Home

EasySelect™ Pichia Expression Kit

1. A H Q A 10 FU Q o A ty D CIG CGC GAC CCG GCC GGC AAC TGC GTG CAC TTC GTG GCC GAG GAG CAG GAC TGA A E F Q D kKK 67 PCR Analysis of Pichia Integrants Introduction Analysis by PCR 68 The following protocol is designed to allow you to analyze Pichia integrants to determine if the gene of interest has integrated into the Pichia genome Isolate genomic DNA from 6 10 Mut or Mut Pichia clones using the protocol on page 71 Isolate DNA from the strain transformed with the parent plasmid After isolating your DNA use the procedure below to identify integrants Amplify your gene of interest with the a factor primer for pPICZa only or 5 the AOX1 primer paired with the 3 AOX1 primer included in the kit This protocol is useful for confirming integration of the gene of interest but will not provide information on the site of integration A more direct procedure is provided on page 70 1 3 Set up PCR reactions as follows 10X PCR Buffer Genomic DNA 1 ug 100 mM dNTPs 25 mM each 5 AOX1 Primer 0 1 ug ul 3 AOX1 Primer 0 1 pg pl Sterile water Taq Polymerase 5 U hl 5 pl 5 pl 1 ul 5 pl 5 pl 29 ul 0 25 pl Resuspend lyophilized primer 2 ug in 20 ul sterile water to prepare a 0 1 ug ul solution The amount of primer may be decreased if desired For 20 pmoles primer use 2 pl of each primer For amplification controls use 100 ng o
2. 86 invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
3. Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product The CofA for each product is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box Continued on next page 78 Technical Support continued Limited Warranty Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional t
4. Recipes for the solutions are found below 60 mM NazHPO 7H20 40 mM NaH2PO H20 10 mM KCl 1 mM MgsO 7H20 50 mM f mercaptoethanol pH 7 0 1 Dissolve the following in 950 ml deionized water 16 1 g Na HPO 7H 0 5 5 8 NaH2PO H20 0 75 g KCl 0 246 g MgSO4 7H20 2 7 ml B mercaptoethanol 2 Adjust pH to 7 0 with either NaOH or HCl and bring the volume up to 1 liter with water 3 Do not autoclave Store at 4 C 4 mg ml in 100 mM phosphate buffer pH 7 0 1 Dissolve the following in 90 ml deionized water 1 61 g NazHPOu 7H20 0 55 g NaH PO H20 2 Adjust pH to 7 0 with either NaOH or HCl and add 400 mg of ONPG Stir to dissolve and bring the volume up to 100 ml with water 3 Store at 4 C in the dark Dissolve 12 4 g sodium carbonate in 100 ml of deionized water Store at room temperature Continued on next page P Galactosidase Assay continued Procedure Note Determination of Specific Activity Sample Calculation 1 Determine protein concentration of your lysate by Lowry Bradford or BCA assay Equilibrate Z buffer ONPG solution and sodium carbonate solution to 28 C Add 10 50 ul of your crude assay to 1 ml of Z buffer and equilibrate at 28 C As a control for spontaneous hydrolysis of ONPG add an aliquot of your lysis buffer to 1 ml of Z buffer 4 To initiate the reaction add 0 2 ml 4 mg ml ONPG to each of the tubes in Step 2 5 Incubate the samples and the control
5. 6 g sodium phosphate monobasic 372 mg EDTA 50 ml glycerol Use NaOH to adjust pH and bring up the volume to 1 liter Store at 4 C Right before use add the protease inhibitors Bellco 1 800 257 7043 has a wide variety of baffled flasks from 50 to 2000 ml Wheaton 1 609 825 1100 only sells side baffle flasks 59 Proteins Expressed in Pichia Table 60 The table below provides a partial list of references documenting successful expression of heterologous proteins in Pichia pastoris Note that both Mut and Mut phenotypes were used successfully as well as secreted and intracellular expression Protein Expression Where Expressed Reference Levels How Expressed grams liter Enzymes Invertase 2 3 Secreted Tschopp et al Mutt 1987b Bovine Lysozyme c2 0 55 Secreted Digan et al 1989 Mut Streptokinase 0 08 Intracellular Hagenson et al active 1989 Alpha amylase 2 5 Secreted Paifer et al 1994 Mut Pectate Lyase 0 004 Secreted Guo et al 1995 Mut Spinach Phospho 0 1 Intracellular Brandes et al ribulokinase Muts 1996 Antigens Hepatitis B surface 0 4 Intracellular Cregg et al 1987 antigen Muts Pertussis Antigen 3 0 Intracellular Romanos et al P69 Mut 1991 Tetanus Toxin 12 0 Intracellular Clare et al 1991a Fragment C Mut Mut HIV 1 gp120 1 25 Intracellular Scorer et al 1993 Mut Tick Anticoagulant 1 7 S
6. Allows insertion of your gene into the expression vector C terminal myc epitope tag Glu GIn Lys Leu Ile Ser Glu Glu Asp Leu Asn Permits detection of the fusion protein by the Anti myc Antibody or Anti myc HRP Antibody see page viii for ordering information Evan et al 1985 C terminal polyhistidine tag Permits purification of your recombinant fusion protein on metal chelating resin such as ProBond In addition the C terminal polyhistidine tag is the epitope for the Anti His C term Antibody and the Anti His C term HRP Antibody see page viii for ordering information Lindner et al 1997 AOX1 Transcription Termination TT Native transcription termination and polyadenylation signal from AOX1 gene 260 bp that permits efficient 3 mRNA processing including polyadenylation for increased mRNA stability TEF1 promoter Transcription elongation factor 1 gene promoter from Saccharomyces cerevisiae that drives expression of the Sh ble gene in Pichia conferring Zeocin resistance GenBank Acc no D12478 D01130 EM7 synthetic prokaryotic promoter Constitutive promoter that drives expression of the Sh ble gene in E coli conferring Zeocin resistance Sh ble gene Streptoalloteichus hindustanus ble gene Zeocin resistance gene CYC1 transcription termination region 3 end of the Saccharomyces cerevisiae CYC1 gene that allows efficient 3 mRNA processing of the Sh ble
7. 2 days 72 3 days 96 4 days 120 5 days and 144 6 days For secreted expression transfer the supernatant to a separate tube Store the supernatant and the cell pellets at 80 C until ready to assay Freeze quickly in liquid N2 or a dry ice alcohol bath For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N2 or a dry ice alcohol bath Analyze the cell pellets for protein expression by Coomassie stained SDS PAGE and Western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electrophoresis next page 41 Analysis by SDS Polyacrylamide Gel Electrophoresis Introduction Polyacrylamide Gel Electrophoresis Preparing Samples 42 This section provides guidelines to prepare and analyze your samples using SDS polyacrylamide gel electrophoresis If you are pouring your own polyacrylamide gels please note that any standard SDS polyacrylamide gel apparatus and protocol will work For example a 12 polyacrylamide gel with a 5 stacking gel is recommended for proteins ranging in size from 40 100 kDa For other recommendations See standard texts such as Molecular Cloning A Laboratory Manual Sambrook et al 1989 Current Protocols in Molecular Biology Ausubel et al 1994 Guide to Protein Purification Deutscher 1990 or Protein Methods Bollag and Edelstein 1991 Alternatively a wide range of pre
8. Plasmids e NO 7 ee a LA NOIS 16 For pPICZa only The initiation ATG in the a factor signal sequence in pPICZa corresponds to the native initiation ATG of the AOX1 gene If you are using pPICZa the open reading frame ORF of the mature gene of interest should be cloned in frame and downstream of the a factor signal sequence and in frame with the C terminal tag if desired Note Cloning of your gene of interest in frame with the signal sequence does not automatically guarantee that your protein will be in frame with the C terminal tag Please consider both the frame of the signal sequence and the C terminal fusion tag when designing a cloning strategy If you wish to express your gene of interest without the C terminal peptide be sure your gene contains a stop codon The predicted protease cleavage sites for the a factor signal sequence are indicated in the figures on pages 21 23 Refer to Ausubel et al 1990 pages 3 16 1 to 3 17 3 or Sambrook et al 1989 pages 5 10 to 5 13 for help with cloning pPICZ and pPICZa contain unique Bgl II and BamH I sites to allow construction of plasmids containing multiple copies of your gene For information on how to construct multimers please contact Technical Support see page 78 For preparing competent E coli cells for transformation use your own procedure or refer to Current Protocols in Molecular Biology Ausubel et al 1994 or Molecular Biology A Labora
9. Technical Supp Ort voii lil 78 Purchaser Notification ysies eere ea EEE RE EES o EEE EEKE En ESEE E erario 80 References iii ia 82 111 1v Important Information Kit Contents The EasySelect Pichia Expression Kit contains the following components The Pichia EasyComp Kit This kit contains sufficient reagents for 6 preparations of competent cells Each competent cell preparation yields enough cells for 20 transformations Upon receipt store Solutions I and III at 4 C You may store Solution Il at 4 C or at room temperature Component Description Quantity Solution I Sorbitol solution containing ethylene glycol and 75 ml DMSO for the preparation of competent cells Solution II PEG solution for the transformation of competent 150 ml cells 2 x 75 ml Solution III Salt solution for washing and plating transformed 150 ml cells 2 x 75 ml Stab Vials Pichia and E coli stabs Store at 4 C Strain Genotype Phenotype Pichia only X 33 wild type Mutt GS115 his4 His Mutt KM71H arg4 aox1 ARG4 Mut Arg GS115 Albumin HIS4 Mut GS115 pPICZ lacZ his4 His Mutt TOPIO0F E coli F proAB lacl lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC o80lacZAM15 AlacX74 deoR recA1 A araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG Box 3 Vectors and Zeocin Store at 20 C Reagent Amount pPICZA B andC 20 pg of
10. Y 8 Zo 22 c myc epitope 6xHis stop 5 XX Comments for pPICZ A 3329 nucleotides Bgl g 5 AOX1 promoter region bases 1 941 5 end of AOX7 mRNA base 824 The restriction site 5 AOX1 priming site bases 855 875 between Not and the Multiple cloning site bases 932 1011 myc epitope is different c myc epitope tag bases 1012 1044 in each version of pPICZ Polyhistidine tag bases 1057 1077 Apa in pPICZA 3 AOX priming site bases 1159 1179 Xba in pPICZ B 3 end of MRNA base 1250 SnaB in pPICZ C AOX1 transcription termination region bases 1078 1418 Fragment containing TEF1 promoter bases 1419 1830 EM7 promoter bases 1831 1898 Sh ble ORF bases 1899 2273 CYC1 transcription termination region bases 2274 2591 pUC origin bases 2602 3275 complementary strand Continued on next page 12 Selecting a Pichia Expression Vector continued Features of pPICZa A B and C pPICZa A 3593 bp pPICZa B 3597 bp and pPICZa C 3598 bp contain the following elements All features have been functionally tested Feature Benefit 5 AOX1 A 942 bp fragment containing the AOX1 promoter that allows methanol inducible high level expression in Pichia Targets plasmid integration to the AOX1 locus Native Saccharomyces cerevisiae a factor secretion signal Allows for efficient secretion of most proteins from Pichia Multiple cloning site with 10 unique restriction sites
11. 1471 multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPICZa A is available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX7 mRNA 5 AOX1 priming site I AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG TTCCAATTGA CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT ATTCGAAACG ATG AGA TTT CCT TCA ATT TTT ACT GCT GTT TTA TTC GCA GCA Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala TCC TCC GCA TTA GCT GCT CCA GTC AAC ACT ACA ACA GAA GAT GAA ACG GCA Ser Ser Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala a factor signal sequence CAA ATT CCG GCT GAA GCT GTC ATC GGT TAC TCA GAT TTA GAA GGG GAT TTC Gln Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe GAT GTT GCT GTT TTG CCA TTT TCC AAC AGC ACA AAT AAC GGG TTA TTG TTT Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe a factor priming site Xho T T ATA AAT ACT ACT ATT GCC AGC ATT GCT GCT AAA GAA GAA GGG GTA TCT CTC Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Kex2 signal cleavage EcoRI Pll Sfi 1 BsmB Asp718 GAG AAA AGA GAG GCT GAA cch GAATTCAC GTGGCCCAG CCGGCCGTC TCGGATCGGT Glu Lys Arg Glu AlagGlu Alag Ste13 signal cleavage Kpn Xho Sac ll Not Xba c myc epitope ACCTCGAGCC GCGGCGGCC GCCAGCTTTC TA GAA CAA AAA CTC ATC TCA GAA GAG
12. 1995 Cloning of a New Pectate Lyase Gene pelC from Fusarium solani f sp pisi Nectria haematococca Mating Type VI and Characterization of the Gene Product Expressed in Pichia pastoris Arch Biochem Biophys 323 352 360 Guthrie C and Fink G R 1991 Guide to Yeast Genetics and Molecular Biology In Methods in Enzymology Vol 194 J N Abelson and M I Simon eds Academic Press San Diego CA Hagenson M J Holden K A Parker K A Wood P J Cruze J A Fuke M Hopkins T R and Stroman D W 1989 Expression of Streptokinase in Pichia pastoris Yeast Enzyme Microbiol Technol 11 650 656 Henikoff S and Cohen E H 1984 Sequences Responsible for Transcription Termination on a Gene Segment in Saccharomyces cerevisiae Mol Cell Biol 4 1515 1520 Higgins D R 1995 Heterologous Protein Expression in the Methylotrophic Yeast Pichia pastoris In Current Protocols in Protein Science Supplement 2 P T Wingfield ed pp 5 7 1 5 7 16 Holm C Meeks Wagner D W Fangman W L and Botstein D 1986 A Rapid Efficient Method for Isolating DNA from Yeast Gene 42 169 173 Irniger S Egli C M and Braus G H 1991 Different Classes of Polyadenylation Sites in the Yeast Saccharomyces cerevisiae Mol Cell Bio 11 3060 3069 Johnston M 1987 A Model Fungal Gene Regulatory Mechanism the GAL Genes of Saccharomyces Cerevisiae Microbiol Rev 51 458 476 Koutz P J Davis
13. Autoclave 690 ml water for 20 minutes on liquid cycle 2 Cool to room temperature then add the following and mix well 100 ml 1 M potassium phosphate buffer pH 6 0 100 ml 10X YNB 2 ml 500X B 100 ml 10X GY For BMMH add 100 ml 10X M instead of glycerol To add histidine add 10 ml of 100X H stock solution Mix and store at 4 C 6 Store media at 4 C The shelf life of this solution is approximately two months Buffered Glycerol complex Medium Buffered Methanol complex Medium 1 liter 1 yeast extract 2 peptone 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 10 biotin 1 glycerol or 0 5 methanol 1 Dissolve 10 g of yeast extract 20 g peptone in 700 ml water 2 Autoclave 20 minutes on liquid cycle 3 Cool to room temperature then add the following and mix well 100 ml 1 M potassium phosphate buffer pH 6 0 100 ml 10X YNB 2 ml 500X B 100 ml 10X GY For BMMY add 100 ml 10X M instead of glycerol Store media at 4 C The shelf life of this solution is approximately two months Continued on next page Pichia Media Recipes continued Breaking Buffer Vendors for Baffled Flasks 50 mM sodium phosphate pH 7 4 1 mM PMSF phenyImethylsulfonyl fluoride or other protease inhibitors 1mM EDTA 5 glycerol 1 Prepare a stock solution of your desired protease inhibitors and store appropriately Follow manufacturer s recommendations 2 For 1 liter dissolve the following in 900 ml deionized water
14. Collect the cells by centrifugation at 1 500 x g for 5 10 minutes at room temperature 3 Wash the cells with 10 ml sterile water by centrifugation as in Step 2 1 Resuspend the cells in 2 ml of SCED buffer pH 7 5 Make this solution fresh 2 Add 0 1 0 3 mg of Zymolyase mix well before adding to the cells Incubate at 37 C for 50 minutes to achieve lt 80 spheroplasting 3 Add 2 ml of 1 SDS mix gently and set on ice 0 to 4 C for 5 minutes Add 1 5 ml of 5 M potassium acetate pH 8 9 and mix gently Centrifuge at 10 000 x g for 5 10 minutes at 4 C and save the supernatant Continued on next page 71 Isolating Total DNA from Pichia continued DNA Precipitation 12 Transfer the supernatant from Step 5 page 71 and add 2 volumes of ethanol to the supernatant Incubate at room temperature for 15 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C Resuspend the pellet gently in 0 7 ml of TE buffer pH 7 4 and transfer to a microcentrifuge tube Gently extract with an equal volume of phenol chloroform 1 1 v v followed by an equal volume of chloroform isoamy l alcohol 24 1 Split the aqueous layer into two microcentrifuge tubes Add 1 2 volume of 7 5 M ammonium acetate pH 7 5 and 2 volumes of ethanol to each tube Place on dry ice for 10 minutes or at 20 C for 60 minutes Centrifuge at 10 000 x g for 20 minutes at 4 C and wash the pellets once with 1 ml of 70 ethanol Briefly air dry
15. Glu Gln Lys Leu Ile Ser Glu Glu polyhistidine tag EA I GAT CTG AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTGTAGCC Asp Leu Asn Ser Ala Val Asp His His His His His His TTAGACATGA CTGTTCCTCA GTTCAAGTTG GGCACTTACG AGAAGACCGG TCTTGCTAGA 3 AOX7 priming site I TTCTAATCAA GAGGATGTCA GAATGCCATT TGCCTGAGAG ATGCAGGCTT CATTTTTGAT 3 polyadenylation site l ACTTTTTTAT TTGTAACCTA TATAGTATAG GATTTTTTTT GTCATTTTGT TTCTTCTCGT To express your protein with a native N terminus you must clone your gene flush with the Kex2 cleavage site You will need to use PCR and utilize the Xho I site upstream of the Kex2 cleavage site Continued on next page 21 Cloning into pPICZa continued Multiple Cloning Below is the multiple cloning site of pPICZa B Restriction sites are labeled to Site of pPICZa B indicate the cleavage site The boxed nucleotide indicates the variable region 811 871 931 983 1034 1085 1136 1187 1243 1300 1352 1412 1472 The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence pPICZa B is available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX7 mRNA 5 AOX1 priming site AACCTTTTTT TITATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG TTCCAATTGA pein hull CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT ATTCGAAACG ATG AGA T
16. N acetylglucosamine GalNAc N acetylgalactosamine and NeuAc N acetylneuraminic acid Enzyme Type of Specificity enzyme Endoglycosidase D Endo Cleaves various high mannose glycans Endoglycosidase F Endo Cleaves various high mannose glycans Endoglycosidase H Endo Cleaves various high mannose glycans B galactosidase Exo Removes terminal galactosides from Gal B1 3 GlcNAc Gal B1 4 GlcNAc or Gal B1 3 GalNAc Peptide N Glycosidase F Endo Glycoproteins between Asn and GlcNAc removes oligosaccharides Sialidases Exo NeuAc a2 6 Gal Neuraminidases NeuAc a2 6 GlcNAc Vibrio cholerae or NeuAc a2 3 Gal Clostridium perfringens Arthobacter ureafaciens Newcastle disease virus Commercial There are a number of commercial vendors who will contract to analyze proteins Carbohydrate for glycosylation A number of companies also supply kits and reagents for Analysis researchers to do carbohydrate analysis in their own laboratories A partial list is rovided below Company Type of Service Phone Number Glyko Kits for Carbohydrate Analysis 1 800 334 5956 Reagents Contract Services Oxford GlycoSystems Kits for Carbohydrate Analysis 1 800 722 2597 Reagents Contract Services New England BioLabs Reagents 1 800 632 5227 52 Appendix E coli Media Recipes Low Salt LB Low Salt LB medium is needed for use with the Zeocin antibiotic Note that you Luria Bertani may substitute
17. Pichia Transformants 28 1 Mix 80 ul of the cells from Step 6 previous page with 5 10 ug of linearized DNA in 5 10 pl sterile water and transfer them to an ice cold 0 2 cm electroporation cuvette Note For circular DNA use 50 100 ug Incubate the cuvette with the cells on ice for 5 minutes Pulse the cells using the manufacturer s instructions for Saccharomyces cerevisiae 4 Immediately add 1 ml of ice cold 1 M sorbitol to the cuvette Transfer the cuvette contents to a sterile 15 ml tube and incubate at 30 C without shaking for 1 to 2 hours 5 Spread 10 25 50 100 and 200 ul each on separate labeled YPDS plates containing 100 ug ml Zeocin Plating at low cell densities favors efficient TM Zeocin selection Incubate plates from 3 10 days at 30 C until colonies form Pick 10 20 colonies and purify streak for single colonies on fresh YPD or YPDS plates containing 100 pg ml Zeocin A quick direct way to select putative multi copy recombinants is to plate the transformation mix on increasing concentrations of Zeocin 1 Prepare YPDS plates containing 500 1000 and 2000 pg ml Zeocin 2 Plate 100 to 200 pl of the transformation mix on each plate and incubate at 30 C for 2 days 3 Test transformants for the Mut phenotype page 33 and expression of your protein page 37 Generally several hundred to several thousand Zeocin resistant Zeo colonies are generated using the above
