Pyrosequencing Analysis Protocol for the Detection of the
Contents
1. 5 1 These reference viruses are to be used directly for viral RNA isolation and pyrosequencing This is because virus passage in cell culture can alter the genetic make up of the virus which may affect the pyrosequencing results For example an H275Y variant could revert to a wild type sequence H275 Examples of reference viruses for a particular target may be found in part 1 of section VIII 5 2 biotinylated amplicon is generated using isolated viral RNA in an RT PCR reaction as described in section V 6 Procedure L Gubareva Distribution Copy Effective 04 19 2012 Page 25 of 41 SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq and Prevention CDC Atlanta GA 30333 of HEALTH A 4 6 1 Preparation of Run Sample Sheet and Import into PyroMark ID Platform 6 1 1 Prepare an MS Excel spreadsheet of samples to be tested Figure 1 and save as a text tab delimited file txt 6 2 Setup of Pyrosequencing Reaction See part 6 2 in section VI Pyrosequencing SQA Protocol Using the PyroMark 24 Platform 6 3 Pyrosequencing Using the PyroMark Q24 Equipment and Software 6 3 1 Open PyroMark M 24 software 6 3 2 Import the saved text file into the PyroMark Q24 platform as follows 6 Click on New Run 7 Right Click on the first well 8 Click on Insert Sample Layout File 9 Browse to find the run sample sheet saved as txt2. Atlanta GA 30333 3 File Tool Window gt Oe Er ____ NENNEN Q Example Files 89 Untitled EESAN amna 223 E A H1N1 pdm NA 275 80 Instrument Method v Enter Assay Sample ID and Note 88 A HTNT pdm NA 275 in liis iniu 89 CTGAx14 Plate ID p i Example run j beg H3N1 NA 292 294 59 H3N2 N 119 Reagent ID 88 KRAS 12413 59 p16 Estimated Run Time Run Note lt Add Folder Shortcut Add File Shortcut Figure 3 Example of PyroMark 24 Software Showing an SQA Run Setup L Gubareva Distribution Copy Effective 04 19 2012 Page 21 of 41 SERVICE jS Us 27 E A DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service E Centers for Disease Control ic and Prevention CDC Atlanta GA 30333 3 File Tools Window B8 X M gt Shortcuts E Example Files SQA o OR 50 Dispensations A H1N1 pdm NA 275 2 Assay A H1N1 pdm NA 275 tad A H3N2 NA 113 Dispensation Order S SNP Dispensations BICATG A H1N1 pdm N 275 80 A H1N1 Jpdm NA 223 F6 Expanded Dispensation Order Assay Note Settings Analysis Parameters Quality Quality Control Window Number of Bases 20 4 lt t v Add Folder Shortcut Es Figure 4 Example of Defining an SQA Entry Label Should Face User Figure 5 PyroMark M Q24 Cartridge Setup L Gubareva Distribution Copy Effective 04 19 2012
3. Nuclease free RT PCR grade water Ambion Distilled deionized water Mediatech 5 Procedure 5 1 RNA Isolation RNA isolation procedures should be qualified and validated for recovery and purity before testing specimens Commercially available isolation procedures including QIAamp Viral RNA Mini Kit Qiagen RNeasy Mini Kit Qiagen MagNA Pure Compact RNA Isolation Kit Roche MagNA Pure LC RNA Isolation Kit II Roche and MagNA Pure Total Nucleic Acid Kit Roche have been shown to generate highly purified RNA when following manufacturer s recommended procedures Performance of RT PCR based assays depend on the amount and quality of the RNA sample 5 2 Programming the Thermal Cycler The following program incorporates cDNA synthesis immediately followed by PCR amplification Step 1 Incubate 50 C for 30 minutes Step 2 Denature 94 C for 2 minutes Step 3 Denature 94 C for 15 seconds Step 4 Anneal 55 C for 30 seconds Step 5 Extend 68 C for 1 minute Step 6 Repeat steps 3 5 for 45 cycles Step 7 Extend 68 C for 5 minutes Step 8 Hold 4 C forever 5 3 Preparation of the RT PCR Reaction Mix and Thermal Cycling 5 3 1 Combine the components of the Superscript III One Step RT PCR System to prepare a reaction mix Table 1 For multiple reactions prepare a master mix with some excess of reagent to allow for controls and pipetting error For example for 96 samples prepare a master mix for 100 samples
4. beads PyroMark Binding Buffer Annealing Buffer Denaturation Solution 1X Wash Buffer and 70 Ethanol from 4 C storage and place at room temperature Note Dilute PyroMark 10X Wash Buffer in distilled deionized water 1 10 to make the working solution of wash buffer listed above Dilute 96 ethanol to 70 ethanol by combining 700 ml of 96 ethanol and 280 ml of distilled deionized water L Gubareva Distribution Copy Effective 04 19 2012 Page 11 of 41 SERVICE SM Us EA x or H Tha C e L Gubareva DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service 6 2 3 6 2 10 6 2 11 Centers for Disease Control and Prevention CDC Atlanta GA 30333 When at room temperature prepare binding buffer solution 60 ul of binding buffer solution 1s needed per sample For 24 samples combine 2 ml Binding Buffer 1 ml distilled deionized water and 150 ul Streptavidin Sepharose beads resuspend beads by inverting in a 15 ml conical tube Briefly mix the binding buffer solution by inverting Aliquot 60 ul of the binding buffer solution into the wells of a 24 well PCR plate that will be used for pyrosequencing the RT PCR product Transfer 20ul of RT PCR product into the respective wells of the 24 well PCR plate containing binding buffer solution Cover the plate with a plastic adhesive cover place on an orbital plate shaker and agitate at 1400 rpm for at least 10 minutes Allow the plate to continue shaking u
5. in Step 6 1 1 10 Click Open 6 3 3 In the drop down Instrument Method menu select Q24 Method 000X The specific number for X should match what 15 on the reagent cartridge to be used Instructions for the setup of a new instrument parameter are provided with the reagent cartridge 6 3 4 Select a dispensation entry 6 3 4 Go to the Shortcuts tab and under the SNP Dispensations folder click to select the dispensation order Figure 3 6 3 4 2 If the target specific entry is not in the SNP Dispensation folder under the Shortcuts folder then create a new SNP entry To create a new SNP referred to as AQ by the software entry right click on the SNP Dispensations folder go to New Assay and click on AQ Assay Enter the name A HINI pdm09 NA275 Under the Dispensation Order box enter the sequence to be analyzed ATC TACTAT The generated dispensation should be visible under the Expanded Dispensation Order box Figure 4 L Gubareva Distribution Copy Effective 04 19 2012 Page 26 of 41 of HEALTH A 4 SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq and Prevention CDC Atlanta GA 30333 Note Because of the natural genetic variability of the influenza virus genome SNP analysis can be affected if mutations occur in the region near the site of analysis Such mutations are rare but will caus
6. provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities This additional document to the pyrosequencing protocol is for the detection of the H5 Y substitution at position 275 in the NA of A HINI pdm09 influenza viruses These RT PCR and pyrosequencing primers will generate sequences for pre pandemic A H1NI viruses as well The specific single nucleotide changes that are associated with the amino acid substitution H275Y in the NA are H CAC Y TAC for the A HIN1 pdm09 or H CAT Y TAT for the pre pandemic A HIN1 The pyrograms and the IdentiFire library provided in this section contains sequences for both A HINI pdm09 and A H1NI viruses so their sequences may be distinguished 1 Reference Viruses Below are examples of reference viruses carrying histidine H or tyrosine Y at position 275 which may be used in the NA 275 pyrosequencing assay Reference Subtype Variant A California 07 2009 A HINI pdm09 H275 A Washington 29 2009 A HINI pdm09 H275Y A North Carolina 39 2009 A HINI pdm09 H275Y A Washington 10 2008 HINI H275 A Florida 21 2008 HINI H275Y L Gubareva Distribution Copy Effective 04 19 2012 Page 38 of 41 m ge Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 SM K DEPARTMENT OF HEALTH amp HUMAN SE
7. 0 6 Run Setup Untitled PEE 3 File Tool Window Help amp x 5 3 V i Shortcuts Example Files HLJ 50 Dispensations gl Run Nam E 1 1 223 647 prim i eed B A H1N1 pdm NA 275 795 prime Instrument Method PyroMark 024 Method 003 v A1 B A H1N1 pdm NA 275 804 prime Plate ID Type AQ CS ENEDPTTNIENEENESI Pen e CK Doo Mnt 88 B NA273 Barcode Sample 10 1 a B N D1397N v 2 E SS Run Setup Well Information Sequence to T ACTATGAGG 889 BNAI22IT v 3 Estimated Run Time 88 B NA221T v 4 Run Note Dispensation 5 1c CTA Order amp Add Folder Shortcut Add File Shortcut Figure 3 Example of PyroMark Q24 Software Showing a SNP Run Setup L Gubareva Distribution Copy Effective 04 19 2012 Page 33 of 41 DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 ap PyroMark 024 2 0 6 AQ Assay G SNP Dispensations A H1N1 pdm NA 275 804 primer 3 File Tool Window 2M Ge id LJ Shortcuts 3 Example Files H SQA Dispensations 5 09 SNP Dispensations 88 A HTNT pdm NA 223 F6 E A HTNT pdm NA 275 79 A HTN1 pdm NA 275 80 A HTNT pdm N 275 80 B N 273 B NA D197N v 2 B NA4221T v 1 B N 4221T v 2 B N 4221T v 3 EJ B N 4221T v 4 B N 4221V v 1 B N 4221V v 2 B
8. A HINI pdm09 wildtype H275 T822C with a silent mutation at nucleotide 822 and pre pandemic HINI wildtype H275 with silent mutations for amino acids 279 and 280 gt A H1IN1 pdm09 wildtype H275 ATCACTATGAGGAATGCTCC gt A H1IN1 pdm09 variant H275Y ATTACTATGAGGAATGCTCC gt A HIN1 pdm09 wildtype H275 T822C ACCACTATGAGGAATGCTCC gt A HIN1 pdm09 variant H275Y T822C ACTACTATGAGGAATGCTCC gt Pre pandemic HINI wildtype H275 TTCATTATGAGGAATGCTCT gt Pre pandemic HIN 1 wildtype H275 TTCATTATGAGGAATGTTCC gt Pre pandemic HINI variant H275Y TTTATTATGAGGAATGCTCT gt Pre pandemic HINI variant H275Y TTTATTATGAGGAATGTTCT gt Pre pandemic HINI variant H275Y TTTATTATGAGGAATGTTCC Effective 04 19 2012 L Gubareva Distribution Copy Page 40 of 41 SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq and Prevention CDC Atlanta GA 30333 of HEALTH t IX References Deyde V M and L V Gubareva Influenza genome analysis using pyrosequencing method current applications for a moving target Expert Review of Molecular Diagnostics 2009 9 5 493 509 Deyde V M T Nguyen R A Bright A Balish B Shu S Lindstrom A I Klimov and L V Gubareva Detection of molecular markers of antiviral resistance in influenza A H5NI viruses using a pyrosequencing method Antimicrob Agents Chemother 2009 53 3 1039 1047 Deyde V
9. Ethanol Fisher 15 ml Falcon conical tubes Fisher Plastic Falcon pipettes and Pipette Aid Fisher Assorted pipettes and pipette tips Rainin 24 well plastic PCR reaction plates Fisher Distilled deionized water Mediatech Nuclease free water Ambion Plastic troughs trays for sample clean up Qiagen Filter probes for Vacuum prep tool Qiagen Plastic bottles for preparing buffers and reagents Nalgene 5 Reference Viruses and Biotinylated Amplicon Template 5 1 These reference viruses are to be used directly for viral RNA isolation and pyrosequencing This is because virus passage in cell culture can alter the genetic make up of the virus which may affect the pyrosequencing results For example an H275Y variant could revert to a wildtype sequence H275 Examples of reference viruses for this target may be found in part 1 of section VIII 5 2 biotinylated amplicon 15 generated using isolated viral RNA in an RT PCR reaction with its corresponding primers as described in section V and section VIII 6 Procedure 6 1 Preparation of Run Sample Sheet and Import into PyroMark ID Platform 6 1 1 Prepare an MS Excel spreadsheet of samples to be tested Figure 1 and save as a text tab delimited file txt 6 2 Setup of Pyrosequencing Reaction 6 2 1 Set the digital heat block to 89 C place the Q24 Sample Prep Thermoplate holder upon the heat block and allow the plate to heat to 89 C 6 2 2 Remove the Streptavidin Sepharose
10. L Gubareva Distribution Copy Effective 04 19 2012 Page 7 of 41 SERVICES SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 or HEALTY A amp 5 3 1 1 If using 50 ul reaction volume aliquot 45 ul of the master mix into the wells of a 96 well PCR plate or into 0 2 ml PCR tubes on a cold block Add 5 ul of RNA from test and reference viruses in the corresponding well tube Close wells on the plate with stripped caps or foil and close tubes with caps 5 3 1 2 using a 25 ul reaction volume Table 1 combine 22 5 ul of the master mix with 2 5 ul viral RNA 5 3 2 Briefly centrifuge to ensure that all of the components are at the bottom of the amplification tube 5 3 3 Place the plate tubes in the thermal cycler and run the RT PCR program see 5 2 5 3 4 Analysis of the RT PCR product should be made by gel electrophoresis to determine the production of an amplicon of the appropriate length L Gubareva Distribution Copy Effective 04 19 2012 Page 8 of 41 SERVICES SS Us A DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service gt Centers for Disease Control g and Prevention CDC Atlanta GA 30333 HEAL TH C e Table 1 RT PCR Reaction Components Component Reaction Reaction 50 ul volume 25 ul volume 2X Reaction Mix Forward Primer 20 uM Reverse Primer 20 u M
