETRIEVING AND STORING DATA e gb and gp formats These formats are used in Vector NTI for saving single nucleotide and protein sequence documents They are very similar to the GenBank formats with the same extensions although they contain some extra information e apr format This format is used for storing alignments and
154. rom the full sequence will be transfered over to the BLAST alignment see Figure 2 10 40 CHAPTER 2 RETRIEVING AND STORING DATA Search complete 1 of 100 selected Hit Table Alignment View Notes E Value 4 Name Description Organism Sequence Le Sequences Accession PairwisiR o 139093 Pan paniscus clones kia192 kia193 kia Pan paniscus 1 270 2 100 0 0 J M30678 Pan troglodytes MHC class protein mRN Pan troglody 1 270 2 98 8 o J X13113 Chimpanzee mRNA for MHC class antig Chimpanzee 1 268 2 98 7 o J BC003069 Homo sapiens major histocompatibility c Homo sapiens 1 270 2 98 3 o J X13111 Human mRNA for HLA A11E a MHC clas Human mRNA 1 270 2 98 3 0 NM_002116 Homo sapiens major histocompatibility c Homo sapiens 1 270 2 98 0 o CR625955 full length cDNA clone CSODE012YE05 o full length c 1 270 2 lt 98 0 4 0 J CR624725 full length cDNA clone CSODIO82YI10 of full length c 1 270 2 98 0 v N N lt Selected sequences are only summaries Download Full Seguence s Alignment View Download Dotplot Dotplot Self Text View Notes G db Er Extract El Reverse Complement SP Translate X Allow Editing TP Annotation X Tools M Save mo EJA 30 3 1 200 400 600 800 1 000 1 270 Consensus a Colors AOC le Guy rr q M Graphs 1 200 400 600 800 1 000 1 270 e F MHC class alpha chain pep
155. rs Select Share Folder from the File menu Alternatively right click Ctrl click on Mac OS X on a local folder and select the same option e If you share a folder all documents in that folder are shared e If you share a folder all sub folders of that folder are shared e If you share a folder it is available to all your contacts In the future Geneious may support per account options for sharing your documents or even organize contacts into groups so that you can share your documents with specific groups only 10 4 Browsing Searching and Viewing Shared Documents Folders that your contacts have shared will appear beneath that contact just as they do in your contact s own Services panel You can browse these folders as you do your local folders You 10 5 CHAT 131 can also search a shared folder just as you can a local one Additionally you can search all of a contact s shared documents by clicking on the contact itself and then conducting the search You can also search all the shared documents of all of an account s contacts by clicking on the account and conducting the search Agents can be set up on shared folders contacts and accounts You cannot search browse or run or set up agents on a contact that is currently offline When you first view your contact s documents in the Document Table the documents you see are only summaries To view the whole document select the summary s of the documents s you would like to view and
156. s e Genetic distance model This lets the user choose the kind of substitution model used to estimate branch lengths If you are building a tree from DNA sequences you have the choices Jukes Cantor HKY and Tamura Nei If you are building a tree from amino acid sequences you only have the option of Jukes Cantor distance correction 4 6 PCR PRIMERS PRO ONLY 91 e Tree building method There are two methods under this option Neighbor joining 20 and UPGMA 15 e Create consensus via resampling Check this box to build a consensus tree using resampling of sequence alignment data e Resample tree Check this to perform resampling e Resampling method Either bootstrapping or jackknifing can be performed when resam pling columns of the sequence alignment e Number of samples The number of alignments and trees to generate while resampling A value of at least 100 is recommended e Create Consensus Tree Choose this to create a consensus tree from the samples e Sort Topologies Produce trees which summarise the topologies resulting from resampling See above for more details e Support threshold This is used to decide which monophyletic clades to include in the con sensus tree after comparing all the trees in the original set see Consensus Tree section above e Topology Threshold The percentage of topologies in the original trees which must be rep resented by the summarizing topologies e Save r
157. s E 400 AG COCUCCCUAGEE COAG UGUG Cee clue Co cu Pair Primer Dimer 2 0 bewe Pair Tm Diff 1 97 mus L Sequence TGGATGAGCCAGGGGACACAGA Ls data right click and choose Annotation gt Copy Properties Figure 4 8 Primer annotation with extension Additional Options The advanced options include additional options that tell Geneious to be more lenient with how it designs and tests primers e Maximum Degeneracy Turning this on allows Geneious to design primers which con tain a certain number of ambiguities Such a primer is called a degenerate primer This is because the sequence actually represents more than one primer sequence The maxi mum degeneracy that you specify is the maximum number of primers that any primer sequence is allowed to represent For example a primer which contains the nucleotide character N once and no other ambiguities has a degeneracy of 4 because N represents the four bases A C G and T A primer that contains an N and an R has degeneracy 4 2 8 because R represents the two bases A and G Maximum Mismatches This is available when testing and allows you to specify a limited number of mismatches that you wish to permit between a primer and the target sequence You can limit the position in which mismatches are allowed by clicking the Mismatch Options button Inverse PCR Enables inverse PCR which will invert the primer pair and remove the option of a target region and the ability to use a probe 4
