Home

Matchmaker Library Construction & Screening Kits User Manual

1. 20 ul SV40 Large T PCR Fragment 25 ng ul 0 5 ml S cerevisiae strain AH109 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 7 Matchmaker Library Construction amp Screening Kits User Manual ll List of Components continued e 05ml S cerevisiae strainY187 50 ml NaCl Solution 0 9 10g Leu DO Supplement 10g Leu Trp DO Supplement 10g Ade His Leu Trp DO Supplement Yeastmaker Yeast Transformation System 2 Cat No 630439 includes the following e 50 ml 1M LiAc 10X e 50 ml 10XTE Buffer 50 ml YPD Plus Liquid Medium e 20 ul pGBTO9 0 1 ug ul control plasmid e 2x1ml_ Herring Testes Carrier DNA denatured 10 mg ml e 2x50 ml 5096 PEG 3350 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 8 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Ill Additional Materials Required The following reagents are required but not supplied Store all reagents and solutions at room temperature 20 22 C unless specified otherwise First strand cDNA synthesis and SMART PCR cDNA amplification Advantage 2 PCR Kit Cat Nos 639206 amp 639207 Sterile 0 5 ml microcentrifuge tubes Poly A or total RNA Mineral oil Thermal Cycler Note The cycling parameters in this protocol were set using a hot lid thermal cycler and may not be optimal for non hot lid cyclers DNA siz
2. Prepare competent yeast cells Appendix B Setup two 1 5 ml microcentrifuge tubes Add DNA competent yeast cells and PEG LiAc Solution using the volumes and in the order indicated Table XI Mix thoroughly by gently vortexing d Incubate in a water bath at 30 C for 30 min Vortex gently every 15 min D sa a os 3 Add 20 ul of DMSO to each tube mix and then place the tube in a 42 C waterbath for 20 min Vortex gently every 5 min Centrifuge at high speed for 15 sec Remove supernatant and resuspend in 1 ml of YPD Plus Liquid Medium Incubate in a water bath at 30 C for 90 min Mix every 15 min by gently vortexing Centrifuge at high speed for 15 sec Discard the supernatant and resuspend in 1 ml of NaCl Solution by gently pipetting up and down Spread 100 ul of a 1 10 1 100 and 1 1 000 dilution onto 100 mm SD agar plates e SD Leu Trp To check the cotransformation efficiency e SD Ade His Leu Trp X a Gal To select for cotransformants expressing interacting proteins Incubate the plates at 30 C face down for 2 4 days until colonies appear Compare your results with those shown in Table XII Pick the largest colonies and restreak them on the same selection medium After colonies have grown seal these master plates with Parafilm and store at 4 C For long term storage gt 2 weeks prepare glycerol stock cultures and freeze at 70 C These strains are useful references
3. Add 45 ml 2X YPDA Kan 50 ug ml Swirl gently d Rinse cells from library vial with two 1 ml aliquots of 2X YPDA Kan 50ug ml e Incubate at 30 C for 20 24 hr with gentle swirling 30 50 rpm h Note Low speed swirling is necessary to keep cells from settling to the bottom of the flask However shaking the culture at speeds gt 50 rpm will significantly reduce mating efficiency After 20 hr of mating check a drop of the mating culture under a phase contrast microscope 400X If zygotes are present allow mating to continue for four more hours Otherwise continue to Step g Note A zygote typically has a three lobed shape the lobes representing the two haploid parental cells and the budding diploid cell Transfer the mating mixture to a sterile 100 ml centrifuge bottle Centrifuge at 1 000 x g for 10 min Meanwhile rinse the mating flask twice 50 ml each rinse with 0 5XYPDA Kan 50 ug ml Combine the rinses and use them to resuspend the pellet Centrifuge at 1 000 x g for 10 min Resuspend the cell pellet in 10 ml of 0 5XYPDA Kan 50 ug ml Measure the total volume of cells medium 5 Select for yeast diploids expressing interacting proteins a b To determine the mating efficiency spread 100 ul of a 1 10 000 1 1 000 1 100 and 1 10 dilution of the mating mixture on three media 100 mm plates e SD Leu e SD Trp e SD Leu Trp Spread remaining mating mixture onTDO or QDO plates 200 ul cells 150 mm pla
4. IX Generating a cDNA Library A Generating a cDNA library with SMART technology Messenger RNA transcripts are efficiently copied into ds cDNA using SMART Switching Mechanism at 5 end of RNA Transcript technology Zhu Y Y et al 2001 This cDNA synthesis and amplification system is particularly well suited for one hybrid and two hybrid library construction because it consistently delivers high yields of cDNA while maintaining sequence representation By maintaining the complexity of the original tissue the SMART procedure provides you with the best opportunity of detecting rare and potentially novel interactions during yeast one hybrid and two hybrid screening B How SMART cDNA Synthesis and Amplification Works In the first strand cDNA synthesis step MMLV Moloney Murine Leukemia Virus Reverse Transcriptase RT is used to transcribe RNA into DNA To prime RNA for cDNA synthesis you may use either a modified oligo dT primer our CDS III Primer or a random primer our CDS III 6 Primer The composition of the resulting cDNA library may differ depending on which primer you choose If you use the CDS III Primer which hybridizes to the 3 end of poly A RNA sequences close to the 5 end of the transcript may be slightly under represented If instead you use the CDS III 6 Primer a random primer that can hybridize to many different sequences on the RNA template your library should contain a variety of 5 and 3 end sequences
5. Note To check the transformation efficiency spread 100 ul of a 1 10 1 100 1 1 000 and 1 10 000 dilution on 100 mm SD Leu plates Incubate plates upside down at 30 C until colonies appear 3 6 days Calculate the transformation efficiency Expected results 21 x 106transformants 3 ug pGADT7 Rec 3 Harvest pool transformants a e205 ch Chill plates at 4 C for 3 4 hr Add 5 ml Freezing Medium to each plate Use sterile glass beads and gentle swirling to dislodge the cells into the liquid Combine all liquids in a sterile flask Mix well Check the cell density using a hemacytometer If the cell density lt 2 x 10 cells ml reduce the volume of the suspension by centrifuging Aliquot 1 ml and store at 80 C not longer than 1 year To determine the library titer spread 100 ul of a 1 100 1 1 000 and 1 10 000 dilution on 100 mm SD Leu plates Incubate at 30 C until colonies appear 2 3 days Count the colonies cfu and calculate the number of clones in your library 4 Mate the library host strain with your bait strain a b Thaw a 1 ml aliquot 2 2 x 10 cells of your AH109 library in a room temperature water bath Combine the 5 ml Y187 bait culture from Section VIII C 7 21 x 10 cells ml and the 1 ml aliquot of AH109 library cells 22 x10 cells ml in a sterile 2 L flask Note The flask size must be atleast2Lto permit sufficient aeration ofthe mating culture at low speed swirling
6. asingle copy may be sufficientin many cases Formoreinformation abouttargetcopy number see Ghosh et al 1993 Tandem copies may be generated by various methods but we have found the most convenient and reliable method for generating them to be oligonucleotide synthesis It works nicely because well defined regulatory elements are usually 20 bp 1 Design two antiparallel oligonucleotides one representing the sense strand and the other its antisense complement Note The sense strand should consist of one or more copies of the target element with a different restriction site on each end When the two strands are annealed the resulting double stranded DNA will have a different overhang at each end for directional cloning into pHIS2 See the pHIS2 Vector Information Packet PT3705 5 for a diagram of the multiple cloning site 2 Synthesize both strands without 5 phosphates according to the protocol ofthe synthesizer manufacturer C Insert Your DNA Target into the Multiple Cloning Site of pHIS2 1 For each construct planned mix 0 1 ug of sense strand and 0 1 ug of antisense strand oligonucleotide in 10 ul of 50 mM NaCl 2 Anneal the oligonucleotides by heating at 70 C for 5 min and then slowly cooling to room temperature 30 min 3 Completely digest 0 1 ug of pHIS2 in a 20 ul double digest using an appropriate pair of restriction enzymes Incubate at 37 C for 2 hr or as directed by the enzyme manufacturer 4 Electrophorese a 2 ul
7. Hold the sample collection tube to prevent it from detaching from the spin column 8 Combine duplicate experimental samples in a single tube 9 Add the following reagents 1 10 vol Sodium Acetate 3 M pH 4 8 2 5 vol 95 ethanol 20 C 10 Mix gently by rocking the tube back and forth 11 Place the tube in a 20 C freezer or a dry ice ethanol bath for 1 hr Optional You may incubate at 20 C overnight which may result in better recovery 12 Centrifuge the tube at 14 000 rpm for 20 min at room temperature 13 Carefully remove the supernatant with a pipette Do not disturb the pellet 14 Briefly centrifuge the tube to bring all remaining liquid to the bottom 15 Carefully remove all liquid and allow the pellet to air dry for 10 min 16 Resuspend the pellet in 20 ul of Deionized H O and mix gently The cDNA is now ready for in vivo recombination Library Construction with pGADT7 Rec or pGADT7 Rec2 Proceed with One Hybrid orTwo Hybrid Library Construction or store the cDNA at 20 C until you are ready Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual X Constructing amp Screening One Hybrid and Two Hybrid Libraries A Constructing GAL4 AD Fusion Libraries for One Hybrid and Two Hybrid Screening 1 Whether you plan to screen for one hybrid or two hybrid interactions the methods used to construct the lib
8. J amp Herskowitz 1993 Isolation of ORC6 a component of the yeast origin of recognition complex by a one hybrid system Science 262 1870 1873 Liaw G J 1994 Improved protocol for directional multimerization of a DNA fragment Bio Techniques 17 668 670 Liu J Wilson E Milbrandt J amp Johnston M 1993 Identifying DNA binding sites and analyzing DNA binding domains using a yeast selection system In Methods A Companion to Methods in Enzymology 5 125 137 Louret O E Doignon F amp Crouzet M 1997 Stable DNA binding yeast vector allowing high bait expression for use in the two hybrid system BioTechniques 23 816 819 Luban J Alin K B Bossolt K L Humaran T amp Goff S P 1992 Genetic assay for multimerization of retroviral gag polyproteins J Virol 66 5157 5160 Luban J amp Goff S P 1995 The yeast two hybrid system for studying protein interactions Curr Opinion Biotechnol 6 1 59 64 Luo Y Vijaychander S Stile J amp Zhu L 1996 Cloning and analysis of DNA binding proteins by yeast one hybrid and one two hybrid systems Biotechniques 20 564 568 Ma J amp Ptashne M 1987 A new class of yeast transcriptional activators Ce 51 113 119 Marcil R amp Higgins D R 1992 Direct transfer of plasmid DNA from yeast to E coli by electroporation Nucleic Acids Res 20 917 Matchmaker Two Hybrid System 3 January 1999 Clontechniques XIV 1 12 14 Matchmaker Libr
9. Miura K 1975 A blocked structure at the 5 terminus of mRNA from cytoplasmic polyhedrosis virus Nature 253 374 375 Ghosh S Selby M J amp Peterlin B M 1993 Synergism between Tat and VP16 in trans activation of HIV 1 LTR J Mol Biol 234 610 619 Gietz D St Jean A Woods R A amp Schiestl R H 1992 Improved method for high efficiency transformation of intact yeast cells Nucleic Acids Res 20 1425 Golemis E A Gyuris J amp Brent R 1996 Analysis of protein interactions and Interaction trap two hybrid systems to identify interacting proteins In Current Protocols in Molecular Biology John Wiley amp Sons Inc Sections 20 0 and 20 1 Gstaiger M Knoepfel L Georgiev O Schaffner W amp Hovens C M 1995 A B cell coactivator of octamer binding transcription factors Nature 373 360 362 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XV References continued Guarente L 1993 Strategies for the identification of interacting proteins Proc Natl Acad Sci USA 90 1639 1641 Gubler U amp Hoffman B J 1983 A simple and very efficient method for generating cDNA libraries Gene 25 263 269 Gubler U amp Hoffman B J 1983 A simple and very efficient method for generating complementary DNA libraries Gene 25 263 269 Guthrie C amp Fink G R 1991 Gui
10. Prepare a Master Mix by combining the components as specified in Table XIII TABLE XIII ASSEMBLING MASTER MIXES FOR PCR COLONY SCREENING Reagent 1 rxn 10 rxns 25 rxns 1 extra 1 extra PCR grade deionized H O 41 ul 451 ul 1066 ul 10X Advantage 2 PCR Buffer 5 ul 55 ul 130 ul 5 LD Amplimer 20 uM 1 ul 11 ul 26 yl 3 LD Amplimer 20 uM 1 ul 11 ul 26 yl 50X dNTP Mix 10 mM ea 1 ul 11 ul 26 yl 50 X Advantage 2 Polymerase Mix 1 ul 11 ul 26 yl Total 50 ul 550 ul 1300 ul 4 Using a sterile pipette tip scrape a few cells from a colony that you wish to analyze Place the cells in the bottom of a clean 250 ul PCR tube 5 Add 50 ul of Master Mixto the tube Gently pipette up and down to disperse the cells 6 Overlay the reaction mixture with 2 drops of mineral oil if necessary Cap the tube and place it in a preheated thermal cycler 7 Begin thermal cycling If you have a hot lid thermal cycler use the following program Note These cycling parameters may not be optimal for non hot lid thermal cyclers e94 C 3 min e 25 30 cycles 94 C 30sec 68 C 3 min 68 C 3min e Soak at 15 C 8 Analyze the PCR product as described in Part C C Analyze the cDNA Insert by Agarose EtBr Gel Electrophoresis Analyze a 5 yl aliquot of the PCR product from Part B alongside DNA size markers on a 0 896 1X TAE agarose EtBr gel Tip To distinguish the PCR product from similar size inserts in other AD library plasmids digest the PCR product
11. Propagate additional cultures only from isolated colonies on this working stock plate Notes e AH109 and transformants derived from this strain should be maintained on adenine supplemented YPD i e YPDA for optimal viability of the strain and to prevent selection of spontaneous ade or adeb mutations Guthrie amp Fink 1991 f you cannot recover the strain by scraping the frozen stock the cells may have settled to the bottom of the tube before the stock was frozen If this happens thaw the frozen culture on ice and vortex it before restreaking e Although nonlibrary stock cultures may be thawed and refrozen several times without significantly decreasing the viability we recommend that you divide the once thawed stock into aliquots before you refreeze it This will keep the viability higher and will reduce the risk of bacterial contamination 3 Test for the nutritional requirements shown in Table Il a Using a sterile loop or toothpick streak 3 4 colonies from the working stock onto separate appropriate SD selection plates b Incubate plates at 30 C for 4 6 days Yeast grows slower on SD selection medium than on YPDA c Compare your results with those shown in Table II Proceed only if AH109 and Y187 have the expected phenotypes 4 Usewell isolated colonies fromthe verified working stock plate to inoculate liquid cultures for mating or for preparing competent cells Seal the verified working stock plate with Parafilm and
12. Trp viability of AH109 partner cfu ml on SD Leu Trp viability of diploids Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol A continued c Compare the viable cfu ml of the two mating partners The strain with the lower viability is the limiting partner In this library screening protocol the AH109 library strain should be the limiting partner to ensure that the maximum number of library cells find a mating partner In a control cross either strain could be limiting d Calculate the mating efficiency i e Diploid cfu ml of diploids x 100 Diploid cfu ml of limiting partner Note If the mating efficiency was lt 2 and if you obtained few if any positive clones you may wish to repeat the library screening with another 1 ml aliquot But first see the Troubleshooting Guide for tips on improving the mating efficiency e Estimate the number of clones screened cfu ml of diploids x resuspension volume ml of clones screened 7 Controls for Protocol A Small Scale Yeast Transformation Use this small scale transformation protocol to produce the following three control strains Two Hybrid Transformation Controls Control Vectors Control Strain plasmid 1 SV40 Large T PCR Fragment pGADT7 Rec Cotansform Recombin
13. Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual VIII Constructing a DNA BD Fusion Vector for Two Hybrid Analysis A Construct a DNA BD Fusion e Youcangeneratea GALA DNA BD fusion gene ifcompatible restriction sites are presentinthe test gene andthecorresponding vector TableV If not generate the gene fragment by PCR using primers that contain the desired restriction site Scharf 1990 A restriction site at the end ofa gene can often be changed into a differentsite or put into a different reading frame by using a PCR primerthatincorporates the desired mutation Alternatively if you have already cloned your gene into a Creator DonorVector use Cre recombinase to transfer your geneto pLP GBKT7 Refer to the Creator DNA Cloning Kits User Manual PT3460 1 for details e For more detailed information on cloning see Sambrook et al 1989 TABLE V COMPARISON OF MATCHMAKER DNA BD VECTORS DNA BD vector Description Size Protein Expression pGBKT7 GALA 44 DNA BD 73 kb High TRP1 Kan pBridge GALA 44 DNA BD 6 5 kb Low TRP1 Amp pGBT9 gt GALA 445 DNA BD 5 4 kb Low TRP1 Amp pAS2 1 GALA 445 DNA BD 8 4 kb High TRP1 Amp CYHs2 pLP GBKT7 GALA 445 DNA BD 75 kb High TRP1 Kan loxP Contains two distinct expression cassettes for investigating ternary protein complexes gt DNA BD vectors used in previous Matchmaker Two Hybrid Systems e Creator Acceptor Vector LP
14. all three DNA components can be introduced into the yeast reporter strain Figure 4 Screening begins as soon as the pGADT7 Rec2 AD vector is assembled by the host s recombination processes Positive one hybrids can be identified immediately after cotransformation by plating the transformation mixture on medium that selects for the H S3 nutritional reporter For protocol details see Section XI 2 Two Hybrid Library Screening yeast mating or cotransformation Two Hybrid libraries can be screened by either yeast mating or cotransformation As described above cotransformationallows you to construct and screen your library in asingle host strain The procedure is quick and efficient For details please review Protocols A and B in Section XII and see theTwo Hybrid Library Construction amp Screening flowchart in Figure 7 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 27 Matchmaker Library Construction amp Screening Kits User Manual XI Constructing amp Screening a One Hybrid Library PLEASE READ ENTIRE PROTOCOL BEFORE STARTING Before starting library construction Pour an appropriate number of SD agar plates SD His Leu Trp optimal 3 AT to select for one hybrid interactions 150 mm SD Leu to measure the transformation efficiency of the library plasmid 100 mm SD Trp to measure the transformation efficiency of the reporter plasmid 100 mm SD Leu Trp to measure
