GenomeWalker™ Kits User Manual
Contents
1. Version No PR47603 GenomeWalker Kits User Manual VI Suggestions for Characterizing Products continued Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity iv The promoter is tissue or stage specific Again recloning into a vector that has a strong enhancer may allow you to detect promoter activity Alternatively it may be possible to demonsirate the presence of a promoter by testing the construct in another host cell or in the whole organism v Reporter construct makes a bicistronic message The cloned fragment contains the ATG and some portion of the open reading frame from the gene of interest This results in a bicistronic message in which two ORFs may compete for translation the downstream ORF i e the reporter may not be efficiently translated If you suspect this to be the case test for promoter activity at the RNA level by performing RT PCR Reporter expression can be assayed by Northern blot however RT PCR is much faster and more sensitive if suitable primers are available vi The cloned fragment s contains a strong negative enhancer There are numerous instances of so called negative enhancers that prevent transcription of a functional promoter If you suspect this to be the case try recloning in the presence of a known strong enhancer or testing subclones in which upstream sequences have been deleted 5 Deletion analysis of promoters After fi2. Clontech Laboratories Inc www clontech com Protocol No PT1116 1 10 Version No PR47603 GenomeWalker Kits User Manual IV GenomeWalker Protocol continued Recommended cycling parameters forthe Applied Biosystems GeneAmp PCR Systems 2400 and 9600 are provided in Appendix C Please refer to the Troubleshooting Guide Section V for suggestions on optimizing PCR conditions 2 Use some form of hot start PCR Itis advantageous to use some form of hotstart andthe protocol assumes that TagStart Antibody has been included in the 50X polymerase mix see Section Ill Additional Materials Hot start can also be performed using wax beads Chou et al 1992 or manually D Aquila et al 1991 If you use a manual or wax based hot start you will need to adapt the protocol to these particular methods 3 Touchdown PCR The PCR cycling parameters in Steps IV C 8 and IV C 16 are for touchdown PCR Don etal 1991 Roux 1995 Hecker and Roux 1996 Touchdown PCR involves using an annealing extension temperature that is several degrees higher than the T of the primers during the initial PCR cycles Although primer annealing and amplification is less efficient at this higher temperature it is also much more specific The higher temperature also enhances the suppression PCR effect with AP 1 see Appendix B This allows a critical amount of gene specific product to accumulate The annealing extension temperature is then reduced to
3. If yoursecondary PCR produces asingle major band with little background and no minor bands you may be able to clone the fragment directly If the product of your secondary reaction has significant background you will need to gel purify the desired band There are several options for gel purifying DNA fragments We recommend either the NucleoSpin Extract Kit Cat No 635960 or 635961 or the NucleoTrap Gel Extraction Kit Cat No 636018 for gel purifying PCR products Note on TAE vs TBE gels We recommend that you use Tris Acetate EDTA TAE buffer instead of Tris Borate EDTA TBE buffer in your agarose gels when purifying DNAfragments for cloning In our experience DNA purified from TBE gels is more difficult to clone than DNA purified from TAE gels Note on EtBr and UV damage to DNA Minimize the exposure of your DNA to UV light 2 Sequencing and scanning for regulatory elements Prior to testing GenomeWalker products for promoter activity most researchers will want to sequence at least part of their clones and look for common regulatory sequence motifs such as promoters enhancers etc 3 Testing for promoter activity GenomeWalker products can be cloned into a promoter reporter vector to test for the presence of a promoter Cloning in both orientations will provide a positive and negative control Suitable promoter cloning vectors from Biosciences Clontech include the following e pSEAP2 Basic is sold separately Cat N
4. Primer 1 AP1 10 uM Nested Adaptor Primer 2 AP2 10 uM See Figure 4 on the next page for the sequences of AP1 and AP2 Positive Control Primer 1 PCP1 10 uM Positive Control Nested Primer 2 PCP2 10 uM See Appendix A for the seguences of the positive control primers supplied with each GenomeWalker Kit www clontech com Clontech Laboratories Inc 7 Version No PR47603 GenomeWalker Kits User Manual ll List of Components continued GenomeWalker Adaptor Srf I Mlu _ _ Sall _ Sma Xma 5 GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT 3 3 H N CCCGACCA PO 5 7 7 F L a Bre b s Adaptor Primer 1 AP1 22 mer Nested Adaptor Primer 2 AP2 19 mer 5 GTAATACGACTCACTATAGGGC 3 5 ACTATAGGGCACGCGTGGT 3 Figure 4 Structure of the GenomeWalker adaptor and adaptor primers The adaptor has been ligated to both ends of the genomic DNA fragments in all four GenomeWalker Libraries supplied with each kit The amine group on the lower strand of the adaptor blocks extension of the 3 end of the adaptor ligated genomic fragments and thus prevents formation of an AP1 binding site on the general population of fragments The design of the adaptor and adaptor primers is critical for the suppression PCR effect Figure 6 The Ta s of AP1 and AP2 are 59 C and 71 C determined by nearest neighbor analysis Freier et al 1986 lll Additional Materials Reguired The