158. s used by ClustalW 24 and ClustalX 23 two well known multiple se guence alignment programs Clustal format files are used to store multiple seguence alignments and contain the word clustal at the beginning An example Clustal file CLUSTAL W 1 74 seql KSKERYKDENGGNYFOLRI multiple sequence alignment EDWWDANRI ETVWKAITCNA 2 2 IMPORTING AND EXPORTING DATA 25 seq2 YEGLTTANGXKEYYODKNGGNFEFKLREDWWTANRETVWKAITCGA seg3 KRIYKKIFKEIHSGLSTKNGVKDRYON DGDNYFOLREDWWTANRSTVWKALTCSD seq4 SORHYKD DGGNYFOLREDWWTANRHTVWEAITCSA seg NVAALKTRYEK DGONFYOLREDWWTANRATIWEAITCSA seg6 FSKNIX 0IEELODEWLLEARYKD TDNYYELREHWWTENRHTVWEALTCEA seq7 KELWEALTCSR segl GGGKYFRNTCDG GONPTETONNCRCIG ATVPTYFDYVPOYLRWSDE seg2 P GDASYFHATCDSGDGRGGAO0APHKCRCDG ANVVPTYFDYVPOFLRWPEE seg3 KISNASYFRATC SDGOSGAO0ANNYCRCNGDKPDDDKP NTDPPTYFDYVPOYLRWSEE seq4 DKGNA YFRRTCNSADGKSOSOARNOCRC KDENGKN ADOVPTYFDYVPOYLRWSEE seg5 DKGNA YFRATCNSADGKSOSOARNOCRC KDENGXN ADOVPTYFDYVPOYLRWSEE seg6 P GNAOYFRNACS EGKTATKGKCRCISGDP PTYFDYVPOYLRWSEE seg P KGANYFVYKLD RPKFSSDRCGHNYNGDP LINLDYVPOYLRWSDE CSFASTA format ABI csfasta files represent the color calls generated by the SOLID seguencing system DNA Star files DNAStar seg and pro files are used in La
159. se Fastal v Browse Type Nucleotide v C Do not check File For duplicate names or invalid bases residues better performance Figure 5 2 Adding a FASTA database the sequences you want to BLAST Enter a name for the database and click OK There are two requirements for a FASTA file to be suitable for creating a database from e The FASTA file must contain only the same types of sequence i e Nucleotide or Amino Acid e The sequences in the FASTA file must all have unique names If the file meets these requirements it will be added as a database otherwise you will be in formed of the problem Creating a database from local documents To create a BLAST database from sequences in your local documents folders first select the doc uments that you want Then go to Tools gt Add Remove Databases Add Sequence Database and select Custom BLAST from the Service drop down box Enter a name for the database and click OK 5 1 4 Using Custom BLAST Once you have added one or more databases they will appear under Custom BLAST in the Sequence Search database drop down These can be used in exactly the same way as the NCBI BLAST ones 112 Database Program CHAPTER 5 CUSTOM BLAST PRO ONLY Click Add Remove Databases For setup Custom BLAST My Database NCBI chromosome Complete genomes and chromosomes from refseq DNA dbsts GenBank EMBL and DDBJ STS Divisions DNA env_nr Protein sequences from e
160. se files is not displayed in the Documents Table Be aware that whole genomes can be very large and can take a long time to download You can cancel the download of document summaries by selecting Cancel Downloads from any of the locations mentioned above Advanced Search also provides you with a number of options for restricting the search on a field depending on the field you are searching against For example if you are using numbers to search for Sequence length or No of nodes you can further restrict your search with the second drop down box 2 3 SEARCHING 33 e is greater than gt e is less than lt e is greater than or equal to gt e is less than or equal to lt Likewise if you are searching on the Creation Date search field you have the following op tions e is before or on e is after or on e is between When searching your local folders you have the option of searching by Document type The second drop down list provides the options is and is not The third drop down lists the various types of documents that can be stored in Geneious such as 3D Structure Nucleotide sequence and PDF see Figure 2 5 Match all H of the following Document type a is 3D structure 44 VI Include Subfolders Fewer Options X Name Summary Tm af Alpha Helix Alpha Helix af Cyclopropane Cyclopropane Vir