15. loxP Accepts a gene of interest from any Creator Donor Vector and expresses it as a GAL4 DNA BD fusion 1 Purify the gene fragment Note We recommend the NucleoSpin Extraction Kit Cat No 635961 for rapid isolation of DNA fragments 2 Digest the DNA BD vector with the appropriate restriction enzyme s treat with phosphatase and purify 3 Ligate the appropriate vector and insert Transform ligation mixtures into E coli 4 Identify insert containing plasmids by restriction analysis or PCR B Test the DNA BD Fusion for Transcriptional Activation 1 Transform AH109 and Y187 with the hybrid construct using a small scale transformation protocolsuch asthe one given in Section XII A 7 Plate transformants onthe following media e SD Trp X a Gal e SD His Trp X a Gal e SD Ade Trp X a Gal Include a negative control For example transform cells with an empty DNA BD vector Note The dropout supplements required to make these media are not supplied with the Matchmaker Library Construction amp Screening Kit Cat No 630445 You must purchase these supplements separately from a commercial supplier or prepare them yourself using the recipe given in Appendix C of the Yeast Protocols Handbook PT3024 1 2 Analyze results Bait protein is inactive if the transformant colonies are white and do not grow on SD His Trp or SD Ade Trp Go to Steps 5 6 e Bait protein is active if transformant colonies are blue and gro
16. which are represented in near equal proportions When MMLV RT encounters a 5 terminus on the template the enzyme s terminal transferase activity adds a few additional nucleotides primarily deoxycytidine to the 3 end of the cDNA The SMART III Oligonucleotide which has an oligo G sequence at its 3 end base pairs with the deoxycytidine stretch creating an extended template Figure 8 RT then switches templates and continues replicating to the end of the oligonucleotide In the majority of syntheses the resulting ss cDNA contains the complete 5 end of the mRNA as well as the sequence complementary to the SMART III Oligo which then serves as a universal priming site SMART anchor inthe subsequent amplification by long distance PCR LD PCR Chenchik et al 1998 Only those ss cDNAs having a SMART anchor sequence at the 5 end can serve as a template and be exponentially amplified by long distance PCR LD PCR In the second step ss cDNA is amplified by LD PCR to produce a ds cDNA library We recommend using the Advantage 2 PCR Kit Cat Nos 639206 amp 639207 to generate and amplify ds cDNA The Advantage 2 Polymerase Mix consists of TITANIUM Taq DNA Polymerase a nuclease deficient N terminal deletion of Taq DNA polymerase TaqStart Antibody to provide automatic hot start PCR Kellogg et a 1994 and a minor amount of a proofreading polymerase This polymerase system lets you amplify cDNA as large as 20 kb with a fidelity rat
17. with a frequent cutter restriction enzyme such as Alu or Hae Ill Run a small sample on a 2 agarose EtBr gel Compare the digestion pattern with that of other inserts e f a high percentage ofthe colonies appear to contain the same AD library insert expand your PCR analysis to another batch of 50 colonies Alternatively eliminate the abundant clones by performing yeastcolony hybridization on each master plate Refer to theYPH for this procedure Usea vector free oligonucleotide probe designed from the sequence ofthe mostabundantinsert Transfer a representative of each type of insert to a new master plate e f the PCR product consists of more than one band see Part E below e f the PCR product consists of a single band Clontech Laboratories Inc www clontech com Protocol No PT3529 1 40 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions continued 1 Prepare a new master plate with a representative clone from each group 2 If you are satisfied with the number of unique clones prepare a glycerol stock of each unique type Store at 80 C 3 Purify the PCR product using any suitable method We normally use a NucleoSpin Extraction Kit Cat No 635961 4 Proceed with Part D D Sequence the cDNA Insert AD library cDNA inserts can be sequenced using the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 a T7 Sequencing Primer or t
18. 3 vectors is located downstream of the GAL4 coding sequence the GAL4 domains are not transcribed Thus in vitro Co IP specifically detects interactions between bait and library proteins b Coimmunoprecipitate the epitope tagged fusion proteins using c Myc and HA antibodies Durfee et al 1993 Zhang et al 1993 Note If the fusion proteins do not coimmunoprecipitate use other means to confirm the interaction Protein interactions with weak affinities may escape detection by coimmunoprecipitation See Phizichy amp Fields 1995 for details on more sensitive detection methods Furthermore the AD fusion proteins may potentially not be in frame with the epitope tag One Hybrid Protein DNA interactions can often be confirmed and studied in vitro using an electrophoretic mobility shift assay EMSA Wu et al 1994 a Transcribe and translate the HA epitope tagged fusion protein in vitro using the T7 promoter in the AD vector pGADT7 Rec2 Note The T7 promoter in pGADT7 Rec2 is located downstream of the GALA coding sequence thus the GALA activation domain is not transcribed in vitro b Perform an EMSA assay with your wild type and mutant DNA targets to verify and if desired to map the DNA binding activity of the protein H Retest the Interaction in Mammalian Cells In mammalian cells proteins are more likely to be in their native conformations and to have the appropriate post translational modifications therefore results
19. Antigen ori SMART III sequence CDS III sequence Figure 17 Map of pGADT7 RecT AD Control Vector pGADT7 RecT is a product of recombination that encodes a fusion of the SV40 largeT antigen and the GALA AD To generate this control cotransform yeast with the SV40 LargeT PCR Fragment and pGADT7 Rec Cloning Vector Sma l linearized Because the linearized vector shares sequence homology with the ends of the Large T PCR Fragment these two components recombine via a double crossover mechanism to produce the circular control plasmid pGADT7 RecT The SV40 Large T DNA GenBank Locus SV4CG was derived from a plasmid referenced in Li amp Fields 1993 PCR amplification was performed at Clontech a a 72 f ori Panui GALA DNA BD EcoR Murine p53 insert pGBKT7 53 8 3 kb a a 390 Figure 18 Map of pGBKT7 53 DNA BD ControlVector pGBKT7 53 is a positive control plasmid that encodes a fusion of the murine p53 protein a a 72 390 and the GALA DNA BD a a 1 147 The murine p53 cDNA GenBank Accession Cat No K01700 was cloned into pGBKT7 at the EcoR and BamH sites The p53 insert was derived from the plasmid described in Iwabuchi et al 1993 plasmid modification was performed at Clontech pGBKT7 53 has not been sequenced Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Appendix D Tw
20. Co Parafilm is a registered trademark of the American National Can Co Clontech Clontech logo and all other trademarks are the property of Clontech Laboratories Inc Clontech is a Takara Bio Company 2006 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Introduction Matchmaker Library Construction amp Screening Kits provide a simple method for constructing cDNA libraries for yeast two hybrid and one hybrid screening These kits combine Matchmaker Systems with SMART cDNA Synthesis technology which allows you to construct cDNA libraries from any tissue source starting with as little as 1 ug of poly A RNA or total RNA Following a routine in vivo cloning step you can then screen these libraries for one hybrid and two hybrid interactions using a sensitive transcriptional assay provided by our Matchmaker Systems Principle of the one hybrid assay a protein DNA interaction assay One hybrid assays enable you to identify and characterize proteins that bind to a target cis acting DNA sequence an upstream element that enhances transcription from a downstream minimal promoter The assay may also be used to map the DNA binding domain of previously known or newly identified DNA binding proteins With the Matchmaker One Hybrid System you can readily obtain the genes encoding the corresponding DNA binding protein In a Mat
21. Figure 4 Constructing and screening Matchmaker One Hybrid and Two Hybrid libraries As this diagram shows recombination mediated cloning makes library construction and screening quick and efficient Though not shown here two hybrid libraries can also be screened by yeast mating See Section XII for details For details about SMART cDNA synthesis and amplification please refer to Section IX pGADT7 Rec is used for two hybrid library construction and screening while pGADT7 Rec2 is used for one hybrid library construction and screening Though related the two vectors denoted as pGADT7 Rec 2 in the figure have different replication elements See Section X and the corresponding Vector Information Packets for more information Clontech Laboratories Inc www clontech com Protocol No PT3529 1 6 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Il List of Components This kit contains sufficient reagents to make 5 one hybrid Cat No 630304 or 5 two hybrid Cat No 630445 libraries Store Deionized H O CHROMA SPIN Columns NaCl Solution Dropout DO Supplements NaOAc LiAc PEG TE Buffer andYPD Plus Medium at room temperature Store yeast strains Control Poly A RNA and the SMART III Oligo at 70 C Store all other reagents at 20 C First strand cDNA synthesis 10 ul SMART III Oligo 10 uM 5 AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG 3 10 ul CDS III Primer 10 uM 5 ATTCTAGAGGCCGA
22. a suitable MATa strain with the following three plasmids and select on SD Trp plates i DNA BD ii DNA BD bait iii pGBKT7 Lam c Foreach candidate AD library plasmid to betested setupthe yeast matings indicated in Figure 13 using the Trp and Leu transformants obtained in Steps a amp b above Refer to Section XII A 8 for a small scale yeast mating procedure d Select for diploids by spreading mating mixtures on SD Leu Trp plates as directed e Streakorreplica plateto SD Ade His Leu Trp X a gal True positives are AD library clones exhibiting reporter gene expression only when the AD library plasmid is introduced by mating with the plasmid encoding the DNA BD bait protein Additional Two Hybrid Tests e Transfer the library insert from the AD to the DNA BD vector and vice versa and then repeat the two hybrid assay Chien et al 1991 van Aelst et al 1993 You should still be able to detect the interaction Create a frameshift mutation just upstream of the library insert in the AD plasmid by cutting at the Mlu site filling in the overhangs and then religating Bendixen et al 1994 Repeat the two hybrid assay you should not be able to detect the interaction e Generate site specific deletion or substitution mutants and repeat the two hybrid assay 1 Transform AH109 with AD library plasmid s 2 Plate on SD Leu Master plate with candidate clones 3 Inoculate 0 5 ml YPD cultures U U U 4 Mate to Y
23. and maintenance of yeast see theYeast Protocols Handbook PT3024 1 We also recommend Guthrie amp Fink s Guide to Yeast Genetics and Molecular Biology 1991 and Heslot amp Gaillardin s Molecular Biology and Genetic Engineering of Yeasts 1992 A Genotypes TABLE I MATCHMAKER YEAST STRAIN GENOTYPES Strain Genotype References AH109 MATa trp1 901 leu2 3 112 ura3 52 his3 200 James et al 1996 gal4A gal80A LYS2 GAL 1 y45 GAL 15 HISS Our unpublished GAL2 4s GAL2 5 4 ADE2 observations URA3 MEL 1 As MEL 15 lacZ MEL1 Y187 MATa ura3 52 his3 200 ade2 101 trp1 901 Harper et al 1993 leu2 3 112 gal4 met gal80A URA3 GAL Tuas GAL T lacZ MEL1 a The GAL 1 GAL2 and MEL 1 upstream activating sequences UASs are responsive to the GAL4 transcriptional activator The trp1 his3 gal4 and gal80 mutations are all deletions eu2 3 112 is a double mutation AH109 is a derivative of strain PJ69 2A and includes the ADE2 and HIS3 nutritional markers and an endogenous MEL1 gene James et al 1996 The lacZ reporter gene was introduced into PJ69 2A to create strain AH 109 B Phenotypes It is important to verify the phenotypes of the AH109 and Y 187 strains Table Il 1 To recover strains from frozen stock scrape a small amount of cells from the surface with a sterile loop or wooden stick and streak them onto YPDA plates 2 Incubate plates at 30 C for 3 5 days until colonies appear
24. entities purchasing these reagents must obtain a license from the Research Foundation of the State University of New York before using them Clontech is required by its licensing agreement to submit a report of all purchasers of two hybrid reagents to SUNY Stony Brook Please contact the Office of Technology Licensing amp Industry Relations at SUNY Stony Brook for license information Tel 631 632 9009 Fax 631 632 1505 SMART Technology is covered by U S Patent Nos 5 962 271 and 5 962 272 For Profit and Not For Profit purchasers of SMART Products are entitled to use the reagents for internal research However the following uses are expressly prohibited 1 performing services for third parties 2 identifying nucleic acid sequences to be included on nucleic acid arrays blots or in libraries or other cDNA collections which are then sold to third parties Reproduction modification reformulation or resale of the reagents provided in SMART Products is not permitted For information on licensing SMART Technology for commercial purposes please contact a licensing representative by phone at 650 919 7320 or by e mail at licensing 9 clontech com The pBridge Vector is the property of the Institut National de la Sant et de la Recherche M dicale INSERM Inquiries regarding the commercial use or resale of this vector must be directed to INSERM France NucleoSpin and NucleoBond are a registered trademarks of Macherey Nagel GmbH amp
25. for checking new batches of SD selection medium TABLE XII CONTROLTWO HYBRID COTRANSFORMATIONS EXPECTED RESULTS Control Strain Plate on SD Minimal Media Phenotype Mel1 His Ade Positive Control AH109 pGADT7 RecT pGBKT7 53 Ade His Leu Trp X a Gal Blue Negative Control AH109 pGADT7 RecT pGBKT7 Lam Ade His Leu Trp X a Gal no colonies Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 37 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions This section presents strategies for verifying and analyzing protein protein and protein DNA interactions Figure 12 provides a detailed overview A Retest the Phenotype 1 Library transformants may contain more than one AD library plasmid which can complicate the analysis of putative positive clones Thus it is a good idea to restreak the positive colonies on SD dropout plates 2 3 times to segregate the AD library plasmids You should restreak on an SD dropout medium that selects for both the library and bait plasmids as well as for the one hybrid or two hybrid interaction a Restreak positive one hybrid clones on SD His Leu Trp optimal 3 AT Restreak positive two hybrid clones on either TDO or ODO medium Keep in mind that ODO is a more stringent selection Reminder TDO stands for triple dropout medium SD Ade Leu Trp or SD His Leu Trp ODO stands for quadruple dropout
26. gal Detection Kit II 631712 General cloning reagents e Creator pDNR Cloning Kits many e QUICK Clone cDNA many e KC8 Electrocompetent Cells 630435 e Fusion Blue Competent Cells 636700 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Appendix A Typical Results of ds cDNA Synthesis Double stranded cDNA synthesized from Control Human Placenta Poly A RNA using the protocol in this manual should appear as a moderately strong smear from 20 1 kb to 4 kb or more on a 1 2 agarose EtBr gel Figure 14 Double stranded cDNA Figure 14 Double stranded cDNA synthesized from Control Human Placenta Poly A RNA 1 ul 1 0 ug of Control Human Placenta Poly A RNA was used as the template for first strand cDNA synthesis Two first strand samples were prepared One with a random primer our CDS III 6 Primer Lanes 1 amp 3 and the other with an oligo dT primer our CDS III Primer Lanes 2 amp 4 Next 2 ul of the single stranded cDNA was amplified by LD PCR Each ds cDNA product was then purified with a CHROMA SPIN TE 400 Column The ds cDNA was analyzed on a 1 2 agarose EtBr gel before Lanes 1 amp 2 7 ul cDNA per lane and after Lanes 3 amp 4 5 ul cDNA per lane column purification Lane M was loaded with 250 ng of a 1 kb DNA size marker Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version N
27. medium SD Ade His Leu Trp b Incubate plates at 30 C for 4 6 days 2 Optional Test the phenotype further by assaying for a third reporter gene or by selecting for the interaction under different concentrations of 3 AT e Two hybrid colonies Replica plate or transfer well isolated colonies to SD Ade His Leu Trp plates containing X a Gal to verify that they maintain the correct phenotype and to test for the expression of MEL7 e One hybrid colonies Replica plate or transfer well isolated colonies to SD His Leu Trp plates containing different concentrations of 3 AT to verify that they maintain the correct phenotype and to test the strength of the interaction 3 Collect the restreaked and retested positive colonies in a grid fashion on fresh master plates 4 Incubate plates at 30 C for 4 6 days 5 After colonies have grown seal plates with Parafilm and store at 4 C for up to 4 weeks B Rescue the Library cDNA Insert To identify the gene and thus protein responsible for a positive one hybrid or two hybrid interaction first rescue the gene by Plasmid Isolation or by PCR Colony Screening Plasmid Isolation 1 Isolate plasmid DNA from yeast using the Yeastmaker Yeast Plasmid Isolation Kit Cat No 630441 or other suitable method 2 Because the plasmid DNA isolated from each yeast colony will be a mixture of the bait plasmid and at least one type of AD library plasmid you will need to separate the plasmids by sele