18. Pichia Straits zoieso irokesere eo A A ate ES E EEEE a Ee 37 Analysis by SDS Polyacrylamide Gel Electrophoresis ccociconononcnonnononenenrnrannnnnrnnnnnonnrororarancnnanararanananos 42 Optimizing Pichia Protein Expression oooococoncncnnnononenncnnnnnrnnonnnnncnnarorananannnnnnananananonnnnnnn nana rarannn Oea RRES 45 SC A nibs eA Be ae et ee SAN a ed i eae 47 Purificada 50 Pr tein Glyc sylatio Nesini esne eei eiea E ae E Eee E EEEE E Eees 52 Aprendo 53 ECOL Media RECIPES siiciiticd dt dt AAA 53 Pichia Media Recipes yin SEs So da abet ck eta EEA A EE e A 54 Proteins Expressed AAA N 60 Recombination and Integration in Pichi ococononincncnonnonnnnanennnrnnnnnnnnnnnnnrnrorananannnnanarananan on nn conan career 62 Lithium Chloride Transformation Method cccccccccsessseseseseseecececeteneesesescsnsneseseseseeeeceeeneeesesesesnanenes 64 ZOOM AAA Mls assist late tata Mou ag ia Cas 66 PCR Analysis of Pichia Integrant ccccccccccccssesetesesesneneesessscececeeeneseseseeceeeesesenesesesnsnensnesessseseeeeeeeneies 68 Direct PCR Screening of Pichia Clone sonrie unane ee ea are aa E a A a E a Ronai 70 Isolating Total DNA from Pichi sssrin ne E REE REEE REEE E EAER 71 Determining the Copy Number of Multiple IntegradtS ococoococoninononnnomncnnnnncncncarararnnnnnnrnraranannaoa 73 Isolating Total RNA from PichlA ooconononininonnnonncncnenenrnrnrnnnnnnncnrnraranannrnnnaranananan nr nn nana nara raranannnnrnararananans 75 AE A E E tienen 76
19. Pichia recombinants you will then test expression of both Mut and Mut recombinants This will involve growing a small culture of each recombinant inducing with methanol and taking time points If looking for intracellular expression analyze the cell pellet from each time point by SDS polyacrylamide gel electrophoresis SDS PAGE If looking for secreted expression analyze both the cell pellet and supernatant from each time point We recommend that you analyze your SDS PAGE gels by both Coomassie staining and Western blot We also suggest checking for protein activity by assay if one is available Not all proteins express to the level of grams per liter so it is advisable to check by Western blot or activity assay and not just by Coomassie staining of SDS PAGE gels for production of your protein Choose the Pichia recombinant strain which best expresses your protein and optimize induction based on the suggestions on pages 45 46 Once expression is optimized scale up your expression protocol to produce more protein for purification Both pPICZ and pPICZa contain a polyhistidine tag that binds divalent cations like Ni to facilitate purification Metal binding resins such as ProBond can be used to purify proteins expressed from pPICZ or pPICZa We recommend that you use the ProBond Purification System Cat no K850 01 to purify fusion proteins expressed using pPICZ or pPICZa Note that instructions for equilibration of and chromat
20. R Cordoves C Valdes M Lleonart R Herrera L and delaFuente J 1994 High Level Expression of the B microplus Bm86 Antigen in the Yeast Pichia pastoris Forming Highly Immunogenic Particles for Cattle J Biotechnol 33 135 146 Romanos M A Clare J J Beesley K M Rayment F B Ballantine S P Makoff A J Dougan G Fairweather N F and Charles I G 1991 Recombinant Bordetella pertussis Pertactin p69 from the Yeast Pichia pastoris High Level Production and Immunological Properties Vaccine 9 901 906 Romanos M A Scorer C A and Clare J J 1992 Foreign Gene Expression in Yeast A Review Yeast 8 423 488 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Schmitt M E Brown T A and Trumpower B L 1990 A Rapid and Simple Method for Preparation of RNA from Saccharomyces cerevisiae Nucleic Acids Res 18 3091 Scorer C A Buckholz R G Clare J J and Romanos M A 1993 The Intracellular Production and Secretion of HIV 1 Envelope Protein in the Methylotrophic Yeast Pichia pastoris Gene 136 111 119 Sreekrishna K Nelles L Potenz R Cruse J Mazzaferro P Fish W Fuke M Holden K Phelps D Wood P and Parker K 1989 High Level Expression Purification and Characterization of Recombinant Human Tumor Necrosis Factor Synthesized
21. Siegel R Akong M Craig W S Buckholz R G Madden K R Kellaris P A Davis G R Smiley B L Cruze J Torregrossa R Velicelebi G and Thill G P 1987 High Level Expression and Efficient Assembly of Hepatitis B Surface Antigen in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 479 485 Cregg J M Vedvick T S and Raschke W C 1993 Recent Advances in the Expression of Foreign Genes in Pichia pastoris Bio Technology 11 905 910 Despreaux C W and Manning R F 1993 The dacA Gene of Bacillus stearothermophilus Coding for D Alanine carboxypeptidase Cloning Structure and Expression in Escherichia coli and Pichia pastoris Gene 131 35 41 Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA Digan M E Lair S V Brierley R A Siegel R S Williams M E Ellis S B Kellaris P A Provow S A Craig W S Velicelebi G Harpold M M and Thill G P 1989 Continuous Production of a Novel Lysozyme via Secretion from the Yeast Pichia pastoris Bio Technology 7 160 164 Drocourt D Calmels T P G Reynes J P Baron M and Tiraby G 1990 Cassettes of the Streptoalloteichus hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance Nucleic Acids Res 18 4009 Ellis S B Brust P F Koutz P J Water
22. a0x1 Cregg et al 1989 Koutz et al 1989 Expression of the AOX1 gene is controlled at the level of transcription In methanol grown cells approximately 5 of the polyA RNA is from the AOX1 gene The regulation of the AOX1 gene is a two step process a repression derepression mechanism plus an induction mechanism e g GAL1 gene in Saccharomyces Johnston 1987 Briefly growth on glucose represses transcription even in the presence of the inducer methanol For this reason growth on glycerol is recommended for optimal induction with methanol Note that growth on glycerol alone derepression is not sufficient to generate even minute levels of expression from the AOX1 gene The inducer methanol is necessary for even detectable levels of AOX1 expression Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a Loss of the AOX1 gene and thus a loss of most of the cell s alcohol oxidase activity results in a strain that is phenotypically Mut Methanol utilization slow This has in the past been referred to as Mut The Mut designation has been chosen to accurately describe the phenotype of these mutants This results in a reduction in the cells ability to metabolize methanol The cells therefore exhibit poor growth on methanol medium Mut Methanol utilization plus refers to the wild type ability of strains to metabolize methanol as the sole carbon source These two phenotypes are used when evaluating Pichia transforma
23. and licenses for its use as an expression system are owned by Research Corporation Technologies RCT Inc Tucson Arizona Life Technologies has an exclusive license to sell Pichia expression kits and vectors to scientists for research purposes only under the terms described below Use of Pichia pastoris by commercial entities for any commercial purpose requires the user to obtain a commercial license as detailed below Before using any Pichia expression product please read the following license agreement If you do not agree to be bound by its terms contact Life Technologies within 10 days for authorization to return the unused Pichia expression products and to receive a full refund If you do agree to the terms of this license agreement please complete the User Registration Card and return it to Life Technologies before using the product Life Technologies Corporation Life Technologies grants you a non exclusive license to use the enclosed Pichia expression vectors Expression Vector for academic research or for evaluation purposes only The Expression Vectors are being transferred to you in furtherance of and reliance on such license You may not use the Expression Vectors for any commercial purpose without a license for such purpose from Research Corporation Technologies Inc Tucson Arizona Commercial purposes include any use of Expression Products or Expression Vectors in a Commercial Product any use of Expression Products or Ex
24. by Northern analysis and check your sequence for AT rich regions It may be necessary to change the sequence in order to express your gene Scorer et al 1993 e The native 5 end of the AOX1 mRNA is noted in each multiple cloning site This is needed to calculate the size of the expressed mRNA of the gene of interest if you need to analyze mRNA for any reason For pPICZ only e For proper initiation of translation your insert should contain an initiation ATG codon as part of a yeast consensus sequence Romanos et al 1992 An example of a yeast consensus sequence is provided below The ATG initiation codon is shown underlined G A NNATGG Note that other sequences are also possible Although not as strong as the mammalian Kozak translation initiation sequence the yeast consensus sequence is thought to have a 2 3 fold effect on the efficiency of translation initiation e To express your gene as a recombinant fusion protein you must clone your gene in frame with the C terminal peptide containing the c myc epitope and the polyhistidine tag The vector is supplied in three reading frames to facilitate cloning Refer to the diagrams on pages 18 20 to develop a cloning strategy e If you wish to express your protein without the C terminal peptide be sure to include a stop codon Continued on next page 15 General Cloning Information continued General Considerations Cloning Procedures Constructing Multimeric
25. by the User For the procedures described in this manual you will need the following reagents and equipment Additional reagents may be required Please check each experiment to ensure you have all the reagents necessary 30 C and 37 C rotary shaking incubator Water baths capable of 16 C 37 C and 65 C Centrifuge suitable for 50 ml conical tubes floor or table top Baffled culture flasks with metal covers 50 ml 250 ml 500 ml 1000 ml and 3 liters 50 ml sterile conical tubes 6 ml and 15 ml sterile snap top tubes Falcon 2059 or similar UV Spectrophotometer Restriction enzymes and appropriate buffers Agarose and low melt agarose Mini agarose gel apparatus and buffers Glass milk Sterile water CIAP calf intestinal alkaline phosphatase 1 unit yl 10X CIAP Buffer Phenol chloroform 3 M sodium acetate 100 ethanol 80 ethanol T4 Ligase 2 5 units pl 10X Ligation Buffer with ATP Low Salt LB medium see page 53 for recipe Zeocin antibiotic see page viii for ordering information Low Salt LB plates containing 25 ug ml Zeocin YPDS plates containing 100 ug ml Zeocin plates Polyacrylamide Gel Electrophoresis apparatus and buffers Media for transformation growth screening and expression see pages 54 59 Sterile cheesecloth or gauze Breaking Buffer see Recipes page 59 Acid washed glass beads available from Sigma Electroporator and 0 2 cm cuvettes or reagents for transformation optiona
26. gene for increased stability GenBank Acc no M34014 pUC origin Allows replication and maintenance of the plasmid in E coli Sac I Pme I BstX I Unique restriction sites that permit linearization of the vectors at the AOX1 locus for efficient integration into the Pichia genome Continued on next page 13 Selecting a Pichia Expression Vector continued Map of pPICZa A The figure below summarizes the features of the pPICZa A B and C vectors The B and C vector sequences for pPICZa A B and C are available for downloading from our website www invitrogen com or from Technical Support see page 78 Details of the multiple cloning sites are shown on page 21 for pPICZa A page 22 for pPICZa B and page 23 for pPICZa C Comments for pPICZa A Bgl Il 3593 nucleotides Pst is in Version B only 5 AOX1 promoter region bases 1 941 ia l 5 AOX1 priming site bases 855 875 Mo only a factor signal sequence bases 941 1207 a factor priming site bases 1144 1164 Multiple cloning site bases 1208 1276 c myc epitope bases 1275 1304 The two Xho sites in the vector allow Polyhistidine 6xHis tag bases 1320 1337 the user to clone their gene in frame with 3 AOX1 priming site bases 1423 1443 the Kex2 cleavage site resulting in AOX1 transcription termination region bases 1341 1682 expression of their native gene without TEF1 promoter bases 1683 2093 additional amino acids at the N terminus
27. in log phase growth Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature Decant supernatant and resuspend cell pellet to an ODs of 1 0 in MMH BMMH or BMMY medium to induce expression approximately 100 200 ml Place culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator to continue growth Add 100 methanol to a final concentration of 0 5 methanol every 24 hours to maintain induction At each of the times indicated below transfer 1 ml of the expression culture to a 1 5 ml microcentrifuge tube Use these samples to analyze expression levels and determine the optimal time post induction to harvest Centrifuge at maximum speed in a tabletop microcentrifuge for 2 3 minutes at room temperature Time points hours 0 6 12 24 1 day 36 48 2 days 60 72 3 days 84 and 96 4 days For secreted expression transfer the supernatant to a separate tube Store the supernatant and the cell pellets at 80 C until ready to assay Freeze quickly in liquid N2 or a dry ice alcohol bath For intracellular expression decant the supernatant and store just the cell pellets at 80 C until ready to assay Freeze quickly in liquid N2 or a dry ice alcohol bath Analyze the supernatants and cell pellets for protein expression by Coomassie stained SDS PAGE and Western blot or functional assay see Analysis by SDS Polyacrylamide Gel Electropho
28. is the site of cleavage 2 The Glu Ala repeats are further cleaved by the STE13 gene product In Saccharomyces cerevisiae the Glu Ala repeats are not necessary for cleavage by Kex2 but cleavage after Glu Lys Arg may be more efficient when followed by Glu Ala repeats A number of amino acids are tolerated at site X instead of Glu in the sequence Glu Lys Arg X These amino acids include the aromatic amino acids small amino acids and histidine Proline however will inhibit Kex2 cleavage For more information on Kex2 cleavage see Brake et al 1984 There are some cases where Ste13 cleavage of Glu Ala repeats is not efficient and Glu Ala repeats are left on the N terminus of the expressed protein of interest This is generally dependent on the protein of interest To express your protein with a native N terminus use the Xho I site at bp 1184 1189 to clone your gene flush with the Kex2 cleavage site Use PCR to rebuild the sequence from the Xho I site to the arginine codon at nucleotides 1193 1195 Remember to include the first amino acid s of your protein if necessary for correct fusion to the Kex2 cleavage site Continued on next page 17 Cloning into pPICZ Multiple Cloning Site of pPICZ A 18 811 871 931 991 042 098 158 1218 Below is the multiple cloning site for pPICZ A Restriction sites are labeled to indicate the cleavage site The boxed nucleotides indicate the variable reg
29. ml of MGYH BMGH or BMGY in a 250 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until culture reaches an ODs 2 6 approximately 16 18 hours Use this 25 ml culture to inoculate 1 liter of MGYH BMGH or BMGY in a 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth OD w 2 6 Harvest the cells using sterile centrifuge bottles by centrifuging at 1500 3000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pellet to an ODeo 1 0 2 6 liters in MMH BMMH or BMMY medium to start induction Aliquot the culture between several 3 or 4 liter baffled flask Cover the flasks with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached as determined from the time course study Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature For intracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill to 4 C and concentrate it down if desired see page 49 Proceed directly to purification page 50 or store the supernatant at 80 C until ready to process further Continued on next page 47 Scale up of Expression con
30. protocol For more colonies you may modify the protocol as described below Note that you will need 20 150 mm plates with YPDS agar containing 100 pg ml Zeocin 1 Setup two transformations per construct and follow Steps 1 through 5 of the Transformation by Electroporation protocol above 2 After 1 hour in 1 M sorbitol at 30 C Step 4 above add 1 ml YPD medium to each tube Shake 200 rpm the cultures at 30 C 3 After 1 hour take one of the tubes and plate out all of the cells by spreading 200 ul on 150 mm plates containing 100 ug ml Zeocin 4 Optional Continue incubating the other culture for three more hours for a total of four hours and then plate out all of the cells by spreading 200 pl on TM 150 mm plates containing 100 pg ml Zeocin 5 Incubate plates for 2 to 4 days at 30 C until colonies form Select 6 10 of your Zeo Pichia transformants and confirm the Mut phenotype as described on page 33 You may also analyze for the presence of insert using PCR page 68 or for copy number using Southern analysis page 74 EasyComp Transformation Introduction Required Reagents and Equipment Before Beginning Preparing Competent Cells TM The Pichia EasyComp Kit produces chemically competent Pichia cells and is included to provide an alternative to electroporation and a rapid convenient method for transformation However because of the low transformation efficiency 3 ug plasmid
31. site GATACTTTTT TATTTGTAAC CTATATAGTA TAGGATTTTT TITGTCATTT TGTTTCTTCT To express your protein with a native N terminus you must clone your gene flush with the Kex2 cleavage site You will need to use PCR and utilize the Xho I site upstream of the Kex2 cleavage site 22 Continued on next page Cloning into pPICZa continued Multiple Cloning Below is the multiple cloning site of pPICZa C Restriction sites are labeled to Site of pPICZa C indicate the cleavage site The boxed nucleotide indicates the variable region The 811 871 931 983 1034 1085 1136 1187 1244 1301 1353 1413 1473 multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPICZa C is available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX7 mRNA 5 AOX1 priming site T AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TIGCGACTGG TTCCAATTGA et onal CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT I ATTCGAAACG ATG AGA TTT CCT TCA ATT TTT ACT GCT GTT TTA TTC GCA GCA Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala TCC TCC GCA TTA GCT GCT CCA GTC AAC ACT ACA ACA GAA GAT GAA ACG GCA Ser Ser Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala a factor signal sequence CAA ATT CCG GCT GAA GCT GTC ATC GGT TAC TCA GAT TTA GAA GGG GAT TTC Gln Ile Pro Ala Glu Ala Val Ile Gly
32. that you screen 6 10 verified recombinant clones for expression levels Start with colonies from the freshest plates available Colony viability drops over time so if you have any doubts it is better to streak out your strain You may also start the cultures with a small sample from a frozen glycerol stock that was generated from a single colony The following steps are guidelines and are presented to get you started with expression You may have to change the conditions to optimize expression for your particular protein Use bottom or side baffled flasks whenever possible These are available in a variety of sizes 50 2000 ml If you are analyzing a number of recombinants you can try 50 ml conical tubes Be sure that the medium is well aerated by increasing the rate of shaking or placing the tubes at an angle in the shaker Continued on next page 39 Expressing Recombinant Pichia Strains continued Mutt Intracellular or Secreted 40 You can test the effectiveness of your expression conditions by growing GS115 pPICZ lacZ which is Mut and expresses B Galactosidase intracellularly Remember to include GS115 transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 25 ml of MGYH BMGH or BMGY ina 250 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until culture reaches an OD 00 2 6 approximately 16 18 hours The cells will be