161. sequences and nucleotide sequences can be either DNA or RNA sequences The result of a BLAST query is a table of hits Each hit refers to a GenBank accession number and the gene or protein name of the sequence Each hit also has a Bit score which provides information about how similar the hit is to the query sequence The bigger the bit score the better the match Finally there is also an E value or Expect value which represents the number of hits with at least this score that you would expect purely by chance given the size of the database and query sequence The lower the E value the more likely that the hit is real Geneious can perform seven different kinds of BLAST search e blastn Compares a nucleotide query sequence against a nucleotide sequence database e Megablast A variation on blastn that is faster but only finds matches with high similarity e Discontiguous Megablast A variation on blastn that is slower but more sensitive It will find more dissimilar matches so it is ideal for cross species comparison e blastp Compares an amino acid query sequence against a protein sequence database e blastx Compares a nucleotide query sequence translated in all reading frames against a protein sequence database You could use this option to find potential translation prod ucts of an unknown nucleotide sequence e tblastn Compares a protein query sequence against a nucleotide sequence database dy namically transl
162. sergene a seguence analysis tool produced by DNAStar DNA Strider Seguence files generated by the Mac program DNA Strider containing one Nucleotide or Pro tein seguence EMBL UniProt Nucleotide seguences from the EMBL Nucleotide Seguence Database and protein seguences from UniProt the Universal Protein Resource EndNote 8 0 XML format EndNote is a popular reference and bibliography manager EndNote lets you search for journal articles online import citations perform searches on your own notes and insert references into documents It also generates a bibliography in different styles Geneious can interoperate with 26 CHAPTER 2 RETRIEVING AND STORING DATA EndNote using Endnote s XML Extensible Markup Language file format to export and import its files FASTA format The FASTA file format is commonly used by many programs and tools including BLAST 1 T Coffee 17 and ClustalX 23 Each sequence in a FASTA file has a header line beginning with a gt followed by a number of lines containing the raw protein or DNA sequence data The sequence data may span multiple lines and these sequence may contain gap characters An empty line may or may not separate consecutive sequences Here is an example of three sequences in FASTA format DNA Protein Aligned DNA gt Orangutan ATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTG gt gi 532319 pir TVFV2E TVFV2E envelope protein ELRLRYCAPAGFALLKCNDADYDGFKTNCS
163. should be reverse complemented When the Extract button is chosen for the reverse primer it will offer to reverse complement because the annotation runs in the reverse direction Choose Yes 170 180 190 200 210 220 230 Sic BACH Ac ACI CACCANAN jae clic Ec ARANACEC CACA AMC Gi ENACCACANAAMAC IC CANCAC c e 1st forward primer 2nd forward primer Name 1st forward primer Type primer_bind Created by primer3 N Length 23 N _ Interval 174 gt 196 L 340 350 360 GC 52 17 jo Ac CES AB ARC M CEARECEEACCC HN Tm 58 39 las Hairpin 6 0 Primer Dimer 2 0 Zamu Product Size 165 0 420 430 440 Pair Hairpin 5 0 cccakeenemacackacacam escceaN Pair Primer Dimer 3 0 mei Pair Tm Diff 1 3 Sequence AGAGTGCACCATATGCGGTGTGA Figure 4 6 Primer design output When no primers can be found If no primers or DNA probes that match the specified criteria can be found in one or more of the sequences then a dialog is shown describing how many had no matches and for what reasons To see why no primers or DNA probes were found for particular sequences click the Details button at the bottom of the dialog The dialog will then open out to display a list of all the sequences for which no primers or DNA probes were found For each of the sequences the following information is listed e Which of Forward Primer Reverse Primer Primer Pair and or DNA Probe could not be found in the sequence 4 6 PCR
164. support geneious com e e Tools Preferences Preferences y y y Internet Advanced Advanced Options 0 y y Proxies Network Connections 4 y Settings Lan Settings Figure 1 5 Checking browser settings 1 3 3 Web links inside Geneious don t work under Linux Set your BROWSER environment variable to the name of your browser The details depend on your browser and type of shell For example if you are using Mozilla and bash then put export BROWSER mozilla in your bashrc file When using a csh shell variant put setenv BROWSER mozilla in your cshrc file 14 CHAPTER 1 GETTING STARTED Figure 1 6 General Preferences Chapter 2 Retrieving and Storing data Geneious is a one stop shop for handling and managing your bioinformatic data This chapter summarizes the different ways you can use Geneious to acquire update organize and store your data By the end of this chapter you should be able to e Know the purpose of each panel in Geneious e Import Export data from various sources e Organize your data into easily accessible folders e Automatically update your data Know about the advantages of the Note functionality e Customize Geneious to meet your needs 2 1 The main window This section provides more information on each of the panels in Geneious Figure 2 1 2 1 1 The Services Panel The Services Panel shows a tree that concisely displays sources of data and your stored docu men