11. N 4221V v 3 B N 4221V v 4 B N 4221V v 6 B N R150K EJ H5 M2 lt gt Add Folder Shortcut Add File Shortcut Help Em Assay Setup Assay A HTNT1 pdm N 275 804 primer Sequence to Analyze AT C TACTATGAGG PN Generate Dispensation Order Dispensation Order Histogram Assay Note Variable Positions Analysis Parameters Position Name Type Analyze 1 Pos 1 SNP Revert to Default Show Change Log Figure 4 Example of Defining a SNP Entry L Gubareva Distribution Copy Effective 04 19 2012 Page 34 of 41 SERVICE SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 of HEALTH i t Al ATC TACTATGAGG A2 4CC TACTATGAGG Figure 5 SNP Results for NA H275 with a Silent Mutation at Nucleic Acid Position 822 A Analysis using the dispensation generated for the major circulating virus variant ATT CATTA B Analysis using the dispensation generated for the silent virus variant ACT CATTA Label Should Face User Figure 6 PyroMark Q24 Cartridge Setup L Gubareva Distribution Copy Effective 04 19 2012 Page 35 of 41 SERVICE SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control P and Prevention CDC of HEALTH 4 4 Atl
12. Public Health Service K Centers for Disease Control oF HEALTH 4 4 and Prevention CDC Atlanta GA 30333 83 Bookl Microsoft Excel 2 x Home Insert Layout Formulas Data Review View e x E m r Li EJ T T eee d g f or d Delete Bie unl eias A 40 00 Conditional Format Cell y Sot amp Find amp Formatting as Table Styles Format 22 Filter Select Font fa Number iti 1 B C D E F G H J K L N E Sample ID Note 1 275 2 275 3 275 4 275 5 275 7 275 8 275 9 275 10 275 11 275 12 275 13 275 14 275 15 275 16 275 17 275 18 275 19 275 20 275 21 275 22 275 Mock 275 cs Neg 275 M Sheeti Sheet2 Sheet3 2 Ready Figure 1 Example of a Run Sample Sheet for PyroMark 24 Platform L Gubareva Distribution Copy Effective 04 19 2012 Page 31 of 41 ERVIC Y S Es 7 Public Health Service Centers for Disease Control and Prevention CDC DEPARTMENT OF HEALTH amp HUMAN SERVICES Atlanta GA 30333 Denaturation 1X Wash Solution Buffer Figure 2 The PyroMark Q24 Vacuum Prep Workstation Effective 04 19 2012 Distribution Copy L Gubareva Page 32 of 41 S E DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service p Centers for Disease Control 79 and Prevention CDC Atlanta GA 30333 EP PyroMark 024 2
13. Pump Laboport Orbital Plate Shaker Labnet Digital Heat Block VWR 4 Reagents and Supplies Sequencing primer Stocks of 100 uM in aliquots of 20 ul should be stored at 20 C L Gubareva Distribution Copy Effective 04 19 2012 Page 24 of 41 SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq of HEALTH A 4 and Prevention CDC Atlanta GA 30333 The sequence of the primer can be found in section VIII part 2 The primer sequence is provided for synthesis by the testing lab group Streptavidin Sepharose High Performance beads GE Healthcare PyroMark Binding Buffer Qiagen PyroMark Annealing Buffer Qiagen PyroMark Denaturation Solution Qiagen PyroMark 10X Wash Buffer Tris Acetate Qiagen Pyro Gold Reagents Qiagen Note Buffers Sepharose Beads and PyroGold Reagents should be stored at 4 C PyroMark 24 Plate 24 well clear plastic plates Qiagen 96 Ethanol Fisher 15 ml Falcon conical tubes Fisher Plastic Falcon pipettes and Pipette Aid Fisher Assorted pipettes and pipette tips Rainin 24 well plastic PCR reaction plates Fisher Distilled deionized water Mediatech Nuclease free water Ambion Plastic troughs trays for sample clean up Qiagen Filter probes for Vacuum prep tool Qiagen Plastic bottles for preparing buffers and reagents Nalgene 5 Reference Viruses and Biotinylated Amplicon Template
14. tool and turn ON the vacuum Flush until the tray is almost emptied 1 2 minutes Turn the vacuum OFF Remove the reagent trays from the Vacuum Prep Workstation discard excess solutions and rinse the reagent trays with distilled deionized water Set the reagent trays upon paper towels on the bench to dry When the Pyrosequencing run is finished remove and discard the 24 well clear plastic plate from the PyroMark Q24 instrument Remove the cartridge from the PyroMark M 24 instrument and discard unused enzyme substrate and nucleotides Wash the cartridge at least 3 times with distilled deionized water and check to make sure that all dispensation pins are clean by applying pressure to the top of each of the channels in the cartridge see Note for 6 3 10 Analysis of Pyrosequencing Data 6 5 1 6 5 2 When the SQA run is complete remove the USB stick and copy the finished run onto your computer Note The icon for a completed run file is a blue check and will replace the ereen icon which denotes a run setup that has not yet been run Reopen the run in the PyroMark 024 software to reveal the SQA analysis window Figure 6 Distribution Copy Effective 04 19 2012 Page 15 of 41 of HEALTH t 6 6 L Gubareva SERVICE ST Ys DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq 6 5 3 6 5 4 6 5 5 and Prevention CDC Atlanta GA 30333 Under t
15. M M Okomo Adhiambo T G Sheu T R Wallis A Fry N Dharan A I Klimov and L V Gubareva Pyrosequencing as a tool to detect molecular markers of resistance to neuraminidase inhibitors 1n seasonal influenza A viruses Antiviral Res 2009 81 1 16 24 Deyde V M T G Sheu A A Trujillo M Okomo Adhiambo R Garten A I Klimov and L V Gubareva Detection of molecular markers of drug resistance in 2009 pandemic influenza A HINI viruses by pyrosequencing Antimicrob Agents Chemother 2010 54 3 1102 1110 Sheu T G V M Deyde R J Garten A I Klimov L V Gubareva Detection of antiviral resistance and genetic lineage markers in influenza B virus neuraminidase using pyrosequencing Antiviral Research 2010 85 2 354 360 If you have a technical question about this SOP you may contact the CDC Molecular Epidemiology Team Influenza Division at fluantiviral cdc gov L Gubareva Distribution Copy Effective 04 19 2012 Page 41 of 41
16. Page 22 of 41 Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 DEPARTMENT OF HEALTH amp HUMAN SERVICES Shortcuts Example Files SOA Dispensations H SNP Dispensations S C T G C T GC T G C A T G C T G 5 10 15 20 C 4 T G C T G C T G C T G C T G 5 10 15 20 Add Folder Shortcut Add File Shortcut L Gubareva Figure 6 Example of an SQA Run Analysis Distribution Copy Effective 04 19 2012 Assay H1N1pdm NA 275 Sample ID 2 Note 275 Page 23 of 41 SERVICE ST Ys DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq of HEALTH t and Prevention CDC Atlanta GA 30333 VII Pyrosequencing for Single Nucleotide Polymorphism SNP Analysis Protocol Using the PyroMark M Q24 Platform NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities Analysis of samples using the SNP assay requires knowledge of the sequence To assure that there is no natural variation within the targeted sequence it is recommended that the SQA assay be run first Moreover compared to SQA SNP analysis is more susceptible to interference by various factors e g quality of RT PCR product background