5. Though rare such extension does occur presumably due to incomplete amine modification or incomplete adaptor ligation Given the exponential nature of PCR amplification such events would lead to nonspecific amplification and unacceptable backgrounds in the absence of suppression PCR Each of these features helps eliminate nonspecific amplification among the general population of DNA fragments In combination with touchdown PCR and nested PCR these innovations allow amplification of a specific target from a very complex mixture of DNA fragments all of which have the same terminal structure using a single set of gene specific primers Of the three features suppression PCR is the most critical unpublished data Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 25 GenomeWalker Kits User Manual Appendix B continued e On rare occasions the 3 end of the GenomeWalker Adaptor is extended creating a template with the full adaptor seguence on both ends Melt at 95 C e Anneal at 68 C API a Suppression PCR DNA synthesis No primer binding panhandle structure suppresses PCR a Even when the adaptor is extended very little full length amplification occurs Figure 6 The suppression PCR effect In rare cases the 3 end of the GenomeWalker Adaptor gets extended Though rare such extens
6. adaptor primer AP2 and anested gene specific primer GSP2 This generally produces a single major PCR product from at least three of the four libraries and often in all four Each of the DNA fragments which begin in known sequence at the 5 end of GSP2 and extend into the unknown adjacent genomic DNA can then be cloned and further analyzed Figure 2 shows sample results of primary and secondary GenomeWalker PCR Amplification of each of the GenomeWalker human libraries with the adaptor primers and primers derived from exon 1 of the human tissue type plasminogen activator tPA gene generated single major products of the size expected based on the map of the tPA locus Each kit also includes positive control primers PCP1 and PCP2 which generate a single major product from each library Thermostable DNA polymerase s are not included in the kit see next paragraph Long distance PCR with the Advantage 2 PCR Kit GenomeWalker reactions should be performed with a 50X polymerase mix containing a combination of DNA polymerases suitable for long distance PCR LD PCR Barnes 1994 Cheng et al 1994 In LD PCR a combination of two thermostable DNA polymerases is used to increase the range and accuracy of PCR amplification Most of the extension is carried out by a primary polymerase while a secondary polymerase provides the critical 3 gt 5 exonuclease or editing function that corrects misincorporated nucleotides Protocol No PT1
7. clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual VIII Related Products For a complete listing of all Biosciences Clontech products please visit www clontech com Products Cat No e GenomeWalker Kits Human 638901 Mouse 638902 Rat 638903 e GenomeWalker Universal Kit 638904 e Advantage 2 PCR Kit 639206 639207 e Advantage 2 Polymerase Mix 639201 e TagsStart amp Antibody 639250 Great EscAPe SEAP2 Reporter System 3 631706 Includes two vectors listed below pSEAP2 Basic Vector 631715 pSEAP2 Control Vector 631717 e Luminescent B gal Reporter System 3 631713 Includes two vectors listed below ppgal Basic Vector 631707 ppgal Control Vector 631709 e pEGFP 1 Promoter Reporter Vector 632319 e SMART RACE cDNA Amplification Kit 634914 e NucleoTrap6 Gel Extraction Kit 636018 e NucleoSpin Extract Kit 635960 635961 Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 23 GenomeWalker Kits User Manual Appendix A Seguence of the Positive Control Primers e The positive control primers in the GenomeWalker Human Kit Cat No 638901 are derived from exon 1 of the tissue type plasminogen activator tPA cDNA PCP1 Primer tPA1 5 AGA AAC CCG ACC TAC CAC GGC TTG CTC CTT 3 PCP2 Primer tPA2 5 CCC TTT CCT CGC AGA GGT TTT CTC TCC AGC 3 e The positive control primers in the GenomeWalker Mouse Kit Cat No 63890
8. difficult to amplify Repeat your experiment using a final concentration of 5 DMSO in your primary and secondary PCR For each PCR add 2 5 ul of DMSO and only 37 5 ul of H2O to the Master Mix Step IV C 2 amp 11 Add the DMSO to the Master Mix last Note You will need to perform more cycles in the presence of DMSO Forthe primary PCR perform 36 cycles instead of 32 forthe secondary PCR perform 24 cycles If this fails repeat again using a final concentration of 6 DMSO and 3 glycerol in your primary and secondary PCR If neither DMSO concentration solves the problem try increasing the temperature to 99 C for 5 seconds at the beginning of the first cycle 3 Smears or multiple major bands observed in positive controland gene specific primers If the positive control primers give the expected pattern but your gene specific primers still generate a smear after secondary PCR try repeating your experiment using 5 DMSO as discussed above However in most cases it will be necessary to redesign your gene specific primers if you get smears after the secondary PCR Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 GenomeWalker Kits User Manual VI Suggestions for Characterizing GenomeWalker Products A Restriction Mapping of GenomeWalker PCR Products GenomeWalker PCR producis are generally clean enough to allow simple restriction mapping without cloning An example of such an experimen
9. 116 1 www clontech com Clontech Laboratories Inc Version No PR47603 3 GenomeWalker Kits User Manual l Introduction continued Amplify gene of interest from all four libraries Genomic DNA y fragment ass No binding site for AP1 5 GSP1 Binding site is created a on template of interest AP2 m GenomeWalker by extension of GSP1 Adaptor fon Primary PCR with Advantage 2 Y Polymerase Mix contains TagStart M Antibody ERE Uu LE AP2 Secondary or nested PCR with GSP2 N Advantage 2 Polymerase Mix Y E Examine products on y an agarose EtBr gel M 1 234 M n w o 0 5 Clone amp characterize major PCR products Test for promoter activity by cloning into reporter vector Figure 1 Flow chart of the GenomeWalker protocol The gel shows typical results generated by nested PCR with the GenomeWalker human libraries and gene specific primers Primary and secondary nested PCR was performed using Advantage 2 Polymerase Mix and the cycling parameters described in the protocol Lane 1 EcoR V Library Lane 2 Dra Library Lane 3 Pvu ll Library Lane 4 Ssp Library Lane M DNA size markers The absence of a major product in one of the libraries is not unusual In our experience there is no major band in one or more lanes in approximately half of the GenomeWalker experiments As explained in the Expected Results and Troubleshooting Guide Sectio