165. tein sequences derived from the Patent division of GenBank PDB Sequences derived from 3D structure Brookhaven PDB RefSeg RefSeq protein sequences from NCBI s Reference Sequence Project SwissProt Curated protein sequences information from EMBL sequence manually then Geneious will display a large text box in which you can enter your query sequence as either unformatted text or FASTA format Select your database using the first drop down box Databases are grouped together under their respective services The available programs in the second drop down box will depend on the database you have chosen Geneious also allows you to specify most of the advanced options that are available in BLAST To access the advanced options click the More Options button which is in the bottom left of the Sequence Search options The available options vary depending on the kind of BLAST search you have selected For details on each of the options you can hover your mouse over the option to see a short description or refer to the NCBI BLAST documentation at http www ncbi nlm nih gov blast blastcgihelp shtml Once a search has started a results folder will be created under the Searches folder in the Sources panel Search progress is shown in the document table The search can be cancelled by 2 4 PUBLIC DATABASES 39 7 Sequence Search O pygmy chimpanzee nucleotide Query Use selected alignments For profile search 2 Enter unformatted or FA
166. the click the Download button inside the document view or just above it There are also Download items in the File menu and in the popup menu when document summary is right clicked Ctrl click on Mac OS X The size of these files is not displayed in the Documents Table You can cancel the download of document summaries by selecting Cancel Downloads from any of the locations mentioned above 10 5 Chat You can either chat with a single contact or invite several contacts to join you in a new chat 10 5 1 Chatting with One Contact To start chatting with a particular contact who may be online using Geneious or another chat client which uses the Jabber protocol click on that contact and select New Chat Session either from the Collaboration menu or from the popup menu right click on the contact or Ctrl click on Mac OS X Type your messages into the text field at the bottom of the window that pops up and click Send or press the Enter key to send 10 5 2 Chatting with Multiple Contacts Starting a Chat Session with Multiple Contacts To invite several contacts to join you in a new chat session click on your account not the con tacts and then select New Chat Session from either the Collaboration menu or the context menu right click on the account or Ctrl click on Mac OS X Select the online contacts which you want to invite you can select a range by Shift clicking or add contacts to the selection by Ctrl
167. the same if you are searching your local documents or a public database such as NCBI To search the selected database or folder click the Search button from the toolbar For non local folders search will be on by default and cannot be closed This applies to NCBI and EMBL databases For local folders search is off by default When search is first activated the document table will be emptied to indicate no results have been found To return to browsing click the Search button again or press the Escape key while the cursor is in the search text field To initiate a search enter the desired search term s in the text field and press enter or click the adjacent Search button Once a search starts the results will appear in the document table as they are found The Search button changes to a Cancel button while a search is in progress and this may be clicked at any time to terminate the search Feedback on a search progress is presented in the status bar directly below the toolbar see Figure 2 4 32 CHAPTER 2 RETRIEVING AND STORING DATA immunodeficiency C Search More Options Name Summary R Ed NC_001802 Human immunodeficiency virus 1 complete genome E NC 004455 Simian immunodeficiency virus 2 complete genome Ed NC_001549 Simian immunodeficiency virus complete genome Ed NC_003074 Arabidopsis thaliana chromosome 3 complete sequence Ed NC_002305 Salmonella typhi plasmid R27 complete sequence a NC
168. threshold 3 then 70 of the column is now similar so those 7 K s would be colored the lighter grey 60 80 range Alternatively going back to the default threshold value of 1 and with a column consiting of 7 K s 2 R s and 1 Y now since the 7 K s and 2 R s have similarity exceeding the threshold whereas the Y is not that similar to K and R the K s and R s will be colored dark grey since they make up 90 of the column 3 1 4 Graphs This option is visible when viewing protein sequences chromatogram traces multiple se quences or sequence alignments Turn this option on by clicking the Graph checkbox and the graph s will be displayed below the sequence s The number control to the right of each graph controls the height of that graph in pixels A number of graphs are available Identity This is available for sequence alignments It displays the identity across all sequences for every position Green means that the residue at the position is the same across all sequences Yellow is for less than complete identity and red refers to very low identity for the given posi tion Figure 3 2 Sequence Logo This is available for sequence alignments It displays a sequence logo where the height of the logo at each site is equal to the total information at that site and the height of each symbol in the logo is proportional to its contribution to the information content When zoomed out far enough such that he horizontal width of each sit