28. sample of the digest ona 1 agarose gel to confirm that the plasmid has been efficiently linearized 5 Combine 5 ul of digested plasmid with 1 ul of annealed oligo and 4 ul of H O 6 Add 1 2 ul of 10X T4 ligation buffer and 0 8 ul at least 0 8 units of T4 DNA ligase and incubate at room temperature for 4 hr Note Since the molar ratio of oligonucleotide to vector is 100 1 or greater gel purification to remove the stuffer fragment is unnecessary 7 Separately transform competent E colicells with each construct using astandard method Sambrook et al 1989 We recommend using a general purpose strain such as DH5a or Fusion Blue Competent Cells 8 Plate transformants on LB kan plates and incubate at 37 C overnight 9 Prepare plasmid using any standard method that yields highly pure DNA Sambrook et al 1989 Check for inserts by electrophoresing on a 2 agarose gel and sequencing across the junctions D Test your Target Reporter Construct for Background HIS3 Expression 1 Transform Y187 with the target reporter construct using a small scale protocol For example see the small scale protocol used in Section XI C 2 Follow the procedure in Section IV F to determine the optimum concentration of 3 AT to use in the selection medium For example we find that 10 mM 3 AT is sufficient to suppress background growth of Y187 cells transformed with p53HIS2 Control Vector Clontech Laboratories Inc www clontech com Protocol No PT3529 1
29. store at 4 C Strain SD Ade SD Met SD Trp SD Leu SD His SD Ura YPDA AH109 Y187 Notes e AH109 andY187 can grow on SD Leu Trp if functional TRP1 and LEU2 genes are introduced e AH109 and AH109 Y187 diploids can grow on SD Ade His if the ADE2 and HIS3 genes carried by AH109 are activated i e in the presence of GALA Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual IV Yeast Strains continued C Mating type compatibilities e Y187 MATa can mate with AH109 HF7c CG 1945 Y190 or SFY526 all MATa D Colony Color and Size e Y187 carries the ade2 101 mutation and AH109 exhibits the Ade phenotype inthe absence of GALA On medium with low amounts of adenine the colonies will turn pink after a few days andmayturndarkerasthecolonyages WhengrownonAde supplemented medium the color change may not be noticeable These colonies grow to gt 2 mm in diameter However small 1 mm whitecolonieswillformatarate of 1 296 dueto spontaneous mutationsthateliminate mitochondrial function Holm 1993 Avoid these white colonies when inoculating cultures e Y187 grows more slowly and forms noticeably smaller colonies on average than AH109 E Reporter genes AH109 contains four reporters ADE2 HIS3 MEL 1 and lacZ under the control of three distinct GALA upstream activating s
30. testing 3 AT in the range 0 to 15 mM e g 0 2 5 5 75 10 12 5 and 15 mM f you are working with Y187 transformants containing pHIS2 reporter plasmids we recommend you start by testing 3 AT in the range 10 to 60 mM Note These are recommendations only The optimal concentration may be slightly higher or lower depending on the construct and strain used 2 Usethe lowest concentration of 3 AT that after one week allows only small 1 mm colonies to grow Too much 3 AT in the medium can kill freshly transformed cells Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 13 Matchmaker Library Construction amp Screening Kits User Manual V Yeast Vectors A One Hybrid System 1 Cloning Vectors pHIS2 is a one hybrid reporter vector that contains the H S3 nutritional reporter gene It has a multiple cloning site MCS upstream of the H S3 reporter gene so that a cis acting DNA target sequence can be inserted and therefore linked to the minimal promoter of the H S3 locus P s It also contains a CEN6 ARS4 sequence for stable low copy propagation in yeast pGADT7 Rec2 is a cloning vector that can be used to express a protein of interest as a fusion with the GALA activation domain AD This vector is engineered for homologous recombination mediated cloning in yeast Figure 4 Thus you can construct cCDNA AD fusion libraries by transforming yeast with Smal linearized pGADT7 Rec2 p
31. the number of clones screened 100 mm plates Allow SD agar plates to dry at room temperature for 2 3 days or at 30 C for 3 hr e Prepare PEG LiAc Solution Section Ill Be sure to run the necessary controls Part C in parallel with your experimental sample Important Note that you must prepare competent yeast cells before starting library construction Please take some time to review the procedure in Appendix B and plan your work accordingly A Cotransform Yeast Strain Y 187 with ds cDNA pGADT7 Rec2 and pHIS2 target DNA 1 Prepare competent yeast cells Appendix B 2 In a sterile 15 ml tube combine the following e 20 ul ds cDNA from Section IX I Step 16 e 6 ul pGADT7 Rec2 0 5 ug ul e 5 ug pHIS2 target DNA prepared in Section VII e 20 ul Herring Testes Carrier DNA denatured Note The combined volume of these DNA components should not exceed 60 yl or 1 10 the volume of the competent cells added at Step 3 below Transfer 50 ul of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 15 ml reaction tube Add 600 ul of competent cells to the DNA Gently mix by vortexing Add 2 5 ml PEG LiAc Solution Mix gently by vortexing for 3 5 sec Incubate at 30 C for 45 min Mix cells every 15 min Add 160 ul DMSO mix and then place the tube in a 42 C water bath for 20 min Mix c
32. 10 Constructing AD fusion libraries by recombination mediated cloning in yeast 27 Figure 11 Screening an AD fusion library for two hybrid interactions 32 Figure 12 Strategies for analyzing and verifying putative positive one hybrid and two hybrid interactions 39 Figure 13 Yeast mating to verify protein protein two hybrid interactions 42 Figure 14 Double stranded cDNA synthesized from Control Human Placenta Poly At RNA 52 Figure 15 Map of p53HIS2 Control Vector 54 Figure 16 Map of pGAD Rec2 53 AD Control Vector 54 Figure 17 Map of pGADT7 RecT AD Control Vector 55 Figure 18 Map of pGBKT7 53 DNA BD Control Vector 55 Figure 19 Map of pGBKT7 Lam DNA BD Control Vector 56 Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc Practice of the two hybrid system is covered by U S Patent Nos 5 283 173 5 468 614 and 5 667 973 assigned to the Research Foundation of the State University of New York Purchase of any Clontech two hybrid reagent does not imply or convey a license to practice the two hybrid system covered by these patents Commercial
33. 187 transformed with DNA BD DNA BD bait DNA BD lamin C Ci OO UN Ze o9 SQ 759oo SN 5 Plate on SD Leu Trp 6 Replica plate or streak onto CENE SD Ade His Leu Trp X a Gal Qu GD gt Figure 13 Yeast mating to verify protein protein two hybrid interactions Clontech Laboratories Inc www clontech com Protocol No PT3529 1 42 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions continued G Retest the Interaction n Vitro e Two hybrid Protein protein interactions can often be confirmed in vitro using coimmunoprecipitation Co IP The Matchmaker Co IP Kit Cat No 630449 includes all the essential reagents including antibodies Protein A Beads and a detailed step by step protocol needed to perform in vitro Co IP Following is a general Co IP protocol suitable for Matchmaker vectors a Transcribe and translate the epitope tagged fusion proteins in vitro using the T7 promoters in the AD and DNA BD vectors Note Matchmaker System 3 vectors pGADT7 pGADT7 Rec pGADT7 Rec2 pLP GADT7 pGBKT7 and pLP GBKT7 contain a T7 RNA polymerase promoter and either a c Myc or hemagglutinin HA epitope tag so that you can use them directly for in vitro transcription and translation For all other GAL4 based vectors you must incorporate aT7 promoter and epitope tag using PCR and an appropriate pair of primers Because theT7 promoter in System
34. 40 LargeT PCR Fragment and pGADT7 Rec The DNA BD and AD vectors have different nutritional markers so they can be independently selected when yeast transformants are plated on SD minimal medium lacking specific nutrients The selection medium you choose depends on which plasmids you are using whether you are selecting for one or two plasmids and whether you are selecting for colonies in which two hybrid proteins are interacting The vectors carry different antibiotic markers so that they can be independently selected in E coli Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 15 Matchmaker Library Construction amp Screening Kits User Manual VI Protocol Overview One Hybrid Library Construction amp Screening Poly A RNA EAA VNAV PPP PIPPI PPP PPPS poly A 3 CDS III oligo dT or random primer First strand synthesis coupled with dC tailing by RT SMART IIl Oligonucleotide Template switching and extension by RT 5 m GGG AAD PP poly A CCC 3 3 Amplification by LD PCR NN 4 M uc ds cDNA with SMART III amp CDS Ill anchors Figure 6 Matchmaker One Hybrid Library Construction amp Screening Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual VI Proto
35. G J 2000 the Matchmaker Two Hybrid System Clontech Laboratories Inc www clontech com Protocol No PT3529 1 4 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Introduction continued Constructing and screening Matchmaker one hybrid and two hybrid libraries Constructing and screening Matchmaker one hybrid and two hybrid libraries consists of four main steps Figure 3 Notice that both procedures follow the same general path If you intend to screen for two hybrid interactions the first step Step 1 is to construct a DNA BD fusion vector If on the other hand you intend to screen for one hybrid interactions your first step is to construct a DNA target H S3 reporter vector Next Step 2 use the SMART reagents we provide to generate a cDNA library from the poly At or total RNA that you provide In the case of yeast two hybrid screening you may skip RNA isolation cDNA synthesis and AD fusion library construction Step 3 if instead of preparing your own library you intend to screen one of our many premade Matchmaker cDNA libraries Representing a broad range of tissues these libraries are available as glycerol stocks or pretransformed in yeast strain Y187 We also offer a Matchmaker Custom Library Service To use this service send us the tissue or cells you wish to screen and we will make the AD fusion library for you Please note however that many of our premade and pretransformed M
36. GGCGGCCGACATG d T VN 3 e 10 ul CDS III 6 Primer 10 uM 5 ATTCTAGAGGCCGAGGCGGCCGACATG NNNNNN 3 N A G C orT V A G or C e 20 ul MMLV Moloney Murine Leukemia Virus Reverse Transcriptase 7 ul RNase H 100 ul 5XFirst Strand Buffer 250 mM Tris pH 8 3 30 mM MgCl 375 mM KCI 100 ul DTT dithiothreitol 20 mM 5 ul Control Poly At RNA Human Placenta 1 ug ul 50 ul dNTP Mix dATP dCTP dGTP dTTP 10 mM each 500 ul Deionized H O Cat No 630445 only cDNA amplification 50 ul 5 PCR Primer 10 uM 5 TTCCACCCAAGCAGTGGTATCAACGCAGAGTGG 3 50 ul 3 PCR Primer 10 uM 5 GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACA 3 e 500yl 10X GC Melt Solution cDNA purification 10 CHROMA SPIN TE 400 Columns e 300 ul Sodium Acetate 3 M pH 4 8 One Hybrid Library Construction Cat No 630304 20 ug pHIS2 Reporter Vector 500 ng ul 20 ug pGADT7 Rec2 AD Cloning Vector Sma I linearized 500 ng ul 20 ug pGAD Rec2 53 Control Vector 500 ng ul 20 ug p53HIS2 Control Vector 500 ng ul 0 5 ml S cerevisiae strainY187 50 ml NaCl Solution 0 9 10g Leu DO Supplement 10g Trp DO Supplement 10g Leu Trp DO Supplement 10g His Leu Trp DO Supplement Two Hybrid Library Construction Cat No 630445 20 ug pGBKT7 DNA BD Cloning Vector 500 ng ul 25 ug pGADT7 Rec AD Cloning Vector Sma l linearized 500 ng ul 20 ug pGBKT7 53 Control Vector 500 ng ul 20 ug pGBKT7 Lam Control Vector 500 ng ul
37. J 1997 A novel reporter gene MEL7 for the yeast two hybrid system Anal Biochem 253 270 272 Arndt K T Styles C amp Fink G R 1987 Multiple global regulators control H S4transcription in yeast Science 237 874 880 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A amp Struhl K 1995 Current Protocols in Molecular Biology John Wiley amp Sons Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Bartel P L Chien C T Sternglanz R amp Fields S 1993a Using the two hybrid system to detect protein protein interactions In Cellular Interactions in Development A PracticalApproach ed Hartley D A Oxford University Press Oxford pp 153 179 Bartel P L Chien C T Sternglanz R amp Fields S 1993b Elimination of false positives that arise in using the two hybrid system BioTechniques 14 920 924 Bendixen C Gangloff S amp Rothstein R 1994 A yeast mating selection scheme for detection of protein protein interactions Nucleic Acids Res 22 1778 1779 Birnboim H C amp Doly J 1979 A rapid alkaline extraction procedure for screening recombinant plasmid DNA Nucleic Acids Res 7 1513 Borson N D Sato W L amp Drewes L R 1992 A lock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods amp Appl 2 144 148 Chen X Ru
38. Matchmaker Library Construction amp Screening Kits User Manual PT3529 1 PR6Z2169 Published 22 December 2006 Matchmaker Library Construction amp Screening Kits User Manual Table of Contents Introduction List of Components Additional Materials Required IV Yeast Strains 11 V Yeast Vectors 14 VI Protocol Overview One Hybrid Library Construction amp Screening 16 VI Protocol Overview One Hybrid Library Construction amp Screening 17 Vil Constructing a Reporter Vector for One Hybrid Analysis 18 VIII Constructing a DNA BD Fusion Vector for Two Hybrid Analysis 19 IX Generating a cDNA Library 21 X Constructing amp Screening One Hybrid and Two Hybrid Libraries overview 27 XI Constructing amp Screening a One Hybrid Library 28 XII Constructing amp Screening a Two Hybrid Library 30 Protocol A Screen by Yeast Mating 30 Protocol B Screen by Cotransformation 35 XIII Analyzing Positive Interactions 38 XIV Troubleshooting Guide 44 XV References 47 XVI Related Products 50 Appendix A Typical Results of ds cDNA Synthesis 52 Appendix B Preparation of Competent Yeast Cells LiAc Method 53 Appendix C One Hybrid Control Vector Information 54 Appendix D Two Hybrid Control Vector Information 55 List of Tables Table I Matchmaker Yeast Strain Genotypes 11 Table Il Matchmaker Yeast Strain Phenotypes 11 Table Ill One Hybrid System Vectors 14 Table IV Two Hybrid System Vectors 15 Table V Compari
39. PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual IX Generating a cDNA Library continued PLEASE READ ENTIRE PROTOCOL BEFORE STARTING e We suggest you also perform a positive control cDNA synthesis with Human Placenta Poly A RNA This control lets you verify that all components are working properly and lets you evaluate the yield and sizes of the ds cDNA synthesized from your RNA sample e Inthe protocols that follow you have the option of priming first strand cDNA synthesis with an oligo dT or random primer Sections F and G respectively The reaction conditions vary slightly depending on the primer used EF Synthesize First Strand cDNA using an Oligo dT Primer 1 Combine the following reagents in a sterile 0 25 ml microcentrifuge tube 1 2 ul RNA sample 0 025 1 0 ug poly A or 0 10 2 0 ug total RNA For the control reaction use 1 ul 1 ug of the control RNA 10 yl CDS III Primer 1 2 ul Deionized H O to bring volume up to 4 0 ul 4 0 yl Total volume Mix contents and spin briefly Incubate at 72 C for 2 min Cool on ice for 2 min Spin briefly Add the following to the reaction tube 2 0 ul 5X First Strand Buffer 10 ul DTT 20 mM 10 ul dNTP Mix 10 mM 1 0 ul MMLV Reverse Transcriptase 9 0 ul Total volume oan WN N Mix gently by tapping Spin briefly Incubate at 42 C for 10 min 9 Add 1 0 ul SMART III Oligonucleotide 10 Incubate at 42 C for 1 hr in an a
40. RAS and RAF and other protein kinases Proc Natl Acad Sci USA 90 6213 6217 Vojtek A Hollenberg S amp Cooper J 1993 Mammalian Ras interacts directly with the serine threonine kinase Raf Cell 74 205 214 Wang M M amp Reed R R 1993 Molecular cloning of the olfactory neuronal transcription factor Olf 1 by genetic selection in yeast Nature 364 121 126 Wei Z Angerer R C amp Angerer L M 1999 Identification of a new sea urchin ets protein SpEts4 by yeast one hybrid screening with the hatching enzyme promoter Mol Cell Biol 19 1271 1278 Wilson T E Fahrner T J Johnston M amp Milbrandt J 1991 Identification of the DNA binding site for NGFI B by genetic selection in yeast Science 252 1296 1300 Wu Y Liu Y Lee L Miner Z amp Kulesz Martin M 1994 Wild type alternatively spliced p53 binding to DNA and interaction with the major p53 protein in vitro and in cells EMBO J 13 4823 4830 Yang M Wu Z amp Fields S 1995 Protein peptide interactions analyzed with the yeast two hybrid system Nucleic Acid Res 23 7 1152 1156 Ye Q amp Worman H J 1995 Protein protein interactions between human nuclear lamins expressed in yeast Experimental Cell Res 219 292 298 Zhang X Settleman J Kyriakis J M Takeuchi Suzuki E Elledge S J Marshall M S Bruder J T Rapp U R amp Avruch J 1993 Normal and oncogenic p21 5 proteins bind to the amino terminal re
41. ROTOCOL BEFORE STARTING Before starting e Pour SD agar plates SD Leu 5 10 100 mm plates SD Trp 5 10 100 mm plates SD Leu Trp 5 10 100 mm plates SD His Leu Trp 50 150 mm plates SD Ade His Leu Trp X a Gal 50 150 mm plates Allow SD agar plates to dry at room temperature for 2 3 days or at 30 C for 3 hr before plating any transformation mixtures e Plan controls Step 3 Controls should be done in parallel with experimental work e Prepare Freezing Medium YPD medium with 25 v v glycerol e Prepare PEG LiAc Solution Section III 1 Cotransform yeast strain AH109 with ds cDNA pGADT7 Rec and pGBKT7 bait Important Note that you must prepare competent yeast cells before starting library construction Please take some time to review the procedure in Appendix B and plan your work accordingly a Prepare competent yeast cells Appendix B b In a sterile 15 ml tube combine the following e 20 ul ds cDNA from Section IX I Step 16 e 6ul pGADTT7 Rec 0 5 ug ul e b5yg pGBKT7 bait plasmid DNA x10 ul 20 yl Herring Testes Carrier DNA denatured Transfer 50 ul of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 15 ml reaction tube Add 600 yl of competent cells to the DNA Gently mix by vortexing Add 2 5 ml PEG LiAc Solution Gently mix by vortexing Incubate at 30 C