33. the parent strain of KM71 arg4 his4 and Arg transformants were isolated and analyzed for the Mut phenotype Genetic analysis of Arg transformants showed that the wild type AOX1 gene was replaced by the aox1 ARG4 construct To create KM71H KM71 was transformed with a gene fragment encoding the HIS4 gene and a His convertant was isolated The advantage of using KM71H is that there is no need to screen for the Mut phenotype on methanol minimal medium All transformants will be Mut Secondly since the AOX1 locus was completely deleted it is theoretically possible to replace aox1 ARG4 with your construct by gene replacement The phenotype of this strain would be Mut Arg This means the recombinant strain would require arginine in the medium to grow Unfortunately simple inclusion of arginine does not totally alleviate the effects of the arg4 mutation and arg4 strains do not grow well on minimal medium supplemented with arginine Therefore we do not recommend that you generate transformants in KM71H by replacing the aox1 ARG4 construct Continued on next page Pichia Strains continued Control Expression Strains Growth of Pichia Strains Growth on Methanol GS115 His Mut Albumin This strain is a control for secreted expression page 41 and the Mut phenotype when characterizing Pichia transformants page 34 The gene for serum albumin was cloned with its native secretion signal then integrated into Pi
34. using Invitrogen s FastTrack 2 0 or Micro FastTrack 2 0 mRNA Isolation Kit If you wish to use another protocol scale up the reaction to yield about 2 mg of total RNA per time point The mRNA is for northern blot analysis of Pichia recombinants to determine if the gene of interest is being induced and transcribed You should isolate RNA from induced cultures using an uninduced culture as a negative control Prepare the following solutions Remember to use DEPC treated water and to use equipment free of RNase MGYH or BMGY medium DEPC treated water 3 M sodium acetate pH 5 3 Buffered phenol 10 SDS in DEPC treated water Phenol chloroform 1 1 Chloroform isoamy l alcohol 24 1 65 C water bath AE buffer 50 mM sodium acetate pH 5 3 1 mM EDTA 1 Grow two cultures 100 200 ml in MGYH or BMGY but induce only one of them Use the same protocol for induction that you used when expressing recombinant Pichia strains pages 37 41 2 Take 10 ml time points at 1 2 3 4 and 6 days by centrifuging at 1 500 x g for 10 minutes at room temperature 3 Resuspend cell pellet in 400 ul AE buffer and transfer to a microcentrifuge tube Add 40 ul 10 SDS and vortex for 20 seconds 2 Add an equal volume 450 500 ul of buffer saturated phenol and vortex for 20 seconds 3 Incubate at 65 C for 4 minutes Incubate in a dry ice ethanol bath until crystals show 1 minute Centrifuge at maximum speed for 2 minutes at 4
35. which may be suitable are TOP10 DH5aF JM109 or any other strain which is recombination deficient recA and deficient in endonuclease A endA F proAB lacl lacZAM15 Tn10 Tet mcrA A mrr hsdRMS mcrBC o80lacZAM15 AlacX74 deoR recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG A Any E coli strain that contains the complete Tn5 transposable element i e DH5aF1Q SURE SURE2 encodes the ble bleomycin resistance gene These strains will confer resistance to Zeocin For the most efficient selection it is highly recommended that you choose an E coli strain that does not contain the Tn5 gene i e TOP10 DH5 DH10 etc We recommend that you make a frozen stock of TOP10F to keep on hand e Culture TOP10F in 5 ml LB with 10 pg ml tetracycline Grow overnight e Mix thoroughly 0 85 ml of culture with 0 15 ml sterile glycerol e Transfer to a freezer vial and freeze in liquid nitrogen or a dry ice ethanol bath e Store at 80 C Selecting a Vector Features of pPICZ A B and C Selecting a Pichia Expression Vector If your protein is cytosolic and non glycosylated you may elect to express the protein intracellularly using one of the pPICZ vectors If your protein is normally secreted glycosylated or directed to an intracellular organelle you may wish to try secreting your protein using one of the pPICZa vectors We recommend that you try both the native secretion si
36. within the vector or the insert The size of the fragment will increase in additions of 4 7 kb over the size of the fragment containing 1 copy of the gene Alternatively digestion of DNA from Pichia recombinants containing multiple copies will produce a band that will vary in intensity depending on the number of copies of your gene It is very important to include a control to show the intensity of a single copy gene You can quantify the relative band intensities using densitometry to estimate gene dosage It is very important to include DNA from the host strain alone X 33 GS115 or KM71H the host strain transformed with the parent vector and the host strain transformed with a vector containing one copy of your gene e Use standard procedures and solutions for Southern blotting as outlined in Molecular Cloning A Laboratory Manual Sambrook et al 1989 pages 9 31 9 58 e Isolate genomic DNA and quantify using fluorometry Be sure to eliminate RNA It is very important to load the same amount of DNA into each lane to accurately determine copy number if you are using relative intensities e Probe your Southern blot with a fragment complementary to your gene Isolating Total RNA from Pichia Introduction Solutions Growth of Cells Lysing Cells mRNA Isolation and Northern Analysis This protocol is designed to isolate 60 300 ug total RNA Schmitt et al 1990 from Pichia which is suitable for mRNA isolation
37. year 10X M 5 Methanol Mix 5 ml of methanol with 95 ml of water Filter sterilize and store at 4 C The shelf life of this solution is approximately two months 10X GY 10 Glycerol Mix 100 ml of glycerol with 900 ml of water Sterilize either by filtering or autoclaving Store at room temperature The shelf life of this solution is greater than one year 1M potassium phosphate buffer pH 6 0 Combine 132 ml of 1 M K HPO 868 ml of 1 M KH2PO and confirm that the pH 6 0 0 1 if the pH needs to be adjusted use phosphoric acid or KOH Sterilize by autoclaving and store at room temperature The shelf life of this solution is greater than one year Continued on next page Pichia Media Recipes continued Using Pichia Media YPD or YEPD The table below is designed to help you decide which Pichia medium to use for a particular application Medium Description Application YPD or YEPD Rich complex broth General growth and storage YPDS YPD with sorbitol and Selection of Pichia Zeo Zeocin Zeocin transformants MGYH or Minimal medium containing Intracellular Expression MGY glycerol and or histidine Generation of biomass prior to methanol induction MDH or MD Minimal medium containing Determination of Mut glucose and or histidine phenotype MMH or MM Minimal medium containing Determination of Mut methanol and or histidine phenotype Intracellular expression of desired
38. 0 dilution Time 10 minutes ODaz0 0 4 The amount of protein in the reaction 0 01 ml x 0 01 dilution factor x 10 mg ml 0 001 mg protein in the reaction The specific activity 0 400 x 380 15 200 units mg protein 10 x 0 001 mg Pure P galactosidase has an activity of 300 000 units mg protein 11 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS SDSs Safety Data Sheets are available on our website at www invitrogen com sds
39. 57 1217 The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPICZ Cis available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX7 mRNA 5 AOX1 priming site AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG TTCCAATTGA Date vol CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT Sfu EcoR Pml Sfi l BsmB Asp718 Kpn Xho I I I l l l l I ATTCGAAACG AGGAATTCAC GTGGCCCAGC CGGCCGTCTC GGATCGGTAC CTCGAGCCGC Sac Il Not SnaB myc epitope 1 I 1 I GGCGGCCGCC AGCTT ACGTA GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Polyhistidine tag l l AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTGTAGCC TTAGACATGA Asn Ser Ala Val Asp His His His His His His CTGTTCCTCA GTTCAAGTTG GGCACTTACG AGAAGACCGG TCTTGCTAGA TTCTAATCAA 3 AOX7 priming site GAGGATGTCA GAATGCCATT TGCCTGAGAG ATGCAGGCTT CATTTTTGAT ACTTTTTTAT 3 polyadenylation site TTGTAACCTA TATAGTATAG GATTTTTTTT GTCATTTTGT TTC Continued on next page Cloning into pPICZa Multiple Cloning Below is the multiple cloning site of pPICZa A Restriction sites are labeled to Site of pPICZa A indicate the cleavage site The boxed nucleotide indicates the variable region The 811 871 931 983 1034 1085 1136 1187 1244 1299 1351 1411
40. Buckholz R G and Gleeson M A G 1991 Yeast Systems for the Commercial Production of Heterologous Protein Bio Technology 9 1067 1072 Calmels T Parriche M Burand H and Tiraby G 1991 High Efficiency Transformation of Tolypocladium geodes Conidiospores to Phleomycin Resistance Curr Genet 20 309 314 Clare J J Rayment F B Ballantine S P Sreekrishna K and Romanos M A 1991a High level Expression of Tetanus Toxin Fragment c in Pichia pastoris Strains Containing Multiple Tandem Integrations of the Gene Bio Technology 9 455 460 Clare J J Romanos M A Rayment F B Rowedder J E Smith M A Payne M M Sreekrishna K and Henwood C A 1991b Production of Epidermal Growth Factor in Yeast High Level Secretion Using Pichia pastoris Strains Containing Multiple Gene Copies Gene 105 205 212 Cregg J M Barringer K J and Hessler A Y 1985 Pichia pastoris as a Host System for Transformations Mol Cell Biol 5 3376 3385 Cregg J M and Higgins D R 1995 Production of Foreign Proteins in the Yeast Pichia pastoris Canadian J Botany Supp 73 5981 5987 Continued on next page 82 References continued Cregg J M Madden K R Barringer K J Thill G and Stillman C A 1989 Functional Characterization of the Two Alcohol Oxidase Genes from the Yeast Pichia pastoris Mol Cell Biol 9 1316 1323 Cregg J M Tschopp J F Stillman C
41. C 5 Transfer aqueous phase to new centrifuge tube and add an equal volume of phenol chloroform and vortex for 20 seconds Centrifuge at maximum speed for 2 minutes at 4 C 6 Remove upper phase to a new tube and add 40 pl of 3 M sodium acetate pH 5 3 and 2 5 volumes of 100 ethanol 20 C Centrifuge at maximum speed for 15 minutes at 4 C Remove ethanol 7 Wash pellet with 80 ethanol and air dry briefly Resuspend total RNA in 20 ul DEPC treated water and store at 80 C Yield is 60 300 pg total RNA See Ausubel et al 1994 for a protocol for mRNA isolation and Northern analysis The FastTrack 2 0 mRNA Kit Cat no K1593 02 is designed to isolate mRNA from 0 2 to 1 mg total RNA The Micro FastTrack 2 0 Kit Cat no K1520 02 is designed to isolate mRNA from 100 pg total RNA You will need 1 5 ug mRNA per time point 75 p Galactosidase Assay Introduction Preparation of Solutions Z Buffer ONPG Solution 1M Sodium Carbonate 76 The GS115 pPICZ lacZ strain is provided as a Hist Mutt intracellular expression control Growth of the strain during Mut expression provides a positive control for expression conditions You may use the cell free f galactosidase assay adapted from Miller 1972 page 403 to evaluate expression of B galactosidase Prepare the following e A fresh crude cell lysate of GS115 pPICZ lacZ see page 40 e Zbuffer e ONPG solution e 1Msodium carbonate solution
42. C terminal polyhistidine tag All vectors contain the Zeocin resistance gene for positive selection in E coli and Pichia See pages 11 14 for more information on these vectors Two different phenotypic classes of recombinant strains can be generated Mutt and Mut Mut refers to the Methanol utilization slow phenotype caused by the loss of alcohol oxidase activity encoded by the AOX1 gene A strain with a Mut phenotype has a mutant a0x1 locus but is wild type for AOX2 This results in a slow growth phenotype on methanol medium Both X 33 and GS115 are Mut and KM71H is Mut Transformation of X 33 or GS115 with plasmid DNA linearized in the 5 AOX1 region will yield Mut transformants while KM71H will yield only Mut transformants Both Mutt and Mut recombinants are useful to have as one phenotype may favor better expression of your protein than the other You should test between 6 10 recombinants per phenotype because the site of recombination may affect expression There is no way to predict beforehand which construct or isolate will better express your protein For more information on recombination in Pichia see page 62 Once you have successfully cloned your gene behind the AOX1 promoter you will then linearize your plasmid to stimulate recombination when the plasmid is transformed into Pichia Continued on next page Experimental Outline continued Expression and Scale up Purification After isolating your
43. D R Purcell T J Bergseid M Collins Racie L A LaVallie E R and Hoeffler J P 1996 Production of a Recombinant Bovine Enterokinase Catalytic Subunit in the Methylotrophic Yeast Pichia pastoris Bio Technology 14 77 81 Wagner S L Siegel R S Vedvick T S Raschke W C and VanNostrand W E 1992 High level Expression Purification and Characterization of the Kunitz type Protease Inhibitor Domain of Protease Nixin 2 amyloid b Protein Precursor Biochem Biophys Res Commun 186 1138 1145 Wegner G H 1990 Emerging Applications of the Methylotrophic Yeasts FEMS Microbiology Reviews 87 279 284 Weiss H M Haase W Michel H and Reilander H 1995 Expression of Functional Mouse 5 HT5 A Serotonin Receptor in the Methylotrophic Yeast Pichia pastoris Pharmacological Characterization and Localization FEBS 377 451 456 Zaret K S and Sherman F 1984 Mutationally Altered 3 Ends of Yeast CYC1 mRNA Affect Transcript Stability and Translational Efficiency J Mol Biol 177 107 136 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owner Zeocin is a trademark of CAYLA
44. DNA yields about 50 colonies it is very difficult to isolate multi copy integrants In instances where multi copy integrants are desired please use electroporation page 28 for best results Note that cells are prepared differently for electroporation Do not use cells prepared using the EasyComp protocol for electroporation e 30 C rotary shaking incubator e YPD Yeast Extract Peptone Dextrose medium see Recipes page 55 e 50 ml sterile conical tubes e Centrifuge suitable for 50 ml conical tubes floor or table top e 1 5 ml sterile screw cap microcentrifuge tubes e 80 C freezer e Styrofoam box or paper towels e Streak a YPD plate with your Pichia pastoris strain such that isolated single colonies will grow Incubate the plate at 28 30 C for 2 days e Equilibrate Solution I to room temperature 1 Inoculate 10 ml of YPD with a single colony of your Pichia strain Grow overnight at 28 30 C in a shaking incubator 250 300 rpm 2 Dilute cells from the overnight culture to an ODeo of 0 1 0 2 in 10 ml of YPD Grow the cells at 28 30 C in a shaking incubator until the ODeo is 0 6 1 0 This will take approximately 4 to 6 hours 3 Pellet the cells by centrifugation at 500 x g for 5 minutes at room temperature Discard the supernatant 4 Resuspend the cell pellet in 10 ml of Solution I No incubation time is required 5 Pellet the cells by centrifugation at 500 x g for 5 minutes at room temperature Dis
45. EM7 promoter bases 2095 2162 Sh ble ORF bases 2163 2537 CYC1 transcription termination region bases 2538 2855 pUC origin bases 2866 3539 complementary strand 14 General Cloning Information Introduction General Considerations Before cloning your gene into one of the pPICZ or pPICZa vectors consider some of the general guidelines presented below If you are cloning into pPICZa it is important to clone your gene in frame with the a factor signal sequence The multiple cloning sites for all vectors are presented on pages 18 23 to help you develop a cloning strategy The following are some general considerations applicable to pPICZ or pPICZa e The codon usage in Pichia is believed to be similar to Saccharomyces cerevisiae e Many Saccharomyces genes have proven to be functional in Pichia e Maintain plasmid constructions in a recA endA E coli strain such as TOP10 e The BsmB I site in the multiple cloning site has been specifically engineered to be compatible with inserts that have BamH I and or Bgl Il ends The BamH I and Bg II sites will be destroyed upon ligation but the insert can be released by digestion with BsmB I e The premature termination of transcripts because of AT rich regions has been observed in Pichia and other eukaryotic systems Henikoff and Cohen 1984 Irniger et al 1991 Scorer et al 1993 Zaret and Sherman 1984 If you have problems expressing your gene check for premature termination
46. G R Stillman C Barringer K Cregg J M and Thill G 1989 Structural Comparison of the Pichia pastoris Alcohol Oxidase Genes Yeast 5 167 177 Laroche Y Storme V Meutter J D Messens J and Lauwereys M 1994 High Level Secretion and Very Efficient Isotopic Labeling of Tick Anticoagulant Peptide TAP Expressed in the Methylotrophic Yeast Pichia pastoris Bio Technology 12 1119 1124 Linder S Schliwa M and Kube Granderath E 1996 Direct PCR Screening of Pichia pastoris Clones BioTechniques 20 980 982 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Nico Farber K Harder W Ab G and Veenhuis M 1995 Review Methylotrophic Yeasts as Factories for the Production of Foreign Proteins Yeast 11 1331 1344 Paifer E Margolles E Cremata J Montesino R Herrera L and Delgado J M 1994 Efficient Expression and Secretion of Recombinant Alpha Amylase in Pichia pastoris Using Two Different Signal Sequences Yeast 10 1415 1419 Continued on next page 84 References continued Ridder R Schmitz R Legay F and Gram H 1995 Generation of Rabbit Monoclonal Antibody Fragments from a Combinatorial Phage Display Library and Their Production in the Yeast Pichia pastoris Bio Technology 13 255 260 Rodriguez M Rubiera R Penichet M Montesinos R Cremata J Falcon V Sanchez G Bringas
47. H values to optimize protein production BMGY BMMY contain yeast extract and peptone to stabilize secreted proteins and to prevent or decrease proteolysis of secreted proteins Inclusion of yeast extract and peptone allow better growth and biomass accumulation There are some proteins specifically susceptible to proteases that have optimal activity at neutral pH If this is the case expression using MGYH and MMH media may be indicated As Pichia expression progresses in an unbuffered medium such as MMH the pH drops to 3 or below inactivating many neutral pH proteases Brierley et al 1994 Pichia is resistant to low pH so the low pH will not affect growth In contrast it has been reported that by including 1 Casamino acids Difco and buffering the medium at pH 6 0 extracellular proteases were inhibited increasing the yield of mouse epidermal growth factor Clare et al 1991b If you know your protein of interest is especially susceptible to neutral pH proteases express your protein in an unbuffered medium MMH If there is no evidence that your secreted protein of interest is susceptible to proteases at neutral pH we recommend you do your initial expressions in BMMY If the expressed protein is degraded try expressing your protein in an unbuffered medium The most important parameter for efficient expression in Pichia is adequate aeration during methanol induction As a general rule when inducing expression never allow cultu
48. Low Salt LB for regular LB for most applications Medium 1 Tryptone 0 5 Yeast Extract 0 5 NaCl pH 7 5 1 For 1 liter dissolve the following in 950 ml deionized water 10 g tryptone 5 g yeast extract 5g NaCl Adjust the pH of the solution to 7 5 with 1 N NaOH and bring the volume up to 1 liter Autoclave for 20 minutes at 15 lb sq in and 121 C Let cool to 55 C and add desired antibiotics at this point For Low Salt LB medium with Zeocin add Zeocin to 25 ug ml final concentration Store at 4 C If you have added Zeocin store medium in the dark Low Salt LB Agar 1 Plates Make Low Salt LB Medium above and add 15 g liter agar before autoclaving Autoclave for 20 minutes at 15 lb sq in Let cool to 55 C and add desired antibiotics at this point For Low Salt LB plates with Zeocin add Zeocin to 25 ug ml final concentration Pour into 10 cm petri plates Let the plates harden then invert and store at 4 C If you have added Zeocin store plates in the dark Plates containing Zeocin are stable for 1 2 weeks 53 Pichia Media Recipes Introduction Stock Solutions 54 The expression of recombinant proteins in Pichia pastoris requires the preparation of several different media Recipes for these media are included in this section In addition Yeast Nitrogen Base is available from Invitrogen see below for ordering information Item Amount Cat no Yeast Nitro