169. tide N M Consensus amp Highlighting NECIO M Annotations 12 of 13 Ce 1 pygmy c 2 T 27 2 BC003069 m U M Complement amp Translation Statistics 1 270 98 3 Layout amp Properties gt Alt click on a sequence position or annotation or select a region to zoom in Alt shift click to zoom out Figure 2 9 Sequence Search Complete If you have a mirror of the NCBI BLAST databases you can set Geneious to use this by going to Tools gt Add Remove Databases Set Up Search Services This will bring up a dialog that allows you to change the setup for various search services in Geneious Choose NCBI using the service drop down box at the top of the dialog Enter the url for the mirror and click OK to apply the new settings You can also edit the databases that show up in Geneious by clicking on Edit Databases This will only change the databases that Geneious displays and will not have any effect on the actual databases on the BLAST server 2 5 Storing data Your Local Documents Geneious can be used to store your documents locally Under the Local folder in the Services Panel you are able to create sub folders to organize and store a variety of document types Table 2 4 This is also where you can set up special folders to receive documents that are downloaded by a Geneious agent To create a new folder in Geneious select the Local folder or a sub folder icon in the servi
170. tion can take a long time e With Find Similar Sequences you can search and create documents for sequences in UniProt which match the domain architecture of your Pfam sequence document ie they have the same domains in the same places This operation can take a long time Get Domains in Sequence creates a domain document for every domain in a Pfam se quence document e If your domain document is a member of a Pfam clan you can use Get Clan to get a document representing that clan Get Domains in Clan will do the opposite ie get documents representing each domain in a clan e If your domain document contains the seed alignment for the domain you can use Get Full Alignment to get a domain document with the full alignment e Conversely you can use Get seed alignment to get a domain document with the seed alignment only from a domain document with the full alignment e Get Full Sequences will return the full UniProt sequence documents from which the sequences in the alignment in a domain were extracted e Get Full Sequence will return the full UniProt sequence document from which a se quence taken from an alignment in a domain was extracted 120 CHAPTER 7 PFAM PRO ONLY Chapter 8 Smart Folders Pro only Smart folders are a new feature of Geneious that allow you to separate relevant data from extraneous search results retrieved by an agent Smart Folders are created from within the Create Agent dialog To open t
171. tion of your Local folders To check where your Local folders are being stored on your hard drive open the Tools menu in the Menu Bar Click Tools Preferences General Your documents are stored at the location specified by the Data Storage Location field see Figure 2 12 You can change this location by clicking the Browse button and selecting a new location Geneious will remember this new location when you exit 2 6 AGENTS 45 800 Preferences Plugins and Features Appearance and Behavior Keyboard NCBI Sequencing Data Storage Location Users alexei Geneious Browse Search History Clear M Check for new versions of Geneious Also check for beta versions of Geneious Check for updates now 3 Figure 2 12 Setting the location of your local documents 2 6 Agents Geneious offers a simple way for you to continuously receive the latest information on genomes sequences and protein structures This feature is called an agent Each agent is a user defined automated search You can instruct an agent to search any Geneious accessible database at reg ular intervals eg weekly including your contacts on Collaboration This simple but powerful feature ensures that you never miss that critical article or DNA sequence To manage agents click on the agent icon in the toolbar An agent has to be set up before it can be used 2 6 1 Creating agents To set up an Agent click the Agents
172. tract E Reverse Complement gt gt a Document View 1 10 20 30 Consensus IMICMIICAM GG GAAG AGA MIIGGGTACO Identity Ce 1 Adam TTCTTTCMTAGG GAAGCAGA TTTGGGTACC MK Ce 2 Harry TTCTTTCATGGG GAAGCAGA TTGGGTACC De 3 Sally TTCTTTCATGGGBAEGAAGCAGA TTTGGGTACC Ce 4 Bob TTCTTTCATGGG GHAGA TTTGGGTACC De 5 Jane TTCTTTCATGGGGMMBAGGCAGAMTTTGGGTACC lt te Alt click on a sequence position or annotation or select a region to zoo Sources 1 of 6 selected O Help v Local 0 Name 4 Description FR Tutorial Help 454 Data 6 COXII CDS Multiple alignment of 51 Cytochrome C O v 2 sample Documents 0 Pairwise protein Pairwise alignment of peptidase from kiw 3D Structures 5 7 People Document 5 sequences from f Alignment View Help Alignments 6 PFam B_7 domai ho ssqience elsa Hoh 7 Three Kingdoms Tabl pf Alanyl tRNA synthe qu ighly Contig Assembly 6 ng able ynthe customizable viewer for protein 7 Transcript varian of 4 variants of MAPK and puialaatida saauanaan seq seq EI lt gt E tres Alignment View Text View Notes Zoo The sequence view lets you zoom in to view individual residues or zoom out to view an entire sequence and all its annotations Buttons for controlling zoom are positioned at the top of the options panel on the right of the sequence view You can also hold Alt and turn the mouse wheel up down t