42. Version No PR6Z2169 53 Streak aYPDA agar plate with a small portion of frozen yeast stock e g AH109 orY187 If the tube has thawed prior to streaking vortex to ensure even distribution of the yeast cells Incubate the plate upside down at 30 C until colonies appear 3 days Yeast strains can be stored for up to 1 month at 4 C on YPDA medium in culture plates sealed with Parafilm Prepare 1 1XTE LiAc Solution Section III Prepare YPDA liquid medium Yeast Protocols Handbook Inoculate one colony x 4 weeks old 2 3 mm in diameter into 3 ml of YPDA medium in a sterile 15 ml centrifuge tube Matchmaker Library Construction amp Screening Kits User Manual Appendix C One Hybrid Control Vector Information 3 x p53 DNA elements EcoR 2 P minHIS3 HIS3 CEN6 ARS4 Xho 1 1051 3 UTR amp p53HIS2 T inHIS3 7 2 kb TRP1 Figure 15 Map of p53HIS2 Control Vector p53HIS2 is a yeast one hybrid reporter vector that serves as a positive control in the Matchmaker One Hybrid Library Construction amp Screening Kit Cat N o 630304 It contains 3 tandem copies of the consensus DNA binding site for p53 The three DNA targets are located upstream of the minimal promoter of the HIS3 locus P us and the H S3 nutritional reporter gene p53HIS2 is designed for use with pGAD Rec2 53 a plasmid that encodes murine p53 as a fusion to the GALA AD Yeast cells that contain both of these plasmids will dis
43. are more likely to represent biologically significant interactions Two hybrid interactions Clontech offers the following products for testing two hybrid interactions in mammalian cells ThepCMV Myc amp pCMV HAVectorSet Cat No 631604 for invivocoimmunoprecipitation in mammalian cells The CMV promoter in these vectors allows constitutive expression of the bait and library cDNA in a wide variety of mammalian cell types TheMammalianTwo HybridAssay Kit Cat No 630301 is ideal for confirming protein interactions via two hybrid interactions in mammalian cells One hybrid interactions One way to test one hybrid interactions in mammalian cells is to clone your DNA target into a mammalian reporter vector For example if your DNA target is part of larger cis acting regulatory sequence a promoter or promoter enhancer element the element can be cloned into one of our promoterless Living Colors Fluorescent Protein pSEAP or ppgal Reporter Vectors Similarly the cDNA encoding the putative DNA binding protein can be cloned into a constitutive mammalian expression vector such as plRES2 EGFP If the putative DNA binding protein functions as a transcriptional activator you may be able to detect its activity by cotransfecting cells with these vector constructs Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIV Trouble
44. ary Construction amp Screen Kit October 2000 Clontechniques XV 4 5 7 McNabb D S amp Guarente L 1996 Genetic and biochemical probes for protein protein interactions Curr Opin Biotechnol 7 b 554 559 Mendelsohn A R amp Brent R 1994 Biotechnology applications of interaction traps two hybrid systems Curr Opinion Biotechnol 5 482 486 Okayama H amp Berg P 1982 High efficiency cloning of full length cDNA Mol Cell Biol 2 161 170 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XV References continued Ozenberger B A amp Young K H 1995 Functional interaction of ligands and receptors of the hematopoietic superfamily in yeast Mol Endocrinol 9 1321 1329 Phizichy E M amp Fields S 1995 Protein protein interactions Methods for detection and analysis Microbiol Rev 59 94 123 Pringle J R Broach J R amp Jones E W eds 1992 The Molecular and Cellular Biology of the Yeast Saccharomyces Genome Dynamics Protein Synthesis and Energetics Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Ruden D M 1992 Activating regions of yeast transcription factors must have both acidic and hydrophobic amino acids Chromosoma 101 342 348 Ruden D M Ma J Li Y Wood K amp Ptashne M 1991 Generating yeast transcriptional activators containing no yeast
45. atchmaker cDNA Libraries are constructed in high copy yeast expression vectors ideal for two hybrid work but less suitable for one hybrid analysis We recommend using low copy vectors such as pGADT7 Rec2 and pHIS2 for one hybrid screening because they generate fewer false positives Following cDNA synthesis construct a GAL4 AD fusion library by cloning the cDNA into one of our Matchmaker AD Cloning Vectors pGADT7 Rec2 if you are constructing a one hybrid library pGADT7 Rec if you are constructing a two hybrid library The cloning takes place in vivo via homologous recombination Figure 4 Thissteptakes advantage ofthe highly efficientrecombination system in yeast to fuse ds cDNA with the appropriate GAL4 AD plasmid With recombination mediated cloning library construction and screening Steps 3 and 4 can be completed in quick succession without the need for any bacterial transformation or amplification steps Simply transform yeast with the cDNA library and the appropriate Matchmaker vectors then spread the cells on dropout medium to select for one hybrid or two hybrid interactions One Hybrid Library Construction amp Screening Two Hybrid Library Construction amp Screening Overview Section VI Overview Section VI 1 Construct a DNA target reporter vector 1 Construct a DNA BD fusion vector by cloning your DNA target sequence into pHIS2 by cloning your bait gene into pGBKT7 or Section VII other GAL4 DNA BD vector Section VIII 2 Gen
46. ation s ggrn anT7 RecT AH109 in vivo 2 pGBKT7 53 Y187 pGBKT7 53 3 pGBKT7 Lam Y187 pGBKT7 Lam Component 1 ul 2 ul 3 ul SV40 LargeT PCR Fragment 25 ng ul 5 0 pGADT7 Rec Sma l linearized 500 ng ul 0 5 pGBKT7 53 500 ng ul 0 5 pGBKT7 Lam 500 ng ul 0 5 Herring Testes Carrier DNA 10 mg ml denatured 5 5 5 AH109 competent yeast cells 50 Y187 competent yeast cells 50 50 PEG LiAc Solution 500 500 500 Select for transformants by plating on SD Leu SD Trp SD Trp Transfer 50 ul of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 1 5 ml reaction tube a Prepare competent yeast cells Appendix B b Set up three 1 5 ml microcentrifuge tubes Add DNA competent yeast cells and PEG LiAc Solution using the volumes and in the order indicated Table IX c Mix thoroughly by gently vortexing d Incubate at 30 C for 30 min Vortex gently every 10 min e Add 20 ul of DMSO to each tube mix and then place the tube in a 42 C waterbath for 15 min Vortex gently every 5 min f Centrifuge at high speed in a microcentrifuge for 15 sec Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 33 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Scre
47. b In a sterile prechilled 15 ml tube combine the following e 20 ul ds cDNA from Section IX I Step 16 e 6 ul pGADT7 Rec 0 5 ug ul e 20 ul Herring Testes Carrier DNA denatured Transfer 50 ul of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 15 ml reaction tube Add 600 yl of competent cells to the DNA Gently mix by vortexing Add 2 5 ml PEG LiAc Solution Gently mix by vortexing Incubate at 30 C for 45 min Mix cells every 15 min Add 160 ul DMSO mix and then place the tube in a 42 C water bath for 20 min Mix cells every 10 min i Centrifuge at 700 x g for 5 min j Discard the supernatant and resuspend in 3 ml of YPD Plus Liquid Medium Note YPD Plus is specially formulated to promote transformation Do not use standard YPD medium for this step 20 0 20 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 30 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol A continued k l m Incubate at 30 C with shaking for 90 min Centrifuge at 700 x g for 5 min Discard the supernatant and resuspend in 30 ml of NaCl Solution 0 9 2 Select transformants on SD Leu plates a b C Spread 150 ul on each 150 mm plate 200 plates total
48. bes Note l that a conventional tapered 1 5 ml microcentrifuge tube can be substituted for the 2 ml collection tube This will allow the sample to be confined to a narrower area for easier handling 2 ml Collection Tubes 3 Centrifuge at 700 x g for5 min After centrifugation the column matrix will appear semi dry This step purges the equilibration buffer from the column and re establishes the matrix bed Note The column fitted in the 2 ml microcentrifuge tube can be placed inside a 17 x 100 mm polypropylene tube during centrifugation in a swinging bucket rotor 4 Remove the spin column and collection tube from the centrifuge rotor and discard the collection tube and column equilibration buffer Note Always hold both the CHROMA SPIN Column and the 2 ml microcentrifuge tube when removing them from the rotor 5 Place the spin column into the second 2 ml microcentrifuge tube Carefully and slowly apply your cDNA sample 95 ul from Step IX H 7 to the center of the gel bed s flat surface Do not allow any sample to flow along the inner wall of the column Note A conventional tapered 1 5 ml microcentrifuge tube can be substituted for the 2 ml collection tube This will allow the sample to be confined to a narrower area for easier handling 6 Centrifuge at 700 x g for 5 min 7 Remove the spin column and collection tube from the rotor and detach them from each other The purified sample is at the bottom of the collection tube Note
49. bock M J amp Whitman M 1996 A transcriptional partner for MAD proteins in TGF b signalling Nature 383 691 696 Chenchik A Diatchenko L Chang C amp Kuchibhatla S January 1994 Great Lengths cDNA Synthesis Kit for high yields of full length cDNA Clontechniques IX 1 9 12 Chenchik A Zhu Y Y Diatchenko L Li R Hill J amp Siebert P D 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In Gene Cloning and Analysis by RT PCR BioTechniques Books MA pp 305 319 Chien C T Bartel P L Sternglanz R amp Fields S 1991 The two hybrid system A method to identify and clone genes for proteins that interact with a protein of interest Proc Nat Acad Sci USA 88 9578 9582 Chomczynski P amp Sacchi N 1987 Single step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction Anal Biochem 162 156 159 D Alessio J M amp Gerard G F 1988 Second strand cDNA synthesis with E coli DNA polymerase and RNase H the fate of information at the mRNA 5 terminus and the effect of E coli DNA ligase Nucleic Acids Res 16 1999 2014 Dalton S amp Ireisman R 1992 Characterization of SAP 1 a protein recruited by serum response factor to the c fos serum response element Cell 68 597 612 Durfee T Becherer K Chen P L Yeh S H Yang Y Kilbburn A E Lee W H amp Elledge S J 1993 The retinoblastoma p
50. chmaker one hybrid assay potential DNA binding proteins are expressed as fusions to the GALA activation domain AD by cloning the corresponding cDNA into pGADT7 Rec2 a low copy vector designed for one hybrid screening One or more tandem copies of the target DNA sequence are cloned into pHIS2 a reporter vector that contains the nutritional reporter gene H S3 Interaction between a DNA binding protein and the target sequence stimulates transcription of HIS3 Figure 1 enabling the yeast host strain Y187 a His auxotroph to grow on minimal media lacking histidine Principle of the two hybrid assay a protein protein interaction assay Two hybrid assays can be used to identify novel protein protein interactions confirm suspected interactions and define interacting domains In a Matchmaker Two Hybrid assay a bait gene is expressed as a fusion to the GAL4 DNA binding domain DNA BD while another gene or cDNA is expressed as a fusion to the GAL4 activation domain AD Fields amp Song 1989 Chien et al 1991 When bait and library fusion proteins interact in a yeast reporter strain such as AH 109 the DNA BD and AD are brought into proximity and activate transcription of the reporter genes ADE2 HIS3 lacZ and MEL1 Figure 2 DNA BD and AD fusions are created by cloning cDNAs into the yeast expression vectors pGBKT7 and pGADT7 Rec pGBKT7 expresses proteins as fusions to the GAL4 DNA BD while pGADT7 Rec expresses proteins as fusions to t
51. chmaker yeast one hybrid assays Itis notintendedto serve asa cloning vector nor is it intended to be used as a source of murine p53 cDNA Instead use pGAD Rec2 53 with p53HIS2 to produce a positive control yeast strain Yeast strains AH109 and Y187 which are normally unable to grow on histidine deficient media will grow on medium lacking histidine when transformed with pGAD Rec2 53 and p53HIS2 Transformants acquire the ability to synthesize histidine as a result of the interaction between the GAL4 AD p53 fusion expressed by pGAD Rec2 53 and the p53 consensus DNA binding sequence in p53HIS2 Upon binding the consensus sequence the GAL4 AD p53 fusion stimulates transcription of the H S3 reporter gene in p53HIS2 and confers the His phenotype to the host pGAD Rec2 53 contains an autonomous replication sequence ARS4 and LEU2 nutritional marker for replication and selection in yeast the centromeric sequence CEN6 ensures proper segregation of the plasmid during mitosis and meiosis The vector also contains a pUC ori and ampicillin resistance gene Amp for propagation and selection in E coli This vector has not been completely sequenced Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Appendix D Two Hybrid Control Vector Information i SV40 NLS Amp GAL4 AD pGADT7 RecT 10 0 kb HA epitope tag Large T pUC
52. col Overview Two Hybrid Library Construction amp Screening Construct a DNA BD Fusion Section VII Clone bait gene into pGBKT7 or other Generates cONA Library Matchmaker GAL4 based DNA BD vector Prepare competent 4 M yeast cells Appendix B 100 ng of total RNA or 25 ng of poly A RNA Transform AH109 and Y187 with bait plasmid Y Test for autonomous reporter gene activation and cell toxicity Synthesize first strand cDNA Go e Amplify ds cDNA by LD PCR EAE Purify size select ds cDNA Prepare Y187 cells See Troubleshooting for mating Guide Protocol B Construct an AD Fusion Library Screen by Cotransformation Section XII Protocol A Construct an AD Fusion Library Screen by Yeast Mating Section XII Prepare competent AH109 yeast cells Appendix B Library Construction Three Step Library Construction One Step Cotransform yeast strain AH109 with Cotransform yeast strain AH109 with ds cDNA ds cDNA pGADT7 Rec e pGADT7 Rec DNA BD bait plasmid Select transformants on SD Leu Two Hybrid Screening Select for transformants expressing Harvest Pool Transformants interacting proteins Analysis Two Hybrid Screening Verify positive interactions Mate with Y187 pretransformed with DNA BD bait plasmid i Select for yeast diploids expressing interacting proteins Y Analysis Verify positive interactions Figure 7 Matchmaker Library Construc
53. ction in E coli Note Bait pasmids used with previous versions of our two hybrid and one hybrid systems contained the gene for ampicillin resistance Bait plasmids used with newer versions of our kits however contain the gene for kanamycin resistance If you used bait and library plasmids that contain different antibiotic selection markers a Transform the isolated plasmid extract from yeast into a general purpose E coli strain b Plate the transformants on LB medium containing ampicillin to select for the AD library plasmid only If you used bait and library plasmids that containthesame antibiotic selection marker a Transform the yeast purified plasmid into KC8 E coli cells b Plate the transformants on M9 medium lacking leucine to select for the AD library plasmid only Note KC8 cells have a defect in euB that can be complemented by yeast LEU2 3 Purify the AD library plasmid using any suitable method 4 Amplify the cDNA insert by PCR using the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 and the Advantage 2 PCR Kit Cat No 639206 5 Analyze the PCR product as described in Part C Clontech Laboratories Inc www clontech com Protocol No PT3529 1 38 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions continued Retest the phenotype Rescue the library cDNA insert using one of the following procedu
54. d an empty bait plasmid either pHIS2 or pGBKT7 depending on the system you are using Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions continued If you are retesting a one hybrid interaction and a non binding mutant of your target element is available consider using it as an additional negative control Prepare a mutant type construct otherwise identical to your original target reporter construct and transform Y187 with the mutant reporter plasmid the candidate cDNA insert and pGADT7 Rec2 Colonies should result from transcriptional activation using the wild type but not the mutant type target For an example see Li amp Herskowitz 1993 b Plate on the appropriate SD dropout medium c Incubate plates at 30 C until colonies appear 2 Yeast Mating The following procedure describes how yeast mating can be used to retest positive two hybrid interactions If you have access to a MATa strain such as AH109 a similar approach could be used for the analysis of one hybrid interactions in which case the DNA BD bait plasmid is replaced by the pHIS2 reporter plasmid If you have many positive clones to analyze it will be more convenient to handle the clones in batches of 10 or so each a Transform AH109 with the AD library plasmid s and select on SD Leu b Transform Y187 or
55. de to yeast genetics and molecular biology Methods in Enzymology Academic Press San Diego 194 1 932 Gyuris J Golemis E Chertkov H amp Brent R 1993 Cdi1 a human G1 and S phase protein phosphatase that associates with Cdk2 Cell 75 791 803 Hagen F S Gray C L amp Kuijper J L 1988 Assaying the quality of cDNA libraries Bio Techniques 6 4 340 345 Harper J W Adami G R Wei N Keyomarsi K amp Elledge S J 1993 The p21 Cdk interacting protein Cip1 is a potent inhibitor of G1 cyclin dependent kinases Cell 75 805 816 Heslot H amp Gaillardin C eds 1992 Molecular Biology and Genetic Engineering of Yeasts CRC Press Inc Hill J Donald K A amp Griffiths D E 1991 DMSO enhanced whole cell yeast transformation Nucleic Acids Res 19 5791 Holm C 1993 A functional approach to identifying yeast homologs of genes from other species In Methods A Companion to Methods in Enzymology 5 102 109 Hopkin K 1996 Yeast two hybrid systems more than bait and fish J NIH Res 8 27 29 Huynh T V Young R A amp Davis R W 1985 DNA Cloning A Practical Approach ed Glover D M IRL Press Oxford Ito H Fukada Y Murata K amp Kimura A 1983 Transformation of intact yeast cells treated with alkali cations J Bacteriol 153 163 168 Iwabuchi K Li B Bartel P amp Fields S 1993 Use of the two hybrid system to identify the domain of p53 involved in olig
56. e briefly 4 Overlay the reaction mixture with 2 drops of mineral oil if necessary Cap the tube and place it in a preheated 95 C thermal cycler 5 Begin thermal cycling If you have a hot lid thermal cycler use the following program e 95 C 30 sec e x cycles 95 C 10sec 68 C 6 min 68 C 5min Refer to Table VI to determine the optimal number of cycles to use B Program the cycler to increase the extension time by 5 sec with each successive cycle For example in the second cycle the extension should last 6 min and 5 sec in the third 6 min and 10 sec And so on Note These cycling parameters may not be optimal for non hot lid thermal cyclers 6 When the cycling is complete analyze a 7 ul aliquot ofthe PCR product from each sample alongside 0 25 ug of a 1 kb DNA size marker on a 1 2 agarose EtBr gel Typical results obtained with Human Placenta Poly At RNA are shown in AppendixA If your PCR product does not appear as expected refer to the Troubleshooting Guide 7 Proceed with Section or store ds cDNA at 20 C until use I Purify ds cDNA with a CHROMA SPIN TE 400 Column CHROMA SPIN Columns are packed with resins that fractionate molecules based on size Molecules larger than the pore size are excluded from the resin These molecules quickly move through the gel bed when the column is centrifuged while molecules smaller than the pore size are held back Inthe following protocol a CHROMA SPINTE 400 Column
57. e markers 1 kb DNA ladder 1 2 Agarose EtBr gel cDNA size fractionation e 1 5 ml sterile microcentrifuge tubes Ring stand with small clamp for holding CHROMA SPIN columns e 95 ethanol 20 C 1 xylene cyanol Constructing bait plasmids e Competent E coli cells Use a general purpose strain such as DH5a or Fusion Blue Competent Cells Cat No 636700 Fusion Blue Competent Cells are an E coli K 12 strain that provides high transformation efficiency paired with blue white screening capability when used with the appropriate plasmids The strain carries recA and endA mutations that make it a good host for obtaining high yields of plasmid DNA T4 DNA ligase e 10X T4 ligation buffer Sambrook et al 1989 or the buffer provided with the enzyme LB amp plates e 50 mM NaCl Materials for purifying plasmid from E coli transformants Yeast transformation Prepare reagents in sterile containers PEG LiAc Solution polyethylene glycol 3350 lithium acetate Prepare a fresh 10 ml solution just prior to transformation using the stock solutions provided Mix 8 ml of 50 PEG 3350 with 1 ml of 10XTE Buffer and 1 ml of 1M LiAc 10X 1 1XTE LiAc Solution Should be freshly prepared before each transformation using the stock solutions provided Combine 1 1 ml of 10XTE with 1 1 ml of 1 M LiAc 10X Bring the total volume to 10 ml using sterile deionized H O Dimethyl Sulfoxide DMSO Sigma Cat No D8418 Pro
58. e significantly higher than that of conventional PCR Barnes 1994 Poly A RNA BS DPPPP PP PPP DPD PP PPPS ply A 3 CDS III oligo dT or random primer First strand synthesis coupled with dC tailing by RT Y 666 nnn poly A 5 cce ET SMART III Oligonucleotide Template switching and extension by RT Y 5 mmm GGG V poly A wm CCC 3 Amplification i by LD PCR e D a ds cDNA with SMART III amp CDS Ill anchors Figure 8 Synthesis of high quality ds cDNA using SMART technology Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 21 Matchmaker Library Construction amp Screening Kits User Manual IX Generating a cDNA Library continued C Good Laboratory Practices Wear gloves to protect your RNA and cDNA samples from degradation by nucleases When resuspending pellets or mixing reactions gently pipet the solution up and down or tap the bottom of the tube Spin briefly to bring contents to the bottom of the tube Do not vortex samples when resuspending pellets vortexing may shear your cDNA Perform all reactions on ice unless otherwise indicated Add enzymes to reaction mixtures last Be sure the enzyme is thoroughly blended into the reaction mixture by gently pipetting the mixture up and down Do not increase the size volume of any of the reactions All components have been optimized for the volumes spec
59. e sterile 5 mm glass beads to promote even spreading of the cells Incubate plates colony side down at 30 C for 3 5 days to allow diploid cells to form visible colonies Score for growth Calculate the mating efficiency Confirm nutritional and reporter phenotypes of diploids Table X Pick representative colonies from selection plates Streak onto fresh medium After colonies have grown seal plates with Parafilm and store at 4 C For long term storage gt 2 weeks prepare glycerol stock cultures and freeze at 70 C These diploids are useful as reference strains when you wish to check a new batch of SD selection medium TABLE X SET UP FOR CONTROLTWO HYBRID MATINGS Cross Plate on SD Minimal Media Phenotype 100 mm plates Mel1 His Ade Positive Control AH109 pGADT7 RecT xY187 pGBKT7 53 Leu TIrp Leu Trp Ade His Leu Trp X a Gal Blue Negative Control AH109 pGADT7 RecT x Y187 pGBKT7 Lam Leu TIrp Leu Trp Ade His Leu Trp X a Gal no colonies Spread 100 yl aliquots of 1 10 and 1 100 dilutions of the mating culture P Use these plates to calculate the mating efficiency Clontech Laboratories Inc www clontech com Protocol No PT3529 1 34 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol B Protocol B Screen by Cotransformation PLEASE READ ENTIRE P
60. elds of ds cDNA may be due to PCR undercycling If you suspect undercycling incubate the PCR reaction mixture for two more cycles and recheck the product If you already used the maximum recommended number of cycles increase by three more cycles If additional cycles do not improve the yield of PCR product repeat the PCR using a fresh aliquot of the first strand product A low yield of ds cDNA may also be due to a low yield of first strand cDNA Possible problems with the first strand reaction include a mistake in the procedure such as using a suboptimal incubation temperature or omitting a component or insufficient RNA in the reaction It is also possible that the RNA has been partially degraded by contaminating RNases before the first strand synthesis Problems with the first strand cDNA synthesis can be more easily diagnosed if you perform parallel reactions using the control RNA provided in the kit If good results were obtained with the control RNA but not with your experimental RNA then there may be a problem with your RNA Size distribution of ds cDNA is less than expected Your RNA starting material may be degraded very impure or too dilute Check the quality and quantity of your RNA by running a sample on a gel If the RNA seems too dilute but otherwise of good quality restart the experiment using more RNA If the RNA seems degraded restart the experiment using a fresh lot or preparation of RNA Also check the stability of you
61. ells every 10 min Centrifuge at 700 x g for 5 min 10 Discard the supernatant and resuspend in 3 ml of YPD Plus Liquid Medium Note YPD Plusis specially formulated to promote transformation Do notuse standardYPD medium for this step 11 Incubate at 30 C with shaking at 265 rpm for 90 min 12 Centrifuge at 700 x g for 5 min 13 Discard the supernatant and resuspend in 6 ml of NaCl Solution 0 9 o 090 RU co B Select for One Hybrid Interactions 1 To determine the transformation efficiency and to calculate the number of clones screened spread 100 ul of a 1 10 1 100 and 1 1 000 dilution onto 100 mm SD Leu SD Trp and SD Leu Trp agar plates 2 Spread the remaining mixture on SD His Leu Trp optimal 3 AT plates 150 ul cells 150 mm plate to select for one hybrid interactions 3 Incubate at 30 C for 3 7 days until colonies appear 4 Calculate the transformation efficiency and number of clones screened a Colonies on SD Leu x dilution factor volume ml plated x 6 ml sitransformants per 3 ug pGADT7 Rec2 Expected 21 x 108 transformants 3 ug pGADT7 Rec2 b Colonies on SD Leu Trp x dilution factor volume ml plated x 6 ml clones screened Expected 23 x 10 clones library Clontech Laboratories Inc www clontech com Protocol No PT3529 1 28 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XI Constructing amp Screening a One Hybrid Library c
62. ells transformed with the DNA BD bait plasmid If the bait strain grows noticeably slower your DNA BD bait protein may be toxic Note We also recommend checking for toxicity in strain AH109 e UseaSmall ScaleYeastTransformation Protocol such as the one given in Section XII A 7 to prepare transformants Select transformants on SD Trp then prepare an overnight culture as follows 1 Inoculate 50 ml of SD Trp Kan 20 ug ml with one large 2 3 mm colony 2 Incubate at 30 C overnight 16 24 hr with shaking at 250 270 rpm 3 Check the ODgo of the culture it should be 20 8 If the ODso is much less than 0 8 the DNA BD fusion may be toxic see the Troubleshooting Guide If the fusion does not appear to hamper yeast growth i e is nontoxic and you plan to screen your two hybrid library by yeast mating continue with Steps 4 7 If you are planning to screen by cotransformation you may stop here and proceed to Section IX 4 Centrifuge at 600 x g for 5 min Remove supernatant 6 Resuspend in 5 ml SD Trp liquid medium Count cells using a hemacytometer The cell density should be 21 x 10 cells ml 7 Mate this bait strain with your AD fusion library host strain Section XII A 4 Note Y187 MATa can mate with AH109 HF7c CG 1945 Y190 or SFY526 all MATa o1 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 20 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual
63. en the GAL4 AD and large T antigen e p53 and SV40 largeT antigen interact in a yeast two hybrid assay Li amp Fields 1993 Iwabuchi et al 1993 b Negative Control e pGBKT7 Lam encodes a fusion of the GAL4 DNA BD with human lamin C and provides a control for a fortuitous interaction between an unrelated protein and either the pGADT7 RecT control or your AD library plasmid Lamin C neither forms complexes nor interacts with most other proteins Bartel et al 1993b S Fields pers comm Ye amp Worman 1995 TABLE IV TWO HYBRID SYSTEM VECTORS Use Epitope Yeast selection Bacterial selection Cloning vectors pGBKT7 Express any protein c Myc TRP1 kanamycin as a GALA DNA BD fusion pGADT7 Rec Express any protein as a HA LEU2 ampicillin Sma l linearized GALA AD fusion Control vectors pGADT7 RecT gt Express SV40 large T antigen HA LEU2 ampicillin as a GALA AD fusion pGBKT7 53 Express p53 as a GAL4 c Myc TRP1 kanamycin DNA BD fusion pGBKT7 Lam Express lamin C as a GALA c Myc TRP1 kanamycin DNA BD fusion HA hemagglutinin These epitope tags can be used to verify protein protein interactions in vitro by coimmunoprecipitation Co IP using the antibodies and protocol provided with the Matchmaker Co IP Kit Cat No 630449 They are not intended to be used for detection affinity purification or Co IP of hybrid proteins expressed in yeast Created by homologous recombination in vivo by cotransforming yeast with SV
64. ening a Two Hybrid Library Protocol A continued g h i Remove supernatant and resuspend in 1 ml of YPD Plus Liquid Medium Incubate at 30 C for 90 min Centrifuge at high speed for 15 sec Discard the supernatant and resuspend in 1 ml of NaCl Solution by gently pipetting up and down Spread 100 ul of a 1 10 1 100 and 1 1 000 dilution onto 100 mm plates containing SD Leu or SD Trp depending on the nutritional marker carried by the plasmid Table IX Incubate the plates at 30 C face down for 2 4 days until colonies appear Pick the largest colonies and restreak them on the same selection medium Seal these master plates with Parafilm and store at 4 C not longer than 1 month Use these colonies for the control matings in Section 8 8 Controls for Protocol A Small Scale Yeast Mating a sa a Pick one colony of each type i e AH109 pGBKT7 RecT Y187 pGBKT7 53 and Y187 pGBKT7 Lam to use in the mating Use only large 2 3 mm fresh lt 2 weeks old colonies from the master plates Place both colonies in one 1 5 ml microcentrifuge tube containing 0 5 ml of 2XYPDA medium Vortex the tube for 1 min to completely resuspend the cells Incubate at 30 C overnight 20 24 hr with shaking Note Use the lowest shaking speed possible to prevent cells from settling Vigorous shaking can reduce the mating efficiency Plate cells on SD minimal media Table X 100 ul cells 100 mm plate Us
65. equences UASs and TATA boxes Figure 5 The ADE2 reporter alone provides strong nutritional selection For higher stringency and to reduce the incidence of false positives select for ADE2 and HISS3 James et al 1996 You also have the option of assaying for MEL1 which encodes a galactosidase MEL1 is endogenous to both Y187 and AH109 Because a galactosidase is a secreted enzyme its activity can be detected by adding X a Gal Cat No 630407 to the selection plate If MEL1 is active and X a Gal is present the colony will turn blue lacZ inY187 exhibits a high level of induced B galactosidase activity in a positive two hybrid assay because it is under the control of the intact GAL7 UAS AH109 Constructs GAL1 UAS GAL1 TATA HIS3 GAL2 TATA ADE2 MEL1 UAS MEL1 TATA TA MEL1 UAS MEL1 TATA Y187 Constructs GAL1 UAS GAL1TATA lacZ Figure 5 Reporter gene constructs in yeast strainsAH109 andY187 Strain AH109 is a derivative of strain PJ69 2A and includes the ADE2and HlS3nutritional markers James etal 1996 MEL1isan endogenous GAL4 responsive gene The acZreporter gene was introduced into PJ69 2A to create strain AH109 The HIS3 ADE2 and MEL 1 lacZreporter genes are under the control of three completely heterologous GAL4 responsive UAS and promoter elements GAL1 GAL2 and MEL1 respectively Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screen
66. erate a cDNA library from any tissue or cell source using SMART cDNA Synthesis technology Section IX 3 Construct a GAL4 AD fusion library using homologous recombination Sections XI amp XII 4 Screen for one hybrid or two hybrid interactions by yeast mating or transformation Sections XI amp XII Figure 3 General steps of yeast one hybrid and two hybrid screening For more detailed flow charts of the one hybrid and two hybrid procedures please refer to Figures 6 and 7 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual l Introduction continued SMART cDNA synthesis and amplification by LD PCR Step 1 cDNA synthesis E 5 hours ds cDNA with SMART III amp CDS IIl anchors protein bait MCS Kan pGBKT7 Two Hybrid DNA BD Vector pGADT7 Rec 2 AD Vector Sma l linearized LEU2 GAL4 DNA BD GAL4 AD TRP1 de N pGBKT7 or P Steps 2 amp 3 DNA target f Library construction Amp in vivo cloning PHIS2 2 hours ran One Hybrid Reporter Vector Prepare competent yeast cells and TRP1 transform pGADT7 Rec 2 GALA AD AD Vector ES Sma V linearized Amp Homologous recombination in yeast mediates GAL4 AD Vector assembly Plate on selective medium Step 4 to screen for one hybrid or Screening two hybrid interactions 3 days
67. for 45 min Mix cells every 15 min Add 160 ul DMSO mix and then place the tube in a 42 C water bath for 20 min Mix cells every 10 min i Centrifuge at 700 x g for 5 min j Discard the supernatant and resuspend in 3 ml of YPD Plus Liquid Medium Note YPD Plus is specially formulated to promote transformation Do not use standard YPD medium for this step k Incubate at 30 C with shaking for 90 min l Centrifuge at 700 x g for 5 min m Discard the supernatant and resuspend in 6 ml of NaCl Solution 0 9 Frown ao 2 Select for transformants expressing interacting proteins a Spread the cotransformation mixture onTDO or ODO plates 150 ul cells 150 mm plate TDO stands forTriple Dropout Medium SD His Leu Trp ODO stands for Quadruple Dropout Medium SD Ade His Leu Trp See Figure 11 Note Determine the transformation efficiency as follows i Remove a 30 ul aliquot from the 6 ml suspension and dilute with 720 ul of NaCl Solution for a final volume of 750 ul ii Spread 150 ul aliquots of this dilution on two separate 150 mm plates SD Leu Trp and SD Leu Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 35 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol B continued b Incubate at 30 C until colonies appear After 2 3 days some colonies will be visible but plates sh
68. gulatory domain of c Raf 1 Nature 364 308 313 Zhu L amp Hannon G J 2000 Yeast Hybrid Technologies Eds Zhu L amp Hannon G J Eaton Publishing BioTechniques Books Division Natick MA Zhu Y Y Machleder E M Chenchik A Li R and Siebert P D 2001 Reverse transcriptase template switching A SMART approach for full length cDNA library construction Biotechniques 30 892 897 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 49 Matchmaker Library Construction amp Screening Kits User Manual XVI Related Products For the latest and most complete listing of all Clontech products please visit www clontech com Products RNA isolation cDNA synthesis PCR purification e NucleoTrap mRNA Kit Mini or Midi sizes e NucleoSpin RNA II Kit NucleoSpin Extraction Kit Advantage 2 PCR Kit Advantage 2 Polymerase Mix Poly A RNA Total RNA e Human b Actin Control Amplimer Set Mouse b Actin Control Amplimer Set e Rat b Actin Control Amplimer Set e CHROMA SPIN TE 400 Columns e SMART PCR cDNA Synthesis Kit Yeast culture amp plasmid isolation e Yeastmaker Yeast Transformation System 2 e Yeastmaker Yeast Plasmid Isolation Kit e YPD Medium e YPD Agar Medium e Minimal SD Base contains glucose Minimal SD Agar Base contains glucose Dropout DO Supplements for use with any SD Base Two Hybrid screening amp analysis e Match
69. he 3 AD Sequencing Primer provided with MatchmakerTwo Hybrid System 3 Cat No 630303 Always check the vector sequence against the primer you wish to use Be aware that some Matchmaker AD plasmids e g pACT2 do not contain aT7 Promoter Verify the presence of an open reading frame ORF fused to the GAL4 AD sequence and compare the sequence to those in GenBank EMBL or other databases f your sequencing results reveal a very short peptide 10 amino acids fused to the AD or no fusion peptide at all keep sequencing beyond the stop codon You may find another larger open reading frame ORF Such gaps can occur when a portion of the 5 untranslated region of an mRNA is cloned along with the coding region A Western blot will reveal the presence and size of an AD fusion protein Insome cases two different ORFs may be expressed as a fusion with the AD even though a nontranslated gap comes between them due for example to occasional translational read through If yoursequencing results fail to reveal any ORF in frame with theAD coding region itcould be thatthe positive library clone is transcribed inthe reverse orientation from a cryptic promoter within the ADH1 terminator Chien etal 1991 Yeast also allowtranslational frameshifts A large ORF in the wrong reading frame may actually correspond to the expressed protein E Segregation of AD Library Plasmids Use one of the following procedures when a positive one hybrid or
70. he GALA AD In yeast both fusions are expressed at high levels from the constitutive ADH1 promoter P 5 Other GAL4 based DNA BD cloning vectors such as pGBTY pAS2 1 and pBridge are also compatible with this kit pBridge Vector can be used to perform three hybrid assays to identify ternary protein complexes H H Transcription E for one hybrid and two NEM Y Y Library One hybrid and two hybrid methods are protein based on the finding that many eukaryotic transcription transcription factors are modular their OQ lt gt ninina promoter EE transcription activating and DNA binding domains are structurally and functionally Figure 1 Screening for protein DNA interactions with the distinct This allows researchers to con Matchmaker One Hybrid System In this construct three copies of the DNA target T have been inserted into the struct various gene fusions that when pHIS2 reporter vector expressed as fusion proteins in yeast can simultaneously bind to a target DNA sequence and activate transcription of a downstream reporter Figures 1 and 2 um SENIUM transcription Matchmaker systems usethe transcription GALUAS minimalpromoter ADEZ HIS3 lacZ and MEL1 activating and DNA binding domains of GALA a well characterized yeasttranscrip tion factor To learn more about GAL4 based yeast hybrid technology see Zhu Figure 2 Screening for protein protein interactions with L amp Hannon
71. ian cell types using RevTet On amp RevTet Off Gene Expression Systems Retest the interaction in mammalian cells Matchmaker Mammalian Two Hybrid Assay Kit pCMV Myc amp pCMV HA Vector Set Isolate the full length cDNA from one of the following SMART cDNA libraries t lvzedib e SMART Libraries in Creator Donor Vectors Catalyzed y e Large Insert cDNA Libraries e DAE min Gene transfer Your own Acceptor Vector Map the interacting domain s Diversify PCR Random Mutagenesis Kit Figure 12 Strategies for analyzing and verifying putative positive one hybrid and two hybrid interactions Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 39 Matchmaker Library Construction amp Screening Kits User Manual XIII Analyzing Positive Interactions continued PCR Colony Screening This procedure uses the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 and Advantage 2 PCR Polymerase Mix We recommend using the Advantage 2 Polymerase Mix rather than any other DNA polymerase formulation because we find that it performs well in yeast cell samples and because it is optimized for applications that involve longer templates and require high fidelity 1 Preheat a PCR thermal cycler to 94 C 2 PlacetheAdvantage 2PCR Kitcomponents and GALAAD LD Insert Screening Amplimers onice and allow them to thaw completely Mix each componentthoroughly before use 3
72. ified Ethidium bromide is a carcinogen Use appropriate precautions in handling and disposing this reagent For more information see Sambrook etal 1989 BondEx Ethidium Bromide Detoxification Cartridges are available from Clontech Phenol is acorrosive Always wear gloves and protective clothing when handling solutions containing this reagent If possible handle solutions containing phenol and or chloroform under a chemical fume hood In preparing your reactions use the Deionized H O supplied Otherwise use freshly deionized e g Milli O grade H O without treatment with DEPC diethyl pyrocarbonate Avoid using autoclaved H O because recycled steam in some autoclaves can introduce contaminants that may interfere with PCR Rinse all glassware with 0 5 N NaOH followed by deionized H O Then bake the glassware at 160 180 C for 4 9 hr Use only single use plastic pipettes and pipette tips when handling RNA D RNA Isolation Many procedures are available for the isolation of total RNA and poly At RNA Chomczynski amp Sacchi 1987 Farrell 1993 Sambrook et al 1989 Clontech offers several kits for the isolation of total RNA and subsequent isolation of poly A RNA see Related Products The minimum amountof starting material for cDNA synthesis is 100 ng oftotal RNAor25ng of polyA RNA In general the more RNA you start with the fewer PCR cycles will be required for amplification seeTableVI Fewer thermal cycles are less likel
73. ing Kits User Manual IV Yeast Strains continued F Leaky HIS3 expression e 3 amino 1 2 4 triazole 3 AT is a competitive inhibitor of the yeast H S3 protein His3p 3 AT is used to inhibit low levels of His3p expressed in a leaky manner and thus to suppress background growth on SD medium lacking histidine Fields 1993 Durfee et al 1993 e Transformants derived from AH109 may show slightly elevated H S3 expression because of intrinsic DNA binding properties of the bait protein A small amount of 3 AT is generally sufficient to suppress background growth on SD His However if you are selecting for both HIS3 and ADE2 expression it is generally not necessary to suppress H S3 leakiness in the initial library screen e Some yeast strains have relatively high basal levels of His3p If you useY190 MATa as a host strain 25 45 mM 3 AT willbe required inthe medium to suppress background growth To optimize the 3 AT concentration in your selection medium Before starting this procedure note that His Trp Dropout Supplement is not supplied with this kit You must purchase His Trp dropout supplement separately or prepare your own using the recipe given in Appendix C of the Yeast Protocols Handbook PT3024 1 1 Plate yeast transformants on a series of SD His Trp plates containing different concentrations of 3 AT e f you are working with AH109 transformants containing DNA BD plasmids such as pGBKT7 we recommend you start by
74. ir incubator or hot lid thermal cycler Note If you use a water bath or non hot lid thermal cycler for this incubation cover the reaction mixture with one drop of mineral oil before you close the tube This will prevent loss of volume due to evaporation co 11 Place the tube at 75 C for 10 min to terminate first strand synthesis 12 Cool the tube to room temperature then add 1 0 ul RNase H 13 Incubate at 37 C for 20 min 14 If you plan to proceed directly to the LD PCR step take a 2 ul aliquot from the first strand synthesis and place it in a clean prechilled 0 5 ml tube Place the tube on ice and proceed to Section H If you used mineral oil in your first strand reaction tube be sure to take the 2 ul sample from the bottom of the tube to avoid the oil 15 Any first strand reaction mixture that is not used right away should be placed at 20 C First strand cDNA can be stored at 20 C for up to three months G Synthesize First Strand cDNA using a Random Primer 1 Combine the following reagents in a sterile 0 25 ml microcentrifuge tube 1 2 ul RNA sample 0 025 1 0 ug poly At or 0 10 2 0 ug total RNA For the control reaction use 1 ul 1 ug of the control RNA 10 yl CDSIII 6 Primer 1 2 yl Deionized H O to bring volume up to 4 0 ul 4 0 ul Total volume 2 Mix contents and spin briefly 3 Incubate at 72 C for 2 min 4 Cool on ice for 2 min 5 Spin briefly Protocol No PT3529 1 www clontech com Clontech Laborat
75. is usedto select for DNA molecules gt 200 bp For more information about CHROMA SPIN Columns please refer to the CHROMASPIN Columns User Manual PT1300 1 available atour website atwww clontech com Note We recommend centrifuging CHROMA SPIN Columns in aswinging bucket or horizontal rotor Fixed angle rotors can also be used but there is a risk that a portion of the sample will slide down the inner side of the column instead of passing through the gel matrix resulting in reduced orinconsistent purification Performthe following stepsfor each experimentalandcontrolsample 1 Remove the CHROMA SPIN Column from the protective plastic bag and invert it several times to resuspend the gel matrix completely Use one column for each 95 ul cDNA sample 2 Holding the CHROMA SPIN Column upright grasp the break away end between your thumb and index finger and snap off Figure 9 Place the end of the spin column into one of the 2 ml microcentrifuge collection tubes and lift off the top cap Save the top cap and the white end cap Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 25 Matchmaker Library Construction amp Screening Kits User Manual IX Generating a cDNA Library continued Clear top cap CHROMA SPIN Column main body lt lt Matrix lt lt Break away end White end cap Figure 9 CHROMA SPIN Column and Collection Tu
76. ium d Score for growth on SD Leu SD Trp and SD Leu Trp Calculate Mating Efficiency and Number of Colonies Screened Part 6 e For colonies growing on TDO medium Replica plate colonies onto ODO medium Incubate at 30 C for 3 8 days f Choose Ade His colonies for further analysis Not all of the colonies surviving this selection will be true two hybrid positives However the most common class of false positives will be eliminated by screening for expression of ADE2 and HIS3 James et al 1996 Other types of false positives can be eliminated as described in Section XIII g Streak out Ade His colonies on fresh SD Ade His Leu Trp X a Gal master plates and grow for 2 4 days at 30 C Having X a Gal present in the medium enables you to test Ade His colonies for the activation of a third reporter MEL 1 which encodes a galactosidase a secreted enzymethathydrolyzes X a Galto produce a blue end product h Seal the master plates with Parafilm and store at 4 C If desired prepare glycerol stock cultures of interesting clones and freeze at 70 C for long term storage 6 Calculate Mating Efficiency amp Number of Clones Screened a Countthe colonies cfu growing on the SD Leu SD Trp and SD Leu Trp dilution plates that have 30 300 cfu b Calculate the viable cfu ml on each type of SD medium cfu viable cfu ml Vol plated ml x dilution factor cfu ml on SD Leu viability ofY187 partner cfu ml on SD
77. maker Two Hybrid System 3 pCMV Myc amp pCMV HA Vector Set e Mammalian Matchmaker Two Hybrid Assay Kit e Matchmaker cDNA amp Genomic Libraries Matchmaker Pretransformed Libraries Cat Nos 636022 636023 635990 635991 635992 635961 639206 639207 639201 639202 many many 639001 639002 639007 639008 639011 639012 636076 634902 630439 630441 630409 630410 630411 630412 many 630303 631604 630301 many many Note Clontech offers premade cDNA and genomic AD fusion libraries from a broad range of tissues for use in two hybrid assays For added convenience you can also choose from a variety of Pretransformed Libraries These libraries are not recommended for use in Matchmaker one hybrid screens Matchmaker AD LD Insert Screening Amplimer Set e GALA DNA BD Monoclonal Antibody e GALA AD Monoclonal Antibody e HA Tag Polyclonal Antibody e c Myc Monoclonal Antibody pGBKT7 DNA BD Vector pGADT7 AD Vector pBridge Vector pLP GBKT7 DNA BD Acceptor Vector Clontech Laboratories Inc www clontech com 50 630433 630403 630402 631207 631206 630443 630442 630404 630406 Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XVI Related Products Two Hybrid screening amp analysis continued Cat Nos pLP GADT7 AD Acceptor Vector 630405 e X a gal 630407 e Matchmaker Co IP Kit 630449 e Luminescent f
78. n yeast gt The reporter and AD vectors have different nutritional markers so they can be independently selected when yeast transformants are plated on SD minimal medium lacking specific nutrients The selection medium you choose depends on which plasmids you are using whether you are selecting for one or two plasmids and whether you are selecting for colonies in which one hybrid interactions are occurring The vectors carry different antibiotic markers so that they can be independently selected in E coli Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual V Yeast Vectors continued B Two Hybrid System 1 Cloning Vectors e pGBKT7 Used to express a protein of interest as a fusion with the GAL4 DNA binding domain DNA BD e pGADT7 Rec Usedto express a protein of interest as a fusion with the GALA activation domain AD This vector is engineered for homologous recombination mediated cloning pGADT7 Rec is provided as Sma l digested linear DNA 2 Control Vectors a Positive Control e pGBKT7 53 encodes a fusion between the GAL4 DNA BD and murine p53 e SV40LargeT PCR Fragment encodes SV40 largeT antigen Use this DNA fragment together with pGADT7 Rec to check the transformation recombination efficiency in yeast In vivo SV40 LargeT PCR Fragment and pGADT7 Rec recombine to form pGADT7 RecT which encodes a fusion betwe
79. o PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Appendix B Preparation of Competent Yeast Cells LiAc Method This protocol will yield 1 2 ml of competent cells Before starting 2 Incubate at 30 C with shaking for 8 hr 3 Transfer 5 ul of the culture to a 250 ml flask containing 50 ml of YPDA 4 Incubate at 30 C with shaking at 230 250 rpm for 16 20 hr The OD should reach 0 15 0 3 5 Centrifuge the cells at 700 x g for 5 min at room temperature 6 Discard the supernatant and resuspend the cell pellet in 100 ml of YPDA 7 Incubate at 30 C for 3 5 hr ODs 0 4 0 5 8 Centrifuge the cells at 700 x g for 5 min at room temperature 9 Discard the supernatant and resuspend the cell pellet in 60 ml of sterile deionized H O 10 Centrifuge the cells at 700 x g for 5 min at room temperature 11 Discard the supernatant and resuspend the cells in 3 ml of 1 1 X TE LiAc Solution 12 Split the resuspension between two 1 5 ml microcentrifuge tubes 1 5 ml per tube 13 Centrifuge each tube at high speed for 15 sec 14 Discard the supernatant and resuspend each pellet in 600 ul of 1 1XTE LiAc Solution Note Competent cells should be used for transformation immediately following preparation however if necessary they can be stored at room temperature for a few hours without significantly affecting the competency Protocol No PT3529 1 wwwelontechcom Clontech Laboratories Inc
80. o Hybrid Control Vector Information continued a a 66 MCS Ndel Ncol Sfil f P ori ADH1 GAL Y EcoR Human lamin C DNA BD Smal Xma l Bami pGBKT7 Lam ori a a 230 A c Myc epitope tag Figure 19 Map of pGBKT7 Lam DNA BD Control Vector pGBKT7 Lam is a negative control plasmid that encodes a fusion of the human lamin C protein a a 66 230 and the GAL4 DNA BD a a 1 147 The lamin C cDNA insert GenBank Accession Cat No M13451 was derived from the plasmid referenced in Bartel et al 1993a Plasmid modification was performed at Clontech Yeast cotransformed with pGBKT7 Lam and pGADT7 RecT provide a measure of the background that is due to false positive two hybrid interactions pGBKT7 Lam has not been sequenced Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Notes Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 57 Matchmaker Library Construction amp Screening Kits User Manual Notes Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Notes Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 59
81. o screen by cotransformation construct your library using Protocol B For a quick comparison of these two protocols refer back to Figure 7 Important Note that you must prepare competent yeast cells before starting library construction Please take some time to review the procedure in Appendix B and plan your work accordingly Protocol A Screen by Yeast Mating PLEASE READ ENTIRE PROTOCOL BEFORE STARTING Before starting e Pour SD agar plates You will need SD Leu 200 150 mm plates SD Leu 5 10 100 mm plates SD Trp see note below 5 10 100 mm plates SD Leu Trp 5 10 100 mm plates SD His Leu Trp see note below 50 150 mm plates SD Ade His Leu Trp X a Gal 50 150 mm plates Allow SD agar plates to dry at room temperature for 2 3 days or at 30 C for 3 hr before plating any transformation mixtures Note As explained in the List of Additional Materials Required Section Ill the dropout supplements required to make these media are not supplied You must obtain these supplements separately from a commercial supplier or prepare them yourself using the recipe in Appendix C of the Yeast Protocols Handbook PT3024 1 e Plan controls Steps 7 8 Controls should be done in parallel with experimental work Prepare Freezing Medium YPD medium with 2596 v v glycerol e Prepare PEG LiAc Solution Section III 1 Transform yeast strain AH109 with ds cDNA and pGADT7 Rec a Prepare competent yeast cells Appendix B
82. olyzes X a Gal to produce a blue end product 3 Controls for Protocol B Small Scale Yeast Cotransformation Usethis small scale cotransformation protocol to produce the following two control strains Two Hybrid Cotransformation Controls Cotransform AH109 with Control Strain plasmids SV40 Large T PCR Fragment Rakonbinati n 1 Positive Control e pGADT7 Rec p AH109 pGADT7 RecT pGBKT7 53 e pGBKT7 53 IEVIVO e SV40 Large T PCR Fragment Recombination 2 Negative Control e pGADT7 Rec y AH108 pGADT7 RecT pGBKT7 Lam pGBKT7 Lam in vivo TABLE XI SET UP FOR CONTROLTWO HYBRID COTRANSFORMATIONS Component 1 Positive Control ul 2 Negative Control pl SV40 LargeT PCR Fragment 25 ng ul 5 0 5 0 pGADT7 Rec Sma l linearized 500 ng ul 0 5 0 5 pGBKT7 53 500 ng ul 0 5 pGBKT7 Lam 500 ng ul 0 5 Herring Testes Carrier DNA 10 mg ml denatured 5 5 AH109 Competent Yeast Cells 50 50 PEG LiAc Solution 500 500 Transfer 50 yl of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 1 5 ml reaction tube Clontech Laboratories Inc www clontech com Protocol No PT3529 1 36 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol B continued
83. omerization Oncogene 8 1693 1696 James P Haliaday J amp Craig E A 1996 Genomic libraries and a host strain designed for highly efficient two hybrid selection in yeast Genetics 144 1425 1436 Kato S Sekine S Oh S W Kim N S Umezawa Y Abe N Yokoyama Kobayashi M amp Aoki T 1994 Construction of a human full length cDNA bank Gene 150 243 250 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hot start PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase Bio Techniques 16 1134 1137 Kumar R Chen S Scheurer D Wang O L Duh E Sung C H Rehemtulla A Swaroop A Adler R amp Zack D J 1996 The bZIP transcription factor Nrl stimulates rhodopsin promoter activity in primary retinal cell cultures J Biol Chem 271 47 29612 29618 Kuo H J Maslen C L Keene D R amp Glanville R W 1997 Type VI collagen anchors endothelial basement membranes by interacting with type IV collagen J Biol Chem 272 26522 26529 Lehming N Thanos D Brickman J M Ma J Maniatis T amp Ptashne M 1994 An HMG like protein that can switch a transcriptional activator to a repressor Nature 371 175 179 Li B amp Fields S 1993 Identification of mutations in p53 that affect its binding to SV40T antigen by using the yeast two hybrid system FASEB J 7 957 963 Li J
84. ontinued 5 Restreak the His colonies on fresh SD His Leu Trp optimal 3 AT Incubate at 30 C for 2 4 days Seal the plates with Parafilm and store at 4 C For long term storage prepare glycerol stocks and store at 70 C 6 Analyze positive interactions as described in Section XIII C One Hybrid Controls One Hybrid Controls Cotransform Y187 with Control Strain plasmids 1 Positive Control ae Y187 pGAD Rec2 53 p53HIS2 e pGAD Rec2 53 Transform 2 Negative Control e pHIS2 vm Y187 pGAD Rec2 53 pHIS2 Component 1 Positive Control ul 2 Negative Control ul pGAD Rec2 53 500 ng ul 1 0 1 0 p53HIS2 500 ng ul 1 0 pHIS2 500 ng ul 1 0 Herring Testes Carrier DNA 10 mg ml denatured 5 5 Y187 Competent Yeast Cells 50 50 PEG LiAc Solution 500 500 Transfer 50 ul of Herring DNA to a microcentrifuge tube and heat at 100 C for 5 min Then immediately chill the DNA by placing the tube in an ice bath Repeat once more before adding the DNA to the 1 5 ml reaction tube 1 Prepare competent yeast cells Appendix B 2 Set up two 1 5 ml microcentrifuge tubes Add DNA competent yeast cells and PEG LiAc Solution using the volumes and in the order indicated Table VII 3 Mix thoroughly by gently vortexing Incubate in a water bath at 30 C for 30 min Vortex gently every 10 min Add 20 ul of DMSO to each tube mix and then place the tube in a 42 C waterbath for 15 min Vortex gen
85. orated into the cDNA by RT and LD PCR have been engineered into the pGADT7 Rec and pGADT7 Rec2 plasmids In yeast the linear plasmid is restored to its circular form by recombination with overlapping sequences at the ends of the SMART cDNA Successful plasmid assembly results in a positive Leu2 transformant SMART III ds cDNA CDS III X Recombination gt X pGADT7 Rec 2 GAL4 AD pGADT7 Rec or pGADT7 Rec2 Vector Sma l linearized Figure 10 Constructing AD fusion libraries by recombination mediated cloning in yeast To clone cDNA into pGADT7 Rec or pGADT7 Rec2 cotransform yeast with ds cDNA generated with our modified SMART procedure and either pGADT7 Rec two hybrid screen or pGADT7 Rec2 one hybrid screen Yeast repair enzymes will restore the Sma I linearized plasmid to its circular form by recombining sequences at the ends of the cDNA with homologous sequences at the ends of pGADT7 Rec 2 The outcome is a fully functional GAL4 AD cDNA expression vector B Screening GAL4 AD Fusion Libraries 1 One Hybrid Library Screening cotransformation With recombination mediated cloning Figure 10 library construction and screening can be carried out in the same host strain on the same day If you prepare a DNA target reporter plasmid e g pHIS2 DNA target in advance you can include it in the cotransformation reaction together with your cDNA library and pGADT7 Rec2 With a single transformation step
86. ories Inc Version No PR6Z2169 23 Matchmaker Library Construction amp Screening Kits User Manual IX Generating a cDNA Library continued 6 o yN 1 12 13 14 15 16 Keep the tube at room temperature and add the following 2 0 ul 5X First Strand Buffer 1 0 ul DTT 20 mM 1 0 ul dNTP Mix 10 mM 1 0 ul MMLV Reverse Transcriptase 9 0 ul Total volume Mix gently by tapping Spin briefly Incubate at 25 30 C for 10 min at room temperature Incubate at 42 C for 10 min 10 Incubate at 42 C for 1 hr in an air incubator or hot lid thermal cycler Add 1 0 ul SMART III Oligonucleotide Note If you use a water bath or non hot lid thermal cycler for this incubation cover the reaction mixture with one drop of mineral oil before you close the tube This will prevent loss of volume due to evaporation Place the tube at 75 C for 10 min to terminate first strand synthesis Cool the tube to room temperature then add 1 0 ul 2 units RNase H Incubate at 37 C for 20 min If you plan to proceed directly to the LD PCR step take a 2 ul aliquot from the first strand synthesis and place it in a clean prechilled 0 5 ml tube Place the tube on ice and proceed to Section H If you used mineral oil in your first strand reaction tube be sure to take the 2 ul sample from the bottom of the tube to avoid the oil Any first strand reaction mixture that is not used right away should be placed at 20 C Fir
87. otides from the cDNA When using these columns to purify ds cDNA please keep the following points in mind The resolving function of the column will be diminished if the gel matrix becomes dry In drying the matrix body may shrink away from the inner wall of the column casing The ds cDNA mixture can then flow down the sides of the column allowing small contaminants to elute with the cDNA The column should be stored and used at room temperature If it is chilled at 4 C and then warmed to room temperature for use bubbles may form which interfere with the proper functioning of the column Extreme uneven deposition of the ds cDNA mixture on the surface of the column can cause inefficient separation of ds cDNA from low molecular weight contaminants C Constructing amp Screening One Hybrid and Two Hybrid Libraries Low transformation efficiency e Check the purity of the DNA and if necessary repurify by ethanol precipitation e The fusion protein encoded by the DNA BD bait plasmid Two Hybrid System may be toxic Try using a vector that expresses lower levels of the fusion such pGBT9 Improper media preparation Remake media and test with control transformations e Checkthe efficiency using the pGBT9 Control Plasmid Plate on SD Trp The transformation should yield 21 x 105 colonies ug DNA Low mating efficiency Two Hybrid System e Theremayhavebeenaninsufficientnumberofpretransformed baitcellsin the mating When y
88. ou preparethe overnightliquid culture ofthe baitstrain be sureto use alarge fresh colony fortheinoculum Aftercentrifugingandresuspending countthecells usinga hemacytometer The density should be gt 1 x 10 ml an 100 fold excess over the pretransformed library cells e One or both of the fusion proteins is toxic to yeast You may be able to engineer the fusion in a way that alleviates its toxicity but still allows the interaction to occur Alternatively use a DNA BD or AD vector e g pBridge or pGBT9 that expresses lower levels of the fusion It may be necessary to perform the mating on agar plates Bendixen et al 1994 or on filters Fromont Racine et al 1997 Be sure to set up mating controls for comparison Bait proteins may interfere with mating if they share homology to yeast mating proteins e g pheromone receptors Shultz et al 1995 Pringle et al 1992 If homology is suspected it may be necessary to screen your library by cotransformation Excessive background growth on library screening medium e Checkto make sure you have prepared the selection medium correctly Add the appropriate amount of 3 AT Perform a 3 AT titration with the transformed reporter strain to optimize the concentration If your target pHIS2 reporter One Hybrid System grows on SD His medium even in the presenceof gt 60mM3 AT theinsertedtargetelementmaybeinteractingwithyeastendogenous transcriptional activators or may notrequire trans acting facto
89. ould be incubated for atleast 5 days to allow slower growing colonies to appear Ignore the small pale colonies that may appear after 2 days but never grow to 1 mm in diameter True Ade His colonies are robust and can grow to 2 mm Also Ade colonies are white or light pink whereas Ade colonies will slowly turn red on adenine limited medium Score for growth on the SD Leu and SD Leu Trp dilution plates i Count the colonies growing on SD Leu colonies x 1 000 transformants 3 ug pGADT7 Rec Expected results 21 x 108 transformants 3 ug pGADT7 Rec ii Count the colonies growing on SD Leu Trp colonies x 1 000 clones screened Expected results 25 x 10 clones library For colonies growing on TDO medium Replica plate colonies onto ODO medium Incubate at 30 C for 3 8 days Choose Ade His colonies for further analysis Not all of the colonies surviving this selection will be true two hybrid positives However the most common class of false positives will be eliminated by screening for expression of ADE2 and HISS3 James et al 1996 Other types of false positives can be eliminated as described in Section XIII StreakoutAde His colonies on fresh SD Ade His Leu Trp X a Gal master plates and grow for 2 4 days at 30 C Having X a Gal present in the medium enables you to test Ade His colonies for the activation of a third reporter MEL 1 which encodes a galactosidase a secreted enzyme that hydr
90. play the His phenotype as a result of the interaction between murine p53 and the DNA binding sites in pb3HIS2 When the GAL4 AD p53 fusion interacts with these sites it stimulates transcription of H S3 giving yeast strains such asY187 and AH109 which are normally auxotrophic for histidine the ability to grow on histidine dropout medium p53HIS2 contains an autonomous replication sequence ARS4 and TRP7 nutritional marker for replication and selection in yeast the centromeric sequence CEN6 ensures proper segregation of the plasmid during mitosis and meiosis The vector also contains a Col E1 ori and kanamycin resistance gene Kan for propagation and selection in E coli This vector has not been completely sequenced Hind MI 1480 Hind MI 3146 Figure 16 Map of pGAD Rec2 53 AD Control Vector pGAD Rec2 53 encodes a fusion of the GALA AD and murine p53 a known DNA binding protein Thukral S K et a 1994 The vector is derived from pGADT7 Rec2 and was constructed at Clontech by homologous recombination in E coli Specifically the vector was produced by transforming competent E coli cells with EcoR l BamH l linearized pGADT7 Rec2 and ds cDNA encoding murine p53 a a 73 391 As a result this vector does not contain the T7 RNA polymerase promoter or hemagglutinin HA epitope tag nor does it share any homology with the SMART III or CDS III oligonucleotides pGAD Rec2 53 is designed for use asa positive control vector in Mat
91. plier or prepare them yourself using the recipe given in Appendix C of the Yeast Protocols Handbook PT3024 1 e Trp DO Supplement Required for selection of Matchmaker DNA BD cloning vectors in yeast e His Leu Trp DO Supplement Optional triple dropout supplement for low stringency screening of yeast two hybrid libraries e His Trp DO Supplement Required for testing yeast strains transformed with a DNA BD plasmid for background growth on SD minimal media lacking His e Ade Trp DO Supplement Required for testing yeast strains transformed with a DNA BD plasmid for background growth on SD minimal media lacking Ade One Hybrid Library Construction amp Screening The following dropout DO supplement is not supplied with the Matchmaker One Hybrid Library Construction amp Screening Kit Cat No 630304 You must obtain this supplement separately from a commercial supplier or prepare it yourself using the recipe given in Appendix C of the Yeast Protocols Handbook PT3024 1 e His Trp DO Supplement Required for testing yeast strains transformed with a pHIS2 reporter plasmid for background growth on SD minimal media lacking His PCR Colony Screening e Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 10 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual IV Yeast Strains For additional information on the growth
92. protein sequences Nature 350 250 251 Sambrook J Fritsch E E amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Cold Spring Harbor NY Scharf S J 1990 Cloning with PCR In PCR Protocols A Guide to Methods and Applications eds Innis M A Gelfand D H Sninsky J J amp White T J Academic Press Inc San Diego pp 84 91 Schiestl R H amp Gietz R D 1989 High efficiency transformation of intact cells using single stranded nucleic acids as a carrier Curr Genet 16 339 346 Schultz J Ferguson B Sprague G F Jr 1995 Signal transduction and growth control in yeast Curr Opin Genet Dev 5 31 37 Strubin M Newell J W amp Matthias P 1995 OBF 1 a novel B cell specific coactivator that stimulates immunoglobin promoter activity through association with octamer binding proteins Cell 80 497 506 Thukral S K Blain G C Chang K K amp Fields S 1994 Distinct residues of human p53 implicated in binding to DNA simian virus 40 largeT antigen 53BP1 and 53BP2 Mol Cell Biol 14 8315 8321 Tirode E Malaguti C Romero E Attar R Camonis J amp Egly J M 1997 Aconditionally expressed third partner stabilizes or prevents the formation of a transcriptional activator in a three hybrid system J Biol Chem 272 22995 22999 van Aelst L Barr M Marcus S Polverino A amp Wigler M 1993 Complex formation between
93. r RNA by incubating a small sample at 37 C for 2 hr Run it on a gel parallel to a fresh unincubated sample If the RNA appears to be unstable it will yield poor results If this is the case reisolate the RNA using a different method see Related Products Problems with your RNA are easily diagnosed if you perform parallel reactions using the control RNA provided in this kit Presence of low molecular weight 0 1 kb material in the ds cDNA product e Theraw cDNA e g before size fractionation is expected to contain some low molecular weight DNA contaminants including unincorporated primers SMART oligonucleotides and very short PCR products However these small fragments are generally removed from the ds cDNA preparation in the size fractionation step using the columns provided Note that a preponderance of low molecular weight 0 1 kb material in the raw PCR product may be indicative of overcycling If you suspect overcycling then the PCR step must be repeated with a fresh sample of first strand cDNA using 2 3 fewer cycles Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIV Troubleshooting Guide continued Presence of low molecular weight lt 0 1 kb in the size fractionated ds cDNA e CHROMA SPIN columns are designed to remove low molecular weight cDNA fragments small DNA contaminants and unincorporated nucle
94. rary are the same In both cases recombination mediated cloning is used to fuse SMART ds cDNA with the GAL4 AD Figure 10 While the cloning methods are the same the GAL4 AD cloning vectors are not e To construct a one hybrid library use pGADT7 Rec2 e To construct a two hybrid library use pGADT7 Rec pGADT7 Rec2 and pGADT7 Rec differ in their mode of replication pGADT7 Rec is a high copy plasmid it contains a 2 y origin of replication which enables it to replicate multiple times during the cell cycle pGADT7 Rec2 on the other hand is a low copy plasmid it contains an autonomous replication sequence or ARS element which allows the vector to replicate only once during the cell cycle pGADT7 Rec2 also contains a centromeric sequence or CEN element to ensure stable segregation of the plasmid during mitosis and meiosis Low copy plasmids such as pGADT7 Rec2 are preferred for one hybrid analysis because they generate fewer false positives 2 A GALA AD fusion library is produced by cotransforming yeast with SMART ds cDNA and Sma l linearized pGADT7 Rec or pGADT7 Rec2 depending on whether you are constructing a two hybrid or one hybrid library SMART ds cDNA recombines with the AD cloning vector in vivo to yield a complete GAL4 AD expression vector Figure 10 The resulting construct will express the cDNA insert as a GAL4 AD fusion protein This one step cloning procedure is possible because the SMART III and CDS Ill sequences incorp
95. res PCR Colony sees Plasmid Isolation using Matchmaker AD LD Insert Yeastmaker Yeast Plasmid Isolation Kit Screening Amplimer Set Cat No 630433 Amplify the cDNA insert by PCR using the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 Analyze the PCR product by gel electrophoresis PCR product consists of one band Yeast colony contains one AD plasmid PCR product consists of more than one band Yeast colony contains more than one AD plasmid Use one of the following methods to segregate the AD plasmids e Restreak the yeast colony on selective medium e Isolate the plasmids from yeast and transform E coli Select on LB Amp Gel purify each PCR fragment Sequence the PCR product or AD plasmid insert Compare the sequence with that of other proteins in GenBank EMBL or other databases y Creator Acceptor Vectors T Analyze protein function using pde One Hybrid and Two Hybrid Systems Purify the protein using PRO Bacterial Expression Vectors l e Develop antibodies e Determine tissue specific expression using Protein Medleys Retest the interaction in vitro e Study the protein s physical properties Y2H Coimmunoprecipitation Matchmaker Co IP Kit in vitro transcription and translation Localize the protein in vivo in mammalian cells using Living Colors Fluorescent Protein Vectors Y1H Gel shift assay Express the protein in a variety of mammal
96. rotein associates with the protein phosphatase type 1 catalytic subunit Genes Devel 7 555 569 Estojak J Brent R amp Golemis E A 1995 Correlation of two hybrid affinity data with in vitro measurements Molecular and Cellular Biology 15 5820 5829 Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolation and Characterization Academic Press San Diego CA Feilotter H E Hannon G J Ruddel C J amp Beach D 1994 Construction of an improved host strain for two hybrid screening Nucleic Acids Res 22 1502 1503 Fields S 1993 The two hybrid system to detect protein protein interactions METHODS A Companion to Meth Enzymol 5 116 124 Fields S amp Song O 1989 A novel genetic system to detect protein protein interactions Nature 340 245 247 Fields S amp Sternglanz R 1994 The two hybrid system an assay for protein protein interactions Trends Genet 10 286 292 Finley Jr R L amp Brent R 1994 Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators Proc Natl Acad Sci USA 91 12980 12984 Fromomt Racine M Bertrand E Pictet R amp Grange T 1993 A highly sensitive method for mapping the 5 termini of mRNAs Nucleic Acids Res 21 1683 1684 Fromont Racine M Rain J C Legrain P 1997 Toward a functional analysis of the yeast genome through exhaustive two hybrid screens Nat Genet 16 216 217 Furuichi Y amp
97. rovided and ds cDNA generated with the SMART library construction protocol Section IX 2 Control Vectors Appendix C p53HIS2 is a positive control reporter vector that contains three tandem copies of the cis acting DNA consensus sequence recognized by p53 p53HIS2 was constructed by inserting the DNA targets into the multiple cloning site of pHIS2 As a result the DNA targets are positioned just upstream of the minimal promoter of the H S3 locus P inus and the H S3 reporter gene pGAD Rec2 53 is a positive control vector that encodes murine p53 as a fusion with the GAL4 AD Yeast cells that contain both pb3HIS2 and pGAD Rec2 53 should grow on minimal SD media lacking histidine i e on SD His Leu Trp TABLE IIl ONE HYBRID SYSTEM VECTORS Use Epitope Yeast selection Bacterial selection Cloning vectors pHIS2 Link any DNA target to HIS3 TRP1 kanamycin pGADT7 Rec2 Express potential DNA binding Sma l linearized proteins as AD fusions HA LEU2 ampicillin Control vectors p53HIS2 Detect DNA binding activity TRP1 kanamycin of p53 pGAD Rec2 53 Express p53 as an AD fusion HA LEU2 ampicillin a HA hemagglutinin These epitope tags can be used to verify protein protein interactions in vitro by coimmunoprecipitation Co IP using the antibodies and protocol provided with the Matchmaker Co IP Kit Cat No 630449 They are not intended to be used for detection affinity purification or Co IP of hybrid proteins expressed i
98. rsto activate the H S3reporter It may be necessary to redesign the target element and construct a new reporter vector e The DNA BD fusion protein Two Hybrid System may have transcriptional activating properties Deletion of certain portions of bait proteins may be required to eliminate unwanted activity before the protein can be used in a two hybrid screen Bartel etal 1993b Failure to detect known protein protein Two Hybrid or DNA protein interactions One Hybrid interactions e If expression of one or both of the hybrid proteins is toxic to the cell transformants will not grow or will grow very slowly Truncation of one of the hybrid proteins may alleviate the toxicity and still allow the interaction to occur Try using vectors such as pGBT9 or pBridge that express lower levels of the DNA BD fusion protein e The cotransformation efficiency is too low You may not be screening a sufficient number of library cotransformants This can be critical especially if the interacting target protein is encoded by a rare transcript in the source tissue Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XIV Troubleshooting Guide continued e If one of the following situations is occurring it may interfere with the ability of the two hybrid proteins to interact 1 the hybrid proteins are not stably expressed in the host cell 2
99. shooting Guide A Constructing DNA BD Fusions DNA BD bait activates reporter genes e The bait protein has a transcriptional activation domain This is especially likely if the bait protein is a transcription factor Acidic amphipathic domains are often responsible for unwanted transcriptional activation Ruden et al 1991 Ruden 1992 Remove the activating domain by creating specific deletions within the gene Retest the deletion constructs for activation At the amino acid level anet negative charge per 10 amino acids is a minimal AD Note that such deletions may also eliminate a potentially interacting domain e If two test proteins are being assayed switch from the DNA BD to the AD vector and vice versa Bait protein is toxic to yeast cells e Insome cases strains that do not grow well in liquid culture will grow reasonably well on agar plates Resuspend the colony in 1 ml of SD Trp then spread the cell suspension on five 100 mm SD Trp plates Incubate the plates at 30 C until the colonies are confluent Scrape the colonies from each plate pool them in one tube and resuspend in a total of 5 ml of 0 5XYPDA Use the cell suspension in the normal mating procedure B Generating cDNA Libraries Low yield of ds cDNA e Oneor more essential reagents may have been inadvertently omitted from the first strand or ds cDNA synthesis steps Repeat both steps being careful to check off every item as you add it to the reaction e Low yi
100. son of Matchmaker DNA BD Vectors 19 Table VI Relationship Between Amount of RNA and Optimal Number of Thermal Cycles 24 Table VII Set Up for One Hybrid Control Cotransformations 29 Table VIII Control One Hybrid Cotransformations Expected Results 29 Table IX Set Up for Control Two Hybrid Transformations 33 Table X Set Up for Control Two Hybrid Matings 34 Table XI Set Up for Control Two Hybrid Cotransformations 36 Table XII Control Two Hybrid Cotransformations Expected Results 37 Table XIII Assembling Master Mixes for PCR Colony Screening 40 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 2 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual Table of Contents continued List of Figures Figure 1 Screening for protein DNA interactions with the Matchmaker One Hybrid System 4 Figure 2 Screening for protein protein interactions with the Matchmaker Two Hybrid System 4 Figure 3 General steps of yeast one hybrid and two hybrid screening 5 Figure 4 Constructing and screening Matchmaker One Hybrid and Two Hybrid libraries 6 Figure b Reporter gene constructs in yeast strains AH109 and Y187 12 Figure 6 Matchmaker One Hybrid Library Construction amp Screening 16 Figure 7 Matchmaker Two Hybrid Library Construction amp Screening 17 Figure 8 Synthesis of high quality ds cDNA using SMART technology 21 Figure 9 CHROMA SPIN Column and Collection Tubes 26 Figure
101. st strand cDNA can be stored at 20 C for up to three months H Amplify ds cDNA by Long Distance PCR LD PCR TableVI shows the optimal number of thermal cycles to use based on the amount of RNA used in the first strand synthesis Fewer cycles generally mean fewer nonspecific PCR products The optimal cycling parameters inTableVI were determined using the Control Poly A Human Placenta RNA these parameters may vary with different templates and thermal cyclers TABLE VI RELATIONSHIP BETWEEN AMOUNT OF RNA AND OPTIMAL NUMBER OF THERMAL CYCLES Total RNA ug Poly A RNA pug Number of Cycles 1 0 2 0 0 5 1 0 15 20 0 5 1 0 0 25 0 5 20 22 0 25 0 5 0 125 0 25 22 24 0 05 0 25 0 025 0 125 24 26 Clontech Laboratories Inc www clontech com Protocol No PT3529 1 24 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual IX Generating a cDNA Library continued 1 Preheat the PCR thermal cycler to 95 C 2 To prepare sufficient ds cDNA for transformation set up two 100 yl PCR reactions for each experimental sample Set up one reaction for the Control sample In each reaction tube combine the following components 2 ul First Strand cDNA 70 ul Deionized H O 10 ul 10X Advantage 2 PCR Buffer 2 ul BOX dNTP Mix ul 5b PCR Primer 2 ul 3 PCR Primer 10 ul 10X GC Melt Solution N 2 ul 50X Advantage 2 Polymerase Mix 100 ul Total volume 3 Mix gently by flicking the tube Centrifug
102. te e TDO stands forTriple Dropout Medium SD His Leu Trp ODO stands for Quadruple Dropout Medium SD Ade His Leu Trp See Figure 11 Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 31 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol A continued Y187 AH109 DNA BD bait AD fusion library Marker TRP1 Marker LEU2 r Mate Y Medium stringency Plate culture on SD His Leu Trp Replica plate to 1 Ade His Leu Trp High stringency Plate culture on SD Ade His Leu pes Colony growth indicates an interaction between the two hybrid proteins Figure 11 Screening an AD fusion library for two hybrid interactions Use the stringency of your choice to screen for interacting proteins Note high stringency selections result in fewer colonies and reduce the number of false positives However weak interactions may be missed c Incubate at 30 C until colonies appear After 2 3 days some colonies will be visible but plates should be incubated for atleast5 daystoallow slower growing colonies i e weak positives to appear Ignorethe small pale colonies that may appear after 2 days but never grow to 1 mm in diameter True Ade His colonies are robust and can grow to gt 2 mm Also Ade colonies are white or light pink whereas Ade colonies will slowly turn red on adenine limited med
103. the fused GAL4 domains occlude the site of interaction 3 the hybrid protein folds improperly or 4 the hybrid protein cannot be localized to the yeast nucleus In these cases it may help to construct hybrids containing different domains of the bait or library protein For example to study proteins that normally do not localize to the nucleus it may be necessary to generate mutant forms of the protein that can be transported across the nuclear membrane e Some types of protein interactions may not be detectable in a GAL4 based system The conditions in yeast cells may not allow the proper folding or post translational modifications required for interaction of some mammalian proteins AD fusion library plasmid activates the reporters independent of the DNA BD bait protein Two Hybrid System e A rare category of false positives in which an AD library hybrid activates transcription inappropriately Refer to Section XIII for methods to verify protein interactions see Bartel et al 1993a for further discussion of false positives Clontech Laboratories Inc www clontech com Protocol No PT3529 1 Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual XV References Allen J B Wallberg M W Edwards M C amp Elledge S J 1995 Finding prospective partners in the library the yeast two hybrid system and phage display find a match TIBS 20 511 516 Aho S Arffman A Pummi T amp Uitto
104. tion amp Screening Kit Two hybrid libraries may be screened by either yeast mating or cotransformation Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 7 Matchmaker Library Construction amp Screening Kits User Manual VII Constructing a Reporter Vector for One Hybrid Analysis A Background To use the Matchmaker One Hybrid System to screen a cDNA library for DNA binding proteins you must have identified a true or putative target element It must be precisely defined using for example deletion and or point mutation analysis A construct composed of one or more tandem copies of your target regulatory element bordered by restriction sites is then prepared and inserted into the multiple cloning site MCS of pHIS2 This links the target element to the H S3 reporter gene Inserting your target element may alter the level of background H S3 expression Therefore constructs should be tested for background leaky HIS3 expression before you start a one hybrid analysis Background growth due to leaky H S3 expression is controlled by adding 3 AT to the selection medium as described in Section IV F B Synthesize Your Target Element Eachtarget reporterconstructshouldcontainatleastonecopyoftheDNAtargetelementinserted upstream ofthe reporter gene Many early studies indicated thatthe reporter should contain at least three tandem copies ofthe DNA target However asWei et al 1999 have demonstrated
105. tly every 75 min Centrifuge at high speed for 15 sec Remove supernatant and resuspend in 1 ml of YPD Plus Liquid Medium Shake at 30 C for 90 min Centrifuge at high speed for 15 sec 10 Discard the supernatant and resuspend in 1 ml of NaCl Solution 0 996 by gently pipetting up and down 11 Spread 100 ul of a 1 10 1 100 and 1 1 000 dilution on SD Leu SD Trp and SD Leu Trp to check the transformation efficiency and on SD His Leu Trp 10 mM 3 AT to select for positive one hybrids 12 Incubate the plates at 30 C face down for 2 7 days until colonies appear 13 Compare your results with those shown in Table VIII TABLE VIII CONTROL ONE HYBRID COTRANSFORMATIONS EXPECTED RESULTS o A oo Oo Control Strain Plated on SD Minimal Media Phenotype Growth Positive Control Y187 pGAD Rec2 53 p53HIS2 His Leu Trp 10 mM 3 AT Negative Control Y187 pGAD Rec2 53 pHIS2 His Leu Trp 10 mM 3 AT Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 29 Matchmaker Library Construction amp Screening Kits User Manual XII Constructing amp Screening a Two Hybrid Library Protocol A There are two ways to screen a Matchmaker two hybrid library e Yeast mating e Cotransformation The method you choosedeterminesthe protocol you will nowuseto construct and screen your library To screen by yeast mating construct your library using Protocol A T
106. tocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 9 Matchmaker Library Construction amp Screening Kits User Manual Ill Additional Materials Required continued Yeast culture amp mating YPD Medium Cat No 630409 or prepare your own see the Yeast Protocols Handbook PT3024 1 YPDA medium YPD medium supplemented with 30 mg L adenine hemisulfate see the Yeast Protocols Handbook e TE buffer or sterile distilled H O Appropriate sterile tubes or flasks for transformations 100 and 150 mm culture plates Sterile glass rod bent pasteur pipette or 5 mm glass beads for spreading cells on plates X a Gal Cat No 630407 for blue white screening of yeast two hybrids expressing MEL1 a galactosidase Minimal SD Base with and without agar Cat Nos 630412 and 630411 3 amino 1 2 4 triazole 3 AT Sigma Cat No A8056 for suppressing background growth on SD minimal media lacking His Kanamycin stock solution BO mg ml in H O 1000X Store at 20 C Ampicillin stock solution BO mg ml in H O 1000X Store at 20 C Long term library storage 100 Glycerol Freezing Medium YPD medium with 25 v v glycerol Two Hybrid Library Construction amp Screening The following dropout DO supplements are not supplied with the Matchmaker Library Construction amp Screening Kit Cat No 630445 You must obtain these supplements separately from a commercial sup
107. two hybrid colony contains multiple non identical AD library plasmids Segregation in Yeast 1 Restreak positive colonies on SD dropout plates 2 3 times to segregate the AD library plasmids as described in Part A Step 1 2 Replica plate or transfer well isolated colonies to the appropriate SD dropout plates to verify that they maintain the correct phenotype Segregation in Bacteria 1 Isolate the plasmids from yeast using any standard method Note TheYeastmakerYeast Plasmid Isolation Kit Cat No 630441 provides a complete system for isolating plasmid DNA from yeast 2 Transform E coli DH5a cells with the plasmid preparation and select on LB amp plates Pick individual colonies e PCR Fragment Purification using agarose gel electrophoresis F Retest the Interaction in Yeast Retest protein protein and protein DNA interactions in yeast by either cotransformation or yeast mating 1 Cotransformation a Transform competent yeast cells with the bait and AD library plasmids Alternatively transform yeast cells with bait plasmid pGADT7 Rec 2 and the PCR product of interest generated in Part B Forone hybrid analysis use yeast strain Y187 For two hybrid analysis use yeast strain AH109 Be sureto include the appropriate negative and positive controls For examples refer to the controls used in Sections XI and XII One negative control should consist of yeast cells transformed with your candidate AD library plasmid an
108. w on SD His Trp or SD Ade Trp Continue with Steps 3 4 3 If a baitstrain exhibits background growth on His medium you may be able to eliminate or reduce the background by adding 3 AT to the selection medium Section IV F Alternatively use Ade His Leu Trp medium for the library screening 4 If a bait strain exhibits background growth on Ade and His medium it will be difficult to use this bait protein in a two hybrid library screening See Troubleshooting Guide Protocol No PT3529 1 www clontech com Clontech Laboratories Inc Version No PR6Z2169 Matchmaker Library Construction amp Screening Kits User Manual VIII Constructing a DNA BD Fusion Vector for Two Hybrid Analysis continued 5 Optional If a known protein partner for your bait protein is available use it to check whether a two hybrid interaction is detectable with this particular DNA BD bait fusion 6 Optional Verify protein expression e PrepareWestern blotsfromthe lysate oftransformantsand probetheblotswith antibodies to the GAL4 DNA BD Cat No 630403 Use untransformed yeast lysate as a control Notes e Using polyclonal antibodies may result in multiple cross reacting bands e The level of expression from pGBT9 or pBridge is too low to permit detection using our GAL4 DNA BD Monoclonal Antibody C Test the DNA BD Fusion for Toxicity Compare the growth rate in liquid culture of Y187 cells transformed with the empty DNA BD vector and c
109. y to generate nonspecific PCR products and therefore are best for optimal cDNA and library quality Thus if your RNA sample is not limiting use the higher starting amounts of RNA shown in the table E RNA Analysis The sequence complexity of the ds cDNA synthesized and ultimately of the cDNA library constructed depends onthe quality of the experimental RNA starting material Therefore before you use it in a first strand synthesis we recommend you estimate the integrity of the RNA by examining a sample ona denaturing formaldehyde agarose gel Total RNA from mammalian sources should appear as two bright bands 28S and 18S ribosomal RNA at approximately 4 5 and 1 9 kb The ratio of intensities of the 28S and 188 rRNA bands should be 1 5 2 5 1 Intact mammalian poly A RNA should appear as a smear usually 0 5 10 kb or more with faint28S and 18S rRNA bands Thesize distribution may be considerably smaller 0 5 3 kb for nonmammalian species e g plants insects yeast amphibians etc If the ratio of intensity of 28S RNA to 18S RNA for total RNA is less than 1 1 or if your experimental poly A RNA appears significantly smaller than expected e g no larger than 1 5 kb we suggest you prepare fresh RNA after checking your RNA purification reagents for RNase and other impurities If problems persist you may need to find another source of tissue or cells Clontech Laboratories Inc www clontech com Protocol No PT3529 1 22 Version No

Matchmaker Library Construction & Screening Kits User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker Library Construction &amp; Screening Kits User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker Library Construction & Screening Kits User Manual