49. Mut recombinants increase the number of Note flasks put 200 300 ml in a 3 liter flask or try fermentation 48 Continued on next page Scale up of Expression continued Concentration of Proteins Cell Lysis Fermentation Proteins secreted into the media are usually gt 50 homogeneous and will require some additional purification see page 50 or 52 It is optimal to concentrate the protein if the expression level is not particularly high There are several general methods to concentrate proteins secreted from Pichia These general methods include e Ammonium sulfate precipitation e Dialysis e Centrifuge concentrator for small volumes e g Centricon or Centriprep devices available from Amicon e Pressurized cell concentrators for large volumes Amicon ultrafiltration devices e Lyophilization A general guide to protein techniques is Protein Methods Bollag and Edelstein 1991 A general procedure for cell lysis using glass beads is provided on the next page There is also a cell lysis protocol in Current Protocols in Molecular Biology page 13 13 4 Ausubel et al 1994 and in Guide to Protein Purification Deutscher 1990 We also recommend lysis by French Press follow the manufacturer s suggestions for yeast Basic guidelines are available for fermentation of Pichia from Invitrogen We recommend that only those with fermentation experience or those who have access to people with experience atte
50. Saccharomyces cerevisiae and Pichia pastoris have a majority of N linked glycosylation of the high mannose type however the length of theoligosaccharide chains added posttranslationally to proteins in Pichia average 8 14 mannose residues per side chain is much shorter than those in Saccharomyces cerevisiae 50 150 mannose residues Grinna and Tschopp 1989 Tschopp et al 1987b Very little O linked glycosylation has been observed in Pichia In addition Saccharomyces cerevisiae core oligosaccharides have terminal a1 3 glycan linkages whereas Pichia pastoris does not It is believed that the a1 3 glycan linkages in glycosylated proteins produced from Saccharomyces cerevisiae are primarily responsible for the hyper antigenic nature of these proteins making them particularly unsuitable for therapeutic use Although not yet proven this is predicted to be less of a problem for glycoproteins generated in Pichia pastoris because it may resemble the glycoprotein structure of higher eukaryotes Cregg et al 1993 Experimental Outline Selection of Vector and Cloning Transformation and Integration To utilize the strong highly inducible P4ox1 promoter for expression of your protein there are two expression vectors included in this kit One vector pPICZ is for intracellular expression while the other vector pPICZa is for secreted expression Each vector is provided in three reading frames to facilitate cloning in frame with the
51. TT CCT TCA ATT TTT ACT GCT GTT TTA TTC GCA GCA Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala TCC TCC GCA TTA GCT GCT CCA GTC AAC ACT ACA ACA GAA GAT GAA ACG GCA Ser Ser Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala a factor signal sequence CAA ATT CCG GCT GAA GCT GTC ATC GGT TAC TCA GAT TTA GAA GGG GAT TTC Gln Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe GAT GTT GCT GTT TTG CCA TTT TCC AAC AGC ACA AAT AAC GGG TTA TTG TTT Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe a factor priming site Xho T ATA AAT ACT ACT ATT GCC AGC ATT GCT GCT AAA GAA GAA GGG GTA TCT CTC Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Kex2 signal cleavage Pst EcoRI Pmll Sfi BsmB l l i I GAG AAA AGA GAG GCT GAA GC TGCAG GAATTCAC GTGGCCCAG CCGGCCGTC TCGGA Glu Lys Arg Glu fie ean Ala Ste13 signal cleavage Asp718 Kpn Xho Sac ll Noti Xba c myc epitope I 1c I TCGGTACCTC GAGCCGCGGC GGCCGCCAGC TTTCTA GAA CAA AAA CTC ATC TCA GAA Glu Gln Lys Leu Ile Ser Glu polyhistidine tag I GAG GAT CTG AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTGTA Glu Asp Leu Asn Ser Ala Val Asp His His His His His His GCCTTAGACA TGACTGTTCC TCAGTTCAAG TTGGGCACTT ACGAGAAGAC CGGTCTTGCT 3 AOX7 priming site I AGATTCTAAT CAAGAGGATG TCAGAATGCC ATTTGCCTGA GAGATGCAGG CTTCATTTTT 3 polyadenylation
52. Tyr Ser Asp Leu Glu Gly Asp Phe GAT GTT GCT GTT TTG CCA TTT TCC AAC AGC ACA AAT AAC GGG TTA TTG TTT Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe a factor priming site Xho T ATA AAT ACT ACT ATT GCC AGC ATT GCT GCT AAA GAA GAA GGG GTA TCT CTC Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Kex2 signal cleavage Cla EcoR Pml Sfi l BsmB 1 I l I 1 GAG AAG AGA GAG GCT GAA GC ATCGAT GAATTCAC GTGGCCCAG CCGGCCGTC TCGGA Glu Lys Arg Glu AlagGlu Alay Ste13 signal cleavage Asp718 Kpn Xho Sac ll Not Xba c myc epitope I co l TCGGTACCTC GAGCCGCGGC GGCCGCCAGC TTTCTA GAA CAA AAA CTC ATC TCA GAA Glu Gln Lys Leu Ile Ser Glu polyhistidine tag I GAG GAT CTG AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTGTA Glu Asp Leu Asn Ser Ala Val Asp His His His His His His GCCTTAGACA TGACTGTTCC TCAGTTCAAG TTGGGCACTT ACGAGAAGAC CGGTCTTGCT 3 AOX1 priming site I l AGATTCTAAT CAAGAGGATG TCAGAATGCC ATTTGCCTGA GAGATGCAGG CTTCATTTTT 3 polyadenylation site GATACTTTTT TATTTGTAAC CTATATAGTA TAGGATTTTT TTTGTCATTT TGTTTCTTCT To express your protein with a native N terminus you must clone your gene flush with the Kex2 cleavage site You will need to use PCR and utilize the Xho I site upstream of the Kex2 cleavage site 23 Transformation into E coli Introduction Important Transformation Analyzing Transfo
53. Zeocin plates see Recipes page 56 e The PEG in Solution II may precipitate at temperatures below 27 C If you see a precipitate warm the solution at 37 C swirling occasionally until the precipitate dissolves To prevent formation of a precipitate store Solution II at room temperature e Equilibrate Solution III to room temperature e Equilibrate the appropriate number and type of plates to room temperature You will need one plate for each transformation e You may want to include controls to check for contamination We recommend a no DNA and a plasmid only control Continued on next page EasyComp Transformation continued Transformation Protocol 1 10 11 12 For each transformation thaw one tube of competent cells at room temperature and aliquot 50 pl into a sterile microcentrifuge tube If transforming fresh cells use 50 pl of cells from Preparing Competent Cells Step 7 page 29 Add 3 ug of linearized Pichia expression vector DNA to the competent cells Note Using greater than 3 ug of DNA may increase transformation efficiencies in some cases The volume of DNA should not exceed 5 pl Linearized DNA can be used directly from a restriction digest reaction without affecting transformation efficiency Phenol chloroform extraction and ethanol precipitation are not necessary Add 1 ml of Solution II to the DNA cell mixture and mix by vortexing or flicking the tube Incubate the transformati
54. a modified version of the procedure described for S cerevisiae Gietz and Schiestl 1996 This protocol is provided as an alternative to transformation by electroporation Transformation efficiency is between 10 to 10 cfu ug linearized DNA Lithium acetate does not work with Pichia pastoris Use only lithium chloride 1 M LiCl in distilled deionized water Filter sterilize Dilute as needed with sterile water 50 polyethylene glycol PEG 3350 in distilled deionized water Filter sterilize Store in a tightly capped bottle 2 mg ml denatured fragmented salmon sperm DNA in TE 10 mM Tris HCI pH 8 0 1 0 mM EDTA Store at 20 C 1 Grow a 50 ml culture of Pichia pastoris in YPD at 30 C with shaking to an OD o of 0 8 to 1 0 approximately 10 cells ml 2 Harvest the cells and wash with 25 ml of sterile water and centrifuge at 1 500 x g for 10 minutes at room temperature Decant the water and resuspend the cells in 1 ml of 100 mM LiCl Transfer the cell suspension to a 1 5 ml microcentrifuge tube Pellet the cells at maximum speed for 15 seconds and remove the LiCl with a pipet Resuspend the cells in 400 ul of 100 mM LiCl Dispense 50 ul of the cell suspension into a 1 5 ml microcentrifuge tube for each transformation and use immediately Do not store on ice or freeze at 20 C Continued on next page Lithium Chloride Transformation Method continued Transformation 1 Boil a 1 ml sample of single s
55. at 28 C until a faint yellow color develops This should occur at least 10 minutes after the start of the assay to ensure accurate data Note that the tube with no lysate may not change color 6 Stop the reaction by adding 0 5 ml of 1 M sodium carbonate to each tube Record the length of incubation for each sample Read the OD against the control containing buffer alone Determine the protein concentration of your lysate in mg ml If the reaction turns yellow too quickly you need to dilute your lysate Try successive 10 fold dilutions of the lysate using your lysis buffer until the reaction starts turning yellow after 10 minutes This is to ensure that you are measuring a true initial rate Use the following formula to determine the specific activity of the P galactosidase in units mg total protein OD x 380 minutes at 28 C x mg protein in reaction P galactosidase units mg total protein Remember to take into account the volume of lysate added to the reaction and any dilutions made to the lysate when calculating the amount of protein in the reaction The number 380 is the constant used to convert the OD reading into units One unit is defined as the amount of enzyme that will hydrolyze 1 nmole of ONPG per minute at 28 C The molar extinction coefficient of ONPG under these conditions is 4 500 For a sample calculation See below Here is a sample calculation Extract concentration 10 mg ml Assay 10 pl of a 1 10
56. ates 1 liter Minimal Methanol with histidine MMH agar plates 1 liter Sterile toothpicks and Scoring Templates see page 36 Streak out the strains GS115 Albumin Mut and GS115 pPICZ lacZ Mutt on an MDH or MGYH plate as controls for Mut and Mut growth Continued on next page 33 Determining the Mut Phenotype continued Mut in GS115 or X 33 Important Replica Plating Procedure 34 Use the plates containing the Zeo transformants and confirm the Mutt phenotype as described below See page 36 for scoring templates Note Instructions are for GS115 strains These strains require histidine for growth X 33 does not require histidine for growth so you may leave it out of the medium 1 Using a sterile toothpick pick one colony and streak or patch one Zeo transformant in a regular pattern on both an MMH plate and an MDH plate making sure to patch the MMH plate first 2 Use a new toothpick for each transformant and continue until 10 transformants have been patched 1 plate 3 To differentiate Mut from Mut make one patch for each of the controls GS115 Mut Albumin and GS115 pPICZ lacZ Mut onto the MDH and MMH plates Incubate the plates at 30 C for 2 days After 2 days or longer at 30 C score the plates Mut strains will grow normally on both plates while Mut strains will grow normally on the MDH plate but show little or no growth on the MMH plate We recommend purifying your Zeo
57. ay isolate genomic DNA spot it directly onto nitrocellulose or nylon fix and analyze for copy number 1 Grow Mut or Mut transformants in individual wells of a 96 well microtiter plate in 200 ul of YPD broth at 30 C until all wells have approximately the same density This may necessitate several passages Alternatively you may grow individual transformants in culture tubes and normalize the absorbance at 600 nm by adding medium 2 Filter 50 pl of each sample onto a nitrocellulose or nylon filter placed into a dot slot blot apparatus using multi channel pipettor Air dry filters 3 To lyse the cells on the filter treat the filter with four solutions as follows place two sheets of 3 MM paper in a tray and soak with 10 15 ml of 50 mM EDTA 2 5 B mercaptoethanol pH 9 Make sure that the paper is uniformly soaked and that there are no puddles Place the nitrocellulose filter face down on the treated 3MM paper Incubate for 15 minutes at room temperature 4 Remove the nitrocellulose filter from the 3MM paper and replace the 3MM paper with two new sheets Soak with 10 15 ml of 1 mg ml Zymolyase 100T as described in Step 3 Place the nitrocellulose filter face down on the 3MM paper and incubate for 4 hours at 37 C Continued on next page 73 Determining the Copy Number of Multiple Integrants continued Quantitative Dot Blot Procedure continued Southern Blot Analysis Controls General Guidelines 74 5 Re
58. ble transformants of Pichia pastoris via homologous recombination between the transforming DNA and regions of homology within the genome Cregg et al 1985 Cregg et al 1989 Such integrants show extreme stability in the absence of selective pressure even when present as multiple copies Note that single crossover events insertions are much more likely to happen than double crossover events replacements Multiple insertion events occur spontaneously at about 1 10 of the single insertion events Gene Insertion at Gene insertion events at the AOX1 X 33 or GS115 or aox1 ARG4 KM71H loci AOX1 or arise from a single crossover event between the loci and either of the two AOX1 aox1 ARG4 regions on the pPICZ or pPICZa vectors the AOX1 promoter or the AOX1 transcription termination region TT This results in the insertion of one or more copies of the vector upstream or downstream of the AOX1 or the aox1 ARG4 genes The phenotype of such a transformant is Mut X 33 or GS115 or Mut KM71H By linearizing the recombinant vector at a restriction enzyme site located in the 5 AOX1 regions Mut or Mut recombinants can be conveniently generated depending on the host strain used The figure below shows the result of an insertion of the plasmid 5 to the intact AOX1 locus Mut and the gain of Paox1 your gene of interest and the Zeocin resistance gene This also occurs with non linearized plasmid and plasmid that religates althoug
59. card the supernatant Resuspend the cell pellet in 1 ml of Solution I The cells are now competent Aliquot 50 to 200 ul of competent cells into labeled 1 5 ml sterile screw cap microcentrifuge tubes Note Use 50 ul of cells for each transformation You can thaw the cells and refreeze several times without significant loss in transformation efficiency 8 At this point the cells may be kept at room temperature and used directly for transformation or frozen for future use To freeze cells place tubes ina Styrofoam box or wrap in several layers of paper towels and place in a 80 C freezer It is important that you freeze the cells slowly Do not snap freeze the cells in liquid nitrogen 9 Proceed to the transformation procedure Continued on next page 29 EasyComp Transformation continued Note Transformation Required Reagents and Equipment Before Beginning 30 We have observed that higher transformation efficiencies are often obtained with frozen versus freshly prepared cells You may choose to use some of the cells immediately following preparation and freeze the remaining cells in small aliquots You may use the following protocol to transform freshly prepared or frozen competent Pichia cells Transformation efficiency may vary with each strain and vector used e 30 C incubator e Water baths or heat blocks at 30 C and 42 C e Microcentrifuge at room temperature TM e YPDS with 100 pg ml
60. cast NuPAGE and Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen The patented NuPAGE Gel System avoids the protein modifications associated with laemmli type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use refer to our website www invitrogen com or call Technical Support see page 78 You will need to prepare Breaking Buffer see page 59 and have acid washed 0 5 mm glass beads on hand Preparing cell pellets Intracellular and Secreted Expression 1 Thaw cell pellets quickly and place on ice 2 For each 1 ml sample add 100 pl Breaking Buffer to the cell pellet and resuspend 3 Add an equal volume of acid washed glass beads size 0 5 mm Estimate equal volume by displacement 4 Vortex 30 seconds then incubate on ice for 30 seconds Repeat for a total of 8 cycles 5 Centrifuge at maximum speed for 10 minutes at 4 C Transfer the clear supernatant to a fresh microcentrifuge tube 6 Take 50 pl of supernatant cell lysate and mix with 50 pl 2X SDS PAGE Gel Loading buffer Sample Buffer 7 Boil for 10 minutes and load 10 20 ul per well Thickness of the gel and number of wells will determine the volume you load You may store the remaining sample at 20 C for Western blots if
61. chia at the AOX1 locus This strain secretes albumin 67 kDa into the medium at levels gt 1 gram liter GS115 pPICZ lacZ Mut B galactosidase The strain GS115 pPICZ lacZ expresses P galactosidase fused at the C terminus to the myc epitope and the polyhistidine tag Expression of the 119 kDa fusion protein is driven by the Paox1 promoter and is inducible by methanol The fusion protein is visible on a Coomassie stained SDS polyacrylamide gel and can be detected antigenically using the Anti myc Antibody see page viii or enzymatically using an ONPG assay B Gal Assay Kit Cat no K1455 01 GS115 pPICZ lacZ is provided as a positive control for TM Zeocin resistance in Pichia Mut expression page 33 and 41 and purification The growth temperature of Pichia pastoris is 28 30 C for liquid cultures plates and slants Growth above 32 C during induction can be detrimental to protein expression and can even lead to cell death Other important facts Doubling time of log phase Mutt or Mut Pichia in YPD is 2 hours e Mutt and Mut strains do not differ in growth rates unless grown on methanol e Doubling time of log phase Mutt Pichia in methanol medium MM is 4 6 hours e Doubling time of log phase Mut Pichia in MM is 18 hours e One OD6v0 5x 107 cells ml Note that growth characteristics may vary depending on the recombinant protein expressed When plates or medium containing methanol are used as growth medium it
62. ct Zeocin resistant colonies 2 Pick 10 Zeocin resistant transformants and inoculate into 2 ml Low Salt LB TM medium with 25 pg ml Zeocin Grow overnight at 37 C with shaking 3 Isolate plasmid DNA by miniprep for restriction analysis and sequencing see next page 4 Be sure to make a glycerol stock of your purified clone for safekeeping Continued on next page Transformation into E coli continued Sequencing Recombinant Clones Plasmid Preparation We strongly recommend that you sequence your construct to confirm that your gene is in frame with the C terminal peptide before transforming into Pichia Use the sequencing primers included in the kit to sequence your construct To sequence your construct in pPICZ use the 5 AOX1 and the 3 AOX1 Sequencing Primers To sequence your construct in pPICZa use the a factor or the 5 AOX1 and the 3 AOX1 Sequencing Primers To use the primers resuspend each lyophilized primer in 20 pl sterile water This will yield a stock solution of 0 1 ng ul For sequencing protocols Refer to Unit 7 in Current Protocols in Molecular Biology Ausubel et al 1994 or Chapter 13 in Molecular Cloning A Laboratory Manual Sambrook et al 1989 Once you have cloned and sequenced your insert generate enough plasmid DNA to transform Pichia 5 10 ug of each plasmid per each transformation We recommend the S N A P Miniprep Kit Cat no K1900 01 or the PureLi