173. trees sequence translations reverse complements and extraction of sequences Once generated analysis results can be dragged to another location if desired Chapter 5 Custom BLAST Pro only Custom BLAST allows you to create your own custom database from either FASTA files or sequences in your local folders and BLAST against it 5 1 Setting Up The Custom BLAST plugin requires access to NCBI BLAST binary files 5 1 1 Setting up the Custom BLAST files yourself If you want you can download or otherwise acquire the NCBI BLAST binary files outside of Geneious You can download them from here ftp ftp ncbi nih gov blast executables LATEST Choose the appropriate file for your operating system download and extract it You will need to let Geneious know where to look for the files once you have done this To do this go to Tools gt Add Remove Databases Set Up Search Services and select Custom BLAST from the Service drop down box Enter your data location or click Browse to browse to the location of the files 5 1 2 Setting up the Custom BLAST files through Geneious Geneious provides a download manager to help you download and extract the Custom BLAST files To use it go to Tools Tools Add Remove Databases gt Set Up Search Services and select Custom BLAST from the Service drop down box Make sure Let Geneious do the 109 110 CHAPTER 5 CUSTOM BLAST PRO ONLY setup is checked Then click OK After a
174. trees made with AlignX Vector NTI s alignment module e maf pa4 0a4 ea4 and ca6 formats These are the archive formats which Vector NTI uses to export whole databases e cep format This format is produced by the ContigExpress module and Geneious will import seguences including the positions of the base calls traces qualities trimmed regions annotations and editing history for individual reads and contigs 2 2 3 Where does my imported data go The above formats can be all imported into Geneious from local files Geneious also enables you to download certain types of documents directly from public databases such as NCBI and EMBL The method used to retrieve a particular piece of data will determine where in Geneious it is stored Data imported from local files This is imported directly into the currently selected local folder within Geneious If no folder is selected Geneious will open a dialog which lets you specify a folder Data from an NCBI EMBL Contacts search Data downloaded from public databases within Geneious will appear in the Document Table when that database is selected and can be dragged from there into a local folder of your choice Important if you don t drag the documents from a database search into your local folders the results will be lost when Geneious is closed 2 2 4 Data output formats Each data type has several export options Any set of documents may be exported in Geneious native format
175. ts The plus symbol indicates that a folder contains sub folders A minus indicates that the folder has been expanded showing its sub folders Click these symbols to expand or contract folders 15 16 gt o a CHAPTER2 RETRIEVING AND STORING DATA 7 lt Ch y Search Back Forward Sequence Search DeCypher Agents Alignment Tree Assembly Primers Cloning Help Sources 1 of 6 selected Help v Local 0 Name 4 Description s Tutorial Help 454 Data 6 7 COXIICDS Multiple alignment of 51 Cytochrome C O v Sample Documents 0 Pairwise protein Pairwise alignment of peptidase from kiw 3D Structures 5 7 People Document 5 sequences from f Alignment View Help Alignments 6 PFam B_7 domail The an N seguence view is a highly Contig Assembly 6 7 Three Kingdoms Table pf Alanyl tRNA synthe enam Transcript variant of 4 variants of MAPK Sources 20 aa lt gt Tree Documents 4 D Searches 0 G Server Databases amp Collaboration v 2 NCBI 2 BLAST Gene B Genome 2 Nucleotide 2 PopSet E Protein PubMed B snp Structure Taxonomy v P Pfam Not set up E Domains amp UniProt Drar ES Alignment View Text View Notes lt a b E Extract EZ Reverse Complement gt gt pO Document View 1 10 20 30 Consensus IMCIMITCAMGGG GAAG AGA TIIGGGTACC Identity Ce 1 Adam TTCTTTCETMGG Ce 2 Harry TTCT
176. tween 100 8 And 180 8 Optimal Product Size 115 Number of Pairs to Generate 2 More Options Cancel 0K gt Figure 4 7 The primer test dialog There are two ways in which Geneious can test your selection of primers and probes The first option in the dialog tests the chosen set of primers and probes on all selected seguences The check boxes beside each primer and probe can be used to specify if it is being tested The second option tests all combinations of the primers in your database along with any se lected primer seguences as primer pairs on each selected target seguence Primers that are only annotated on a larger seguence are however omitted from this process Warning This option has to test a large number of possible combination so can take a long time to complete All of the same options available for designing primers also apply to testing so if the primers are expected to bind to quite different regions of the test sequences the primer binding region may have to be extended and the target region option can be omitted Click the OK button and testing will commence Once complete a dialog will present the results This dialog tells you how many of the sequences were compatible with the specified primers and probes and provides details and choices very similar to the one described in sec tion 4 6 1 The compatible primers can be annotated onto the sequences in a similar manner to that when designing primers Additionall