10. 2 are derived from intron 6 of the interleukin 16 IL1 gene PCP1 Primer IL1p2 5 TCC GTG TGC ATG TTG CAT GTA TGA CAG AAA GG 3 PCP2 Primer IL1p1 5 TAC CAC GGT AGA CAT ATT CTC AGG GOT GCT GG 3 e The positive control primers in the GenomeWalker Rat Kit Cat No 638903 are derived from exon 5 of the interleukin 6 IL6 gene PCP1 Primer IL61 5 CCA CAG TGA GGA ATG TCC ACA AAC TGA TAT GC 3 PCP2 Primer IL62 5 ACT AGG TTT GCC GAG TAG ACC TCA TAG TGA CC 3 Clontech Laboratories Inc www clontech com Protocol No PT1116 1 24 Version No PR47603 GenomeWalker Kits User Manual Appendix B Design of the GenomeWalker Adaptor The GenomeWalker Adaptor has three design features that are critical to the success of GenomeWalker DNA walking These features which can be seen schematically in Figure 1 in the Introduction are as follows 1 The use of a 5 extended adaptor that has no binding site for the AP 1 primer used in primary PCR An AP1 binding site can only be generated by extension of the gene specific primer 2 Blocking ofthe exposed 3 end of the adaptor with an amine group to prevent extension of the 3 end which would create an AP1 binding site 3 The use of an adaptor primer that is shorter than the adaptor itself suppression PCR As shown in Figure 6 the suppression PCR effect prevents amplification of templates where the 3 end has been extended to create an AP1 binding site
11. Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 Cormack B P Valdivia R amp Falkow S 1996 FACS optimized variants of the green fluorescent protein Gene 173 33 38 D Aguila R T Bechtel L J Videler J A Eron J J Gorczyca amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Freier S M Kierzek R Jaeg er J A Sugimoto N Caruthers M H Neilson T and Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Friezner Degen S J Rajput B amp Reich E 1986 Structure of the human tissue type plasminogen activator gene J Biol Chem 261 6972 6985 Hecker K H amp Roux K H 1996 High and low annealing temperatures increase both specificity and yield in touchdown and stepdown PCR BioTechniques 20 478 485 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Tag DNA polymerase BioTechnigu
12. GenomeWalker Kits User Manual Cat Nos 638901 638902 638903 PT1116 1 PR47603 Published 23 August 2004 GenomeWalker Kits User Manual Table of Contents I Introduction 3 ll List of Components 7 lll Additional Materials Required 8 IV GenomeWalker Protocol 10 A Primer Design 10 B General Considerations 10 C Procedure for PCR based DNA Walking in GenomeWalker Libraries 12 V Expected Results and Troubleshooting Guide 16 VI Suggestions for Characterizing GenomeWalker Products 18 VII References 22 VIII Related Products 23 Appendix A Sequences of the Positive Control Primers 24 Appendix B Design of the GenomeWalker Adaptor 25 Appendix C Parameters for the GeneAmp Systems 2400 amp 9600 27 List of Figures Figure 1 Flow chart of the GenomeWalker protocol 4 Figure 2 Map of the human tissue type plasminogen activator tPA locus and results of primary and secondary GenomeWalker PCR using tPA primers 5 Figure 3 Positive control results with the Mouse and Rat GenomeWalker Kits 6 Figure 4 Structure of the GenomeWalker adaptor and adaptor primers 8 Figure 5 Simple restriction mapping of GenomeWalker PCR products from the human tPA locus 18 Figure 6 The suppression PCR effect 26 Clontech Laboratories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual l Introduction GenomeWalker Kits provide researchers with ready access to a novel method for walk
13. No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 5 GenomeWalker Kits User Manual l Introduction continued In the GenomeWalker protocol the use of LD PCR extends the range of possible PCR products to about 6 kb The precise reason for the upper limiton GenomeWalker products is not clear It may be due to the loss of the suppression PCR effect see Appendix B As discussed in Section lll we recommend our Advantage 2 Polymerase Mix Cat No 639201 Advantage 2 Polymerase Mix is available separately and in the Advantage 2 PCR Kit Cat No 639206 Applications The primary application of GenomeWalker Kits is the rapid cloning of the promoters and other upstream regulatory elements in genes for which only cDNA sequence was previously available In addition to obtaining promoters GenomeWalker DNAwalking can also be used to map intron exon junctions and to walk bidirectionally from any seguence tagged site STS or expressed seguence tag EST Although individual steps are limited to about 6 kb multiple steps can be strung together to create longer walks Consequently this method is useful for filling in gaps in genome maps particularly when the missing clones have been difficult to obtain by conventional library screening methods In all applications the PCR products are generally pure enough to allow restriction mapping without cloning A discussion of cloning GenomeWalker PCR products and testin
14. cedure for PCR based DNA Walking in GenomeWalker Libraries GenomeWalker PCR has been optimized with our Advantage 2 Polymerase Mix which includes TagStart Antibody for automatic hot start PCR 1 Label the 0 5 ml PCR tubes At Clontech we use the following system GSP1 and GSP2 indicate your gene specific primers TABLE SUGGESTED LABELING PLAN DNA 1 PCR 2 PCR Library DL Tube No Primers Tube No Primers DL EcoR V 1A GSP1 amp API 1B GSP2 amp AP2 DL Dra I 2A 2B DL Pvu Il 3A i 3B DL Ssp 4A 4B 5 Negative control None 5A 5B j Positive control DL EcoR V 6A PCP1 amp AP1 6B PCP2 amp AP2 Primers contained in primary master mix a Primers contained in secondary master mix Any of the libraries can be used for the positive control To prevent running out of any one library prematurely use a different library as the positive control for each experiment Clontech Laboratories Inc www clontech com Protocol No PT1116 1 12 Version No PR47603 GenomeWalker Kits User Manual IV GenomeWalker Protocol continued 2 Prepare the primary PCR master mix by combining the following reagents in an 0 5 ml tube 6 rxns per rxn 240 ul 40 ul H O 30 ul 5 ul 10X Advantage 2 PCR Buffer 6 ul 1 pl dNTP 10 mM each 6 ul 1 ul AP1 10 uM 6 ul 1 ul GSP1 10 uM t 6 ul 1 pl Advantage 2 Polymerase Mix 50X 294 ul 49 ul Total volume t GSP1 is your outer gene specific primer Mix well by vorte
15. ems GeneAmp PCR Systems 2400 and 9600 Both the 2400 and 9600 systems use much shorter cycling parameters and smaller thin walled tubes 0 2 ml vs 0 5 ml These systems also eliminate the need to overlay the reaction with mineral oil The following parameters for primary and secondary GenomeWalker PCR give good results with the standard 50 ul positive control reaction with no mineral oil overlay and the 2400 and 9600 thermal cyclers 1 Primary PCR Step IV C 8 e 7 cycles 94 C 2 sec 72 C 3 min e 32 cycles 94 C 2 sec 67 C 3 min 67 C for an additional 4 min 2 Secondary PCR Step IV C 16 e 5 cycles 94 C 2 sec 12 C 3 min e 20 cycles 94 C 2 sec 67 C 3 min 67 C for an additional 4 min Notes Length of denaturation time We have observed that differences of only a few seconds in the denaturation time at 94 C can dramatically affect results with the 2400 and 9600 systems For example positive control products larger than 2 3 kb were not detectable when the incubation time is increased from 2 to 5 sec The extremely short incubation time at 94 C may be necessary to preserve the integrity of the larger genomic DNA templates reguired for LD PCR in the GenomeWalker protocol Reaction volume Although the 2400 and 9600 systems allow you to reduce the reaction volumes in many applications we have not optimized the GenomeWalker protocol for lower reaction volumes Protocol No PT1116 1 www clontech com Clontec
16. ersion No PR47603 9 GenomeWalker Kits User Manual IV GenomeWalker Protocol A Primer Design You will need to design two gene specific primers one for the primary PCR reaction GSP1 and one for the secondary PCR reaction GSP2 The nested PCR primer should anneal to seguences beyond the 3 end of the primary PCR primer i e upstream of the primary PCR primer when walking upstream and downstream of the primary primer when walking downstream Whenever possible the outer and nested primers should not overlap if overlapping primers must be used the 3 end of the nested primer should have as much unique sequence as possible In general the gene specific primers should be derived from seguences as close to the end of the known sequence as possible For walking upstream from cDNAsequence the primer should be as close to the 5 end as possible Ideally the primers should be derived from the first exon of the gene If primers are derived from downstream exons the resulting PCR products are less likely to contain the promoter particularly if the intervening intron s and exon s comprise more than a few kb see Figure 2 Gene specific primers should be 25 28 nucleotides in length and have a GC content of 40 60 This will ensure that the primers will effectively anneal to the template at the recommended annealing and extension temperature of 67 C Primers should not be able to fold back and form intramolecular hydrogen bo
17. es Inc Clontech is a Takara Bio Company 2005 Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 31
18. es 16 1134 1137 Kitts P Adams M Kondepudi A Gallagher D amp Kain S January 1995 Green fluorescent protein A novel reporter for monitoring gene expression in living cells and organisms Clontechnigues X 1 1 3 Nelson K Brannan J amp Kretz K 1995 The fidelity of TagPlus DNA Polymerase in PCR Strategies in Mol Biol 8 24 25 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods amp Applications 4 5185 5194 Sambrook J amp Russell D W 2001 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995a An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 1087 1088 Siebert P D Chen S amp Kellogg D E April 1995b The Human GenomeWalker DNA Walking Kit A new PCR method for walking in uncloned genomic DNA Clontechnigues X II 1 3 Sinai P Kondepudi A Yang T Adams M Kitts P amp Kain S October 1994 The Luminescent p Gal chemiluminescent assay for p galactosidase Application to the analysis of cis regulatory elements Clontechnigues IX 4 1 4 Yang T Kondepudi A Adams M Kitts P amp Kain S July 1994 Ouantitative detection of specific gene regulation with the Great EscAPe secreted alkaline phosphatase Genetic Reporter System Clontechnigues IX 3 1 5 Clontech Laboratories Inc www
19. ficiently after an initial Clontech Laboratories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual lll Additional Materials Reguired continued 1 min incubation at 94 C which irreversibly inactivates the TaqStart Antibody See Kellogg et al 1994 for a discussion of hot start PCR with inactivating antibodies Hot start with wax beads Chou et al 1992 or manual hot start D Aguila et al 1991 can also be used e _ 10X PCR Reaction Buffer If you are using a DNA polymerase mix other than Advantage 2 Polymerase Mix use the PCR reaction buffer provided with the enzyme mix e dNTP mix 10 mM each of dATP dCTP dGTP and dTTP Store at 20 C e 0 5 ml PCR reaction tubes We recommend using GeneAmp 0 5 ml PCR Reaction Tubes Applied Biosystems Cat No N801 0737 or N801 0180 eDeionized H O Milli O filtered or eguivalent e 1 kb DNA ladder The following product is not required but recommended e Advantage6 2 PCR Kit Cat No 639206 or 639207 30rxns 100 rxns 30 ul 100ul 50X Advantage 2 Polymerase Mix 200 ul 600ul 10X Advantage 2 PCR Buffer 200 ul 600ul 10X Advantage 2 SA PCR Buffer 50 ul 120ul 50X dNTP Mix 10 mM each 30 ul 100ul Control DNA Template 100 ng pl 30 ul 100 ul Control Primer Mix 10 uM 2 5ml 50ml PCR Grade Water User Manual PT3281 1 Protocol at a Glance PT3281 2 Protocol No PT1116 1 www clontech com Clontech Laboratories Inc V
20. following reagents are reguired but not supplied Advantage6 2 Polymerase Mix 50X You will need a Tag based 50X polymerase mix suitable for LD PCR Conventional PCR with a single polymerase will not produce a band in most GenomeWalker experiments The GenomeWalker protocol has been optimized with the Advantage 2 Polymerase Mix Cat No 639201 This enzyme mix was specifically developed for PCR amplifications of genomic DNA templates of all sizes This 50X mix contains TITANIUM Tag DNA Polymerase a nuclease deficient N terminal deletion of Tag DNA polymerase plus TagStart amp Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase Advantage 2 Polymerase Mix is also available in the Advantage 2 PCR Kit Cat No 639206 TaqStart Antibody Cat No 639250 If you are not using Advantage 2 Polymerase Mix we strongly recommend that you use some form of hot start in GenomeWalker PCR To do this simply include TagStart Antibody in the 50X polymerase mix see PT1576 1 available at www clontech com TaqStart Antibody is included in Advantage 2 Polymerase Mix This antibody is an effective method for hot start PCR that is simpler and more convenient than wax based or manual methods The TaqStart Antibody binds to and inactivates Taq DNA polymerase and thus eliminates DNA synthesis from nonspecifically bound primers while reactions are being assembled PCR amplification proceeds ef
21. g them for promoter activity is included at the end of this manual Mouse Positive Rat Positive Control Results Control Results M 12 3 4 M 12 3 4 o gt thor o ooooo Figure 3 Positive control results obtained with the Mouse and Rat GenomeWalker Kits see Figure 2 for the human positive control results Primary and secondary nested PCR was performed using Advantage 2 Polymerase Mix and the cycling parameters described in the protocol Lane 1 EcoR V Library Lane 2 Dra I Library Lane 3 Pvu ll Library Lane 4 Ssp I Library Lane M 1kb DNA ladder Clontech Laboratories Inc www clontech com Protocol No PT1116 1 6 Version No PR47603 GenomeWalker Kits User Manual ll List of Components Store all components at 209C Note These reagents are sufficient for 20 reactions consisting of a primary and a secondary PCR with each library Enough primers are provided for 150 primary PCR and 300 secondary PCR amplifications 5 x 20 ul 150 ul 300 ul 25 ul 25 ul Protocol No PT1116 1 GenomeWalker DNA Libraries 100 ng each Human Kit Mouse Kit Rat Kit Cat No 638901 Cat No 638902 Cat No 638903 HDL EcoR V MDL EcoR V RDL EcoR V HDL Dra I MDL Dra I RDL Dra I HDL Pvu II MDL Pvu II RDL Pvu Il HDL Ssp MDL Ssp RDL Ssp The GenomeWalker mouse libraries MDL and rat libraries RDL were constructed from the genomic DNA of ICR Swiss mice and Sprague Dawley rats respectively Adaptor
22. h Laboratories Inc Version No PR47603 27 GenomeWalker Kits User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual Notes Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 GenomeWalker Kits User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual Notes Notice to Purchaser This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of Clontech Laboratories Inc Suppression PCR is covered by U S Patent No 5 565 340 Nucleotrap and NucleoSpin are registered trademarks of MACHEREY NAGEL GmbH and o A license under U S Patent Nos 4 683 202 4 683 195 and 4 965 188 and U S Patents Nos 5 407 800 5 322 770 and 5 310 652 or their foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd for use in research and development has an up front fee component and a running royalty component The purchase price of this product includes limited nontransferable rights under the running royalty component to use only this amount of the product to practice the Po
23. ing upstream i e towards promoters or downstream in genomic DNA from a Known seguence such as a cDNA Siebert et al 1995a 1995b Each kit contains four libraries of uncloned adaptor ligated genomic DNA fragments These are not libraries in the conventional sense that is the DNA fragments are not ligated into a vector which is then propagated in E coli However like conventional libraries GenomeWalker Libraries are a pool of specially prepared DNA fragments from which researchers can identify isolate and clone specific pieces of DNA Construction of GenomeWalker Libraries begins with isolation of very clean genomic DNA that has a very high average molecular weight The starting DNA must be of considerably higher quality than the minimum suitable for Southern blotting or conventional PCR Four separate aliquots are then thoroughly digested with four different restriction enzymes that recognize a 6 base site leaving blunt ends Following digestion each pool of DNA fragments is ligated to the GenomeWalker Adaptor see Appendix B The GenomeWalker protocol takes just two days and consists of two PCR amplifications per library Figure 1 The first or primary PCR amplification uses the outer adaptor primer AP1 provided in the kit and an outer gene specific primer GSP1 provided by the researcher The primary PCR mixture is then diluted and used as a template for a secondary or nested PCR amplification using the nested
24. ion does occur presumably due to incomplete amine modification during oligonucleotide synthesis or incomplete adaptor ligation This creates a molecule that has the full length adaptor seguence on both ends and can serve as a template for end to end amplification Without suppression PCR these rare events would lead to unacceptable backgrounds due to the exponential nature of PCR amplification However in suppression PCR the adaptor primer is much shorter than the adaptor itself Thus during subseguent thermal cycling nearly all the DNA strands will form the panhandle structure shown above which cannot be extended At the appropriate annealing extension temperature this intramolecular annealing event is strongly favored over and more stable than the intermolecular annealing of the much shorter adaptor primer to the adaptor The suppression PCR effect will be reduced or lost if you use an annealing temperature lower than 60 65 C The upper limit of the suppression PCR effect is about 6 kb Clontech Laboratories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual Appendix C Parameters for GeneAmp Systems 2400 amp 9600 As noted elsewhere in this manual cycling parameters may have to be optimized for different thermal cyclers For example the cycling parameters in this protocol which were developed on an Applied Biosystems DNA Thermal Cycler 480 do not work with the Applied Biosyst
25. lymerase Chain Reaction PCR and related processes described in said patents where the processes are covered by patents solely for the research and development activities of the purchaser when this product is used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have a complete license to use this product in the PCR process where the process is covered by patents These rights under the up front fee component may be purchased from Applied Biosystems or obtained by purchasing an Authorized Thermal Cycler No right to perform or offer commercial services of any kind using PCR where the process is covered by patents including without limitation reporting the results of purchaser s activities for a fee or other commercial consideration is hereby granted by implication or estoppel Further information on purchasing licenses to practice the PCR Process where the process is covered by patents may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City California94404 or the FY MU Department at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California GeneAmp and AmpliTaq are registered trademarks of Roche Molecular Systems Inc licensed to the Applied Biosystems Corporation Clontech Clontech logo and all other trademarks are the property of Clontech Laboratori
26. more than one band may occasionally be observed after secondary PCR Store the unused portion of the secondary PCR samples at 4 C until you have confirmed that the procedure has been successful At that point proceed with analyzing and cloning the fragments of interest e g putative promoter fragments as described in Section VI Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 GenomeWalker Kits User Manual V Expected Results and Troubleshooting Guide A Expected Results 1 Primary PCR Figure 2 Section I shows a typical result after primary GenomeWalker PCR In general primary PCR should produce multiple fragments ranging in size from about 500 bp to 5 kb in all four lanes There may be some smearing in some lanes In general you should continue with secondary PCR if you obtain any bands or smearing with your gene specific primer 2 Secondary PCR a Positive control PCP primers Positive conirol secondary PCR should produce major bands of the following sizes GenomeWalker Human Mouse Rat DNA Libraries HDLs MDLs RDLs EcoR V 1 8kb 1 5 kb 1 5 kb Dra 0 9 kb 1 3 kb 1 2 kb Pvu Il 1 5 kb 0 6 kb 0 7 kb Ssp 3 9 kb 3 2 kb 1 0 kb a 1 3 kb band is often observed in HDL Ssp I See the Introduction for gels showing the expected results following the secondary PCR amplification with the human Figure 2 and mouse and rat Figure 3 positive control primers Expe
27. n V this is usually because the distance between the primer and the upstream restriction site is greater than the capability of the system N Amine group that blocks extension of the 3 end of the adaptor ligated genomic fragments AP Adaptor primers GSP Gene specific primers Clontech Laboratories Inc www clontech com Protocol No PT1116 1 4 Version No PR47603 GenomeWalker Kits User Manual l Introduction continued Map of tPA locus and expected PCR products tPA2 Presumed promoter a lt PM T T T T E Ssp EcoRV Pvull Dral Exon I 1 8 kb EcoR V Library 0 9 kb ra Library 1 5kb bi yj Library 3 9 kb ST Ssp Library Gel of primary PCR Gel of secondary PCR reaction products reaction products M 1 2 3 4 M 1 2 3 4 4 0 4 0 3 0 3 0 2 0 2 0 1 6 1 6 1 0 1 0 0 5 0 5 Figure 2 Map of the human tissue type plasminogen activator tPA locus Friezner Degen et al 1986 and results of primary and secondary GenomeWalker PCR using tPA primers Primary and secondary nested PCR was performed using Advantage 2 Polymerase Mix and the cycling parameters described in the protocol The tPA primers used in this experiment are the positive control primers PCP1 and PCP2 provided with the GenomeWalker Human Kit Lane 1 EcoR V Library Lane 2 Dra Library Lane 3 Pvu II Library Lane 4 Ssp Library Lane M 1 kb DNA ladder A 1 3 kb band is often observed in HDL Ssp 1 Protocol
28. nding fragments that have promoter activity many researchers will want to perform a deletion analysis to define the minimal promoter Any standard nested deletion method is compatible with this system C Other Applications of GenomeWalker Other possible applications of the GenomeWalker DNA walking method include the following Mapping intron exon boundaries e Walking short distances upstream or downstream in genomic DNA from known sequences e g expressed sequence tags EST or other sequence tagged sites STS Although individual steps are limited to 6 kb multiple steps can be strung together to create longer walks Walking from 5 or 3 ends generated by RACE using the SMART RACE cDNA Amplification Kit Cat No 634914 You can also clone full length cDNAs and the surrounding genomic sequences without ever screening a library using both our SMART RACE cDNA Amplification Kit and the GenomeWalker Kit Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 21 GenomeWalker Kits User Manual VII References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M
29. nds and sequences at the 3 end of your primers should not be able to anneal to the 3 end of the adaptor primers There should be no more than three G s and C s in the last six positions at the 3 end of the primer Five restriction sites have been incorporated into the GenomeWalker Adaptor Sal cohesive ends Mlu cohesive ends and overlapping Srf I cohesive ends Sma I blunt ends and Xma I cohesive ends sites If you wish to use restriction sites to clone the resulting PCR products suitable sites should also be designed into the 5 end of GSP2 i e the nested gene specific primer used for the secondary PCR reaction The sites in the Adaptor Primer allow easy insertion of PCR products into commonly used promoter reporter vectors Alternatively GenomeWalker products can be cloned into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left byTaq DNA polymerase See Section VI B 3 for a discussion of our various promoter cloning reporter vectors and reporter assay systems B General Considerations 1 Cycling parameters The cycling parameters in this protocol have been optimized using the Applied Biosystems DNA Thermal Cycler 480 Advantage 2 Polymerase Mix and the reagents and positive control primers provided in the GenomeWalker Kit The optimal cycling parameters may vary with different polymerase mixes gene specific primers and thermal cyclers
30. o 631715 and as a component inthe chemiluminescent Great EscAPe SEAP Reporter System 3 Cat No 631706 Yang et al 1994 This kit also includes pSEAP2 Control andreagents necessary for 100 chemiluminescent assays The reporter molecule in the Great EscAPe system is a secreted form of alkaline phosphatase SEAP which can be conveniently measured directly in the culture medium using a sensitive chemiluminescent assay Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 19 GenomeWalker Kits User Manual VI Suggestions for Characterizing Products continued ppgal Basic is sold separately Cat No 631707 and as acomponent in the Luminescent p gal Reporter System 3 Cat No 631713 Sinai et al 1994 This Kit also includes ppgal Control Vector and reagents necessary for 100 chemiluminescent assays pEGFP 1 Promoter Reporter Vector Cat No 632319 uses a bright codon optimized variant of the green fluorescent protein GFP to monitor promoter activity Cormack etal 1996 April 1996 Clontechnigues Kitts et al 1995 Note on ATG start codon If your gene specific primer was downstream of the ATG start codon in your gene of interest then you may wish to eliminate the ATG from your promoter reporter construct s This may prevent a possible false negative result due to the expression of a bicistronic message See Section 4 b v below 4 Explanation of possible results of tests for prom
31. oter activity Some GenomeWalker products will have no promoter activity when cloned in both orientations in a promoter reporter vector There are several possible explanations a None of the fragments contain the promoter Your primer may be several kb from the promoter and or there may be intervening restriction sites between the primer and the promoter This may also be an indication that the primer does not fall into the first exon or within a downstream exon that is within 6 kb of the promoter If this is the case you may need to obtain sequence data from closer to the 5 end of the transcript Alternatively you can walk another step by sequencing the distal end of the GenomeWalker product s designing a new gene specific primer and repeating the amplification protocol The promoter is present but the reporter is not expressed There are several possible reasons why you might not detect promoter activity even if your promoter reporter construct contains the promoter i The fragment is cloned in the wrong orientation Reclone and test in the opposite orientation ii The promoter is too weak to be detected in your assay If this is the case it may be possible to add an enhancer to your construct or reclone your fragment s in a vector that has an enhancer iii The promoter needs to be induced and you do not have the means to induce it Clontech Laboratories Inc www clontech com Protocol No PT1116 1 20
32. r Kits User Manual V Expected Results and Troubleshooting Guide continued B Troubleshooting Guide 1 No products with the positive control primers even after increasing the number of primary cycles from 32 to 37 a Reduce all annealing extension temperatures by 29C i e 72 C to 70 C and 67 C to 65 C b Reduce the length of the incubation at 94 C c Check your 50X polymerase mix by PCR using two specific primers and a 1 10 kb template that works in your hands 2 Expected products observed with positive control primer but no product observed with your gene specific primers a Check the design of your primers If the positive control PCP primers produce the expected PCR products but your gene specific primers do not produce major PCR products with any of the libraries there is probably a problem with your primers If your primer sequence was derived from cDNA sequence information the primary or secondary PCR primer may cross an exon intron junction If this is the case it will be necessary to redesign one or both gene specific primers Remember that all primers should be able to anneal efficiently at 67 C i e have a Tm 67 C If you are sure your primers do not cross intron exon boundaries recheck the sequence of your primers In some instances primers will fail to produce any products due to a mistake in primer design or synthesis b Your target template may have a high GC content Such templates are
33. rimental PCR primers In approximately half the cases single major bands will be observed with each of the four libraries On rare occasions more than one band may be observed The exact size of the major bands will depend on the positions of restriction sites in your gene Typically secondary PCR products will range from 0 2 to 6 kb Fragments generated from nested gene specific primers that are less than 0 4 kb from one of the restriction sites represented in the GenomeWalker libraries may appear as alow molecular weight smear on a 1 2 agarose EtBr gel If this is the case with one or more of the GenomeWalker libraries run this particular PCR product s on a 2 agarose EtBr gel In our experience no product is observed in one or more of the libraries in approximately half the cases This is usually because the distance from the primer to the restriction site is greater than the capability of the system 6 kb This limit reflects the diminished suppression PCR effect as template size increases Targets greater than 6 kb often become indistinguishable in a smear of high molecular weight material Such smearing may also occur in lanes that do contain major bands but should not affect the major bands The absence of a major band in one or more of the libraries does not mean that products obtained with other libraries are not correct Clontech Laboratories Inc www clontech com Protocol No PT1116 1 16 Version No PR47603 GenomeWalke
34. slightly below the primer T for the remaining PCR cycles permitting efficient exponential amplification of the gene specific template As noted above we recommend using primers with T s greater than 68 C to allow you to use the touchdown cycling programs in the protocol 4 Use of the positive controls In each experiment we suggest that you include a positive control in which you amplify one of the libraries using the positive control PCP primers This will confirm that your DNA polymerase mix is functional and thermal cycling parameters are compatible with this protocol To ensure that you do not run out of any one library prematurely use a different library as the positive control for each experiment Note You may wish to perform an initial experiment using all four libraries with the positive control primers prior to using the kit with their gene specific primers Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 GenomeWalker Kits User Manual IV GenomeWalker Protocol continued 5 Amplify all four libraries with each set of GSPs To maximize your chances of success in finding a promoter or taking the largest possible step in a genomic walk we recommend that you amplify all four libraries with each new gene specific primer 6 Use the recommended amounts of enzymes The enzyme amounts have been carefully optimized for the GenomeWalker amplification protocol and reagents C Pro
35. stems 2400 and 9600 Analyze 5 ul of the primary PCR products on a 1 596 agarose EtBr gel along with DNA size markers such as a 1 kb ladder If you do not see any product perform five additional cycles Expected results of primary PCR You should observe multiple fragments ranging in size from about 500 bp to 5 kb in all four lanes There may be some smearing in some lanes See Figure 2 in the Introduction Section l for a sample gel showing products of primary PCR If you obtain any bands or smearing with your gene specific primer continue with secondary PCR as described in Steps 10 17 even if your products are weaker than the positive control or the bands in Figure 2 If you do not observe any product with your gene specific primers consult the Troubleshooting Guide 10 Using a clean 0 5 ml tube for each sample dilute 1 ul of each primary 11 PCR including positive and negative controls into 49 ul of sterile H O Prepare a secondary PCR master mix by combining the following reagents in an 0 5 ml tube 6rxns perrxn 240 ul 40 ul H O 30 ul 5 ul 10X Advantage 2 PCR Buffer 6 ul 1 ul dNTP 10 mM each 6 ul 1 ul AP2 10 uM 6 ul 1 ul GSP2 10 uM t 6 ul 1 ul Advantage 2 Polymerase Mix 50X 294 ul 49 ul Total volume GSP2 is your nested gene specific primer Mix well by vortexing without introducing bubbles and briefly spin the tube in a microcentrifuge Keep on ice until ready to use Clontech Labora
36. t is shown in Figure 5 _ tPA2 Pvu ll BamH _ tPM L T T T 1 T Ssp EcoRV Pvull Dral Exon 18k NN V Library 0 9 kb Dra Library 1 5 kb 5 Pvu ll Library 3 9 kb Ssp Library Restriction digests PCR products BamH Pvu Il lI EW SE XE OY Cora NSN DO O o A m CLOR m M eee ie Jc mo oo 0 5 Figure 5 Simple restriction mapping of GenomeWalker PCR products from the human tPA locus The map shows the positions of the relevant restriction sites in the genomic DNA and in the predicted PCR products The gel on the left shows the products of GenomeWalker PCR The gel on the right shows the pattern of restriction fragments generated by digestions of each PCR product with either BamH I or Pvu Il Lane M DNA size markers Clontech Laboratories Inc www clontech com Protocol No PT1116 1 18 Version No PR47603 GenomeWalker Kits User Manual VI Suggestions for Characterizing Products continued B Cloning GenomeWalker Products and Testing for Promoter Activity 1 Cloning GenomeWalker products Once you have obtained major bands using your gene specific primer you will usually want to clone the fragments into a general purpose cloning vector using restriction sites or into a TA type cloning vector using the A overhang left by the DNA polymerase In some cases you may wish to clone directly into a promoter reporter vector See Section B 3 below
37. tories Inc www clontech com Protocol No PT1116 1 Version No PR47603 GenomeWalker Kits User Manual IV GenomeWalker Protocol continued 12 Add 49 ul of the secondary PCR master mix to the appropriately labeled tubes and to the negative control Do not add master mix to the positive control 13 Prepare your secondary positive control by combining the following reagents in an 0 5 ml tube 40 ul H O 5 ul 10X Advantage 2 PCR Buffer 1 ul dNTP 10 mM each 1 ul AP2 10 uM 1 ul PCP2 10 uM 1 ul Advantage 2 Polymerase Mix 50X 49 ul Total volume 14 Add 1 ul of each diluted primary PCR product to the appropriate tube Be sure to include both the positive and negative controls 15 Overlay the contents of each test tube with one drop of mineral oil and place caps firmly on each tube 16 Commence cycling in a DNA Thermal Cycler 480 PE Biosystems using the following two step cycle parameters 5 cycles 94 C 25 sec 72 C 4min 18 22 cycles 94 C 25sec 67 C 4min 67 C for an additional 4 min after the final cycle Note Do not use a three step cycling program e g 95 C melting 60 C annealing 68 C extension See Appendix C for cycling parameters for the GeneAmp PCR Systems 2400 and 9600 17 Analyze 5 ul of the secondary PCR products on a 1 2 agarose EtBr gel along with DNA size markers such as a 1 kb DNA ladder or A Hind Ill digest As discussed in the Troubleshooting Section Section V A 2
38. xing without introducing bubbles and briefly spin the tube in a microcentrifuge 3 Add 49 ul of the primary PCR master mix to the appropriately labeled tubes and to the negative control Do not add master mix to the positive control see Step 6 4 Add 1 ulof each DNA library i e HDL EcoR V etc to the appropriately labeled tubes including the positive control Do not add any library DNA to the negative control 5 Add 1 ul of H O to the negative control 6 Prepare your positive control by combining the following reagents in a 0 5 ml tube 40 ul H O 5 ul 10X Advantage 2 PCR Buffer ul dNTP 10 mM each ul AP1 10 uM PCP1 10 uM ul DL EcoR V or DL Dra I etc ul Advantage 2 Polymerase Mix 50X 50 ul Total volume 7 Overlay the contents of each test tube with one drop of mineral oil and place caps firmly on each tube ar Cn _nh _ Cee Cree Tc Protocol No PT1116 1 www clontech com Clontech Laboratories Inc Version No PR47603 13 GenomeWalker Kits User Manual IV GenomeWalker Protocol continued 8 Commence cycling in a DNA Thermal Cycler 480 Applied Biosystems using the following two step cycle parameters e 7 cycles 94 C 25sec 72 C 4min e 32 cycles 94 C 25sec 67 C 4min 67 C for an additional 4 min after the final cycle Notes Do not use a three step cycling program e g 95 C melting 60 C annealing 689C extension See Appendix C for cycling parameters for GeneAmp PCR Sy
Download Pdf Manuals
Related Search