63. each vector in TE buffer pH 8 0 40 ul at 500 ng ul pPICZa A B and C 20 ug of each vector in TE buffer pH 8 0 40 ul at 500 ng pl Zeocin 2 x 1 25 ml 100 mg ml TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 Continued on next page Important Information continued Kit Contents continued Media Note vi Box 4 Primers Store at 20 C Reagent Sequence Amount 5 AOX1 5 GACTGGTTCCAATTGACAAGC 37 2 ug lyophilized sequencing primer 312 pmoles 5 Pichia primer 3 AOX1 5 GCAAATGGCATTCTGACATCC 3 2 ug lyophilized sequencing primer 314 pmoles 3 Pichia primer a Factor 5 TACTATTGCCAGCATTGCTGC 3 2 ug lyophilized sequencing primer 315 pmoles The following prepackaged media is included for your convenience Instructions for use are provided on the package Keep the media dry and store at room temperature Media Amount Yield YP Base Medium 2 pouches 2 liters of YP medium YP Base Agar Medium 2 pouches 2 liters of YP agar medium Yeast Nitrogen Base 1 pouch 500 ml of 10X YNB The Pichia and TOP10F E coli stabs supplied with the kit are guaranteed until the expiration date marked on tube when stored at 4 C We recommend you prepare a set of glycerol master stocks prior to using your Pichia page 9 and TOP10F E coli cells page 10 Important Information continued Materials Supplied
64. ecreted Laroche et al protein Muts 1994 Bm86 Tick Gut 1 5 Secreted Rodriguez et al Glycoprotein 1994 Continued on next page Proteins Expressed in Pichia continued Proteins Expressed in Pichia continued Protein Expression Where Expressed Reference Levels How Expressed grams liter Regulatory Proteins Tumor Necrosis 10 0 Intracellular Sreekrishna et al Factor TNF Muts 1989 Mouse Epidermal 0 45 Secreted Clare et al 1991b Growth Factor Muts EGF Human Interferon 0 4 Intracellular Garcia et al 1995 IFN a2b Muts Membrane Proteins Human CD38 0 05 Secreted Fryxell et al 1995 soluble portion Muts Mouse Serotonin 0 001 Secreted Weiss et al 1995 Receptor Mutt Proteases and Protease Inhibitors Carboxypeptidase B 0 8 Secreted Despreaux and Mut Muts Manning 1993 Enterokinase 0 021 Secreted Vozza et al 1996 Mutt Ghilanten 0 01 Secreted Brankamp et al Mut 1995 Kunitz protease 1 0 Secreted Wagner et al inhibitor 1992 Human Proteinase 0 05 Intracellular Sun et al 1995 Inhibitor 6 Mutt Antibodies Rabbit Single Chain gt 0 1 Secreted Ridder et al 1995 Antibody Muts Mut phenotype was not described in the paper 61 Recombination and Integration in Pichia Introduction Like Saccharomyces cerevisiae linear DNA can generate sta
65. egion The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPICZ B is available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX1 mRNA 5 AOX7 priming site I T 811 AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTTCATAA TTGCGACTGG TTCCAATTGA 871 CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACTTGAGA AGATCAAAAA ACAACTAATT Sfu EcoR Pml Sfi BsmB Asp7181 Kpn Xho l l l l l l l l 931 ATTCGAAACG AGGAATTCAC GTGGCCCAGC CGGCCGTCTC GGATCGGTAC CTCGAGCCGC Sac Il Not Xba myc epitope l l 1 991 GGCGGCCGCC AGCTT TCTA GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Polyhistidine tag l 1 1040 AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTGTAGCC TTAGACATGA Asn Ser Ala Val Asp His His His His His His 1096 CTGTTCCTCA GTTCAAGTTG GGCACTTACG AGAAGACCGG TCTTGCTAGA TTCTAATCAA 3 AOX7 priming site I 1156 GAGGATGTCA GAATGCCATT TGCCTGAGAG ATGCAGGCTT CATTTTTGAT ACTTTTTTAT 3 polyadenylation site 1216 TTGTAACCTA TATAGTATAG GATTTTTTTT GTCATTTTGT TTC Continued on next page 19 Cloning into pPICZ continued Multiple Cloning Below is the multiple cloning site of pPICZ C Restriction sites are labeled to Site of pPICZ C indicate the cleavage site The boxed nucleotides indicate the variable region 20 811 871 931 991 1041 1097 11
66. en shown to be a problem 69 Direct PCR Screening of Pichia Clones Introduction A simple protocol has been reported in the literature to directly test Pichia clones for insertion of your gene by PCR Linder et al 1996 Briefly the cells are lysed by a combined enzyme freezing and heating treatment The genomic DNA can be used directly as a PCR template Before Starting You will need the following reagents and equipment on hand A culture or single colony of a Pichia transformant 1 5 ml microcentrifuge tube 5 U ul solution of Lyticase Sigma 30 C water bath or heat block Liquid nitrogen Reagents for PCR Procedure 1 Place 10 pl of a Pichia pastoris culture into a 1 5 ml microcentrifuge tube For relatively dense cultures dilute 1 ul of the culture into 9 pl water Alternatively pick a single colony and resuspend in 10 pl of water Add 5 pl of a5 U pl solution of lyticase and incubate at 30 C for 10 minutes Freeze the sample at 80 C for 10 minutes or immerse in liquid nitrogen for 1 minute Set up a 50 ul PCR for a hot start 10X Reaction Buffer 5 pl 25 mM MgCl 5 pl 25 mM dNTPs 1 ul 5 AOX1 primer 10 pmol ul 1 ul 3 AOX1 primer 10 pmol ul 1 ul Sterile water 27 ul Cell lysate 5 ul Total Volume 45 ul Place the solution in the thermocyler and incubate at 95 C for 5 minutes Add 5 ul of a 0 16 U pl solution of Tag polymerase 0 8 units Cycle 30 times using the following parameter
67. ethanol precipitate using 1 10 volume 3 M sodium acetate and 2 5 volumes of 100 ethanol 4 Centrifuge the solution to pellet the DNA wash the pellet with 80 ethanol air dry and resuspend in 10 ul sterile deionized water Use immediately or store at 20 C Electroporation of Pichia Introduction Important Before Starting Preparing Pichia for Electroporation We strongly recommend electroporation if you are specifically interested in isolating multi copy integrants of your gene in Pichia The frequency of multi copy insertions ranges from 1 to 10 requiring hundreds to thousands of transformants to isolate a suitable number of multi copy clones to test for expression Electroporation yields some of the highest transformation frequencies in Pichia and is the method of choice to isolate multi copy integrants Traditionally spheroplasting has been used to transform Pichia but this method of transformation does not allow direct selection on Zeocin Damage to the cell wall leads to increase sensitivity to Zeocin causing putative transformants to TM die before they express the Zeocin resistance gene You will need the following materials for transforming Pichia and selecting transformants on Zeocin Note Inclusion of sorbitol in YPD plates stabilizes electroporated cells as they appear to be somewhat osmotically sensitive e 5 10 ug pure pPICZ or pPICZa containing your insert Note For tran
68. f recombinant plasmid positive control and 100 ng of the appropriate plasmid without insert negative control Load thermocycler and run the following program Step Temperature Time Cycle Heat Soak 94 C 2 minutes 1X Denaturation 94 C 1 minute Annealing 55 C 1 minute 25X Extension 72 C 1 minute Final Extension 72 C 7 minutes 1X Analyze 10 ul on a 1X TAE 0 8 agarose gel Continued on next page PCR Analysis of Pichia Integrants continued Interpreting PCR If screening Mut integrants you should see two bands one corresponding to the size of your gene of interest the other to the AOX1 gene approximately 2 2 kb In KM71H the PCR product is 3 6 kb because of the ARG4 insert in AOX1 Parent plasmids will produce the following sized PCR products Add the size of these products to the size of your insert to interpret your PCR results Vector PCR Product pPICZ 325 bp A 323 bp B 324 bp C pPICZa using the 5 AOX1 primer 588 bp A 592 bp B 593 bp C pPICZa using the a Factor primer 299 bp A 303 bp B 304 bp C If you use the a factor primer as a PCR primer you will not see a band with Important either GS115 or KM71H This is because there is no a factor signal associated with the chromosomal A0X1 gene Note Sometimes there will be ghost bands appearing in your PCR These do not seem to be significant as they have not be
69. for high expressing recombinants be sure to also check the Mut phenotype This will help you optimize expression of your recombinant clone Pichia pastoris is capable of integrating multiple copies of transforming DNA via recombination into the genome at sites of sequence homology see page 63 for figure Although the exact mechanism of multiple integration events is not fully understood such events are reasonably common among selected transformants Successful expression of the gene of interest to useful levels may depend upon the generation of a recombinant strain that contains multiple copies integrated at the AOX1 locus In addition to simply screening expression levels among several Mut or Mut recombinants via SDS PAGE analysis it may be desirable to determine the existence of strains that have multiple integrants in the Mut or Mut recombinant strain See the Appendix page 73 for methods to determine copy number After confirming the Mut phenotype you may proceed to small scale expression page 37 to test for expression of your gene Continued on next page 35 Determining the Mut Phenotype continued Scoring Templates ON con ore asas ue se ve se ze sso foe 82 22 jf 92 2 v2 ez 2z 12 02 er om con ore asas ue se e se zens foe 82 22 92 s2 v2 ez 2z 12 oz er Expressing Recombinant Pichia Strains Introduction Detection of Recombinant P
70. gen Base 67 g pouch Q300 07 with ammonium sulfate Each pouch contains reagents to prepare tamos 500 ml of a 10X YNB solution 500 g Q300 09 10X YNB 13 4 Yeast Nitrogen Base with Ammonium Sulfate without amino acids Dissolve 134 g of yeast nitrogen base YNB with ammonium sulfate and without amino acids in 1000 ml of water and filter sterilize Heat the solution to dissolve YNB completely in water Store at 4 C Alternatively use 34 g of YNB without ammonium sulfate and amino acids and 100 g of ammonium sulfate The shelf life of this solution is approximately one year If you are using the YNB pouch included in the kit follow the directions on the pouch Note Pichia cells exhibit optimal growth with higher YNB concentrations therefore the amount of YNB used in this kit is twice as concentrated as YNB formulations for Saccharomyces 500X B 0 02 Biotin Dissolve 20 mg biotin in 100 ml of water and filter sterilize Store at 4 C The shelf life of this solution is approximately one year 100X H 0 4 Histidine Dissolve 400 mg of L histidine in 100 ml of water Heat the solution if necessary to no greater than 50 C in order to dissolve Filter sterilize and store at 4 C The shelf life of this solution is approximately one year 10X D 20 Dextrose Dissolve 200 g of D glucose in 1000 ml of water Autoclave for 15 minutes or filter sterilize The shelf life of this solution is approximately one
71. gnal and the a factor signal sequence in order to secrete your protein Note There is no yeast origin of replication in any of the Pichia expression vectors included in this kit Zeo transformants can only be isolated if recombination occurs between the plasmid and the Pichia genome pPICZ A 3329 bp pPICZ B 3328 bp and pPICZ C 3329 bp contain the following elements All features have been functionally tested Feature Benefit 5 AOX1 A 942 bp fragment containing the AOX1 promoter that allows methanol inducible high level expression in Pichia Targets plasmid integration to the AOX1 locus Multiple cloning site with 10 unique restriction sites Allows insertion of your gene into the expression vector C terminal myc epitope tag Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Permits detection of the fusion protein by the Anti myc Antibody or Anti myc HRP Antibody see page viii for ordering information Evan et al 1985 C terminal polyhistidine tag Permits purification of your recombinant fusion protein on metal chelating resin such as ProBond In addition the C terminal polyhistidine tag is the epitope for the Anti His C term Antibody and the Anti His C term HRP Antibody see page viii Lindner et al 1997 AOX1 Transcription Termination TT Native transcription termination and polyadenylation signal from AOX1 gene 260 bp that permits efficient 3 mRNA processing includi
72. growth conditions and handling You should be familiar with basic microbiological and sterile techniques before attempting to grow and manipulate any microorganism You should also be familiar with basic molecular biology and protein chemistry Some general references to consult are Guide to Yeast Genetics and Molecular Biology Guthrie and Fink 1991 Current Protocols in Molecular Biology Ausubel et al 1994 Molecular Cloning A Laboratory Manual Sambrook et al 1989 Protein Methods Bollag and Edelstein 1991 and Guide to Protein Purification Deutscher 1990 X 33 is a wild type Pichia strain that is useful for selection on Zeocin and large scale growth It will grow in YPD and in minimal media The Pichia host strain GS115 has a mutation in the histidinol dehydrogenase gene his4 that prevents it from synthesizing histidine GS115 will grow on complex medium such as YPD also known as YEPD and on minimal media supplemented with histidine The parent strain of KM71H has a mutation in the argininosuccinate lyase gene arg4 that prevents the strain from growing in the absence of arginine The wild type ARG4 gene was used to disrupt AOX1 creating KM71H a Mut Arg strain The ARG4 gene 2 kb was inserted into the cloned wild type AOX1 gene between the BamH I site codons 15 16 of AOX1 and the Sal I site codons 227 228 of AOX1 ARG4 replaces codons 16 through 227 of AOX1 This construct was transformed into
73. h at a lower frequency AOX1 or aox1 ARG4 Pichia Genome HIS4 or his4 Gene of Interest TT Zeocin 5 AOX1 or aox1 ARG4 TT Expression Cassette Continued on next page 62 Recombination and Integration in Pichia continued Multiple Gene Insertion Events Multiple gene insertion events at a single locus in a cell do occur spontaneously with a low but detectable frequency between 1 and 10 of all selected Zeo transformants Because of the low frequency of multiple gene insertion events you will need to screen hundreds to thousands of Zeocin resistant transformants to locate these jack pot clones We recommend that you use electroporation to generate Zeo transformants for screening Multi copy events can occur as gene insertions either at the AOX1 or the aox1 ARG4 loci This results in a Mut phenotype in X 33 or GS115 and a Mut phenotype in KM71H Multiple gene insertion events can be detected by quantitative dot blot analysis Southern blot analysis and differential hybridization See page 73 for a protocol to screen for multiple inserts inf 5 AOX1 or aox1 ARG4 TT 3 Expression Cassette 1 J 2nd Insertion Event Expression E n 5 P aox g Gene Of Interest TT 4 Zeocin 5 AOX1_ or aox1 ARG4 TT 3 Cassette 1 Expression Cassette 2 J 3rd Insertion Event etc 63 Lithium Chloride Transformation Method Introduction Preparation of Solutions Preparing Cells 64 This is
74. hing Associates and Wiley Interscience Barr K A Hopkins S A and Sreekrishna K 1992 Protocol for Efficient Secretion of HSA Developed from Pichia pastoris Pharm Eng 12 48 51 Berdy J 1980 Bleomycin Type Antibiotics In Amino Acid and Peptide Antibiotics J Berdy ed Boca Raton FL CRC Press pp 459 497 Bollag D M and Edelstein S J 1991 Protein Methods New York Wiley Liss Brake A J Merryweather J P Coit D G Heberlein U A Masiarz G R Mullenbach G T Urdea M S Valenzuela P and Barr P J 1984 a Factor Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae Proc Natl Acad Sci USA 81 4642 4646 Brandes H K Hartman F C Lu T Y S and Larimer F W 1996 Efficient Expression of the Gene for Spinach Phosphoribulokinase in Pichia pastoris and Utilization of the Recombinant Enzyme to Explore the Role of Regulatory Cysteinyl Residues by Site directed Mutagenesis J Biol Chem 271 6490 6496 Brankamp R G Sreekrishna K Smith P L Blankenship D T and Cardin A D 1995 Expression of a Synthetic Gene Encoding the Anticoagulant Antimetastatic Protein Ghilanten by the Methylotropic Yeast Pichia pastoris Protein Expression and Purification 6 813 820 Brierley R A Davis G R and Holtz G C 1994 Production of Insulin Like Growth Factor 1 in Methylotrophic Yeast Cells United States Patent 5 324 639
75. in the Methylotrophic Yeast Pichia pastoris Biochemistry 28 4117 4125 Sreekrishna K Potenz R H B Cruze J A McCombie W R Parker K A Nelles L Mazzaferro P K Holden K A Harrison R G Wood P J Phelps D A Hubbard C E and Fuke M 1988 High Level Expression of Heterologous Proteins in Methylotrophic Yeast Pichia pastoris J Basic Microbiol 28 265 278 Strathern J N and Higgins D R 1991 Recovery of Plasmids from Yeast into Escherichia coli Shuttle Vectors In Guide to Yeast Genetics and Molecular Biology C Guthrie and G R Fink eds San Diego CA Academic Press Sun J Coughlin P Salem H H and Bird P 1995 Production and Characterization of Recombinant Human Proteinase Inhibitor 6 Expressed in Pichia pastoris Biochim Biophys ACTA 1252 28 34 Tschopp J F Brust P F Cregg J M Stillman C and Gingeras T R 1987a Expression of the lacZ Gene from Two Methanol Regulated Promoters in Pichia pastoris Nucleic Acids Res 15 3859 3876 Tschopp J F Sverlow G Kosson R Craig W and Grinna L 1987b High Level Secretion of Glycosylated Invertase in the Methylotrophic Yeast Pichia pastoris Bio Technology 5 1305 1308 Varki A and Freeze H H 1994 The Major Glycosylation Pathways of Mammalian Membranes A Summary Subcell Biochem 22 71 100 Continued on next page 85 References continued Vozza L A Wittwer L Higgins
76. included in the kit that will provide examples of Mutt and Mut phenotypes GS115 Albumin is Mut and GS115 pPICZ lacZ is Mut Note that KM71H recombinants do not need to be screened for their Mut phenotype as they all will be Mut Transformation of X 33 or GS115 with linearized constructs favor single crossover recombination at the AOX1 locus Most of the transformants should be Mutt however with the presence of the AOX1 sequences in the plasmid there is a chance that recombination will occur in the 3 AOX1 region also disrupting the wild type AOX1 gene and creating Mut transformants Testing on MDH and MMH plates will allow you to confirm the Mutt phenotype see below All Zeo transformants in KM71H will be Mut because of the disruption of the AOX1 gene a0x1 ARG4 There is no need to test recombinants for the Mut phenotype all recombinants will be Mut Transformants need to be purified on minimal plates to ensure pure clonal isolates before either testing for expression see page 37 or confirming integration by PCR see page 68 Host strains containing the his4 allele e 2 GS115 and transformed with the pPICZ or pPICZa vectors require histidine when grown in minimal media Add histidine to a final concentration of 0 004 to ensure growth of your transformant You may prepare the following media see page 57 and materials several days in advance and store at 4 C Minimal Dextrose with histidine MDH agar pl
77. invitrogen by technologies EasySelect Pichia Expression Kit For Expression of Recombinant Proteins Using pPICZ and pPICZa in Pichia pastoris Cat no K1740 01 Rev Date 18 June 2010 Manual part no 25 0172 MAN0000042 11 Table of Contents Important Information rinine iaeiiio aieneak aior aaeain Daini aaasta aaeoa iaai v Accessory PEOGUICKS dne E i A E AE E OO A E E EE ds Sha RS viii Introduction coins aan 1 COVER VIEW Sisi inn do nn eh idee Ue ocala i San Sis e EET aaah Daa da doa ER ESETA ASA aE ERa 1 Experimental Outline aura ai cata ilibnialii ania ni eiea a aes 4 MethodS seas csi cia 7 Picha Sra iodo dani dle 7 OS RR TN 10 Selecting a Pichia Expression Vector coococoooncnoncnononcnncanannnnnonnnnocanocorananannnnnnaranananonnnnnnnnn na raranannnnnrnrarananano 11 General Cloning Information eocccoocncnonononncnnnrennnnnnenennnanananonnnnnnnnn EE EE EESE E E EERE OEE E R ES 15 Cloning Into PPLE Litto E AE EREE E EEE EEEE AEE E A 18 Cloning Into pPICZO iia librada 21 Transformation into E COLL cocococonenenonincnnnnnncnnnsneneneneranannnnnnnnnnnnn nana rorananannnnnrananananarnn ESAE EEEE eais 24 Preparing Transforming DNA Sirsi ve e natillas 26 Electroporation Of Pichia scssesscexcssseesetsinsecesnsesine cj sehexsog ne abu tidedncvonshseue1ssebexsagnelagatatedesnanshivassaisbstevsantagetabebe 27 Easy Comp Trois AR A oa 29 Determining the Mut Phenotype sssrinin a EEE RE E EEE EEEE RE 33 Expressing Recombinant
78. ion The multiple cloning site has been confirmed by sequencing and functional testing The vector sequence of pPICZ A is available for downloading from our website www invitrogen com or from Technical Support see page 78 5 end of AOX1 MRNA l AACCTTTTTT TTTATCATCA TTATTAGCTT ACTTI 5 AOX1 priming site CAAGCTTTTG ATTTTAACGA CTTTTAACGA CAACT Sfu EcoR Pml Sfi ATTCGAAACG AGGAATTCAC GTGGCCCAGC CGGCCGTCI BsmB Asp718 Kpn Xho myc epitope i TCATAA TTGCGACTGG TTCCAATTGA PTGAGA AGATCAAAAA ACAACTAATT PC GGATCGGTAC CTCGAGCCGC Sac Il Not Apa 1 GGCGGCCGCC AGCTT GGGCCC GAA CAA AAA CTC ATC TCA GAA GAG GAT CTG Glu Glin Lys Leu Ile Ser Polyhistidine tag Glu Glu Asp Leu T 1 AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTTAGCCT TAGACATGAC Asn Ser Ala Val Asp His His His His His His TGTTCCTCAG TTCAAGTTGG GCACTTACGA GAAGACCGGT CTTGCTAGAT TCTAATCAAG 3 AOX1 priming site I 1 AGGATGTCAG AATGCCATTT GCCTGAGAGA TGCAGGCTTC ATTTTTGATA CTTTTTTATT 3 polyadenylati TGTAACCTAT ATAGTATAGG ATTTTTTTTG TCATTTTGTT ion site Continued on next page Cloning into pPICZ continued Multiple Cloning Below is the multiple cloning site of pPICZ B Restriction sites are labeled to Site of pPICZ B indicate the cleavage site The boxed nucleotides indicate the variable r
79. ions using the 2 ml ProBond columns and buffers can be performed at room temperature on the bench top For large scale purifications all reagents must be at 4 C Express your protein using a small scale culture 10 20 ml for Mut strains 100 200 ml for Mutt and the optimal conditions for expression if determined Refer to the Pichia Expression Kit manual for details Once your protein is expressed follow the protocol below to prepare a cell lysate for chromatography TM on ProBond Prepare Breaking Buffer BB as described in the Recipes page 59 1 Wash cells once in BB by resuspending them and centrifuging 5 10 minutes at 3 000 x g at 4 C Resuspend the cells to an ODeo of 50 100 in BB Add an equal volume of acid washed glass beads 0 5 mm Estimate volume by displacement 4 Vortex the mixture for 30 seconds then incubate on ice for 30 seconds Repeat 7 more times Alternating vortexing with cooling keeps the cell extracts cold and reduces denaturation of your protein Centrifuge the sample at 4 C for 5 10 minutes at 12 000 x g Transfer the clear supernatant to a fresh container and analyze for your protein The total protein concentration should be around 2 3 mg ml 7 Save the pellet and extract with 6 M urea or 1 Triton X 100 to check for insoluble protein Continued on next page Purification continued Sample Application Native Conditions Sample Application Denaturing Conditi
80. is advisable to add methanol every day to compensate for loss because of evaporation or consumption e For plates add 100 ul of 100 methanol to the lid of the inverted plate e For liquid medium add 100 methanol to a final concentration of 0 5 Some researchers have had success adding methanol to 1 every day for Mut strains and up to 3 for Mutt without any negative effect to their liquid culture Continued one next page Pichia Strains continued Storing Pichia Strains Note To store cells for weeks to months use YPD medium and YPD agar slants see page 55 e Streak each strain for single colonies on YPD e Transfer one colony to a YPD stab and grow for 2 days at 30 C e The cells can be stored on YPD for several weeks at 4 C To store cells for months to years store frozen at 80 C e Culture a single colony of each strain overnight in YPD e Harvest the cells and suspend in YPD containing 15 glycerol at a final ODeo0 of 50 100 approximately 2 5 x 105 0 x 10 cells ml e Cells are frozen in liquid nitrogen or a dry ice ethanol bath and then stored at 80 C After extended storage at 4 C or 80 C it is recommended that Zeo transformants be checked for correct phenotype and protein expression E coli Strains Genotype of E coli Strain Important En N DY Y Ne 2 10 The E coli strain TOP10F is provided in case no suitable E coli strain is available Other strains
81. is C term Detects the C terminal polyhistidine R930 25 6xHis tag requires the free carboxy Anti His C term HRP group for detection Lindner et al R931 25 1997 HHHHHH COOH Purification of The polyhistidine 6xHis tag allows purification of the recombinant fusion Fusion Protein protein using metal chelating resins such as ProBond Ordering information for ProBond resin is provided below Item Quantity Cat no ProBond Purification System 6 purifications K850 01 ProBond Purification System with 1 kit K852 01 Anti myc HRP Antibody ProBond Purification System with 1 kit K853 01 Anti His C term HRP Antibody ProBond Resin 50 ml R801 01 150 ml R801 15 Purification Columns 50 columns R640 50 10 ml polypropylene columns viii Overview Review Articles General Characteristics of Pichia pastoris Similarity to Saccharomyces Pichia pastoris as a Methylotrophic Yeast Introduction The information presented here is designed to give you a concise overview of the Pichia pastoris expression system It is by no means exhaustive For further information please read the articles cited in the text along with recent review articles Buckholz and Gleeson 1991 Cregg and Higgins 1995 Cregg et al 1993 Nico Farber et al 1995 Sreekrishna et al 1988 Wegner 1990 A general review of foreign gene expression in yeast is also available Romanos et a
82. ity inactivate Zeocin therefore it is necessary to reduce the salt in bacterial medium to 90 mM 5 g liter or less and adjust the pH to 7 5 to make sure the drug remains active Continued on next page Zeocin continued Resistance to Zeocin A Zeocin resistance protein has been isolated and characterized Calmels et al 1991 Drocourt et al 1990 Gatignol et al 1988 This protein the product of the Sh ble gene Streptoalloteichus hindustanus bleomycin gene is a 13 665 Da protein that binds Zeocin in a stoichiometric manner The binding of Zeocin inhibits its DNA strand cleavage activity Expression of this protein in eukaryotic and prokaryotic hosts confers resistance to Zeocin The nucleic acid and protein sequence is given below Nco ACC ATG GCC AAG TTG ACC AGT GCC GTT CCG GTG CTC M A K L T S A V P V L ACC GCG CGC GAC GTC GCC GGA GCG GTC GAG TTC TGG T A R D V A G A V El ty Sma ACC GAC CGG CTC GGG TTC TCC CGG GAC TTC GTG GAG T D R G F S R D F V zal SgrA GAC GAC TTC GCC GGT GTG GTC CGG GAC GAC GTG ACC D D F A G V V R D D V T CTG TTC ATC AGC GCG GTC CAG GAC CAG GTG GTG CCG L E I S A V Q D Q V V P GAC AAC ACC CTG GCC TGG GTG TGG GTG CGC GGC CTG GAC GAG CTG TAC GCC GAG TGG TCG GAG GTC GTG TCC oO eal lt D E uN E lt lt un ACG AAC TTC CGG GAC GCC TCC GGG CCG GCC ATG ACC GAG ATC GGC GAG CAG CCG TGG GGG CGG GAG TTC GCC
83. l 1 M sorbitol Replica plating equipment optional TM Bead Beater optional Biospec TM ProBond Purification System optional vil Accessory Products Introduction The products listed in this section are intended for use with the EasySelect Pichia Expression Kit For more information refer to our website www invitrogen com or call Technical Support see page 78 Accessory Many of the reagents supplied in the EasySelect Pichia Expression Kit are Products available separately from Invitrogen Ordering information is provided below Product Reactions or Amount Cat no Pichia EasyComp Kit 20 transformations K1730 01 Zeocin lg R250 01 58 R250 05 pPICZ A B and C 20 ug of each vector in TE buffer V190 20 pH 8 0 40 pl at 500 ng pl pPICZa A B and C 20 ug of each vector in TE buffer V195 20 pH 8 0 40 pl at 500 ng pl Antibodies for A number of antibodies are available from Invitrogen to detect expression of Detection of your fusion protein from the pPICZ and pPICZa vectors Horseradish Fusion Protein peroxidase HRP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods The amount of antibody supplied is sufficient for 25 Westerns Antibody Epitope Cat no Anti myc Detects the 10 amino acid epitope R950 25 derived f E t al 1985 Anti myc HRP SOKLIEEEDL AEN ane R951 25 Anti H
84. l 1992 As a eukaryote Pichia pastoris has many of the advantages of higher eukaryotic expression systems such as protein processing protein folding and posttranslational modification while being as easy to manipulate as E coli or Saccharomyces cerevisiae It is faster easier and less expensive to use than other eukaryotic expression systems and generally gives higher expression levels As a yeast it shares the advantages of molecular and genetic manipulations with Saccharomyces and it has the added advantage of 10 to 100 fold higher heterologous protein expression levels These features make Pichia very useful as a protein expression system Many of the techniques developed for Saccharomyces may be applied to Pichia These include e transformation by complementation e gene disruption e gene replacement In addition the genetic nomenclature used for Saccharomyces has been applied to Pichia For example histidinol dehydrogenase is encoded by the HIS4 gene in both Saccharomyces and Pichia There is also cross complementation between gene products in both Saccharomyces and Pichia Several wild type genes from Saccharomyces complement comparable mutant genes in Pichia Genes such as HIS4 LEU2 ARG4 TRP1 and URA3 all complement their respective mutant genes in Pichia Pichia pastoris is a methylotrophic yeast capable of metabolizing methanol as its sole carbon source The first step in the metabolism of methanol is the
85. move the nitrocellulose filter from the paper and replace the paper with two new sheets Soak with 10 15 ml of 0 1 N NaOH 1 5 M NaCl Place the nitrocellulose filter face down on the paper and incubate for 5 minutes at room temperature 6 Remove the nitrocellulose filter and replace with two new 3MM sheets Soak with 10 15 ml of 2X SSC Place the nitrocellulose filter face down on the 3MM paper and incubate for 5 minutes at room temperature Repeat 7 Bake nitrocellulose filters at 80 C or UV crosslink DNA to nylon You may probe the filters with a nonradioactive labeled or random primed P labeled probe complementary to your gene You can identify multi copy integrants by a strong hybridization signal relative to the single copy control You can then quantify dot blots for copy number by densitometry of the film or blot or by using a B scanner if radiolabeled For a detailed description of this technique as applied to Pichia pastoris see Clare et al 1991a It is very important to digest your DNA with the right restriction enzyme s to generate a blot of digested and gel separated genomic DNA We recommend that you use a restriction enzyme that cuts outside of the expression cassette This will generate a restriction fragment whose size reflects the number of multimers For example if you have cloned a 1 2 kb fragment into pPICZ and transformed into Pichia you can digest the DNA from this recombinant with Nhe I which does not cut
86. mpt fermentation Contact Technical Support see page 78 for more information 49 Purification Introduction ProBond Resin Binding Capacity of ProBond Important Preparing Cell Lysates 50 In this section you will grow and induce a 10 200 ml culture of your Pichia transformant for trial purification on a metal chelating resin such as ProBond You may harvest the cells and store them at 80 C until you are ready to purify your fusion protein or you may proceed directly with protein purification Note that this section only describes preparation of cell lysates and sample application onto ProBond For instructions on how to prepare and use ProBond resin refer to the ProBond Purification System manual TM We recommend that you use the ProBond Purification System Cat no K850 01 for purifying fusion proteins expressed from pPICZ or pPICZa Note that instructions for equilibration of and chromatography on ProBond resin are contained in the ProBond Purification System If you are using a metal chelating resin other than ProBond follow the manufacturer s recommendations for fusion proteins expressed in bacteria or yeast TM One milliliter of ProBond resin binds at least 1 mg of recombinant protein This amount can vary depending on the nature of the protein Throughout the following protocol be sure to keep the cell lysate and fractions on ice Small scale purificat
87. necessary You may store the cell lysates at 80 C for further analysis Continued on next page Analysis by SDS Polyacrylamide Gel Electrophoresis continued Preparing Preparing supernatant Secreted Expression only Samples 1 Thaw supernatants and place on ice continued 2 Mix 50 ul of the supernatant with 50 pl of SDS PAGE Gel Loading buffer 3 Boil 10 minutes then load 10 30 ul onto the gel You may store the remaining sample at 20 C for Western blots if necessary You may store the supernatants at 80 C for further analysis 4 If you do not see any protein by Coomassie or by Western blot then concentrate the supernatant 5 10 fold and analyze samples again by Western blot Centricon and Centriprep filters Amicon are very useful for this purpose Concentrating You may perform Lowry BCA Pierce or Bradford protein assays to quantify Protein the amounts of protein in the cell lysates and medium supernatants In general Pichia cell lysates contain 5 10 yg pl protein Pichia medium supernatants will vary in protein concentration primarily due to the amount of your secreted protein Pichia secretes very few native proteins If the protein concentration of the medium is gt 50 pg ml 10 ul of medium will give a faint band ona Coomassie stained SDS PAGE gel Controls Include the following samples as controls on your SDS PAGE e Molecular weight standards appropriate for your desired protein e A sample of yo
88. ng polyadenylation for increased mRNA stability TEF1 promoter Transcription elongation factor 1 gene promoter from Saccharomyces cerevisiae that drives expression of the Sh ble gene in Pichia conferring Zeocin resistance GenBank Acc no D12478 D01130 EM7 synthetic prokaryotic promoter Constitutive promoter that drives expression of the Sh ble gene in E coli conferring Zeocin resistance Sh ble gene Streptoalloteichus hindustanus ble gene Zeocin resistance gene for selection in F coli CYC1 transcription termination region 3 end of the Saccharomyces cerevisiae CYC1 gene that allows efficient 3 mRNA processing of the Sh ble gene for increased stability GenBank Acc no M34014 pUC origin Allows replication and maintenance of the plasmid in E coli Sac I Pme I BstX I Unique restriction sites that permit linearization of the vectors at the AOX1 locus for efficient integration into the Pichia genome Continued on next page 11 Selecting a Pichia Expression Vector continued Map of pPICZ A B The figure below summarizes the features of the pPICZ A B and C vectors The and C vector sequences for pPICZ A B and C are available for downloading from our website www invitrogen com or from Technical Support see page 78 Details of the multiple cloning sites are shown on page 18 for pPICZ A page 19 for pPICZ B and page 20 for pPICZ C BsmB Asp718
89. nk HiPure Plasmid DNA Purification Kit Cat no K2100 01 for isolation of pure plasmid DNA Once you have purified plasmid DNA proceed to Preparing Transforming DNA next page 25 Preparing Transforming DNA Introduction Method of Transformation Important Restriction Digest 26 At this point you should have your gene cloned into one of the pPICZ or pPICZa vectors Your construct should contain a yeast consensus sequence A YAA TAATGTCT and be correctly fused to the secretion signal pPICZa and or the C terminal peptide To transform Pichia prepare 5 10 ug of plasmid DNA and linearize the plasmid prior to transformation and selection in Pichia Plate the transformants on YPDS plates containing 100 ug ml Zeocin to isolate Zeocin resistant Zeo clones Remember also to isolate two control strains for background protein expression in Pichia Linearize pPICZ or pPICZa and transform into GS115 to generate a Mut control and KM71H to generate a Mut control We recommend electroporation or chemical methods for transformation of Pichia with pPICZ or pPICZa Electroporation yields 10 to 10 transformants per ug of linearized DNA and does not destroy the cell wall of Pichia If you do not have access to an electroporation device use the Pichia EasyComp procedure on page 29 We do not recommend spheroplasting for transformation of Pichia with plasmids containing the Zeocin resistance marker Sphe
90. nts for integration of your gene Experimental Outline page 4 Continued on next page Overview continued Intracellular and Secretory Protein Expression Posttranslational Modifications Heterologous expression in Pichia pastoris can be either intracellular or secreted Secretion requires the presence of a signal sequence on the expressed protein to target it to the secretory pathway While several different secretion signal sequences have been used successfully including the native secretion signal present on some heterologous proteins success has been variable The secretion signal sequence from the Saccharomyces cerevisiae factor prepro peptide has been used with the most success Cregg et al 1993 Scorer et al 1993 The major advantage of expressing heterologous proteins as secreted proteins is that Pichia pastoris secretes very low levels of native proteins Since there is very low amount of protein in the minimal Pichia growth medium the secreted heterologous protein comprises the vast majority of the total protein in the medium and serves as the first step in purification of the protein Barr et al 1992 Note however that if there are recognized glycosylation sites Asn X Ser Thr in your protein s primary sequence glycosylation may occur at these sites In comparison to Saccharomyces cerevisiae Pichia may have an advantage in the glycosylation of secreted proteins because it may not hyperglycosylate Both
91. ody to your particular Can detect as little as 1 10 pg Analysis protein depending on detection Anti myc antibodies or method alkaline phosphatase Anti His C term antibodies horseradish peroxidase see page viii for ordering radiolabeled antibody information Functional Varies depending on assay Varies depending on assay assay Used to compare relative amounts of protein Host strains containing the his4 allele e 2 GS115 and transformed with the pPICZ or pPICZa vectors require histidine when grown in minimal media Add histidine to a final concentration of 0 004 to ensure growth of your transformant Complex medium such as YPD and BMGY already contain histidine Continued on next page 37 Expressing Recombinant Pichia Strains continued Media Proteases Aeration Kinetics of Growth Temperature and Shaking 38 For expressing recombinant Pichia strains you need BMGY BMMY buffered complex glycerol or methanol medium BMGH BMMH buffered minimal glycerol or methanol medium containing histidine or MGYH MMH minimal glycerol or minimal methanol medium containing histidine see Recipes pages 57 58 BMGH BMMH BMGY and BMMY are usually used for expressing secreted proteins particularly if pH is important for the activity of your protein Unlike MGYH and MMH they are all buffered media Because these media are buffered with phosphate buffer you may use a wider range of p
92. ography on ProBond resin are contained in the ProBond Purification System Kit manual Preliminary preparation steps are described on pages 50 51 If you are using a metal chelating resin other than ProBond please follow the manufacturer s recommendations for fusion proteins expressed in yeast Continued on next page Experimental Outline continued Experimental The overall experimental process is presented below In addition there is a Process discussion about recombination and integration in Pichia which will help you choose the right vector see page 62 More information is provided in a review by Higgins Higgins 1995 Clone gene of interest into one of the six pPICZ Pichia expression vectors Linearize construct with Sac I Pme I or BstX I Transform appropriate Pichia pastoris strain X33 or GS115 for Mut and KM71 for Mut using electroporation or the EasyComp method Plate transformants on medium containing Zeocin All transformants integrate at 5 AOX1 locus by single crossover Mut phenotype is deter mined by the strain used Select 6 10 colonies of each Mut phenotype for small scale expression Choose highest expressers for large scale expression in shake flask or fermentor Pichia Strains Introduction Genotypes of Pichia Strains Construction of KM71H Important Methods Pichia pastoris is quite similar to Saccharomyces cerevisiae as far as general