177. u to help you manage columns in Geneious Lock Columns locks the state of the columns in the current table so that Geneious will never modify the way the columns are set up You can still change the columns your self however e Save Column State allows you to save the the current state if the columns so you can easily apply it to other tables You can give the state a name and it will then appear in the Load Column State menu e Load Column State contains all of the columns states you have saved Selecting a column state from here will immediately apply that state to the current table and lock the columns to maintain the new state Use Delete Column State to remove unwanted columns states from this menu Note If a Note is added to a document refer to the section on Adding Notes for more in formation a Note column is added to the end of the existing Document table Also when accessing BLAST 1 in Geneious the Document Table has additional columns related to the BLAST search 2 1 3 The Document Viewer Panel The Document Viewer Panel shows the contents of any document clicked on in the Document Table To view large documents it is sometimes better to double click on them This opens a view in a new window In the document viewer panel there are two tabs that are common to most types of documents Text view and Notes Text view shows the document s 2 1 THE MAIN WINDOW 19 information in text format The exce
178. ubleshooting 1 3 1 Geneious won t start Geneious has some minimum system requirements It is compatible with the three most com mon operating systems Windows Mac and Linux Check that you have one of the following 12 CHAPTER 1 GETTING STARTED OS versions before you launch Geneious Operating System System requirements Windows 2000 XP Vista Mac OS 10 4 10 5 Unix Linux Geneious also needs Java 1 5 to run If you do not have this on your system already please download a version of Geneious that includes Java 1 5 from http www geneious com This involves downloading a larger file If you are a Mac user and have OS X 10 4 Tiger run Software Update and make sure you have the latest Java installed 1 3 2 I get a connection error when trying to search using NCBI or EMBL If the message reads Check your connection settings there is a problem with your Internet connection Make sure you are still connected to the Internet Both Dial up and Broadband can disconnect If you are connected then the error message indicates you are behind a proxy server and Geneious has been unable to detect you proxy settings automatically You can fix this problem 1 Check the browser you are using These instructions are for Explorer Safari and Firefox 2 Open your default browser 3 Use the steps in Figure 1 5 for each browser to find the connection settings 4 Now go into Geneious and select Preferences There ar
179. umber of hits to Fetch Retrieve sequences from NCBI vi Retrieve single sequence per hit with COGs info O Retrieve entire cog per hit with COGs info Just give me the COGs info Figure 6 2 Configuring a COGs BLAST 116 CHAPTER 6 COGS BLAST PRO ONLY Chapter 7 Pfam Pro only Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein domains and families The data for Pfam is taken from seguences in UniProt Pfam can be found online at the following locations e Sanger Institute UK e Washington D C USA e Karolinska Institutet Sweden e Institut National de la Recherche Agronomigue France 71 Setting up the Pfam databases At the time of release of Geneious 3 5 there was no public online interface to the Pfam database although there is one in the works at the Sanger Institute For this reason if you want to search the Pfam databases you will need to download them first As of Pfam 22 July 2007 the subset of the Pfam databases used by Geneious totalled about 4GB in size so it is recommended you download them somewhere with a fast connection You can use Geneious to search five of the Pfam databases 1 Pfam A seed 29 MB contains records on the manually curated domains in Pfam A and the seed alignment alignment of a representative subset of all occurrences of this domain in UniProt sequences for each domain 2 Pfam A full 392 MB contains rec