17. QA To create a new SQA entry right click on the SQA Dispensations folder go to New Assay and click on SQA Assay Enter the name found in part 4 of section VIII Under the Dispensation Order box enter in the sequence found in part 5 of section VIII The sequence should be visible under the Expanded dispensation order box Figure 4 In the New Run Setup highlight all the wells that are to be used and drag the dispensation order to the wells The name of the entry should now appear in these wells Click the Tools tab to reveal a drop down menu Select Pre Run Information to see the volumes of the enzyme E substrate S and nucleotides A C G and T that need to be added to the cartridge Save the run onto a USB drive Remove the PyroGold reagent kit from 4 C storage Reconstitute both the enzyme E and the substrate S in 620 ul nuclease free water Swirl to mix DO NOT vortex The reconstituted enzyme E and the substrate S are stable for at least 5 days at 4 C or for one freeze 20 C thaw cycle Ensure that the dispensation pins needles on the cartridge are clean and not bent before use To do so fill each channel in the cartridge with distilled deionized water seal the channel and apply pressure Water should stream straaght down out of the pin Remove the excess water and add the corresponding amount of enzyme substrate and nucleotides see 6 3 6 into each channel of the ca
18. RVICES 2 Primers Table 1 RT PCR Primers GGG GAA GAT TGT YAA ATC AGT YGA 20uM 20 uM Forward sw N1 F780 Reverse sw N1 R1273 biot Biot CWA AGA ARC GYC TTA EA C e TG Table 2 Sequencing Primer for amino acid at position 275 in the NA Concentration Sequence 5 3 Primer Sequence sw N1 275 F804 GAA TGC MCC TAA TT RT PCR Product 3 20 ul of RT PCR product should be added to the respective wells of the plate containing the binding buffer solution Target Entry Name A HIN1 pdm09 NA 275 Dispensation Order for SQA 5 CATG CATGCATGCATGCATGCATG should be visible under the expanded dispensation order window Page 39 of 41 Effective 04 19 2012 L Gubareva Distribution Copy Public Health Service ps b Centers for Disease Control EA of n Tha C t QS Ky K DEPARTMENT OF HEALTH amp HUMAN SERVICES and Prevention CDC Atlanta GA 30333 6 Viruses IdentiFire Library for Y275 Detection in Pandemic and Pre pandemic Influenza In the library below a few examples of possible sequences are provided Examples A HINI pdm09 wildtype H275 means the virus is a 2009 pandemic A HIN1 6 1 carrying histidine at position 275 A HINI pdm09 variant Y275 means the virus 15 a 2009 pandemic A HINI carrying the Y275 substitution etc The below library also includes additional sequences containing silent mutations For 6 2 example
19. SuperScript III High Fidelity Enzyme Mix RNAse Inhibitor Nuclease Free Water Template RNA Total Note One of the RT PCR primers used is biotinylated refer to the section VIII part 2 6 Other SOP s and Documents User s Guide for Superscript III One Step RT PCR System with Platinum Taq High Fidelity L Gubareva Distribution Copy Effective 04 19 2012 Page 9 of 41 SERVICE SS Us f DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service gt Centers for Disease Control or HEALTY A amp and Prevention CDC Atlanta GA 30333 VI Pyrosequencing SQA Protocol Using the PyroMark Q24 Platform NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities When the presence of the H275Y variant is detected it is suggested that the SNP analysis be run which allows for allele quantification proportion of H275 and H275Y variants C or T at nt823 of NA gene respectively Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol describes the pyrosequencing assay that 1s used for partial sequencing of the biotinylated amplicon generated in RT PCR This protocol is to be used in conjunction with the Reverse Transcr
20. U K DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control yaq of HEALTH 4 3 and Prevention CDC Atlanta GA 30333 OF Bookl Microsoft Excel ox Home Insert Page Layout Formulas Data Review View Calibri uno ee oe rd Conditional Format Cell y Sor amp Find amp Formatting as Table Styles Format lt 27 Filter Select B C D G H K L N Sample ID Note 1 275 2 275 3 275 4 275 5 275 6 275 275 8 275 9 275 10 275 11 275 12 275 13 275 14 275 15 275 16 275 17 275 18 275 19 275 20 275 21 275 22 275 Mock 275 25 Neg 275 M 4 gt M Sheeti Sheet2 Sheet3 2 Figure 1 Example of a Run Sample Sheet for PyroMark 24 Platform L Gubareva Distribution Copy Effective 04 19 2012 Page 19 of 41 ERVIC Y S Es 7 DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 Denaturation 1X Wash Solution Buffer Figure 2 The PyroMark Q24 Vacuum Prep Workstation Effective 04 19 2012 Distribution Copy L Gubareva Page 20 of 41 SERVICE Sew Us X A E DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service e LS OO ODDO Centers for Disease Control 7 and Prevention CDC
21. World Health Organization Pyrosequencing Analysis Protocol for the Detection of the Substitution at Residue 275 in the Neuraminidase of 2009 Pandemic HINI Viruses Using the PyroMark Q24 Platform November 2012 The WHO Collaborating Centre for the Surveillance Epidemiology and Control of Influenza at the Centers for Disease Control and Prevention CDC Atlanta United States of America has made available this protocol for antiviral susceptibility testing of influenza A HIN1 pdm09 SS dic DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control i and Prevention CDC Atlanta GA 30333 of HEALTH t Pyrosequencing Analysis Protocol for the Detection of the Substitution at Residue 275 in the Neuraminidase of 2009 Pandemic H1N1 Viruses Using the PyroMark Q24 Platform Prepared by Molecular Epidemiology Team Virus Surveillance and Diagnosis Branch Influenza Division National Center for Immunization and Respiratory Diseases Centers for Disease Control and Prevention L Gubareva Distribution Copy Effective 04 19 2012 Page 1 of 41 or HEALTY A amp SERVICE SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 Table of Contents II VII VIII IX Introduction Pyrosequencing Assay Flow Chart Safety Information Ab
22. anta GA 30333 ap PyroMark 024 2 0 6 AQ Run Analysis E T raining Runs 08232011 Kat s Samples pyrorun aed 3 File Tools Reports Window Help ZM OG 9 pao J B Shortcuts AQ Example Files SOA Dispensations Analysis Overview Analysis Setup SNP Dispensations Well Information A6 Assay A H1N1 pdm NA 275 804 primer Sample ID 3 Note 275 Note Add Folder Shortcut Add File Shortcut Figure 7 Example of a Completed SNP Run L Gubareva Distribution Copy Effective 04 19 2012 Page 36 of 41 SERVICE jS Us aS E 2 DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service L Centers for Disease Control and Prevention CDC Atlanta GA 30333 Analysis result Well Al Assay A HINI pdm NA 275 804 primer Sample ID 3 Note Analysis version 2 0 6 Figure 8 Example of a Report in SNP Mode Analvsis result Well Al Assay A HINI pdm NA 275 804 primer Sample ID 3 Mote Analysis version 2 0 6 Figure 9 Example of a Report in AQ Mode L Gubareva Distribution Copy Effective 04 19 2012 Page 37 of 41 SERVICE ST Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 EA x or H Tha C QS VIII Reference Material NOTES This document may not be used as a standalone document This document is
23. breviations Reverse Transcription Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA This protocol describes the RT PCR procedures used for cDNA synthesis and amplification of influenza virus RNA isolated from clinical specimens or grown viral isolates Pyrosequencing Sequence Analysis SQA Protocol Using the PyroMark M Q24 Platform This protocol describes the pyrosequencing assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR Pyrosequencing Single Nucleotide Polymorphism SNP Analysis Protocol Using the PyroMark Q24 Platform This protocol describes the pyrosequencing SNP assay that 15 used for partial sequencing of the biotinylated amplicon generated in RT PCR Reference Material This document contains the reference viruses RT PCR and sequencing primers amount of RT PCR product needed for pyrosequencing name of the target dispensation order pyrogram examples and a sequence library References L Gubareva Distribution Copy Effective 04 19 2012 Page 2 of 41 Page 10 25 39 42 SERVICES SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 of HEALTH t I Introduction For the prophylaxis and treatment of influenza A virus infections there are currently two classes of drugs that are available M2 bl
24. cartridge issues etc Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol 1s to be used in conjunction with the Reverse Transcription Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA section V Pyrosequencing SQA Protocol Using the PyroMark M Q24 ID Platform section VI and Reference Material section VIII This protocol describes the pyrosequencing assay that is used for partial sequencing of the biotinylated amplicon generated in RT PCR to detect and quantify the ratio of wildtype and mutant variants in a viral population The single nucleotide polymorphism SNP and allele quantification AQ analyses are done at nucleotide 823 the first nucleotide of codon CAC of the neuraminidase NA gene of the A HINI pdm viruses Cytosine C at the first position is present in the wildtype viruses carrying histidine at position 275 in the NA protein whereas thymine T at this position 1s present in variant viruses carrying tyrosine at position 275 in the NA protein 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment PyroMark 24 Instrument Qiagen PyroMark Q24 Vacuum Prep Workstation and Hand Tool Qiagen Q24 Sample Prep Thermoplate Qiagen Vacuum
25. dentiFire library can be changed to the users preference When the IdentiFire library is used any mutations within the target region that were not in the sequences of the reference library will be identified by the software as mismatched sequences and the closest matches will be shown Because the PyroMark Q24 platform has limitations it is suggested that each pyrogram be examined and verified visually One such limitation is that if the target sequence contains repeats of more than four or five identical nucleotides the pyrogram peak heights may no longer be directly proportional to the number of nucleotides In such cases the software may overcall or miscall the nucleotide in the final sequence results Both the PyroMark Q24 and the IdentiFire software will not be able to detect mixtures e g H Y at 275 Mixtures must be verified visually As the virus evolves the IdentiFire library sequences and primers may need to be updated 8 Other SOPs and Documents PyroMark M Q24 User s Manual Index of Figures Figure 1 Example of a Run Sample Sheet for PyroMark 24 Platform Figure 2 The PyroMark Q24 Vacuum Prep Workstation Figure 3 Example of PyroMark Q24 Software Showing an SQA Run Setup Figure 4 Example of Defining an SQA Entry Figure 5 PyroMark Q24 Cartridge Setup Figure 6 Example of an SQA Run Analysis L Gubareva Distribution Copy Effective 04 19 2012 Page 18 of 41 SERVICES S
26. e The complementary strand synthesized from the non biotinylated primer will be washed away 6 2 14 With the vacuum still ON transfer the Prep Tool into the reagent tray with 1X Wash Buffer and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool for 30 40 seconds 6 2 15 Turn the vacuum OFF and disconnect the Prep Tool from the vacuum line Place the Prep Tool into the 25 well clear plastic plate containing annealing buffer solution including sequencing primer Move the Prep Tool in circular motions 15 25 seconds in the 24 well clear plastic plate to release beads bound to the single stranded template Note The mixture on the plate should now appear cloudy and the white concave substance should no longer be present on the tips of the probes 6 2 16 Denaturation of template primer mixture Place the 24 well clear plastic plate onto the Q24 Sample Prep Thermoplate holder on the 89 C heat block for 4 minutes Do not leave the 24 well clear plastic plate on the heat block for more than 4 minutes 6 2 17 Annealing template and primer Remove the Q24 Sample Prep Thermoplate holder with the 24 well clear plastic plate from the 89 C heat block and allow it to cool on a bench for 10 minutes 6 2 18 Remove the 24 well clear plastic plate from the Q24 Sample Prep Thermoplate holder and allow it to rest directly on the bench for an additional 4 minutes to end the annealing step Note During the 10 minutes wh
27. e Vacuum Prep Workstation Gently remove plastic adhesive cover from plate to avoid splashing With the vacuum ON as described in Step 6 2 9 place the Prep Tool into the respective wells of the 24 well PCR plate until the entire volume has been collected 5 10 seconds The Streptavidin Sepharose beads with immobilized amplicons will be captured on the tips of the respective filter probes of the Prep Tool and will be visible Note The tips of the probes are white like the beads The captured beads will appear as a concave white substance on the tips of the probes Distribution Copy Effective 04 19 2012 Page 12 of 41 SERVICE ST Ys EA x or H Tha C QS 6 3 L Gubareva DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 6 2 12 With the vacuum still ON transfer the Prep Tool into the reagent tray containing 70 ethanol and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool This step allows any unbound amplicon or unincorporated reagents from the RT PCR reaction to be washed off 6 2 13 With the vacuum still ON transfer the Prep Tool into the reagent tray containing Denaturation Solution and flush until the tray is almost emptied 15 25 seconds then lift to drain the tool This step allows for the denaturation of the double stranded DNA amplicon containing a biotin tagged single stranded DNA templat
28. e the sample to fail for example a virus variant with the silent mutation at nucleotide position 822 T C of the NA gene If a sample with this mutation is determined by SQA the SNP analysis should be done with the following variant sequence ACC TACTAT Figure 5B The result will be inconclusive if such a variant is tested in SNP with the dispensation order generated for the major circulating virus variant ATC TACTAT Figure 5A L Gubareva 6 3 5 6 3 6 6 3 7 6 3 8 6 3 9 6 3 10 6 3 11 6 3 12 6 3 13 6 3 14 On the New Run Setup highlight all the wells that are to be used and drag the dispensation order to the wells The name of the entry should now appear in these wells Click the Tools tab to reveal a drop down menu Select Pre Run Information to see the volumes of the enzyme E substrate S and nucleotides A C G and T that need to be added to the cartridge Copy the run on a USB stick Remove the PyroGold reagent kit from 4 C storage Reconstitute both the enzyme E and the substrate S in 620 ul nuclease free water Swirl to mix DO NOT vortex The reconstituted enzyme E and the substrate S are stable for at least 5 days at 4 C or for one freeze 20 C thaw cycle Ensure that the dispensation pins needles on the cartridge are clean and not bent before use To do so fill each channel in the cartridge with distilled deionized water seal the channel and apply pressure Wate
29. ealth Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 of HEALTH t IV Abbreviations A H1NI1 pdm09 the 2009 A HINI pandemic influenza virus A HINI the pre pandemic A HINI influenza virus AQ allele quantification dNTP deoxyribonucleotide triphosphate histidine NA neuraminidase PPi pyrophosphate RT PCR reverse transcription polymerase chain reaction SNP single nucleotide polymorphism SQA sequence analysis Y tyrosine NA amino acid numbering by NA subtype H275 H274 L Gubareva Distribution Copy Effective 04 19 2012 Page 5 of 41 SERVICES SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 or HEALTY A amp V Reverse Transcription Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA NOTES This procedure is provided for Research Use Only These protocols are not intended to be used for commercial development or for profit testing Please do not distribute these procedures to other laboratories or commercial entities Names of vendors or manufacturers are provided as examples of suitable product sources only Inclusion does not imply endorsement 1 Purpose This protocol describes the RT PCR procedures used for cDNA synthesis and amplification of influenza v
30. en the plate on the holder is cooling Step 6 2 17 Steps 6 3 1 through 6 3 11 can be completed Pyrosequencing Using the PyroMark Q24 Equipment and Software 6 3 1 Open PyroMark 24 software 6 3 2 Import the saved text file into the PyroMark Q24 platform as follows 1 Click on New Run 2 Right Click on the first well Distribution Copy Effective 04 19 2012 Page 13 of 41 of HEALTH A 4 L Gubareva SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq 6 3 3 6 3 4 6 3 5 6 3 6 6 3 7 6 3 8 6 3 9 6 3 10 and Prevention CDC Atlanta GA 30333 3 Click on Insert Sample Layout File 4 Browse to find the run sample sheet saved as txt in Step 6 1 1 5 Click Open In the drop down Instrument Method menu select PyroMark Q24 Method 000X The specific number for X should match what is on the reagent cartridge to be used Instructions for the setup of a new instrument parameter are provided with the reagent cartridge Select a dispensation entry 6 3 4 1 Go to the Shortcuts folder in the SQA Dispensations folder click to select the dispensation order Figure 3 Note SQA Dispensations folder needs to be created prior to this step 6 3 4 2 target specific entry is not in SQA Dispensation folder found under the Shortcuts folder then create a new S
31. he Analyze option select Analyze All Wells to analyze all the samples in the run To analyze only the wells of interest first highlight the wells you wish to analyze and then click Analyze Selected Wells When analysis is complete click Save To report a run under the Report tab select the SQA Full Report This will generate a document containing pyrograms and the results of the analysis Note It is CRITICAL that each pyrogram be examined and verified visually see examples of pyrograms in 6 7 Data Analysis Using IdentiFire M Software 6 6 1 6 6 2 6 6 3 6 6 4 6 6 5 In the PyroMark M Q24 software under the Tools tab click Export As FASTA and save the file Prior to IdentiFire analysis copy the IdentiFire Library found in part 6 of section VIII containing the pyrosequencing target region of interest wildtype and variant genotypes and paste into a new MS Word file save as a text txt Open IdentiFire software Under the Sequence Input select the Sequence File tab Find and select the run to be analyzed To analyze all samples in the run click Add all To analyze only selected samples highlight samples of interest and click Under Analysis Setup select the corresponding library created in Step 6 6 2 in the Sequence Library drop down or select Browse to locate where the library is saved Click on Add to Select the pla
32. howing the common target sequences EA C e 6 6 1 Detection of A HIN1 pdm09 wildtype H275 CAC TAT Be CAC wildtype H275 I 0 2 Detection of A HINI pdm09 variant H275Y AT TAC TAT 1 ATC TACTATGAGG 3 Detection of ACH1N1 pdm09 mixture H275H Y AT C T AC TAT T C TAC mixture H275H Y A6 ATC TACTATGAGG Page 29 of 41 Effective 04 19 2012 L Gubareva Distribution Copy SERVICE ST Ys DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control x or H Tha C QS and Prevention CDC Atlanta GA 30333 Ky 7 Notes See notes in part 7 in section VI Pyrosequencing SQA Protocol Using the PyroMark Q24 ID Platform 8 Other SOPs and Documents PyroMark M 24 User s Manual Index of Figures Figure 1 Example of a Run Sample Sheet for PyroMark 24 Platform Figure 2 The PyroMark Q24 Vacuum Prep Workstation Figure 3 Example of PyroMark Q24 Software Showing a SNP Run Setup Figure 4 Example of Defining a SNP Entry Figure 5 SNP Results for NA H275 With a Silent Mutation at Nucleic Acid Position 822 Figure 6 PyroMark Q24 Cartridge Setup Figure 7 Example of a Completed SNP Run Figure 8 Example of a Report in SNP Mode Figure 9 Example of a Report in AQ Mode L Gubareva Distribution Copy Effective 04 19 2012 Page 30 of 41 SERVICES we K DEPARTMENT OF HEALTH amp HUMAN SERVICES
33. ignal produced is proportional to the amount of pyrophosphate that 1s released upon nucleotide incorporation making it a quantitative analysis Accurate quantitative analysis together with other characteristics makes the pyrosequencing method a desirable for the detection of influenza molecular markers associated with resistance to antiviral drugs Pyrosequencing technology on the Biotage QIAGEN platform is better suited for the analysis of short sequences sequencing up to 100 nucleotides accurately The quantitative analysis of nucleotide incorporation allows for an accurate SNP analysis enabling the detection of minor variants present at 10 or lower In one pyrosequencing run it is possible to analyze up to 96 samples PyroMark Q96 which is valuable in the high throughput screening for molecular markers associated with drug resistance This method 1s also less laborious than the conventional Sanger sequencing and preparation of the pyrosequencing reactions with RT PCR template along with the pyrosequencing run may be completed within 1 5 2 hours The pyrosequencing reaction In the pyrosequencing reaction biotinylated single stranded DNA templates are bound to Streptavidin Sepharose beads in a solution containing enzymes and substrates DNA polymerase assists in the incorporation of a dispensed deoxyribonucleotide triphosphate dNTP into the DNA resulting in the release of pyrophosphate PPi The PPi is then converted into ATP via ATP sulf
34. iption Polymerase Chain Reaction RT PCR Protocol for the Generation of an Amplicon from Influenza Virus RNA section V and Reference Material section VIII 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment PyroMark Q24 Instrument Qiagen PyroMark Q24 Vacuum Prep Workstation and Hand Tool Qiagen Q24 Sample Prep Thermoplate Qiagen Vacuum Pump Laboport Orbital Plate Shaker Labnet Digital Heat Block VWR 4 Reagents and Supplies Sequencing primer Stocks of 100 uM in aliquots of 20 ul should be stored at 20 C The sequence of the primer can be found in section VIII part 2 The primer sequence is provided for synthesis by the testing lab group Streptavidin Sepharose High Performance beads GE Healthcare PyroMark Binding Buffer Qiagen PyroMark Annealing Buffer Qiagen PyroMark Denaturation Solution Qiagen PyroMark 10X Wash Buffer Tris Acetate Qiagen PyroMark Gold Reagents Qiagen Note Buffers Sepharose Beads and PyroGold Reagents should be stored at 4 C L Gubareva Distribution Copy Effective 04 19 2012 Page 10 of 41 of HEALTH t SERVICE SM Us K DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 PyroMark Q24 Plate 24 well clear plastic plates Qiagen 96
35. irus RNA isolated from clinical specimens or grown viral isolates The RT PCR primers are found in Reference Material section The RT PCR amplicon generated is used in the pyrosequencing protocol s section VI and or VII 2 Scope This procedure is for use by the community of Public Health Laboratories with basic experience in RNA isolation RT PCR and pyrosequencing 3 Equipment Thermal Cycler DNA Engine Tetrad 2 Bio Rad 4 Reagents and Supplies RT PCR primer Stocks of 20 uM in aliquots of 20 ul should be stored at 20 C The sequences of primers can be found in section VIII part 2 The primers are provided for synthesis by the testing lab group Superscript II One Step RT PCR System with Platinum High Fidelity Invitrogen Protector RNase Inhibitor Roche 1 5 ml sterile Eppendorf tubes Fisher Flat Top 96 well PCR reaction plates ISC BioExpress Strip Caps for Flat Top PCR reaction plates ISC BioExpress 0 2 ml PCR tubes ISC BioExpress Assorted pipettes and pipette tips Rainin Cold block for 96 well plate ISC BioExpress L Gubareva Distribution Copy Effective 04 19 2012 Page 6 of 41 SERVICES SS Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control and Prevention CDC Atlanta GA 30333 or HEALTY A amp 2 Agarose E Gels 96 Invitrogen E Base electrophoresis system Invitrogen Benchtop PCR Marker Promega
36. ntil ready to begin the sample clean up steps with the PyroMark Vacuum Prep Workstation Step 6 2 11 Prepare annealing buffer solution 40 ul of annealing buffer solution is needed per sample For 24 samples combine 1 1 ml Annealing Buffer and 5 ul of the required 100 uM sequencing primer final concentration 0 45 uM in a 15 ml conical tube Briefly vortex to mix the annealing buffer solution Aliquot 40 ul of the annealing buffer solution into the respective wells of a PyroMark Q24 plate 24 well clear plastic plate Place the plate onto its respective position on the Vacuum Prep Workstation Figure 2 Set plastic reagent trays in their designated positions on the Vacuum Prep Workstation Figure 2 and fill with 70 Ethanol Denaturation Solution 1X Wash Buffer and distilled deionized water respectively When Step 6 2 5 is close to completion 3 5 minutes left prime the filters in the PyroMark Prep Tool by adding distilled deionized water into a plastic reagent tray and place beneath the tool Figure 2 Turn ON the vacuum switch for both the Vacuum Prep Workstation and the vacuum pump This will allow water to flush through and prime the filter probes on the Prep Tool Let the tool sit in the plastic reagent tray until it is ready to use When Step 6 2 5 1s complete remove the plastic PCR plate containing the PCR product bound to Streptavidin Sepharose beads from the shaker Place the plate onto its respective position on th
37. ockers adamantanes and neuraminidase inhibitors NAIs The emergence of influenza viruses resistant to these antiviral drugs have yielded a need for the extensive surveillance of molecular markers associated with antiviral resistance A variety of methods are available for the monitoring of molecular markers associated with drug resistance Sanger sequencing high resolution melting curve and real time reverse transcriptase PCR have been employed for the analysis of these molecular markers within the influenza virus genome Although these methods are used for the analysis of influenza virus genomic variation they have limitations For example real time reverse transcriptase PCR is dependent on the detection of specific mutations and is unable to detect additional mutations The Sanger sequencing method has the ability to identify mutations but it is not suitable for quantitative single nucleotide polymorphism SNP analysis Sanger sequencing is also laborious time consuming and it can be difficult to interpret the sequence chromatograms from samples containing multiple virus variants quasispecies Pyrosequencing technology differs from other sequencing technologies during DNA synthesis it generates a sequence in real time Nucleotide sequences are determined by the sequential addition and subsequent incorporation of nucleotides which trigger a cascade of enzymatic reactions resulting in the release and detection of light The amount of light s
38. r should stream straaght down out of the pin Remove the excess water and add the corresponding amount of enzyme substrate and nucleotides see 6 3 6 into each channel of the cartridge with the label facing the user as shown in Figure 6 Load the volumes carefully to ensure that air bubbles are not created Note If the water does not stream through the pins of the cartridge the pins may be clogged Soaking the pins in warm water may help unclog the pins A cartridge with clogged pins should not be used and a new cartridge may be needed Load the cartridge containing enzyme substrate and nucleotides onto the PyroMark 24 instrument with the cartridge label facing towards the user Load the 24 well clear plastic plate containing the annealed DNA template and sequencing primer onto the PyroMark 24 instrument Insert the USB stick containing the run into the USB port at the front of the PyroMark Q24 instrument Find and click on the run to start the pyrosequencing reaction Ensure that the substrate peak appears after the substrate 1s added to confirm that the enzyme and substrate reagents are working Distribution Copy Effective 04 19 2012 Page 27 of 41 SERVICE ST Ys 6 4 of HEALTH t 6 5 L Gubareva DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 Cleaning the Instrument See part 6 4 in section VI Py
39. rosequencing SQA Protocol Using the PyroMark Q24 ID Platform Analysis of Pyrosequencing Data Using Allele Quantification AQ Mode 6 5 1 6 5 2 6 5 3 6 5 4 6 5 5 6 5 6 When the SNP run is complete remove the USB stick and copy the finished run on to your computer Note The icon for a completed run file is a blue check and will replace the ereen icon which denotes a run setup that has not yet been run Reopen the run in the PyroMark 24 software to reveal the AQ analysis window Figure 7 Under the Analyze tab select Analyze All Wells to analyze all the samples in the run To analyze only selected wells first highlight the wells you wish to analyze and then click Analyze Selected Wells When analysis is complete click Save Pyrosequencing data may be reported in two modes SNP or AQ SNP mode will provide the nucleotide present at the site of analysis for example T T T C or C C Figure 8 AQ mode will provide the percentage of each nucleotide present Figure 9 Under the Report tab select the SNP Full Report or AQ Full Report This will generate a document containing pyrograms and the results of the analysis Distribution Copy Effective 04 19 2012 Page 28 of 41 Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 SERVICE AM Sy Sy SM K DEPARTMENT OF HEALTH amp HUMAN SERVICES Analysis of Pyrosequencing Data Below are examples s
40. rtridge with the label facing the user as shown in Figure 5 Load the volumes carefully to ensure that air bubbles are not created Distribution Copy Effective 04 19 2012 Page 14 of 41 of HEALTH A 4 6 4 6 5 L Gubareva SERVICE SM Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service K Centers for Disease Control ydq 6 3 11 6 3 12 6 3 13 6 3 14 and Prevention CDC Atlanta GA 30333 Note If the water does not stream through the pins of the cartridge the pins may be clogged Soaking the pins in warm water may help unclog the pins A cartridge with clogged pins should not be used and a new cartridge may be needed Load the cartridge containing enzyme substrate and nucleotides onto the PyroMark 24 instrument with the cartridge label facing towards the user Load the 24 well clear plastic plate containing the annealed DNA template and sequencing primer onto the PyroMark 24 instrument Insert the USB stick containing the run into the USB port at the front of the PyroMark Q24 Instrument Find and select the run to start the pyrosequencing reaction Ensure that the substrate peak appears after the substrate is added to confirm that the enzyme and substrate reagents are working Cleaning the Instrument 6 4 1 6 4 2 6 4 3 6 4 4 To clean the Prep Tool place the hand tool in the reagent tray containing distilled deionized water reconnect the vacuum line to the hand
41. urylase in the presence of adenosine 5 phosphosulfate APS The ATP is used by luciferase to aid in the production of a light signal by converting luciferin to oxyluciferin The height of each peak produced by this light signal as can be seen in a pyrogram is proportional to the amount of ATP processed To avoid the recognition of deoxyadenosine triphosphate dATP by luciferase an analog of ATP deoxyadenosine alfa thio triphosphate dATPaS is used by the DNA polymerase for incorporation Apyrase 15 also present in the solution and is used to degrade any unincorporated nucleotides L Gubareva Distribution Copy Effective 04 19 2012 Page 3 of 41 SERVICES SS Us Public Health Service A DEPARTMENT OF HEALTH amp HUMAN SERVICES Centers for Disease Control gt and Prevention CDC Ky Atlanta GA 30333 C e II Pyrosequencing Assay Flow Chart Influenza subtype determination and RNA isolation are not included in this protocol 1 RNA Isolation 6 Pyrosequencing run 7 Data Analysis III Safety Information These protocols can be performed under biosafety level 1 or 2 BSL 1 BSL 2 conditions should be in compliance with institutional regulatory requirements by trained personnel with appropriate personal protective equipment PPE using the standard aseptic technique L Gubareva Distribution Copy Effective 04 19 2012 Page 4 of 41 SERVICES we Us DEPARTMENT OF HEALTH amp HUMAN SERVICES Public H
42. y start button to begin analysis After analysis generate reports and save When saving reports select the option All Reports Distribution Copy Effective 04 19 2012 Page 16 of 41 m ge Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 NS K DEPARTMENT OF HEALTH amp HUMAN SERVICES Ky Analysis of Pyrosequencing Data Below are examples showing the common target sequences EA i2 e 6 7 1 Detection of A HIN1 pdm09 wildtype H275 AT CAC TAT CAC wildtype H275 C Note Arrow shows the presence of C incorporation for T CAC virus variant Page 17 of 41 Effective 04 19 2012 L Gubareva Distribution Copy SERVICE ST Ys 7 Notes of HEALTH t 7 1 7 2 7 3 7 4 7 5 7 6 7 7 DEPARTMENT OF HEALTH amp HUMAN SERVICES Public Health Service Centers for Disease Control and Prevention CDC Atlanta GA 30333 This pyrosequencing protocol 1s for the detection of substitutions found in influenza and is not to be used for typing subtyping rather it 1s to be used for viruses that have already been subtyped by another method e g real time RT PCR A positive control is optional for the pyrosequencing assay since the PyroMark Q24 provides a built in quality control for each assay Specifically if a pyrogram is generated for any of your samples this may serve as your positive control The naming of the sequences in the I
Download Pdf Manuals
Related Search