93. on reactions for 1 hour at 30 C in a water bath or incubator Mix the transformation reaction every 15 minutes by vortexing or flicking the tube Failure to mix the transformation reaction every 15 minutes will result in decreased transformation efficiency Heat shock the cells in a 42 C heat block or water bath for 10 minutes Split the cells into 2 microcentrifuge tubes approximately 525 pl per tube and add 1 ml of YPD medium to each tube Incubate the cells at 30 C for 1 hour to allow expression of Zeocin resistance Pellet the cells by centrifugation at 3 000 x g for 5 minutes at room temperature Discard the supernatant Resuspend each tube of cells in 500 pl of Solution III and combine the cells into one tube Pellet the cells by centrifugation at 3 000 x g for 5 minutes at room temperature Discard the supernatant Resuspend the cell pellet in 100 to 150 pl of Solution III Plate the entire transformation on appropriate selection plates using a sterile spreader Incubate the plates for 3 to 10 days at 30 C Each transformation should yield approximately 50 colonies Continued on next page 31 EasyComp Transformation continued Analyzing Pichia Select 6 10 of your Zeocin resistant Pichia transformants and confirm the Mut Transformants phenotype as described on page 33 You may also wish to analyze for the presence of insert using PCR page 68 Note When selecting Zeocin resistant Pichia transformant
94. ons Note Analysis of Purification Scale up TM For sample application onto ProBond you will need Native Binding Buffer pH 7 8 and a 2 ml ProBond column pre equilibrated using native conditions 1 Combine 1 ml 2 3 mg ml total protein of Pichia lysate with 7 ml Native Binding Buffer TM 2 Take a pre equilibrated ProBond column and resuspend the resin in 4 ml of the diluted lysate from Step 1 3 Seal the column and batch bind by rocking gently at room temperature for 10 minutes 4 Let the resin settle by gravity or low speed centrifugation 800 x g and carefully remove the supernatant Save the supernatant to check for unbound protein 5 Repeat Steps 2 through 4 with the remaining 4 ml of diluted lysate Proceed to Column Washing and Elution Under Native Conditions in the ProBond Purification manual Use the recommendations noted for bacterial cell lysates TM Use the protocol above except pre equilibrate the ProBond column using Denaturing Binding Buffer and combine 1 ml of the Pichia cell lysate with 7 ml of the Denaturing Binding Buffer TM We have observed some Pichia proteins may be retained on the ProBond column using native purification conditions Optimization of the purification or using denaturing purification may remove these non specific Pichia proteins see TM ProBond Purification System manual Be sure to save all fractions washes and flow through for anal
95. ontrol Protein Cat no R900 50 is available for use as a positive control for detection of fusion proteins containing a c myc epitope or a polyhistidine tag The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our website www invitrogen com or call Technical Support see page 78 Inspection of your Coomassie stained SDS PAGE should reveal the induction over time of your protein co migrating with your standard If you are satisfied with the level of expression try a test purification page 50 or scale up expression page 47 If there is no recombinant protein visible then perform either a Western blot or a functional assay if available If you detect low expression of your recombinant protein see Optimizing Pichia Protein Expression page 45 for guidelines to optimize expression Test your expression conditions with the one of the two control strains included in the kit GS115 pPICZ lacZ or GS115 Albumin If there is no indication of expression at all use PCR to analyze your recombinants for the correctly sized PCR product page 69 If you find that you have recombinants perform a Northern analysis to see if and how much full length mRNA is induced See page 75 for an RNA isolation protocol Optimizing Pichia Protein Expression Introduc
96. oxidation of methanol to formaldehyde using molecular oxygen by the enzyme alcohol oxidase In addition to formaldehyde this reaction generates hydrogen peroxide To avoid hydrogen peroxide toxicity methanol metabolism takes place within a specialized cell organelle called the peroxisome which sequesters toxic by products away from the rest of the cell Alcohol oxidase has a poor affinity for O and Pichia pastoris compensates by generating large amounts of the enzyme The promoter regulating the production of alcohol oxidase is the one used to drive heterologous protein expression in Pichia Continued on next page Overview continued Two Alcohol Oxidase Proteins Expression Phenotype of aox1 Mutants Two genes in Pichia pastoris code for alcohol oxidase AOX1 and AOX2 The majority of alcohol oxidase activity in the cell is attributable to the product of the AOX1 gene Expression of the AOX1 gene is tightly regulated and induced by methanol to very high levels typically gt 30 of the total soluble protein in cells grown with methanol The AOX1 gene has been isolated and a plasmid borne version of the AOX1 promoter is used to drive expression of the gene of interest encoding the desired heterologous protein Ellis et al 1985 Koutz et al 1989 Tschopp et al 1987a While AOX2 is about 97 homologous to AOX1 growth on methanol is much slower than with AOX1 This slow growth on methanol allows isolation of Mut strains
97. pression Vectors in the manufacture of a Commercial Product any sale of Expression Products any use of Expression Products or the Expression Kit to facilitate or advance research or development directed to a Commercial Product and any use of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be directly applied to the development or manufacture of a Commercial Product Expression Products means products expressed with the Expression Kit or with the use of any Pichia expression vectors including the Expression Vector or host strains Commercial Product means any product intended for sale or commercial use Continued on next page Purchaser Notification continued Limited Use Label License No 74 Pichia Pastoris Expression System continued Commercial entities may conduct their evaluation for one year at which time this license automatically terminates Commercial entities will be contacted by Research Corporation Technologies during the evaluation period regarding their desire for a commercial license Access to the Expression Kit and Vector must be limited solely to those officers employees and students of your institution who need access to perform the above described research or evaluation You must inform each such officer employee and student of the provisions of this license agreement and require them to agree in writing to be bound by
98. protein BMGH or Buffered minimal medium Secreted Expression Used to BMG containing glycerol and or control the pH of the medium histidine and generate biomass BMMH or Buffered minimal medium Secreted Expression Used to BMM containing methanol and or control the pH of the medium histidine and induce expression of the desired protein BMGY Buffered complex medium Secreted Expression Used to containing glycerol control the pH of the medium decrease protease activity and generate biomass BMMY Buffered complex medium Secreted Expression Used to containing methanol control the pH of the medium decrease protease activity and induce expression Yeast Extract Peptone Dextrose Medium 1 liter 1 yeast extract 2 peptone 2 dextrose glucose Note If you are using the YP Base Medium or the YP Base Agar medium pouches included with the Original Pichia Expression Kit follow the directions on the pouch 1 Dissolve 10 g yeast extract and 20 g of peptone in 900 ml of water Note Add 20 g of agar if making YPD slants or plates 2 Autoclave for 20 minutes on liquid cycle 3 Add 100 ml of 10X D The liquid medium is stored at room temperature Store YPD slants or plates are at 4 C The shelf life is several months Continued on next page 55 Pichia Media Recipes continued YPD Zeocin YPDS Zeocin Agar 56 Yeast Extract Peptone Dextrose Medium 1 liter 1 yeast extract 2 pe
99. ptone 2 dextrose glucose 2 agar 100 pg ml Zeocin 1 Dissolve the following in 900 ml of water 10 g yeast extract 20 g of peptone Include 20 g of agar if making YPD slants or plates Autoclave for 20 minutes on liquid cycle Cool solution to 60 C and add 100 ml of 10X D Add 1 0 ml of 100 mg ml Zeocin if desired You can store liquid medium without Zeocin at room temperature Store medium containing Zeocin at 4 C in the dark Store YPD slants or plates at 4 C The shelf life of medium is several months Medium containing Zeocin has a shelf life of one to two weeks Yeast Extract Peptone Dextrose Medium 1 liter 1 yeast extract 2 peptone 2 dextrose glucose 1 M sorbitol 2 agar 100 ug ml Zeocin 1 Dissolve the following in 900 ml of water 10 g yeast extract 182 2 g sorbitol 20 g of peptone 2 Add 20 g of agar 3 Autoclave for 20 minutes on liquid cycle 4 Add 100 ml of 10X D Di Cool solution to 60 C and add 1 0 ml of 100 mg ml Zeocin TM Store YPDS slants or plates containing Zeocin at 4 C in the dark The shelf life is one to two weeks Continued on next page Pichia Media Recipes continued MGY and MGYH MD and MDH MM and MMH Minimal Glycerol Medium Histidine 1 liter 1 34 YNB 1 glycerol 4 x 107 biotin 0 004 histidine 1 Combine aseptically 800 ml autoclaved water with 100 ml of 10X YNB 2 ml of 500X B and 100 ml of 10X GY 2 For grow
100. res to be more than 10 30 of your total flask volume It is strongly recommended that baffled flasks be used See Recipes page 59 for suppliers of baffled flasks Cover the flasks with cheesecloth 2 3 layers or another loose fitting cover Never use tight fitting covers Aeration is not as critical when generating biomass before induction Note that while Mut and Mut strains will grow at essentially the same rate in YPD or glycerol media Mutt will grow faster than Mut when both are grown on methanol because of the presence of the AOX1 gene product All expression is done at 30 C in a shaking incubator It is critical that the temperature does not exceed 30 C If your incubator temperature fluctuates set the temperature at 28 C If using a floor shaking incubator shake at 225 250 rpm If using a table top shaker that sits inside an incubator shake at 250 300 rpm Continued on next page Expressing Recombinant Pichia Strains continued Before Starting Guidelines for Expression When performing your expression it is important to run the proper controls so that you will be able to interpret your expression results Use the following expression controls GS115 Mut albumin Mut Secretion control GS115 pPICZ lacZ Mutt Mutt Intracellular control GS115 or KM71H Vector no insert background control Since recombination can occur in many different ways that can effect expression clonal variation we recommend
101. resis page 42 Continued on next page Expressing Recombinant Pichia Strains continued Muts Intracellular or Secreted You can test the effectiveness of your expression conditions by growing GS115 which is Mut and secretes albumin to the medium Remember to include X 33 GS115 or KM71H transformed with the parent vector as a control for background intracellular expression 1 Using a single colony inoculate 100 ml of MGYH BMGH or BMGY ina 1 liter baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODeo 2 6 approximately 16 18 hours Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pellet in MMH BMMH or BMMY medium using 1 5 to 1 10 of the original culture volume approximately 10 20 ml Place in a 100 ml baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator to continue to grow Add 100 methanol to a final concentration of 0 5 every 24 hours to maintain induction At each of the times indicated below transfer 1 ml of the expression culture to a 1 5 ml microcentrifuge tube These samples will be used to analyze expression levels and determine the optimal time post induction to harvest Centrifuge at maximum speed in a tabletop microcentrifuge for 2 3 minutes at room temperature Time points hours 0 24 1 day 48
102. rmants 24 Ligation mixtures may be transformed into E coli and selected on Low Salt LB medium see below with Zeocin Transformants are isolated and analyzed for the presence and orientation of insert There is no blue white screening for the presence of insert with pPICZ or pPICZa After obtaining the desired recombinant plasmid you will be ready to transform into Pichia For Zeocin to be active the salt concentration of the medium must remain low lt 90 mM and the pH must be 7 5 Prepare Low Salt LB broth and plates using the recipe in the Appendix page 53 Failure to lower the salt content of your LB medium will result in non selection due to inactivation of the drug Guidelines are as follows e Transformation may be performed by either electroporation or chemical methods Use your preferred method or refer to general molecular biology references Ausubel et al 1994 Sambrook et al 1989 e Add either Low Salt LB or LB medium to the cells after heat shock or electroporation to allow them to recover e Plate on Low Salt LB medium with 25 pg ml Zeocin Note You may also use SOB 2XYT or TB medium but you may have to increase the concentration of Zeocin to 50 ug ml to compensate for differences in the salt concentration e Incubate overnight at 37 C 1 After transformation plate 10 ul and 100 ul of the transformation mix onto Low Salt LB plates with 25 ug ml Zeocin see above and sele
103. roplasting involves removal of the cell wall to allow DNA to enter the cell Cells must first regenerate the cell wall before they are able to express the Zeocin resistance gene For this reason plating spheroplasts directly onto selective medium TM containing Zeocin does not yield any transformants Integration can only occur at the AOX1 locus Vector linearized within the 5 AOX1 region will integrate by gene insertion into the host 5 A0X1 region Therefore the Pichia host that you use will determine whether the recombinant strain is able to metabolize methanol Mutt or not Mut To generate a Mut recombinant strain you must use a Pichia host that contains the native AOX1 gene i e X 33 GS115 SMD1168 If you choose to generate a Mut recombinant strain then use a Pichia host that has a disrupted AOX1 gene 1 e KM71H Information on recombination in Pichia is available on page 62 1 Digest 5 10 ug of plasmid DNA with one of the restriction enzymes listed below Each enzyme cuts one time in the 5 AOX1 region to linearize the either pPICZ or pPICZa Note Choose the enzyme that does not cut within your gene Sac I 209 bp Pme I 414 bp and BstX I 707 bp 2 We recommend that you check a small aliquot of your digest by agarose gel electrophoresis for complete linearization 3 If the vector is completely linearized heat inactivate or add EDTA to stop the reaction phenol chloroform extract once and
104. roteins in Pichia Important You should now have several Mut and Mut recombinant strains which have been confirmed by PCR to contain your insert see page 68 and page 70 The purpose of this section is to determine the optimal method and conditions for expression of your gene Below are some factors and guidelines which need to be considered before starting expression in Pichia pastoris As with any expression system optimal expression conditions are dependent on the characteristics of the protein being expressed Small scale expression conditions may not be optimal for your protein For this reason the method you choose for detection i e SDS PAGE Western or functional assay may be an important factor in determining the success of expression If your method of detection does not reveal any expression you may want to consider using a more sensitive method We recommend that you use the following techniques to analyze the expression of your protein Note that the myc epitope and the polyhistidine tag will contribute 2 5 kDa to the size of your protein Be sure to account for any additional amino acids that are in between the end of your native protein and the myc epitope Technique Method of Detection Sensitivity SDS PAGE Visualization by eye Can detect as little as 100 ng Coomassie in a single band stained SDS PAGE Visualization by eye Can detect as little as 2 ng ina Silver stained single band Western Antib
105. s Step Temperature Time Cycle Denaturation 95 C 1 minute Annealing 54 C 1 minute 30X Extension 72 C 1 minute Final Extension 72 C 7 minutes 1X Analyze a 10 pl aliquot by agarose gel electrophoresis 70 Isolating Total DNA from Pichia Introduction Solutions Preparation Spheroplasting and Lysis The protocol below allows you to isolate DNA from the desired recombinant and the untransformed GS115 or KM71H The purified DNA is suitable for Southern blot analysis dot slot blot analysis or genomic PCR See Current Protocols in Molecular Biology pages 13 11 1 to 13 11 4 Ausubel et al 1994 Guide to Yeast Genetics and Molecular Biology pages 322 323 Strathern and Higgins 1991 or Holm et al 1986 You will need to make the following solutions There is not enough of some of these reagents in the kit to perform this experiment Minimal Medium MD MGYH Sterile water SCED 1 M sorbitol 10 mM sodium citrate pH 7 5 10 mM EDTA 10 mM DTT Zymolyase 3 mg ml stock solution in water Seikagaku America Inc 1 800 237 4512 1 SDS in water 5 M potassium acetate pH 8 9 TE buffer pH 7 4 10 mM Tris HCl pH 7 4 1 mM EDTA pH 8 0 7 5 M ammonium acetate pH 7 5 Phenol chloroform 1 1 v v 1 Grow at 30 C the recombinant strain and the parent strain to an ODo00 of 5 10 in 10 ml of minimal media such as MD or MDH Note his4 strains require histidine for growth 2
106. s A F Harpold M M and Gingeras T R 1985 Isolation of Alcohol Oxidase and Two other Methanol Regulatable Genes from the Yeast Pichia pastoris Mol Cell Biol 5 1111 1121 Evan G L Lewis G K Ramsay G and Bishop V M 1985 Isolation of Monoclonal Antibodies Specific for c myc Proto oncogene Product Mol Cell Biol 5 3610 3616 Fryxell K B O Donoghue K Graeff R M Lee H C and Branton W D 1995 Functional Expression of Soluble Forms of Human CD38 in Escherichia coli and Pichia pastoris Protein Expression and Purification 6 329 336 Garcia J N Aguiar J A Gill M Alvarez A Morales J Ferrero J Gonzalez B Padron G and Menendez A 1995 High Level Expression of Human IFN a2b in Pichia pastoris Biotecnologia Aplicada 12 152 155 Gatignol A Durand H and Tiraby G 1988 Bleomycin Resistance Conferred by a Drug binding Protein FEB Letters 230 171 175 Gietz R D and Schiestl R H 1996 Transformation of Lithium Treated Yeast Cells and the Selection of Auxotrophic and Dominant Markers In Methods in Molecular Biology I H Evans ed Humana Press Totowa NJ Continued on next page 83 References continued Grinna L S and Tschopp J F 1989 Size Distribution and General Structural Features of N Linked Oligosaccharides from the Methylotrophic Yeast Pichia pastoris Yeast 5 107 115 Guo W Gonzalez Candelas L and Kolattukudy P E
107. s it is normal to observe a low amount of background 10 30 Troubleshooting The table below provides solutions to possible problems you may encounter when preparing and transforming competent Pichia pastoris cells Problem Probable Cause Possible Solution Low efficiency of The pH of Solution I Check the pH of Solutions I and II If transformation or Solution lll may the pH is low increase it by adding have drifted The pH NaOH If the pH is high decrease it of both solutions by adding HCl Store solutions at 4 C should be 8 0 in order to minimize drift in pH Transformation Be sure to mix the transformation reaction not mixed reaction every 15 minutes during incubation throughout the 1 hour incubation at 30 C Vortexing works best Incubation time is Pichia pastoris transformations may too short or be incubated for longer periods of temperature is too time up to 3 hours and at higher low temperature 35 37 C This may in some instances result in higher transformation efficiencies Cell density is too Resuspend cells from Preparing low OD600 lt 0 6 Competent Cells Step 6 page 29 in a smaller volume i e 500 ul 32 Determining the Mut Phenotype Introduction Screening for Mut in X 33 and GS115 Mut in KM71H Important Preparation If you used X 33 or GS115 as the host the transformants should be Mutt To confirm the expected phenotype two strains are
108. secrete If it did not secrete try a different signal sequence e g a native or a factor signal sequence e Concentrate your supernatant by ammonium sulfate precipitation or ultrafiltration see page 49 e For Mutt induce expression with a higher density culture e Look for multi copy recombinants i e jackpot clones by dot blot see page 73 There are quite a few examples of increasing the expression levels of a particular protein by increasing the gene dosage See Clare et al 1991a Clare et al 1991b Romanos et al 1991 e Check both Mut and Mut recombinants for increased expression Some proteins express better in one type of genetic background than another e If secreting your protein try intracellular expression The protein may not be processed correctly and fail to secrete Be sure you check your cell pellets for evidence of expression If you are having problems with intracellular expression try secreting your protein It probably will glycosylate which may be desirable or not If glycosylation is undesirable oligosaccharides can be removed with Peptide N Glycosidase F New England BioLabs e Scale up to fermentation page 49 Pichia is a yeast and is particularly well suited to growth in a fermentor Continued on next page 45 Optimization of Pichia Protein Expression continued No Expression Hyper glycosylation 46 Be sure to try some of the easier things listed above as no expres
109. sforming with circular DNA you will need 50 100 ug plasmid DNA If you have constructed multimers in pPICZ or pPICZa you will not be able to linearize the plasmid e YPD Medium e 50 ml conical polypropylene tubes e 1 liter cold 4 C sterile water place on ice the day of the experiment e 25 ml cold 4 C sterile 1 M sorbitol place on ice the day of the experiment e 30 C incubator e Electroporation device and 0 2 cm cuvettes TM e YPDS plates containing 100 pg ml Zeocin See page 56 for recipe aes Grow 5 ml of your Pichia pastoris strain in YPD in a 50 ml conical at 30 C overnight 2 Inoculate 500 ml of fresh medium in a 2 liter flask with 0 1 0 5 ml of the overnight culture Grow overnight again to an ODeo 1 3 1 5 3 Centrifuge the cells at 1 500 x g for 5 minutes at 4 C Resuspend the pellet with 500 ml of ice cold sterile water 4 Centrifuge the cells as in Step 3 then resuspend the pellet with 250 ml of ice cold sterile water 5 Centrifuge the cells as in Step 3 then resuspend the pellet in 20 ml of ice cold 1 M sorbitol 6 Centrifuge the cells as in Step 3 then resuspend the pellet in 1 ml of ice cold 1 M sorbitol for a final volume of approximately 1 5 ml Keep the cells on ice and use that day Do not store cells Continued on next page 27 Electroporation of Pichia continued Transformation by Electroporation Isolating Multi copy Recombinants in vivo Note Analyzing
110. sion can be the same thing as very low expression If none of these things improve protein expression use PCR to check for insertion of your gene into the Pichia genome page 68 If your gene is present perform a Northern blot analysis to check for transcription of your gene There is a protocol in the Appendix for RNA isolation from Pichia see page 75 If you see premature transcriptional termination check the AT content of your gene In Saccharomyces there are a few consensus sequences which promote premature termination One of these TTTTTATA resembles a sequence in HIV 1 gp120 ATTATTTTAT AAA which prematurely terminatates mRNA when expressed in Pichia When this sequence was changed longer transcripts were found Scorer et al 1993 If your protein is hyperglycosylated e Try intracellular expression as your protein will not go through the secretion pathway and therefore not be modified e Try deglycosylating the protein with Peptide N Glycosidase F or other enzymes see page 52 Scale up of Expression Guidelines for Expression Mutt Intracellular or Secreted Once expression is optimized you will want to scale up your expression protocol to produce more protein This may be done by increasing the culture volume using larger baffled flasks below or fermentation Use the guidelines below to scale up your expression protocol To purify your protein see page 50 D Using a single colony inoculate 25
111. strong antibacterial and anti tumor drugs They show strong toxicity against bacteria fungi including yeast plants and mammalian cells Zeocin is not as toxic as bleomycin on fungi Zeocin is a basic water soluble compound isolated from Streptomyces verticillus as a copper chelated glycopeptide The presence of copper gives the solution its blue color The chemical formula for Zeocin is CssHs3N19021S2Cu It contains several unique amino acids sugars and aliphatic amines For general information about the family of bleomycin antibiotics See Berdy 1980 The TM general structure of Zeocin is shown below H CONH2 MW 1 535 The exact mechanism of action of Zeocin is not known however it is thought to be the same as bleomycin and phleomycin due to its similarity to these drugs and its inhibition by the Sh ble resistance protein see next section The copper glycopeptide complex is selective and involves chelation of copper Cu by the amino group of the a carboxamide single nitrogen atoms of both the pyrimidine chromophore and the imidazole moiety and the carbamoyl group of mannose The copper chelated form is inactive When the antibiotic enters the cell the copper cation is reduced from Cu to Cu and removed by sulfhydryl compounds in the cell Upon removal of the copper Zeocin is activated to bind DNA and cleave it causing cell death Berdy 1980 High salt concentrations and acidity or basic
112. th of his4 strains in this medium a version can be made that contains histidine called MGYH by adding 10 ml of 100X H stock solution Store at 4 C The shelf life of this solution is approximately two months Minimal Dextrose Medium Histidine 1 liter 1 34 YNB 4 x 107 biotin 2 dextrose 1 For medium autoclave 800 ml of water for 20 minutes on liquid cycle 2 Cool to about 60 C and then add 100 ml of 10X YNB 2 ml of 500X B 100 ml of 10X D To make MDH add 10 ml of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed If preparing plates pour the plates immediately MD stores well for several months at 4 C Minimal Methanol Histidine 1 liter 1 34 YNB 4 x 10 biotin 0 5 methanol 1 For medium autoclave 800 ml of water for 20 minutes on liquid cycle 2 Cool autoclaved water to 60 C and add 100 ml of 10X YNB 2 ml of 500X B 100 ml of 10X M 3 To make MMH add 10 ml of 100X H stock solution Mix and store at 4 C For plates add 15 g agar to the water in Step 1 and proceed After mixing pour the plates immediately MM and MMH stores well for several months at 4 C Continued on next page 57 Pichia Media Recipes continued BMGH and BMMH BMGY and BMMY 58 Buffered Minimal Glycerol Buffered Minimal Methanol 1 liter 100 mM potassium phosphate pH 6 0 1 34 YNB 4 x 107 biotin 1 glycerol or 0 5 methanol 1
113. the pellets and resuspend each one in 50 ul of TE buffer pH 7 5 Determine the concentration of the DNA sample You may store the samples separately or combined at 20 C until ready for use Determining the Copy Number of Multiple Integrants Introduction Quantitative Dot Blot Solutions Quantitative Dot Blot Procedure You may wish to determine the actual number of gene copies in your Pichia recombinant You may either use quantitative dot blots or Southern hybridization to analyze gene copy number Brierley et al 1994 Clare et al 1991a Romanos et al 1991 Scorer et al 1993 Scorer et al 1994 This requires you to isolate genomic DNA from Pichia recombinants transformed with the parent vector 0 copies of your gene pPICZ or pPICZa containing 1 copy of your gene single copy control and the Pichia recombinants containing multiple copies of your gene Use the protocol detailed on pages 71 72 to isolate genomic DNA For each dot blot you need 10 15 ml of each of the following solutions 50 mM EDTA 2 5 B mercaptoethanol pH 9 1 mg ml Zymolyase 100T in water Seikagaku America Inc 1 800 237 4512 0 1 N NaOH 1 5 M NaCl 2X SSC You will also need 3MM paper The following protocol is a summary of a rapid DNA dot blot technique to detect multiple integrants Romanos et al 1991 It is very important to spot equivalent numbers of cells onto filters to quantify the copy number Alternatively you m
114. the provisions of this license agreement You may not distribute any Expression Vector or host strain contained herein or in the Expression Kit to others even those within your own institution You may only transfer modified altered or original material from the Expression Kit or Vector to a third party following written notification of and written approval from Life Technologies so that the recipient can be licensed You may not assign sub license rent lease or otherwise transfer this license agreement or any of the rights or obligation there under except as expressly permitted by Life Technologies and RCT This license agreement is effective until terminated You may terminate it at any time by destroying all Pichia Expression products in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Pichia Expression products in your control and so notify Life Technologies in writing You may contact Research Corporation Technologies at the following address Bennett Cohen Ph D Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson Arizona 85711 3335 Tel 520 748 4443 Fax 520 748 0025 81 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publis
115. tinued MutS Intracellular 1 or Secreted Using a single colony inoculate 10 ml of MGYH BMGH or BMGY in a 100 ml baffled flask Grow at 28 30 C in a shaking incubator 250 300 rpm until the culture reaches an ODs 2 6 approximately 16 18 hours Use this 10 ml culture to inoculate 1 liter of MGYH BMGH or BMGY ina 3 or 4 liter baffled flask and grow at 28 30 C with vigorous shaking 250 300 rpm until the culture reaches log phase growth ODs 2 6 Harvest the cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature To induce expression decant the supernatant and resuspend cell pellet in 1 5 to 1 10 of the original culture volume of MMH BMMH or BMMY medium approximately 100 200 ml Place the culture in a 1 liter baffled flask Cover the flask with 2 layers of sterile gauze or cheesecloth and return to incubator Continue to grow at 28 30 C with shaking Add 100 methanol to 0 5 every 24 hours until the optimal time of induction is reached Harvest cells by centrifuging at 1 500 3 000 x g for 5 minutes at room temperature For intracellular expression decant the supernatant and store the cell pellets at 80 C until ready to process For secreted expression save the supernatant chill to 4 C and concentrate it down if desired see next page Proceed directly to purification page 50 or store the supernatant at 80 C until ready to process further To increase the amount of cells for
116. tion Proteolysis or Degradation Low Secreted Expression Levels Low Expression Levels Based on available data there is approximately a 50 to 75 chance of expressing your protein of interest in Pichia pastoris at reasonable levels The biggest hurdle seems to be generating initial success i e expression of your protein at any level While there are relatively few examples of expression of gt 10 grams liter there are many examples of expression in the gt 1 gram liter range making the Pichia pastoris expression system one of the most productive eukaryotic expression systems available Likewise there are several examples of proteins that have been successfully expressed in Pichia pastoris that were completely unsuccessful in baculovirus or Saccharomyces cerevisiae suggesting that the Pichia pastoris system is an important alternative to have available If you obtain no or low protein expression in your initial expression experiment use the following guidelines to optimize expression e Doa time course study of expression Check to see if there is a time point that yields a larger percentage of full length protein e Ifsecreting your protein check to see if your protein is susceptible to neutral pH proteases by expressing in unbuffered medium MMH In addition try 1 Casamino acids with buffered medium to inhibit extracellular proteases e Check cell pellet to see if overall expression is low or if the protein did not
117. tory Manual Sambrook et al 1989 Note that electrocompetent TOP10F cells are available from Invitrogen Item Amount Cat no TOP10F Electrocomp 6 x 20 reactions C665 24 TOP10F Electrocomp 2 x 20 reactions C665 11 Continued on next page General Cloning Information continued Important Signal Sequence Processing Optimizing Signal Cleavage Expressing Recombinant Protein with Native N terminus To propagate pPICZ and pPICZa or select Zeo transformants in E coli you will need to prepare Low Salt LB For Zeocin to be active the salt concentration of the medium must remain low lt 90 mM and the pH must be 7 5 Prepare Low Salt LB broth and plates using the recipe on page 53 Failure to lower the salt content of your LB medium will result in non selection due to inactivation of the drug To propagate vectors e Resuspend the plasmid in 20 pl sterile water to make a 1 pg pl solution e Dilute 1 pl of the plasmid 1 ug l to 10 100 pg ul using sterile water or TE buffer e Transform competent E coli with 1 2 ul of the diluted plasmid and select on Low Salt LB with 25 pg ml Zeocin The processing of the a factor mating signal sequence in pPICZa occurs in two steps 1 The preliminary cleavage of the signal sequence by the KEX2 gene product with the final Kex2 cleavage occurring between arginine and glutamine in the sequence Glu Lys Arg Glu Ala Glu Ala where
118. tranded DNA for five minutes then quickly chill in ice water Keep on ice Note It is not necessary nor desirable to boil the carrier DNA prior to each use Store a small aliquot at 20 C and boil every 34 times the DNA is thawed Centrifuge the LiCl cell solution from Step 7 above and remove the LiCl with a pipet For each transformation sample add the following reagents in the order given to the cells PEG shields the cells from the detrimental effects of the high concentration of LiCl 240 ul 50 PEG 36 pl 1 M LiCl 25 pl 2 mg ml single stranded DNA Plasmid DNA 5 10 pg in 50 pl sterile water Vortex each tube vigorously until the cell pellet is completely mixed 1 minute Incubate the tube at 30 C for 30 minutes without shaking Heat shock in a water bath at 42 C for 20 25 minutes Centrifuge the tubes at 6 000 to 8 000 rpm and remove the transformation solution with a pipet Resuspend the pellet in 1 ml of YPD and incubate at 30 C with shaking After 1 hour and 4 hours plate 25 ul to 100 ul on YPD plates containing 100 pg ml Zeocin Incubate the plates for 2 3 days at 30 C Proceed to Analysis of Pichia Transformants page 28 65 Zeocin Description Chemical Properties Mechanism of Action 66 TM Zeocin belongs to a family of structurally related bleomycin phleomycin type antibiotics isolated from Streptomyces Antibiotics in this family are broad spectrum antibiotics that act as
119. transformants to ensure isolation of a pure clonal isolates This is done by streaking for single colonies on YPD or minimal plates with histidine You may do this before or after testing for the Mut phenotype This procedure gives a lower rate of misclassifications but it increases the overall Mutt Mut screening procedure by 2 days You will need equipment to replica plate 1 Using sterile toothpicks patch 10 Zeo transformants on an MDH plate For controls make one patch from each of the strains GS115 Mut Albumin and GS115 pPICZ lacZ Mut onto the MDH plate Incubate the plate at 28 30 C for 2 days After 2 days replica plate the patches from the MDH plate onto fresh MMH and MDH plates to screen for Mut transformants Incubate the replica plates at 28 30 C for 2 days 5 After 2 days at 28 30 C score the replica plates Look for patches that grow normally on the MDH replica plate but show little or no growth on the MMH replica plate these are your Mut transformants Including Mut and Mut control patches on each plate will provide examples of Mutt and Mut phenotypes Continued on next page Determining the Mut Phenotype continued Screening by Functional Assay Multiple Integration Events The Next Step Some researchers have used a functional assay to directly screen for high expressing Pichia recombinant clones without first screening for Mut or Mut phenotypes If you elect to screen directly
120. ur protein as a standard if available e A sample of X 33 GS115 or KM71H with the parent plasmid transformed into it This shows the background of native Pichia proteins that are present intracellularly Inclusion of this sample will help you differentiate your protein from background if you express it intracellularly e Analyze the GS115 pPICZ lacZ and Albumin controls also as they should indicate any problems with the media or expression conditions lt i 7 In addition to Coomassie stained SDS PAGE we strongly recommend XN MENDY Y eae SN performing a Western blot or another more sensitive assay to detect your gt B protein Visualization of the expressed protein will depend on several factors including its expression level its solubility its molecular weight and whether it will be masked by an abundant cellular protein of the same size Western blot analysis enzymatic activities or a defined purification profile if available may help to identify the expressed protein among the native Pichia cellular proteins Continued on next page 43 Analysis by SDS Polyacrylamide Gel Electrophoresis continued Western Blot Analysis Analyzing Protein Expression 44 To detect expression of your recombinant fusion protein by Western blot analysis you may use Anti myc or Anti His C term antibodies available from Invitrogen see page viii or an antibody to your protein of interest In addition the Positope C
121. ypographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 79 Purchaser Notification Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 74 Pichia Pastoris Expression System 80 This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The Pichia Expression System is based on the yeast Pichia pastoris Pichia pastoris was developed into an expression system by scientists at Salk Institute Biotechnology Industry Associates SIBIA and Phillips Petroleum for high level expression of recombinant proteins All patents for Pichia pastoris
122. ysis by SDS PAGE You may need to use Western blot analysis to detect your protein if expression is low or not enough protein was loaded onto the column Refer to the ProBond Purification System manual for a guide to troubleshoot chromatography You may find it necessary to scale up your purification to obtain sufficient amounts of purified protein Adjust the pH and NaCl concentration of your lysate with 1 10 volume of 10X Stock Solution B ProBond Purification System before adding it to the column The pH should be greater than or equal to 7 5 and the NaCl concentration should be 500 mM Using 10X Stock Solution B to adjust the pH and the ionic strength keeps the total volume small for sample application 51 Protein Glycosylation Analyzing When expressing and purifying a glycosylated protein in a heterologous Glycoproteins expression system it is desirable to quickly determine whether the protein is glycosylated properly There are published protocols for carbohydrate analysis of proteins to allow the molecular biologist to characterize glycosylated proteins of interest Ausubel et al 1994 Unit 17 Further information about glycosylation in eukaryotes is available in a review by Varki and Freeze Varki and Freeze 1994 Enzymes for These are just a few of the enzymes available for carbohydrate analysis Analyzing Abbreviations are as follows Asn Asparagine Gal Galactose Glycoproteins GlcNAc

EasySelect™ Pichia Expression Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

EasySelect&trade; Pichia Expression Kit

Contents

Download Pdf Manuals

Related Search

Related Contents

EasySelect™ Pichia Expression Kit