180. usVIRAL PROTEIN VirusVIRAL PROTEIN 1G5G Figure 2 5 Document type search options And Or searches The advanced options lets you search using multiple criteria By clicking the button on right of the search term you can add another search criteria You can remove search criteria by clicking on the appropriate button The Match all any of the following option at the top of the search terms determines how these criteria are combined 34 CHAPTER 2 RETRIEVING AND STORING DATA Match Any requires a match of one or more of your search criteria This is a broad search and results in more matches Match All requires a match all of your search criteria This is a narrow search and results in fewer matches Match all of the following Author 1 contains W Drummond AJ _ Date published is between 3 E Ol Jan 2003 and 33 31 Dec 2005 Create Agent C Search Fewer Options Name Summary FR Choosing appropriate substitution models for the phylogenetic analysis of protein coding seguen SZ choosing appropriate subst Barn Shapiro Andrew Rambaut amp Alexei Drummond 2005 Mol Biol Evol 23 729 0 Tree measures and the number of segregating sites in time structured population samples Roald Forsberg Alexei Drummond amp Jotun Hein 2004 BMC Genet 6 35 Molecular phylogeny of coleoid cephalopods Mollusca Cephalopoda using a multigene approach x effect of data part
181. user to view and edit the contents of folders e Admin allows the user special administrative functions on folders As of this time Geneious only uses the Admin role for the Everybody group By default there is only one group the Everybody group When a user logs in for the first time Geneious will put them into the Everybody group with a role of Edit So this means every user of the server database belongs to this group with a role of Edit unless you enter them into the g_user table beforehand You will want to give yourself the role of Admin for the Everybody group if you want to perform administrative functions within Geneious Unfortunately at this time there is no interface for assigning groups and roles to users So you will need some knowledge of SQL in order to take advantage of this feature You can create groups by adding entries into the g_group table in the database Assign users groups and roles in the table g user_group role It is likely that if you are running in a multi user environment and taking advantage of groups and roles you will want to give only read access of the table g_user_group_role to your users This is so your users can not edit this table with SOL directly as you would do You will also want to add all of your users into g_user manually so Geneious does not think that they are first time users and fail trying to insert them into the
182. y if the primer sequences were not already annotated with a primer annotation they will be annotated during testing 4 6 PCR PRIMERS PRO ONLY 97 4 6 4 Primer Characteristics Convert to Oligo Geneious can convert any number of sequences that are 150 base pairs or fewer in length into primers This operation will also determine the primer characteristics of the sequences such as melting point To do this select your sequences and choose the same Primers action as you do with design or test then choose Convert to Oligo from the popup menu that appears If you select just two sequences you have the additional option of determining their pair characteristics Determining the pair characteristics of two primer sequences can be used to see if two sequences can pair and how well they do so Characteristics for Selection Primer Characteristics can also be determined on a selection in a larger sequence Select a re gion of 150bp or less in the Sequence View and choose Characteristics for Selection The primer characteristics will then be added as an annotation over the exact region that was se lected This will also work on multiple selected regions in the Sequence View Hold the Ctrl key while clicking and dragging to select multiple regions simultaneously 4 6 5 Primer Extensions You can add a primer extension to an existing oligonucleotide Y sequence by selecting Primers Add 5 Extension You can eithe
183. ype they will both appear as searchable fields in the search criteria Filtering Note values can be used to filter the documents being viewed To do so type a value of your Note Type into the Filter Box in the right hand side of the Toolbar Only matching documents will be shown Sorting The fields and values of an added Note Type will appear as columns in the Document Table These new columns can be used to order the table Take the example of protein size A click on the column heading will order the documents in increasing or decreasing order according to their protein size Clicking the column heading again arranges the documents in the opposite order An arrow next to the heading indicates if it is in increasing A or decreasing V order 2 9 Preferences You can access the preferences screen in two ways 1 Shortcut keys Ctrl Shift P Windows Linux 3 Shift P Mac OS X 2 Select the Tools Menu and click Preferences There are several sections in the preferences window which are presented as tabs The most important of these are described below 2 9 1 General This contains connection settings data storage details for your local documents automatic new version checking and a Search History Check for new version of Geneious Enable this to have Geneious check for the release of new versions everytime it is started If a new version has been released Geneious will tell you and give you a link to downlo

Geneious User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents