Home

HaloPlex HS Target Enrichment System Automation Protocol For Ion

Contents

1. Table5 Thermal cycler program for HaloPlex HS restriction digestion Step Temperature Time Step 1 37 C 30 minutes Step 2 4 C Hold Preparation of each restriction digest reaction plate takes approximately 30 45 minutes HaloPlex HS Target Enrichment System ION 41 3 Sample Preparation For 12 column runs the two 384 well plates are prepared sequentially for a total run time of approximately 90 minutes Run the thermal cycler digestion program for each plate as soon as prompted During the 30 minute incubation of plate 1 in the thermal cycler the NGS Bravo begins preparation of the digestion reactions in plate 2 Once the thermal cycler program is complete for plate 1 store the digested DNA in plate 1 on ice until the Digestion_v1 0 pro protocol and thermal cycler program for plate 2 is finished 15 Validate the restriction digestion reaction by electrophoretic analysis of the Enrichment Control DNA ECD reactions a Transfer 4 ul of each ECD digestion reaction from the wells of the 384 well reaction plate indicated in Table 6 to fresh 0 2 ml PCR tubes Note that for 12 column runs four of the eight ECD digests are found on the first 384 well plate and the remaining four digests are on the second 384 well plate Table6 Position of ECD digestion reactions for obtaining validation samples Restriction Enzyme Master Position of ECD Digestion Reaction in 384 Well Plates Mix to be Validated 1 6 Column Runs 12 Column
2. adapter sequence GCTGAGGATCACCGACTGCCCATAGAGAGGCTGAGAC as a custom 3 adapter on the Torrent Server For instructions on how to define custom 3 adapters please refer to Ion PGM documentation Once defined this adapter sequence is retained for future runs If prompted by the Ion PGM user interface for 3 Adapter during analysis of the run select this HaloPlex custom 3 adapter Otherwise use of this custom HaloPlex 3 adapter sequence can be specified during data reanalysis as detailed on page 78 2 During Ion PGM sequencing run setup when prompted by the Ion PGM user interface for Barcode Set select IonXpress The HaloPlex ION index sequences in the provided HaloPlex HS Indexing Primers ION correspond to the IonXpress barcodes HaloPlex HS Target Enrichment System ION 71 3 Sample Preparation 3 Prior to final sequence alignment trim the molecular barcodes from the library amplicons and specify the 3 end adapter sequence using the Ion PGM Reanalyze function as detailed below a From the Run Summary interface click the Reanalyze button b From the task menu in the left segment of the screen select Reanalyze Run In the options section in the right segment locate the Start reanalysis from menu and select Base Calling c From the task menu at left now select Analysis Options In the options section at right verify that the 3 Adapter field contains the HaloPlex custom 3 adapter defined in step 1 above and that
3. NaOH Mix source plate full skirted 96 well Eppendorf twin tec plate HS Wash 2 Solution source plate full skirted 96 well Eppendorf twin tec plate Streptavidin T1 magnetic beads suspended in HS Capture Solution Nunc DeepWell source plate Empty red insert empty Empty tip box Nuclease free water in Thermo Scientific reservoir 5 Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup and Information regions of the form 6 Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the tip boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run 7 When verification is complete click Start to start the run 62 Controls Bn ID Pause Screen HaloPlex HS Target Enrichment System ION Sample Preparation 3 8 When prompted by VWorks as shown below obtain the ligation plate from the thermal cycler Unseal the plate then place the plate on position 6 of the Bravo deck seated on the red insert r Place Ligation Plate Place Ligated DNA in 96 Eppendorf twin tec half skirted plate on red insert at position 6 The NGS Bravo completes the liquid handling steps for capture of the target DNA on the streptavidin beads followed by washing of the captured DNA HaloPlex HS Target Enrichment System ION 63 3 Sample Preparation Step 5 PCR amplify
4. Sample Preparation 3 8 When prompted by VWorks as shown below remove and discard the elution buffer source plate from position 3 of the Bravo deck Place a fresh full skirted 96 well Eppendorf twin tec plate on position 3 When finished click Continue on the VWorks prompt Replace Elution Plate Remove the elution buffer plate from position 3 and replace with a new 96 Eppendorf twin tec PCR plate Click Continue below 9 When the NGS Bravo has finished preparing the final eluted sample plate you will be prompted by VWorks as shown below Click Continue on the VWorks prompt to finish the protocol n Samples are ready The eluted samples are ready Get the sample plate from position 3 Click Continue below to finish the protocol HaloPlex HS Target Enrichment System ION 71 3 Sample Preparation Stopping Point If you do not continue to the next step samples may be stored at 20 C for long term storage up to one year Avoid subjecting the stored DNA samples to multiple freeze thaw cycles 72 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Step 7 Validate enrichment and quantify enriched target DNA Prior to sample pooling and sequencing sample preparation validate enrichment and quantify the enriched target DNA in each library sample by microfluidic analysis using the 2100 Bioanalyzer see page 74 or the 2200 TapeStation see page 75 Expected Results Each ampli
5. including but not limited to the implied warranties of merchant ability and fitness for a particular purpose Agilent shall not be lia ble for errors or for incidental or consequential damages in con nection with the furnishing use or performance of this document or of any information contained herein Should Agilent and the user have a separate written agreement with warranty terms covering the material in this doc ument that conflict with these terms the warranty terms in the separate agreement shall control Technology Licenses The hardware and or software described in this document are furnished under a license and may be used or copied only in accor dance with the terms of such license Restricted Rights Legend U S Government Restricted Rights Soft ware and technical data rights granted to the federal government include only those rights customarily provided to end user cus tomers Agilent provides this customary commercial license in Software and techni cal data pursuant to FAR 12 211 Technical Data and 12 212 Computer Software and for the Department of Defense DFARS 252 227 7015 Technical Data Commercial Items and DFARS 227 7202 3 Rights in Commercial Computer Software or Com puter Software Documentation Notice to Purchaser This product is provided under an agree ment between Bio Rad Laboratories and Agilent Technologies Inc and the manu facture use sale or import of this product is
6. A6 H6 5 1 ul 8 9 pl 12 6 pl 16 3 pl 23 7 ul 47 9 ul RE Master Mix G Column 7 A7 H7 5 1 ul 8 9 ul 12 6 pl 16 3 pl 23 7 yl 47 9 ul RE Master Mix H Column 8 A8 H8 5 1 ul 8 9 ul 12 6 pl 16 3 pl 23 7 ul 47 9 ul A B C D E F G H RE Master Mixes V V V V V V4 4 4 38 RE Master Mix Source Plate Figure 1 VAN 7 C r C 1 zo onmonou gt OC Me NA NA Nos No I 1 Digestion v1 0 pro QOOOOOOO 2 345 8 9 10 11 12 Preparation of the RE Master Mix source plate for automation protocol HaloPlex HS Target Enrichment System ION Sample Preparation 3 Load the NGS Bravo and Run the Digestion_v1 0 pro VWorks Protocol 1 Open the HaloPlex HS setup form using the HaloPlex_HS VWForm shortcut on your desktop Log in to the VWorks software On the setup form under Step select 01 Digestion_v1 0 pro Parameters 1 Step o1 Digestion v1 0 pro ig 2 Number of columns of samples 6 m Update layout and information 3 4 Update current tip state 4 Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns 5 Click Update layout and information 6 Load the Bravo deck according to Table 4 Table4 Initial Bravo deck configuration for Digestion v1 0 pro Location Content 1 empty 2 New tip box 3 For 12 column runs only Empty 384 well Eppendorf twin tec plate no 384 well insert required For 1 to 6 column runs empty 4 gDNA samples in fu
7. HaloPlex HS Target Enrichment System ION 45 3 46 Sample Preparation Stopping Point Option 3 Validation by gel electrophoresis Use a Novex 6 polyacrylamide TBE pre cast gel and 1X Novex TBE Running Buffer For more information to do this step consult the manufacturer s recommendations Prepare an undigested DNA gel control by combining 2 ul of the Enrichment Control DNA stock solution and 2 ul of nuclease free water Add 1 ul of Novex Hi Density TBE Sample Buffer 5X to each 4 ul ECD sample Load 5 ul of each sample on the gel In one or more adjacent lanes load 200 ng of a 50 bp DNA ladder Run the gel at 210 V for approximately 15 minutes Stain the gel in 3X GelRed Nucleic Acid Stain for 10 minutes and visualize bands under UV radiation See Figure 4 for sample gel results Figure 4 Validation of restriction digestion by gel electrophoresis Lanes 1 8 ECD di gestion reactions A H Lane 9 Undigested Enrichment Control DNA Lane 10 25 bp DNA ladder If you do not continue to the next step samples may be stored at 20 C for long term storage There are no more long term stopping points until after the PCR amplification step on page 67 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Step 2 Hybridize digested DNA to HaloPlex HS or ClearSeq HS probes In this step the collection of gDNA restriction fragments is hybridized to the HaloPlex HS or ClearSeq HS probe library During
8. pH 8 5 3 Prepare the DNA sample plate for the run containing up to 95 gDNA samples and the Enrichment Control DNA sample using a full skirted 96 well Eppendorf twin tec plate HaloPlex HS Automated Target Enrichment System runs may include 1 2 3 4 6 or 12 columns of the plate Use full columns of DNA samples for each run a In well Al of a 96 well twin tec plate dispense 32 ul of the supplied Enrichment Control DNA ECD Store on ice b Inseparate wells of the same 96 well twin tec plate dispense 32 ul of each gDNA sample to be included in the run For automated processing fill plate wells column wise in well order Al to H1 then A2 to H2 ending with A12 to H12 Continue to store on ice HaloPlex HS Target Enrichment System ION 35 3 Sample Preparation Prepare the RE Master Mix Source Plate 1 Prepare the appropriate amount of RE Buffer BSA mixture according to the table below Table 1 X Preparation of RE Buffer BSA mixture for Digestion v1 0 pro protocol Reagent Volume for Volume for Volumefor Volumefor Volumefor Volumefor Volume for 1Library 1 Column 2Columns 3Columns 4Columns 6 Columns 12 Columns RE Buffer 24 5 yl 294 ul 490 ul 686 ul 882 ul 1274 yl 2548 ul BSA Solution 0 5 ul 6 ul 10 pl 14 ul 18 ul 26 ul 52 ul Total Volume 25 yl 300 pl 500 pl 700 pl 900 pl 1300 pl 2600 pl CAUTION 2 Obtain the two provided green and red marked Enzyme Strips from the HaloPlex HS kit For each strip la
9. subject to US Pat No 6 627 424 and EP Pat No 1 283 875 B1 owned by Bio Rad Labora tories Inc Purchase of this product con veys to the buyer the non transferable right to use the purchased amount of the product and components of the product in PCR but not real time PCR in the Research Field including all Applied Research Fields including but not limited to forensics ani mal testing and food testing HaloPlex HS Target Enrichment System ION Safety Notices CAUTION A CAUTION notice denotes a hazard It calls attention to an operating procedure practice or the like that if not correctly performed or adhered to could result in damage to the product or loss of important data Do not proceed beyond a CAUTION notice until the indicated conditions are fully understood and met A WARNING notice denotes a hazard It calls attention to an operating procedure practice or the like that if not correctly performed or adhered to could result in personal injury or death Do not proceed beyond a WARNING notice until the indicated conditions are fully understood and met HaloPlex HS Target Enrichment System ION 3 In this Guide This guide describes an optimized automation protocol for using the HaloPlex HS target enrichment system to prepare sequencing library samples for multiplexed sequencing on the Ion Torrent platform Sample processing steps are automated using the Agilent NGS Bravo Option A Before You Begin T
10. 743 yl 104 1 pl 133 9 pl 193 3 pl 386 8 pl For 1 6 column runs RE master mixes A H may be prepared in a 8 x 0 2 ml well strip tube using a multichannel pipette to transfer volumes from Enzyme Strips 1 and 2 to the RE master mix strip For 12 column runs prepare the master mixes in 1 5 ml tubes 4 Mix by gentle vortexing and then spin briefly Keep on ice HaloPlex HS Target Enrichment System ION 37 3 Sample Preparation Prepare the RE master mix source plate 1 Aliquot the Restriction Enzyme Master Mixes to a full skirted 96 well Eppendorf twin tec plate as shown in Figure 1 Add the volumes indicated in Table 3 of each master mix A H to each well of the indicated column of the twin tec plate Keep the master mixes on ice during the aliquoting steps Table3 Preparation of the RE Master Mix Source Plate for Digestion v1 0 pro Master Mix Position on Source Volume of Master Mix added per Well of Source Plate Solution Plate 1 Column 2 Column 3 Column 4 Column 6 Column 12 Column Runs Runs Runs Runs Runs Runs RE Master Mix A Column 1 A1 H1 5 1 ul 8 9 ul 12 6 ul 16 3 ul 23 7 yl 47 9 ul RE Master Mix B Column 2 A2 H2 5 1 ul 8 9 ul 12 6 pl 16 3 pl 23 7 ul 47 9 ul RE Master Mix C Column 3 A3 H3 5 1 ul 8 9 ul 12 6 ul 16 3 pl 23 7 yl 47 9 ul RE Master Mix D Column 4 A4 H4 5 1 ul 8 9 ul 12 6 pl 16 3 pl 23 7 yl 47 9 ul RE Master Mix E Column 5 A5 H5 5 1 ul 8 9 ul 12 6 ul 16 3 pl 23 7 ul 47 9 ul RE Master Mix F Column 6
11. Runs two 384 well plates produced RE Master Mix A A1 A1 plate 1 RE Master Mix B A2 A2 plate 1 RE Master Mix C B1 B1 plate 1 RE Master Mix D B2 B2 plate 1 RE Master Mix E A13 A1 plate 2 RE Master Mix F A14 A2 plate 2 RE Master Mix G B13 B1 plate 2 RE Master Mix H B14 B2 plate 2 b Incubate the removed 4 ul samples at 80 C for 5 minutes to inactivate the restriction enzymes c Analyze the prepared samples using microfluidic electrophoresis on the 2100 Bioanalyzer see page 44 or on the 2200 TapeStation see page 45 or using gel electrophoresis see page 46 42 HaloPlex HS Target Enrichment System ION Sample Preparation 3 The ECD sample contains genomic DNA mixed with an 800 bp PCR product that contains restriction sites for all the enzymes used in the digestion protocol When analyzing validation results the undigested control should have gDNA bands at 2 5 kbp and a PCR product band at 800 bp Each of the eight digested ECD samples should have a smear of gDNA restriction fragments between 100 and 2500 bp overlaid with three predominant bands at approximately 125 225 and 450 bp These three bands correspond to the 800 bp PCR product derived restriction fragments and precise sizes will differ after digestion in each of the eight RE master mixes In addition to the three predominant bands at approximately 125 225 and 450 bp you may detect additional minor bands in the digested ECD sample lanes Succes
12. and integrated devices using a PC The Agilent NGS Bravo Option A is preloaded with VWorks software containing all of the necessary HaloPlex HS system liquid handling protocols General instructions for starting up the VWorks software and the included protocols is provided below Each time a specific VWorks protocol is used in the HaloPlex HS procedure any settings required for that protocol are included in the relevant section of this manual The instructions in this manual are compatible with VWorks software version 11 3 0 1195 If you have questions about VWorks version compatibility please contact service automation agilent com Logging in to the VWorks software 1 Double click the VWorks icon or the HaloPlex_HS VWForm shortcut on the Windows desktop to start the VWorks software 2 If User Authentication dialog is not visible click Log in on the VWorks window toolbar 3 In the User Authentication dialog type your VWorks user name and password and click OK If no user account is set up contact the administrator HaloPlex HS Target Enrichment System ION 21 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Using the HaloPlex_HS VWForm to setup and start a run Use the VWorks form HaloPlex HS VWForm shown below to set up and start each HaloPlex HS automation protocol Open the form using the shortcut on your desktop Use the drop down menus on the form to select the appropriate HaloPlex HS workflow ste
13. for Volume for Volume for Volumefor Volumefor Volume for Volume for 1 Library 1 Column 2Columns 3Columns 4Columns 6Columns 12 Columns Nuclease free water 3 2 yl 40 8 ul 68 0 pl 95 2 ul 122 4 ul 176 8 ul 353 6 pl Herculase Il Reaction 30 pl 382 5 yl 637 5 yl 892 5 yl 1147 5 ul 1657 5 ul 3315 pl Buffer 100 mM dNTP Mix 0 8 ul 10 2 pl 17 0 pl 23 8 yl 30 6 pl 44 2 yl 88 4 ul Primer 1 ION 4 yl 51 0 ul 85 0 ul 119 0 pl 153 0 pl 221 0 ul 442 yl Primer 2 ION 8 ul 102 ul 170 ul 238 yl 306 yl 442 yl 884 ul Herculase II Fusion 4 pl 51 0 ul 85 0 ul 119 0 ul 153 0 ul 221 0 pl 442 yl DNA Polymerase Total Volume 50 pl 637 5 yl 1062 5 yl 1487 5 yl 1912 5 yl 2162 5 yl 5525 yl 7 Using the same Nunc DeepWell plate that was used for the Hyb Purification amp Ligation v1 0 pro run prepare the Master Mix source plate for Amplification vl1 0 pro Add the volume indicated in Table 22 of PCR Master Mix to all wells of column 3 of the Nunc DeepWell plate Table 22 Preparation of the Master Mix Source Plate for Amplification v1 0 pro Master Mix Position on Volume of Master Mix added per Well of Nunc Deep Well Source Plate Solution Source Plate 1 Column 2 Column 3 Column 4 Column 6 Column 12 Column Runs Runs Runs Runs Runs Runs PCR Master Mix Column 3 73 4 yl 126 6 ul 179 7 ul 232 8 ul 339 1 pl 684 4 ul A3 H3 HaloPlex HS Target Enrichment System ION 65 3 Sample Preparation Load the Agilent NGS Bravo and Run the Amplification
14. same Nunc DeepWell plate that was used for the Hybridization_v1 0 pro run prepare the Master Mix source plate for Hyb_Purification_ amp _Ligation_v1 0 pro Add the volume indicated in Table 13 of Ligation Master Mix to all wells of column 2 of the Nunc DeepWell plate Table 13 Preparation of the Master Mix Source Plate for Hyb_Purification_ amp _Ligation_v1 0 pro Master Mix Solution Position on Volume of Master Mix added per Well of Nunc DeepWell Source Plate Source Plate aS See 1 Column 2 Column 3 Column 4 Column 6 Column 12 Column Runs Runs Runs Runs Runs Runs Ligation Master Mix Column 2 A2 H2 73 4 yl 126 6 ul 179 7 ul 232 8 yl 339 1 pl 684 4 yl 54 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Load the Agilent NGS Bravo and Run the Hyb Purification amp Ligation v1 0 pro VWorks Protocol 1 3 4 On the VWorks HaloPlex HS form under Step select 03 Hyb Purification amp Ligation v1 0 pro Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns Click Update layout and information Load the Bravo deck according to Table 14 Table 14 Initial Bravo deck configuration for Hyb Purification amp Ligation v1 0 pro Location Content 1 A wo m Empty Axygen 96 Deep Well Plate square wells for waste New tip box 70 ethanol in Thermo Scientific reservoir empty AMPure XP beads HS Hybridization Stop Solution mix in Nunc DeepWell so
15. strip the High Sensitivity D1000 ScreenTape and loading tips into the 2200 TapeStation as instructed in the 2200 TapeStation User Manual Start the run 3 Analyze the electropherogram for each sample using the analysis guidelines on page 76 See Figure 7 for a sample TapeStation electropherogram JN S S S N SS 1400 1200 1000 Sample Intensity FU co e e Size amp bp n 1 000 1 500 re a 8 8 5383 alal Figure 7 Validation of HaloPlex HS enrichment by 2200 TapeStation analysis HaloPlex HS Target Enrichment System ION 75 3 Sample Preparation Analysis of Electropherogram Results Check that the electropherogram shows a peak fragment size between approximately 165 to 615 bp Determine the concentration of enriched target DNA in the sample by integration under the peak between 165 to 615 bp Peaks at 165 bp may be observed but should be excluded from quantitation Some designs may generate peaks in the 50 150 bp size range These peaks are associated with products including adapter and adapter dimer which will cluster and generate sequence that does not map to the genome If the molar fraction of products sized 50 150 bp is greater than 20 6 do another round of AMPure purification after pooling samples First pool equimolar amounts of libraries to be multiplexed using concentrations determined for the 165 650 peak of each sample Using 40 ul of the po
16. the Certificate of Analysis provided with your kit to determine the hybridization duration appropriate for your design After reviewing the duration of this and other steps in the protocol plan the start time for your experiment accordingly HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 Designs containing 20 000 probes use a 2 hour hybridization time For these designs DNA digestion through PCR protocols see Figure 2 are typically run on the same day with the DNA digestion protocol initiated early in the day Designs containing 220 000 probes use a 16 hour hybridization time which is typically completed overnight Calculate the appropriate start time for the DNA digestion protocol based on your run size and the run time estimates provided in the HaloPlex HS form in the VWorks software HaloPlex HS VWForm to allow overnight hybridization HaloPlex HS Target Enrichment System ION 31 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Run Time Considerations 32 HaloPlex HS Target Enrichment System ION HaloPlex HS Target Enrichment System Protocol eo 0 D ee 3 7 e Sample Preparation e a Step 1 Digest genomic DNA with restriction enzymes 34 Step 2 Hybridize digested DNA to HaloPlex HS or ClearSeq HS probes 47 Step 3 Purify then ligate the circularized DNA hybrids 53 Step 4 Capture and wash the target DNA 59 Step 5 PCR amplify the captured
17. 1 96 ml 3 92 ml Solution HaloPlex HS Target Enrichment System ION 59 3 Sample Preparation 5 Prepare a Nunc DeepWell source plate for the prepared streptavidin magnetic bead suspension Add 40 ul of the homogeneous bead suspension to all sample wells of the Nunc DeepWell plate 6 Place the streptavidin bead source plate at position 5 of the Bravo deck Prepare Wash 1 Mix 7 Prepare fresh 1 M NaOH for use in step 8 Prepare the amount of 1 M NaOH solution shown in Table 17 from a 10 M NaOH stock solution CAUTION Using high quality NaOH is critical for optimal DNA sample quality Donotuse stock NaOH solutions that were stored at concentrations below 10 M to prepare the 1 M NaOH solution Keepthe 1 M NaOH solution container sealed when not in use especially when processing large numbers of samples per run Table 17 Amount of 1 M NaOH required per run size Volume for Volume for Volume for Volume for Volume for Volume for Volume for 1 Library 1 Column 2 Columns 3 Columns 4 Columns 6 Columns 12 Columns 11 ul 99 ul 187 ul 275 yl 363 pl 550 ul 1 1 ml 8 Prepare HS Wash 1 NaOH Mix by combining the reagents in Table 18 Table 18 Preparation of HS Wash 1 NaOH Mix Reagent Volume for Volumefor Volumefor Volumefor Volumefor Volumefor Volume for 1 Library 1Column 2Columns 3Columns 4Columns 6Columns 12 Columns HS Wash 1 Solution 99 ul 891 ul 1683 pl 2475 yl 3267 ul 4950 pl 9 9 ml 1 M NaOH prepared in 11 ul 99 ul 1
18. 2 HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 5 Verify that the Current Tip State indicator on the form shown below matches the configuration of unused tips in the tip box at Bravo Deck position 2 For a fresh tip box containing 12 columns of tips all positions of the Current Tip State unused tip indicator top portion Box 2 should be selected as shown below Clicking Reset selects all columns for position 2 Current Tip State Select columns of unused tips Box 2 iv jv iv iv iv iviv iv iv iv iv iv Select columns of used tips Box 8 rrrrrrrrrrr Fr Reset Clear Also verify that the used tip indicator bottom portion Box 8 matches the configuration of used tips in the tip box at Bravo Deck position 8 For an empty tip box all positions of the Current Tip State used tip indicator bottom portion Box 8 should be cleared as shown above Clicking Reset clears all columns for position 8 Itis important that the Current Tip State indicator matches the configuration of tips present at Bravo Deck positions 2 and 8 when initiating the run Tips that are inappropriately loaded onto the Bravo platform pipette head or tips missing from the pipette head will interfere with automated processing steps You can use partial tip boxes for HaloPlex HS automation protocols as long as positions of available tips are accurately indicated during run setup 6 Afte
19. 54B G9954C ClearSeq Connective Disorder HS ION G9954B G9954C ClearSeq Arrhythmia HS ION G9954B G9954C ClearSeq Noonan Syndrome HS ION G9954B G9954C Tier 1 designs are 1 250 kb and up to 20 000 probes t Tier2 designs are 251 kb 2 5 Mb OR 1 250 kb with 220 000 probes t Selectthe appropriate made to order probe option in SureDesign Kits contain enough reagents for 96 or 48 reactions total including one or more control reactions using Enrichment Control DNA ECD samples Each run of up to 96 samples should include one ECD control enrichment reaction HaloPlex HS Target Enrichment System ION Required Equipment Table 3 Required Equipment for HaloPlex HS Target Enrichment Automated Protocols Description Agilent NGS Bravo Option A with VWorks software version 11 3 0 1195 PlateLoc Thermal Microplate Sealer with Small Hotplate Robotic Pipetting Tips Sterile Filtered 250 uL Thermal Cycler Eppendorf twin tec full skirted 96 well PCR plates Eppendorf twin tec full skirted 384 well PCR plates Eppendorf twin tec half skirted 96 well PCR plates Thermo Scientific Reservoirs Nunc DeepWell Plates sterile 1 3 ml well volume Axygen 96 Deep Well Plate 2 2 ml Square Well waste reservoirs Magnetic separator 1 5 ml tube compatible separator or Conical vial compatible separator Benchtop microcentrifuge Benchtop plate centrifuge P10 P20 P200 and P1000 pipettes NucleoClean Decontamination Wipe
20. 6 well plates The Bravo platform is controlled by the VWorks Automation Control software Fitted with a choice of seven interchangeable fixed tip or disposable tip pipette heads it accurately dispenses fluids from 0 1 uL to 250 uL Before you begin make sure that you have read and understand operating maintenance and safety instructions for using your Bravo platform Refer to the Bravo Platform User Guide 65409 90006 and the VWorks Software User Guide 65415 90063 18 Bravo Platform Deck The protocols in the following sections include instructions for placing plates and reagent reservoirs on specific Bravo deck locations Use Figure 1 to familiarize yourself with the location numbering convention on the Bravo platform deck Back L L Front Figure 1 Bravo platform deck HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 Setting the Temperature of Bravo Deck Heat Blocks Bravo deck positions 4 and 6 are equipped with Inheco heat blocks used to incubate sample plates at defined temperatures during the run Runs that include low temperature 4 C or high temperature 54 C incubation steps may be expedited by pre setting the temperature of the affected block before starting the run Bravo deck heat block temperatures may be changed using the Inheco Multi TEC Control device touchscreen as described in the steps bel
21. 87 pl 275 yl 363 ul 550 ul 1 1 ml step 7 Total Volume 110 pl 990 yl 1870 pl 2750 yl 3630 pl 5500 pl 11 0 ml 60 HaloPlex HS Target Enrichment System ION Sample Preparation Prepare the wash solution source plates 9 Prepare a separate source plate for each of the wash solutions listed in Table 19 Use full skirted 96 well Eppendorf twin tec plates to prepare each source plate For all sample containing wells of the ligation plate add the specified volume to all corresponding wells of each wash solution source plate Table 19 Preparation of solution source plates for Capture amp Wash v1 0 pro protocol Solution Volume to dispense per well of source plate HS Wash 1 NaOH Mix from step8 110 pl HS Wash 2 Solution 160 ul 10 Prepare a Thermo Scientific reservoir containing 45 ml of nuclease free water Load the NGS Bravo and Run the Capture amp Wash v1 0 pro VWorks Protocol 1 On the VWorks HaloPlex HS form under Step select 04 Capture amp Wash v1 0 pro 2 Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns 3 Click Update layout and information HaloPlex HS Target Enrichment System ION 61 3 Sample Preparation 4 Load the Bravo deck according to Table 20 Table 20 Initial Bravo deck configuration for Capture amp Wash v1 0 pro Location Content 1 2 3 Empty Axygen 96 Deep Well Plate square wells for waste New tip box HS Wash 1
22. DeepWell plate prepare the Hybridization Master Mix source plate Add the volumes indicated in Table 8 of the Hybridization Master Mix to all wells of Column 1 of the Nunc DeepWell plate Table8 Preparation of the Master Mix Source Plate for Hybridization_v1 0 pro Master Mix Position on Volume of Master Mix added per Well of Nunc DeepWell Source Plate Solution Source Plate Sees ee AR E RE RE 1 Column 2 Column 3 Column 4 Column 6 Column 12 Column Runs Runs Runs Runs Runs Runs Hybridization Column 1 57 3 yl 98 7 yl 140 2 ul 181 6 ul 264 5 ul 533 8 ul Master Mix A1 H1 Prepare the Hybridization Reaction Plate with HaloPlex HS Indexing Primers 1 In a half skirted 96 well Eppendorf twin tec plate aliquot 5 ul of the appropriate HaloPlex HS ION Indexing Primer to each intended sample indexing well position Keep the plate on ice Be sure to add only one specific Indexing Primer to each well using different indexes for each sample to be multiplexed Record the identity of the Indexing Primer assigned to each well for later sequence analysis Components needed to incorporate a unique molecular barcode sequence into each target fragment prior to amplification are included in the HaloPlex HS ION Indexing Primer solutions and do not need to be added separately 2 If the run includes an ECD control sample that was analyzed as described on page 42 add 32 ul of nuclease free water to well A1 of the hybridization reaction plate Well A
23. Equipment Table4 Reagents and Equipment for Optional Validation Methods Description Vendor and part number 2200 TapeStation Platform and Consumables 2200 TapeStation High Sensitivity D1000 ScreenTape High Sensitivity D1000 Reagents 2100 Bioanalyzer Platform and Consumables 2100 Bioanalyzer Laptop Bundle 2100 Bioanalyzer Electrophoresis Set High Sensitivity DNA Kit Gel Electrophoresis Platform and Consumables XCell SureLock Mini cell Novex 6 Polyacrylamide TBE Pre cast Gels Novex TBE Running Buffer 5X Novex High density TBE Sample Buffer 5X GelRed Nucleic Acid Stain 3X in water DNA molecular weight markers UV transilluminator Agilent p n G2964AA or G2965AA Agilent p n 5067 5584 Agilent p n 5067 5585 Agilent p n G2943CA Agilent p n G2947CA Agilent p n 5067 4626 Life Technologies p n EI0001 Life Technologies p n EC62655BOX Life Technologies p n LC6675 Life Technologies p n LC6678 Biotium p n 41001 General laboratory supplier General laboratory supplier 14 HaloPlex HS Target Enrichment System ION Using the Agilent NGS Workstation Option B for HaloPlex HS Automation The detailed protocols in the following chapters are for the Agilent NGS Workstation Option A but HaloPlex HS target enrichment protocols are also compatible with the Agilent NGS Workstation Option B Depending on the configuration of the system purchased however additional adapters may be required Before initiating experiments s
24. HS Target Enrichment System ION HaloPlex HS Target Enrichment System Protocol ee 4 Reference Kit Contents 82 Nucleotide Sequences of HaloPlex ION Indexes 85 ES Agilent Technologies 81 4 Reference Kit Contents The HaloPlex HS Target Enrichment System is supplied using the part numbers listed below Table 1 HaloPlex HS and ClearSeq HS Target Enrichment System Kit Part Numbers Design Type Custom 1 250 kb up to 20 000 probes ION Custom 251 kb 2 5 Mb OR 251 kb with 720 000 probes ION ClearSeq Cancer HS ION ClearSeq Cardiomyopathy HS ION ClearSeq ICCG HS ION ClearSeq Connective Disorder HS ION ClearSeq Arrhythmia HS ION ClearSeq Noonan Syndrome HS ION Reaction Number 48 Reactions 96 Reactions 48 Reactions 96 Reactions 96 Reactions 96 Reactions 48 Reactions 96 Reactions 48 Reactions 96 Reactions 48 Reactions 96 Reactions 48 Reactions 96 Reactions HaloPlex HS Target Enrichment System ION Store at 20 C 5190 7864 OR 5190 7866 5190 7872 OR 5190 7874 5190 7868 OR 5190 7870 5190 7876 OR 5190 7878 G9934B G9944B 5190 9178 5190 9196 5190 9172 5190 9190 5190 9176 5190 9194 5190 9174 5190 9192 See Table 2 for list of included reagents t Part number 5190 7864 5190 7872 5190 7868 or 5190 7876 is provided for the first order of a specific HaloPlex HS Custom Probe design Re order kits containing previously purchased Custom Probe designs inc
25. HaloPlex HS Target Enrichment System Automation Protocol For lon Torrent Sequencing Version BO June For Research Use Only Not for use in diagnostic procedures SEE Agilent Technologies Notices Agilent Technologies Inc 2015 No part of this manual may be reproduced in any form or by any means including elec tronic storage and retrieval or translation into a foreign language without prior agree ment and written consent from Agilent Technologies Inc as governed by United States and international copyright laws Manual Part Number G9932 90010 Edition Version B0 June 2015 Printed in USA Agilent Technologies Inc 5301 Stevens Creek Blvd Santa Clara CA 95051 USA Technical Support For technical product support contact your local Agilent Support Services representa tive For US and Canada call 800 227 9770 option 3 4 4 For other countries find your support center telephone numbers at www agilent com chem contactus Or send an e mail to SureSelect Support agilent com Notice to Purchaser For Research Use Only Not for use in diag nostic procedures Warranty The material contained in this document is provided as is and is subject to being changed with out notice in future editions Fur ther to the maximum extent permitted by applicable law Agi lent disclaims all warranties either express or implied with regard to this manual and any information contained herein
26. On the VWorks HaloPlex HS form under Step select 06 Final Purification v1 0 pro Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns Click Update layout and information HaloPlex HS Target Enrichment System ION 69 3 70 Sample Preparation 4 Load the Bravo deck according to Table 25 Table 25 Initial Bravo deck configuration for Final Purification v1 0 pro Location Content 1 wo Empty Axygen 96 Deep Well Plate square wells for waste New tip box HS Elution Buffer in full skirted 96 well Eppendorf twin tec plate empty AMPure XP beads water mixture in Nunc DeepWell source plate Amplified DNA samples in half skirted 96 well Eppendorf twin tec plate seated on red insert empty Empty tip box 70 ethanol in Thermo Scientific reservoir 5 Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup region of the form 6 Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the tip boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run 7 When verification is complete click Start to start the run Controls start ID Pause Screen The NGS Bravo completes the liquid handling steps for purification of the amplified target DNA HaloPlex HS Target Enrichment System ION
27. TGGATGAC HaloPlex HS Target Enrichment System ION 85 4 Reference Nucleotide Sequences of HaloPlex ION Indexes 86 HaloPlex HS Target Enrichment System ION E e e o o e0 0905 5 Qeu9 Appendix Provisional Adapter Dimer gt e i Removal Protocol e HaloPlex HS Target Enrichment System Protocol Purify the enriched library pool using AMPure XP beads 88 This section contains a protocol for purification of the target enriched library pool to remove nonspecific molecules sized 50 150 bp including adapters and adapter dimers Only do this protocol if electrophoretic analysis of the target enriched library samples shows one or more peaks at approximately 50 150 bp which represent a molar fraction of gt 20 of DNA in the sample see page 76 RE Agilent Technologies Appendix Provisional Adapter Dimer Removal Protocol Purify the enriched library pool using AMPure XP beads In this step a 40 ul pool of target enriched DNA libraries is purified using AMPure XP beads using manual sample processing This protocol requires a 0 2 ml tube compatible magnetic separation device such as the Agencourt SPRIPlate Super Magnet Plate Agencourt p n A32782 or equivalent 1 Let the AMPure XP beads come to room temperature for at least 30 minutes 2 Prepare 400 ul of 70 ethanol per sample plus excess for use in step 10 3 Transfer 40 ul of each target enriched library pool to a fresh 0 2 ml tube 4 Mix the AMPure XP bead suspensi
28. amples in 96 well Plates for Automated Processing The Agilent NGS Bravo processes samples column wise beginning at column 1 gDNA samples should be loaded into 96 well plates column wise in well order A1 to H1 then A2 to H2 ending with A12 to H12 When processing partial runs with 12 sample columns do not leave empty columns between sample columns always load the plate using the left most column that is available For sample indexing during hybridization to the HaloPlex HS probe see Figure 2 you will need to prepare a separate plate containing the HaloPlex HS ION Indexing Primers Assign the wells to be indexed with their respective indexing primers during experimental design See the Reference chapter for nucleotide sequences of the 16 indexes used in the HaloPlex HS Target Enrichment System for Ion Torrent sequencing Considerations for Equipment Setup Some workflow steps require the rapid transfer of sample plates between the Bravo deck and a thermal cycler Locate your thermal cycler in close proximity to the Agilent NGS Bravo to allow rapid and efficient plate transfer Some workflow steps require that the sample plate be sealed then centrifuged to collect any dispersed liquid before being transfered between instruments To maximize efficiency locate the PlateLoc thermal microplate sealer and the centrifuge in close proximity to the NGS Bravo and thermal cycler Run Time Considerations Before you begin refer to
29. ap tube with clear cap bottle tube with clear cap tube with pink cap Indexing Primers 1 to 16 in orange 96 well plate See Table 3 for a plate map HaloPlex HS Target Enrichment System ION 83 4 Reference Placement of the HaloPlex HS ION Indexing Primers in the orange plate provided with 48 and 96 reaction kits is shown in Table 3 Wells in columns 7 through 12 are empty The number shown in each plate well indicates the identity of the 10 nt index portion of the indexing primer in each well See Table 4 on page 85 for sequences of the corresponding HaloPlex HS ION Indexes Plates provided with 96 reactions kits contain enough of each indexing primer solution for two reactions per well Table3 _HaloPlex HS ION Indexing Primer plate map A B C D E F G H 84 HaloPlex HS Target Enrichment System ION Reference 4 Nucleotide Sequences of HaloPlex ION Indexes The nucleotide sequence of the 10 nt index portion of each HaloPlex HS ION Indexing Primer is provided in Table 4 below Sequences of the HaloPlex ION indexes correspond to the IonXpress barcodes supported by the Ion PGM sequencer Table4 HaloPlex HS ION Indexes 1 16 Index Number Sequence 1 CTAAGGTAAC 2 TAAGGAGAAC 3 AAGAGGATTC 4 TACCAAGATC 5 CAGAAGGAAC 6 CTGCAAGTTC 7 TTCGTGATTC 8 TTCCGATAAC 9 TGAGCGGAAC 10 CTGACCGAAC 11 TCCTCGAATC 12 TAGGTGGTTC 13 TCTAACGGAC 14 TTGGAGTGTC 15 TCTAGAGGTC 16 TC
30. bel the color marked tube with A then continue labeling the remaining tubes with B through H in order Keep the strips on ice It is important to use the restriction enzyme tube strips in the proper orientation when preparing the RE Master Mixes as described below The red or green color marker on the tube strip and cap strip are used to mark well A of each enzyme strip 36 HaloPlex HS Target Enrichment System ION Sample Preparation 3 3 In eight individual tubes prepare the eight Restriction Enzyme Master Mixes A B C D E F G and H according to the table below To prepare Master Mix A combine RE Buffer BSA from step 1 with the indicated volumes of enzyme solution from well A of the Green Enzyme Strip and from well A of the Red Enzyme Strip Prepare Master Mixes B H by repeating this process using enzyme solutions from the corresponding wells B H of each provided Enzyme Strip Table2 Preparation of RE Master Mixes A H for Digestion v1 0 pro protocol Reagent Volume for Volume for Volume for Volume for Volume for Volume for Volume for 1 Library 1 Column 2 Columns 3Columns 4Columns 6Columns 12 Columns RE Buffer BSA Green Enzyme Strip enzyme A H Red Enzyme Strip enzyme A H Total Volume for each Master Mix A B C D E F G or H 2 8 ul 35 7 ul 59 5 ul 83 3 ul 107 1pl 154 7 ul 309 4 ul 0 35 pl 45 ul 74 ul 10 4 pl 13 4 pl 19 3 ul 38 7 ul 0 35 pl 45 ul 74 ul 10 4 pl 13 4 pl 19 3 pl 38 7 ul 3 5 ul 44 7 yl
31. ced in the thermocycler i User data entry Pause and Diagnose Continue a Get the sample plate from position 6 and seal the plate using the PlateLoc Thermal Microplate Sealer with sealing settings of 165 C and 3 0 sec b Transfer the sealed plate to a thermal cycler and run the PCR program in Table 24 using a heated lid Table 24 HaloPlex HS post capture DNA amplification PCR program Segment Number of Cycles Temperature Time 1 1 98 C 2 minutes 2 Obtain cycle number 98 C 30 seconds from Certificate of gt Analysis 60 C 30 seconds 72 C 1 minute 3 1 72 C 10 minutes 4 1 8 C Hold HaloPlex HS Target Enrichment System ION 67 3 Sample Preparation The optimal amplification cycle number varies for each HaloPlex HS or ClearSeq HS probe design Consult the Certificate of Analysis provided with your kit for the PCR cycling recommendation for your probe c After initiating the PCR program in the thermal cycler click Continue on the VWorks prompt to finish the automation protocol d If you are continuing to the next step of PCR product purification remove the Agencourt AMPure XP Beads from 4 C storage for use on page 69 Let the beads come to room temperature for the remainder of the amplification program Stopping Point If you do not continue to the next step PCR products may be stored at 20 C for up to 72 hours or at 8 C overnight For best results however purify PCR products as soon as possib
32. chment 2 Overview of the HaloPlex HS Target Enrichment Procedure Figure 2 summarizes the HaloPlex HS target enrichment workflow for Ion Torrent sequencing For each sample to be sequenced individual HaloPlex HS enriched indexed libraries are prepared Indexing using 16 distinct sequences allows pooling of up to 16 samples per sequencing chip Table 7 summarizes how the VWorks automation protocols are integrated into the HaloPlex HS workflow See the Sample Preparation chapter for complete instructions for use of the VWorks protocols for sample processing Table 7_ Overview of VWorks protocols used during the workflow Workflow Step VWorks Protocol used for Automation Digest genomic DNA Digestion v1 0 pro Hybridize to HaloPlex HS probe and index the Hybridization_v1 0 pro samples Close nicks in probe target hybrids Hyb Purification amp Ligation v1 0 pro Capture and wash enriched DNA Capture amp Wash v1 0 pro PCR amplify the libraries Amplification v1 0 pro Purify amplified libraries Final Purification v1 0 pro HaloPlex HS Target Enrichment System ION 21 2 28 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Overview of the HaloPlex HS Target Enrichment Procedure o Digest and denature sample DNA Target Region _ zz g N pS SO I 9 _ gt SOOO f e Hybridize probe library to DNA targets B
33. con in the prepared library contains one target insert surrounded by sequence motifs required for multiplexed sequencing using the Ion Torrent platform as shown in Figure 5 PCR primer PCR primer binding site Dark bases Index binding site MBC Read primer binding site Figure 5 Content of HaloPlex HS enriched target amplicons Each amplicon contains one target insert blue surrounded by the lon Torrent sequencing elements black and yellow the sample index green and the molecular barcode red The amplicons should be approximately 165 to 615 bp in length with the majority of products sized approximately 200 to 500 bp Although the DNA fragment size distribution may vary for different DNA samples and different probe designs use the constant size range of 165 to 615 bp for quantitation of the enriched target DNA in each sample Any spurious DNA products outside of the 165 to 615 bp size range should be excluded from the target DNA quantitation results HaloPlex HS Target Enrichment System ION 73 3 7A Sample Preparation Option 1 Analysis using the 2100 Bioanalyzer Use a Bioanalyzer High Sensitivity DNA Assay kit and the 2100 Bioanalyzer with 2100 Expert Software version B 02 07 or higher required to run the High Sensitivity Kit See the reagent kit guide for general Bioanalyzer instrument and assay setup instructions 1 Prepare the chip samples and ladder as instructed in the reagent kit guide using 1 ul of enriched lib
34. e 2 for sample Bioanalyzer electrophoresis results Figure 2 Validation of restriction digestion by 2100 Bioanalyzer system analysis Lane 1 50 bp DNA ladder Lanes 2 9 ECD digestion reactions A H Lane 10 Undi gested Enrichment Control DNA HaloPlex HS Target Enrichment System ION Sample Preparation 3 Option 2 Validation by 2200 TapeStation analysis Use a High Sensitivity D1000 ScreenTape and reagent kit For more information to do this step see the Agilent 2200 TapeStation User Manual at www genomics agilent com Prepare an undigested DNA gel control by combining 1 ul of the Enrichment Control DNA stock solution and 1 ul of nuclease free water Prepare the TapeStation samples as instructed in the 2200 TapeStation User Manual Use 2 ul of each ECD sample diluted with 2 ul of High Sensitivity D1000 sample buffer in separate wells of a tube strip for the analysis Load the sample tube strip the High Sensitivity D1000 ScreenTape and loading tips into the 2200 TapeStation as instructed in the 2200 TapeStation User Mamual Start the run See Figure 3 for sample TapeStation electrophoresis results MW bp 1500 1000 1 100 _ a soo k 300 ae a 100 ww X A ee p Figure 3 Validation of restriction digestion by 2200 TapeStation analysis Lane 1 High Sensitivity Ladder Lane 2 Undigested Enrichment Control DNA Lanes 3 10 ECD digestion reactions A H
35. e circularized hybridization products are treated with DNA Ligase to close nicks in the probe target DNA hybrids Prepare the NGS Bravo 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place a red insert on Bravo deck position 6 Place the silver Nunc plate insert on Bravo deck position 9 4 Turn on the chiller set to 0 C at position 9 of the Bravo deck Be sure that the chiller reservoir contains at least 300 ml of 25 6 ethanol Prepare the purification reagents 5 Prepare a Thermo Scientific reservoir containing 45 ml of freshly prepared 70 6 ethanol Verify that the AMPure XP beads have been kept at room temperature for at least 30 minutes Mix the room temperature bead suspension well so that the reagent appears homogeneous and consistent in color Prepare the appropriate amount of AMPure XP beads HS Hybridization Stop Solution mixture according to Table 11 below Mix the combined reagents well on a vortex mixer Preparation of AMPure XP beads HS Hybridization Stop Solution mixture Reagent AMPure XP beads HS Hybridization Stop Solution Total Volume Volume for Volume for Volume for Volumefor Volumefor X Volumefor Volume for 1Library 1 Column 2 Columns 3Columns 4Columns 6 Columns 12 Columns 0 08 ml 0 68 ml 1 32 ml 1 96 ml 2 64 ml 4 0 ml 8 0 ml 0 02 ml 0 17 ml 0 33 ml 0 49 ml 0 66 ml 1 0 ml 2 0 ml 0 1 ml 0 85 ml 1 65ml 2 45 ml 3 3 ml 5 ml 10 ml HaloPlex HS Targe
36. ee Table 5 below and verify that the listed adapters are available for your workstation Table5 Adapter checklist for HaloPlex HS automation using Agilent NGS Workstation Option B Adapter Description Quantity Required for HaloPlex Agilent part number single adapter HS Automation 384 well plate insert 2 G5498B 60 96 well PCR plate insert red 2 G5498B 13 If your NGS Workstation Option B system is already equipped with one red insert purchase one additional insert using the ordering information shown HaloPlex HS Target Enrichment System ION 15 16 HaloPlex HS Target Enrichment System ION HaloPlex HS Target Enrichment System Protocol 00 ee 2 7 e Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment About the Agilent NGS Bravo OptionA 18 Overview of the HaloPlex HS Target Enrichment Procedure 27 Experimental Setup Considerations for Automated Runs 29 This chapter contains an orientation to the Agilent NGS Bravo Option A an overview of the HaloPlex HS target enrichment protocol and considerations for designing HaloPlex HS experiments for automated processing using the Agilent NGS Bravo RE Agilent Technologies 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment About the Agilent NGS Bravo Option A CAUTION About the Bravo Platform The Bravo platform is a versatile liquid handler with a nine plate location platform deck suitable for handling 96 well 384 well and 153
37. ent of the protocol r Replace Hybridization Plate Remove the DNA plate from position 6 and replace the plate with a new 96 twin tec half skirted plate When finished dick Continue below 10 The NGS Bravo completes the liquid handling steps for the ligation reaction When the ligation plate is prepared you will be prompted by VWorks as shown below Transfer plate to thermal cycler Get plate from position 6 seal at 165C for 3 0s Place in thermal cyder and run the ligation protocol outlined in User Guide After transferring the plate click Continue below HaloPlex HS Target Enrichment System ION 57 3 Sample Preparation 11 Get the sample plate from position 6 and seal the plate using the PlateLoc Thermal Microplate Sealer with sealing settings of 165 C and 3 0 sec 12 Transfer the sealed plate to a thermal cycler and incubate at 55 C for 10 minutes using a heated lid Do not include a low temperature hold step in the thermal cycler program following the 10 minute incubation 13 During the 10 minute incubation prepare the following components for later protocol steps Dynabeads MyOne Streptavidin T1 magnetic beads described on page 59 Wash 1 Mix prepare as described on page 60 58 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Step 4 Capture and wash the target DNA In this step the circularized target DNA HaloPlex HS probe hybrids containing bioti
38. es In this step gDNA samples are digested by 16 different restriction enzymes to create a library of gDNA restriction fragments The gDNA is digested in eight different restriction reactions each containing two restriction enzymes The 16 restriction enzymes are provided in two 8 well strip tubes that are distinguished by red and green color markers Enzymes are combined from corresponding wells of the red and green marked strip tubes to make eight different RE Master Mixes which are then combined with each DNA sample in the run Successful enrichment using the protocol in this guide requires high quality DNA samples Before you begin verify that the genomic DNA samples have an OD 260 280 ratio ranging from 1 8 to 2 0 Verify the size distribution of DNA in each DNA preparation by gel electrophoresis Any smearing below 2 5 kb indicates sample degradation This protocol is compatible with FFPE derived DNA samples but enrichment performance and sequencing results may be impacted depending on the extent of DNA fragmentation in each FFPE sample Prepare the NGS Bravo 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place red aluminum inserts on Bravo deck positions 4 and 9 3 Turn on the chiller set to 0 C at position 9 of the Bravo deck Be sure that the chiller reservoir contains at least 300 ml of 25 6 ethanol 4 Place a 384 well adapter insert on Bravo deck position 6 Pre set the temperature of Bra
39. formation in this chapter and have the necessary equipment and reagents listed before you start an experiment RE Agilent Technologies Procedural Notes Safety Notes The 96 reaction kit contains enough reagents to prepare master mixes for four runs of 3 columns of samples 24 samples per run When processing samples using runs with fewer than 24 samples some reagents may be depleted before 96 samples are run The HaloPlex HS protocol is optimized for digestion of 50 ng of genomic DNA split among 8 different restriction digestion reactions plus excess DNA for pipetting losses Using lower amounts of DNA in the enrichment protocol can adversely affect your results Use a fluorometry based DNA quantitation method such as PicoGreen stain or Qubit fluorometry to quantify the DNA starting material Possible stopping points where DNA samples may be stored between steps are marked in the protocol Store the samples at 20 C but do not subject the samples to multiple freeze thaw cycles Ensure that master mixes are thoroughly mixed by pipetting up and down or by gentle vortexing before distributing to the samples In general follow Biosafety Level 1 BL1 safety rules CAUTION Wear appropriate personal protective equipment PPE when working in the laboratory 10 HaloPlex HS Target Enrichment System ION Required Reagents Table 1 Required Reagents for HaloPlex HS Target Enrichment Description Vendor a
40. heck Tips CHANGE TIP BOXES Press RESET on form and CONTINUE to reset to Full boxes or press PAUSE to manually edit User data entry Pause and Diagnose Continue N The NGS Bravo combines each gDNA sample with each RE Master Mix in wells of a 384 well reaction plate For 1 to 6 column runs a single 384 well restriction digest plate is prepared for 12 column runs two 384 well restriction digest plates are prepared HaloPlex HS Target Enrichment System ION Sample Preparation 3 11 When the NGS Bravo has finished preparing each 384 well restriction digest plate for the run you will be prompted by VWorks as shown below The final Bravo deck position of the prepared restriction digest plate varies for different run sizes Transfer plate to thermal cycler Get plate from position 6 seal at 165C for 3 0s Place in thermal cyder and run the digestion program outlined in User Guide After transferring the plate dick Continue below User data entry Ts 12 Remove the 384 well plate from the Bravo deck position indicated in the prompt 13 Seal the sample plate using the PlateLoc Thermal Microplate Sealer with sealing settings of 165 C and 3 0 sec Spin the plate briefly to release any bubbles trapped in the liquid 14 Transfer the sealed plate to a thermal cycler and run the digestion program shown in Table 5 using a heated lid After transferring the plate click Continue on the prompt
41. his chapter contains information such as procedural notes safety information required reagents and equipment that you should read and understand before you start an experiment Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment This chapter contains an orientation to the Agilent NGS Bravo Option A an overview of the HaloPlex HS target enrichment protocol and considerations for designing HaloPlex HS experiments for automated processing using the Agilent NGS Bravo Option A Sample Preparation This chapter describes the steps of the automated HaloPlex HS workflow to prepare target enriched sequencing libraries for the Ion Torrent platform Reference This chapter contains reference information including component kit contents and index sequences Appendix Provisional Adapter Dimer Removal Protocol This chapter describes a protocol used to remove adaptor dimers that may be observed for some designs HaloPlex HS Target Enrichment System ION What s New in Version BO Updated product labeling statement HaloPlex HS Target Enrichment System ION HaloPlex HS Target Enrichment System ION Content 1 2 3 Before You Begin Procedural Notes 10 Safety Notes 10 Required Reagents 11 Required Equipment 13 Optional Validation Reagents and Equipment 14 Using the Agilent NGS Workstation Option B for HaloPlex HS Automation 15 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment About the Agi
42. ick Continue on the VWorks prompt to finish the protocol Table 10 Thermal cycler program for HaloPlex HS probe hybridization Step Temperature Time Duration of Step Designs with lt 20 000 probes Designs with gt 20 000 probes see Certificate of Analysis see Certificate of Analysis Step 1 95 C 5 minutes 5 minutes Step 2 58 C 2 hours 16 hours HaloPlex HS Target Enrichment System ION 51 3 Sample Preparation 12 At least 30 minutes before the end of the Hybridization incubation remove reagents to be used in upcoming protocol steps from cold storage and allow the solutions to reach the appropriate temperature From 20 C storage remove the HS Hybridization Stop Solution HS Ligation Solution HS Capture Solution HS Wash 1 Solution HS Wash 2 Solution and HS Elution Buffer to room temperature Be sure to bring the HS Hybridization Stop Solution to room temperature before use The high viscosity of this solution impedes accurate pipetting at lower temperatures From 4 C storage remove the Agencourt AMPure XP magnetic beads and the Dynabeads MyOne Streptavidin T1 magnetic beads to room temperature From 20 C storage remove the HS Ligation Solution 10 mM rATP and HS DNA Ligase to ice 52 HaloPlex HS Target Enrichment System ION Table 11 Sample Preparation 3 Step 3 Purify then ligate the circularized DNA hybrids In this step the hybridization buffer is removed using AMPure XP beads and then th
43. iotin TEN Sequencing Primer Motif IN Index _ Bridge or Emulsion PCR Primer Target amp Complementary Probe Sequence ws Dark Bases Molecular Barcode NA EQ Ligate and capture uniquely barcoded targets M C C AA Streptavidin Figure 2 Overall HaloPlex HS target enriched sequencing sample preparation workflow HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 Experimental Setup Considerations for Automated Runs HaloPlex HS Automated Target Enrichment System runs may include 1 2 3 4 6 or 12 columns equivalent to 8 16 24 32 48 or 96 wells of SDNA samples to be enriched for sequencing on the Ion Torrent platform Plan your experiments using complete columns of samples Table8 Columns to Samples Equivalency Number of Columns Processed Total Number of Samples Processed 1 8 2 16 3 24 4 32 6 48 12 96 The number of columns or samples that may be processed using the supplied reagents see page 83 will depend on the experimental design For greatest efficiency of reagent use plan experiments using at least 3 columns per run Each 96 reaction kit contains sufficient reagents for 96 reactions configured as 4 runs of 3 columns of samples per run HaloPlex HS Target Enrichment System ION 29 2 30 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Considerations for Placement of gDNA S
44. l should also contain 5 ul of indexing primer from step 1 above The 32 ul of water added back here compensates for the combined volume removed from the eight ECD digest wells during validation Load the Agilent NGS Bravo and Run the Hybridization v1 0 pro VWorks Protocol 1 On the VWorks HaloPlex HS form under Step select 02 Hybridization v1 0 pro Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns Click Update layout and information HaloPlex HS Target Enrichment System ION 49 3 50 Sample Preparation 4 Load the Bravo deck according to Table 9 Table 9 Initial Bravo deck configuration for Hybridization_v1 0 pro Location Content 1 Indexing Primer source plate half skirted 96 well Eppendorf twin tec plate seated on red insert New tip box empty Digested DNA in 384 well plate seated on 384 well insert Empty full skirted 96 well Eppendorf twin tec plate For 12 column runs only Digested DNA in 384 well plate digest plate 2 seated on 384 well insert For 1 to 6 column runs empty empty Empty tip box Hybridization Master Mix source plate Nunc DeepWell plate seated on silver insert 5 Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup and Information regions of the form 6 Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the ti
45. le 68 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Step 6 Purify the amplified target DNA In this step the NGS Bravo does the liquid handling steps to purify the amplified target DNA sample using AMPure XP beads Prepare the NGS Bravo and reagents 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place a red insert on Bravo deck position 6 3 Pre set the temperature of Bravo deck position 6 to 4 C and position 4 to 45 C using the Inheco Multi TEC control touchscreen as described in Setting the Temperature of Bravo Deck Heat Blocks Verify that the AMPure XP beads have been held at room temperature for at least 30 minutes Do not freeze the AMPure XP beads at any time Mix the room temperature bead suspension well so that the reagent appears homogeneous and consistent in color Prepare a Nunc DeepWell source plate containing AMPure XP beads mixed with nuclease free water a For each well to be processed add 100 ul of homogeneous AMPure XP beads per well b Add 40 ul of nuclease free water to each well of beads in the Nunc DeepWell plate Prepare a Thermo Scientific reservoir containing 45 ml of freshly prepared 70 6 ethanol Prepare the elution buffer source plate by placing 45 ul of HS Elution Buffer in each sample well of a full skirted 96 well Eppendorf twin tec plate Load the Agilent NGS Bravo and Run the Final Purification v1 0 pro VWorks Protocol 1
46. lent NGS Bravo Option A 18 About the Bravo Platform 18 VWorks Automation Control Software 21 Overview of the HaloPlex HS Target Enrichment Procedure 27 Experimental Setup Considerations for Automated Runs 29 Considerations for Placement of gDNA Samples in 96 well Plates for Automated Processing 30 Considerations for Equipment Setup 30 Run Time Considerations 30 Sample Preparation Step 1 Digest genomic DNA with restriction enzymes 34 Step 2 Hybridize digested DNA to HaloPlex HS or ClearSeq HS probes 47 Step 3 Purify then ligate the circularized DNA hybrids 53 Step 4 Capture and wash the target DNA 59 Step 5 PCR amplify the captured target library 64 Step 6 Purify the amplified target DNA 69 Step 7 Validate enrichment and quantify enriched target DNA 73 HaloPlex HS Target Enrichment System ION Step 8 Pool samples with different indexes for multiplexed sequencing 77 4 Reference Kit Contents 82 Nucleotide Sequences of HaloPlex ION Indexes 85 5 Appendix Provisional Adapter Dimer Removal Protocol Purify the enriched library pool using AMPure XP beads 88 HaloPlex HS Target Enrichment System ION HaloPlex HS Target Enrichment System Protocol 1 Before You Begin Procedural Notes 10 Safety Notes 10 Required Reagents 11 Required Equipment 13 Optional Validation Reagents and Equipment 14 Using the Agilent NGS Workstation Option B for HaloPlex HS Automation 15 Make sure you read and understand the in
47. ll skirted 96 well Eppendorf twin tec plate seated on red insert 5 empty 6 Empty 384 well Eppendorf twin tec plate seated on 384 well insert 7 empty 8 Empty tip box 9 RE Master Mix source plate full skirted 96 well Eppendorf twin tec plate seated on red insert 7 Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup and Information regions of the form HaloPlex HS Target Enrichment System ION 39 3 40 Sample Preparation Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the tip boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run When verification is complete click Start to start the run Controls D Start JI Pause Screen If Bravo devices do not respond when you start the run but activity is recorded in the Log verify that VWorks is not running in Simulation mode See page 26 for more information 10 When prompted by VWorks as shown below replace the tip box at position 2 with a new tip box and replace the used tip box at position 8 with an empty tip box After both tip boxes are in place click Reset under Current Tip State on the form Verify that the tip state was updated and then click Continue on the prompt shown below Depending on the run size you may be prompted to change tip boxes multiple times during the run C
48. lude part number 5190 7866 5190 7874 5190 7870 or 5190 7878 82 HaloPlex HS Target Enrichment System ION Reference 4 The contents of the HaloPlex HS Target Enrichment kits are detailed in the table below Table 2 HaloPlex HS Target Enrichment System Kit Contents Included Reagents RE Buffer BSA Solution Enzyme Strip 1 Enzyme Strip 2 Enrichment Control DNA Hybridization Solution HS Hybridization Stop Solution HS Ligation Solution HS DNA Ligase 10 mM rATP HS Wash 1 Solution HS Wash 2 Solution HS Capture Solution HS Elution Buffer Primer 1 ION Primer 2 ION Herculase II Fusion DNA Polymerase Herculase Il Reaction Buffer 100 mM dNTP Mix HaloPlex HS or ClearSeq HS Probe HaloPlex HS ION Indexing Primers 48 Reaction Kit tube with clear cap tube with clear cap 8 well strip with green label 8 well strip with red label tube with orange cap bottle tube with clear cap tube with black cap tube with green cap tube with clear cap bottle bottle bottle bottle tube with yellow cap tube with blue cap tube with clear cap bottle tube with clear cap tube with pink cap Indexing Primers 1 to 16 in orange 96 well plate 96 Reaction Kit bottle tube with clear cap 8 well strip with green label 8 well strip with red label tube with orange cap bottle bottle tube with black cap tube with green cap tube with clear cap bottle bottle bottle bottle tube with yellow cap tube with blue c
49. n are captured on streptavidin beads Prepare the NGS Bravo 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place a red insert on Bravo deck position 6 Prepare the Streptavidin beads source plate 3 Vigorously resuspend the Dynabeads MyOne Streptavidin T1 magnetic beads on a vortex mixer The magnetic beads settle during storage 4 Wash the magnetic beads a Transfer 40 ul per sample of the Dynabeads MyOne Streptavidin T1 magnetic bead suspension to a 1 5 ml tube or conical vial using volumes provided in Table 15 Table 15 Volume of Dynabeads MyOne Streptavidin T1 magnetic bead suspension for capture Reagent Volume for Volume for Volumefor Volumefor Volumefor Volumefor Volume for 1 Library 1 Column 2Columns 3Columns 4 Columns 6 Columns 12 Columns Streptavidin T1 0 04 ml 0 36 ml 0 68 ml 1 0 ml 1 32 ml 1 96 ml 3 92 ml Magnetic Beads b Putthe vial into a compatible magnetic device for 5 minutes c After verifying that the solution has cleared carefully remove and discard the supernatant using a pipette d Add an equivalent volume of HS Capture Solution see Table 16 to the beads and resuspend by pipetting up and down Table 16 Volume of Capture Solution used for bead resuspension Reagent Volume for Volume for Volume for Volume for Volumefor Volumefor Volume for 1Library 1 Column 2Columns 3Columns 4Columns 6 Columns 12 Columns HS Capture 0 04 ml 0 36 ml 0 68 ml 1 0 ml 1 32 ml
50. nd part number HaloPlex HS Target Enrichment System Kit Nuclease free Water not DEPC treated Agencourt AMPure XP Kit 5 ml 60 ml Dynabeads MyOne Streptavidin T1 2mL 10 mL 100 mL 10 M NaOH molecular biology grade 10 mM Tris HCl pH 8 5 100 Ethanol molecular biology grade Quant iT dsDNA BR Assay Kit for use with the Qubit fluorometer 100 assays 2 1000 ng 500 assays 2 1000 ng Select the appropriate kit for your probe design from Table 2 Ambion Cat AM9930 Beckman Coulter Genomics p n A63880 p n A63881 Life Technologies p n 65601 p n 65602 p n 65603 Sigma p n 72068 General laboratory supplier Sigma Aldrich p n E7023 Life Technologies p n 032850 Life Technologies p n 032853 HaloPlex HS Target Enrichment System ION 11 Before ordering a HaloPlex HS Target Enrichment System Reagent Kit use Agilent s SureDesign tool at www agilent com genomics suredesign to design a custom HaloPlex HS probe or to select a pre designed ClearSeq HS disease research probe Reagent kit ordering information is supplied as part of the SureDesign process and is summarized in Table 2 below Table2 _HaloPlex HS Target Enrichment System Kits for lon Torrent Sequencing Part Number HaloPlex HS Probe Design 96 Reactions 48 Reactions Custom Panel Tier 1 ION G9932B G9932C Custom Panel Tier 2 ION G9942B G9942C ClearSeq Cancer HS ION G9934B ClearSeq Cardiomyopathy HS ION G9944B ClearSeq ICCG HS ION G99
51. ny residual ethanol with a 20 ul volume pipette 14 Air dry the tubes with open lids at room temperature until the residual ethanol completely evaporates Make sure all ethanol has evaporated before continuing 15 Remove tubes from the magnetic device and add 40 ul of HS Elution Buffer to each sample Use room temperature HS Elution Buffer at this step 16 Mix thoroughly by pipetting up and down 15 times using a 100 ul pipette set to 30 ul 17 Incubate for 2 minutes at room temperature to allow elution of DNA 18 Put the tube in the magnetic device and leave for 2 minutes or until the solution is clear 19 Remove the cleared supernatant approximately 40 ul to a fresh tube You can discard the beads at this time Stopping Point If you do not continue to the next step samples may be stored at 20 C for long term storage up to one year Avoid subjecting the stored DNA samples to multiple freeze thaw cycles HaloPlex HS Target Enrichment System ION 89 In This Book This guide contains information to run the HaloPlex HS Target Enrichment System automation protocol Agilent Technologies Inc 2015 Version BO June 2015 G9932 90010 HaloPlex HS Target Enrichment System ION
52. oled libraries purify the DNA using AMPure XP beads according to the protocol on page 88 76 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Step 8 Pool samples with different indexes for multiplexed sequencing Use the following guidelines to design your sample pooling strategy Use the Bioanalyzer or TapeStation measured concentration of 165 615 bp products in each sample to pool equimolar amounts of differentially indexed samples in order to optimize the use of sequencing capacity Quantify the final HaloPlex enrichment pool using Bioanalyzer analysis and dilute the pool to the concentration recommended in the subsequent template preparation protocol Use Ion Torrent sequencing reagents and protocols designed for 200 bp single end sequencing lon PGM sequencing run setup and analysis guidelines Use the following guidelines to set up and analyze the sequencing run on the Ion Personal Genome Machine Ion PGM using HaloPlex adapter sequences and HaloPlex sample indexes corresponding to the IonXpress barcodes Sequencing data is analyzed using Agilent s SureCall software The instructions in this section are applicable to a workflow that includes analysis using Agilent s SureCall software If your workflow includes data analysis using another tool contact Technical Support for assistance 1 Before the first use of the Ion PGM instrument for HaloPlex HS library sequencing define the HaloPlex specific 3
53. on well until the suspension appears homogeneous and consistent in color 5 For each sample to be purified prepare a bead mix by combining 40 ul of nuclease free water and 100 ul of the homogeneous AMPure XP bead suspension Mix well until the bead mix suspension appears homogeneous 6 Add 140 ul of the homogeneous bead suspension prepared in step 5 to each 40 ul DNA sample Vortex thoroughly Using this bead to sample volume ratio is imperative to ensure optimal purification results 7 Incubate samples for 5 minutes at room temperature with continuous shaking Make sure the samples are properly mixing in the wells during the 5 minute incubation 8 Spin briefly to collect the liquid then place the tubes in the magnetic separation device Wait for the solution to clear approximately 5 minutes 9 Keep the tubes in the magnetic device Carefully remove and discard the cleared solution from each tube using a 200 ul pipette set to 180 ul Do not touch the beads while removing the solution 10 Continue to keep the tubes in the magnetic device while you add 200 ul of 70 ethanol into the tubes Use fresh 70 ethanol for optimal results HaloPlex HS Target Enrichment System ION Appendix Provisional Adapter Dimer Removal Protocol 5 11 Wait for 30 seconds to allow any disturbed beads to settle then remove the ethanol using a 200 ul pipette set to 200 ul 12 Repeat step 10 and step 11 once for a total of two washes 13 Remove a
54. ow See Table 6 for designations of the heat block containing Bravo deck positions on the Multi TEC control device Table6 Inheco Multi TEC Control touchscreen designations Bravo Deck Position Designation on Inheco Multi TEC Control Screen 4 CPAC 2 1 6 CPAC 22 1 Using the arrow buttons select the appropriate block CPAC 2 block 1 or CPAC 2 block 2 crac 2 1 lt gt 24 9 C Shaker 0200 rpm s HaloPlex HS Target Enrichment System ION 19 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 To set the temperature of the selected block press the SET button CPAC 2 1 24 9 C 5 Shaker 0200 rpm 3 Using the numeral pad enter the desired temperature The entered temperature appears in the top left rectangle Once the correct temperature is displayed press the rectangle to enter the temperature 4 Press the Temp button until the new temperature is displayed on the SET button and until the Temp button is darkened indicating that the selected heat block is heating or cooling to the new temperature setting The current temperature of the block is indicated in the center ofthe display CPAC 2 1 25 0 C 2 Current temp 0200 rpm se 20 HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 VWorks Automation Control Software VWorks software included with your Agilent NGS Bravo allows you to control the robot
55. p and number of columns of samples for the run Once all run parameters have been specified on the form click Update layout and information The displayed protocol will not run unless the Update layout and information button has been clicked 4 Yr Agilent Technologies Q The Bravo Deck Setup region of the form will then display the required placement of reaction components and labware on the NGS Bravo deck for the specified run parameters HaloPlex HS Automation Parameters LP N di 1 fi Current Tip State gt Be 4 1 Step 01 Digestion_v1 0 pro Se oq Select columns of unused tips Box 2 NE Ioa Bravo Deck Setul A RRO RRO 2 Number of columns of samples 3 Ei Newtip box Select columns of used tips Box 8 3 Update layout and information Srctrtctrotoccocooo 4 Update current tip state Reset Clear DNA in 96 Empty 384 Eppendorf twin tec Eppendorf twin tec plate onred insert plate on 384 insert Status Mx Ac Reference Elapsed Time 00 00 07 fyab RE Master Mixes in Final DNA Location Labware Needs 96 Eppen twin tec plate on red insert Protocol Duration Temperature Presets oec Controls Information Advanced Settings Start 15 Pause Screen Positions 4and 6 can be pre chilled to 4 C IV Enable audio alerts Ignore all incubation times testing only Position 9 can be pre chilled to 0 C C VWorks Workspace NGS Option A HaloPlex HS Protocol Files 01 Digestion v10 pro v2 0 2
56. p boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run 7 When verification is complete click Start to start the run Controls Start IN Pause Screen The NGS Bravo combines all eight digestion reactions for each gDNA sample with Hybridization Master Mix and the appropriate ION Indexing Primer in wells of a 96 well plate HaloPlex HS Target Enrichment System ION Sample Preparation 3 8 When the NGS Bravo has finished preparing the hybridization plate for the run you will be prompted by VWorks as shown below Transfer plate to thermal cycler Get plate from position 1 seal at 165C for 3 0s Place in thermal cyder and run the hybridization program outlined in User Guide After transferring the plate dick Continue below User data entry Pause and Diagnose Continue N 9 Sealthe sample plate using the PlateLoc Thermal Microplate Sealer with sealing settings of 165 C and 3 0 sec 10 Spin the plate briefly The volume of each hybridization reaction is 100 ul 11 Transfer the sealed plate to a thermal cycler and run the appropriate program in Table 10 using the hybridization duration listed on the Certificate of Analysis Use a heated lid Do not include a low temperature hold step in the thermal cycler program Incubation at 58 C for more than the indicated time is not recommended After transferring the plate cl
57. pre set the temperature of Bravo deck position 6 to 4 C HaloPlex HS Target Enrichment System ION 47 3 Sample Preparation To expedite thermal cycler warm up for the hybridization reaction on page 51 you can enter and initiate the hybridization program on the thermal cycler now and then pause the program until you are instructed to transfer the reaction plate Be sure to pause the thermal cycler before the initiation of the 95 C incubation segment Release the pause immediately after transferring the plate to the thermal cycler in step 11 on page 51 Be sure that the 96 well block is in the thermal cycler before initiating the program for warm up Prepare the Master Mix Source Plate for Hybridization v1 0 pro 1 Prepare the appropriate amount of Hybridization Master Mix according to the table below Mix well by gentle vortexing then spin the tube briefly Table7 Preparation of Hybridization Master Mix for Hybridization_v1 0 pro Reagent Volume for Volume for Volumefor Volumefor Volumefor Volumefor Volume for 1 Library 1 Column 2 Columns 3Columns 4Columns 6 Columns 12 Columns HaloPlex HS or 5 ul 63 8 ul 106 3 pl 148 8 pl 191 3 pl 276 3 pl 552 5 ul ClearSeq HS Probe Hybridization 34 yl 433 5 ul 722 5 pl 1011 5 pl 1300 5 ul 1878 5 ul 3757 0 yl Solution Total Volume 39 pl 497 3 yl 828 8 pl 1160 3 yl 1491 8 yl 2154 8 pl 4309 5 pl 48 HaloPlex HS Target Enrichment System ION 2 Sample Preparation 3 In a Nunc
58. r verifying that the NGS Bravo has been set up correctly click Start in the Controls section of the form to begin the run Do not use the Start button on the VWorks Control Toolbar runs must be initiated using the start button on the HaloPlex HS VWForm shown below Controls Q strt 1 Pause Screen HaloPlex HS Target Enrichment System ION 23 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Error messages encountered at start of run After starting the run you may see the error messages displayed below When encountered make the indicated selections and proceed with the run Encountering either or both of these error messages is not indicative of a problem with the NGS Bravo or your run setup 1 If you encounter the G axis error message shown below select Ignore and Continue leaving device in current state Bravo 1 Error There appears to be a plate present in or in front of the gripper s plate presence sensor Choose Retry to check the plate presence sensor again Choose Ignore to continue to home the G axis Please note that any plate currently held by the Gripper will be dropped Choose Abort to cancel initialization 24 HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment 2 VWorks Automation Control Software 2 If you encounter the W axis error message shown below select Retry Please verif
59. rary sample for the analysis 2 Load the prepared chip into the 2100 Bioanalyzer and start the run within five minutes after preparation 3 Analyze the electropherogram for each sample using the analysis guidelines on page 76 See Figure 6 for a sample Bioanalyzer system electropherogram If the concentration determined by Bioanalyzer analysis is gt 10 ng yl repeat the analysis using a 1 10 dilution of the sample Dilute 1 ul of the sample in 9 ul of 10 mM Tris 1 mM EDTA and then mix well by vortexing at 2000 rpm on the IKA vortex supplied with the Bioanalyzer before analyzing the diluted sample 35 50 100 150 200 300 400 soo 600 700 1000 2000 10380 bp Figure 6 Validation of HaloPlex HS enrichment by 2100 Bioanalyzer analysis HaloPlex HS Target Enrichment System ION Sample Preparation 3 Option 2 Analysis using the 2200 TapeStation Use a High Sensitivity D1000 ScreenTape and reagent kit For more information to do this step see the Agilent 2200 TapeStation User Manual at www genomics agilent com 1 Prepare the TapeStation samples as instructed in the 2200 TapeStation User Manual Use 2 ul of each enriched library sample diluted with 2 ul of High Sensitivity D1000 sample buffer in separate wells of a tube strip for the analysis CAUTION Make sure that you thoroughly mix the combined DNA sample and High Sensitivity D1000 sample buffer on a vortex mixer for 5 seconds for accurate results 2 Load the sample tube
60. s Qubit 2 0 Fluorometer Qubit assay tubes Vortex mixer Vendor and part number Contact Agilent Automation Solutions for ordering information Customerservice automation agilent com Agilent p n G5402 226 Agilent p n 19477 022 Agilent SureCycler 8800 p n G8800A 96 well plate module p n G8810A and 384 well plate module p n G8820A or equivalent thermal cycler and accessories Eppendorf p n 951020401 or 951020619 Eppendorf p n 951020702 Eppendorf p n 951020303 Thermo Scientific p n 1064156 Thermo Scientific p n 260251 Axygen p n P 2ML SQ C E amp K Scientific p n EK 2440 Life Technologies DynaMag 2 magnet p n 12321D or equivalent DynaMag 15 magnet p n 12301D or equivalent VWR p n 93000 196 or equivalent Labnet International MPS1000 Mini Plate Spinner p n C1000 or equivalent Pipetman P10 P20 P200 P1000 or equivalent Millipore p n 3097 Life Technologies p n 032866 Life Technologies p n 032856 General laboratory supplier Protocols are also compatible with Agilent NGS Workstation Option B See page 15 for more information T Thermal cycler must have a maximum reaction volume specification of at least 100 uL and be compatible with 0 2 ml tubes t Compatible with Agilent SureCycler 8800 Select the appropriate device based on run size See page 59 to determine magnetic bead volume to be used for your run size HaloPlex HS Target Enrichment System ION 13 Optional Validation Reagents and
61. sful digestion is indicated by the appearance of the three predominant bands The presence of additional minor bands with relative abundance similar to the additional bands visible in Figure 2 Figure 3 and Figure 4 does not impact enrichment results It is acceptable for band intensities in digestion reaction B to be slighltly reduced compared to the other digestion reactions HaloPlex HS Target Enrichment System ION 43 3 44 Sample Preparation Option 1 Validation by 2100 Bioanalyzer analysis Use a High Sensitivity DNA Kit p n 5067 4626 and the 2100 Bioanalyzer system with 2100 Expert Software version B 02 07 or higher required to run the High Sensitivity Kit See the reagent kit guide for general Bioanalyzer system setup instructions Prepare an undigested DNA gel control by combining 0 5 ul of the Enrichment Control DNA stock solution and 3 5 ul of nuclease free water Prepare the chip samples and ladder as instructed in the reagent kit guide using 1 ul of each ECD sample and undigested DNA control for the analysis When loading samples on the chip load the DNA ladder in the ladder sample well marked on the chip Load the eight ECD digest samples A to H in sample wells 1 to 8 and load the undigested ECD sample in sample well 9 Do not run the undigested ECD control in sample well 1 Place the prepared chip into the 2100 Bioanalyzer instrument and start the run within five minutes after preparation See Figur
62. t Enrichment System ION Pipette the viscous HS Hybridization Stop Solution slowly to ensure that the full volume is aspirated and dispensed Verify that any residual volume of this solution has been dispensed from the pipette tip 53 3 Sample Preparation 8 Prepare a Nunc DeepWell source plate containing the AMPure XP bead HS Hybridization Stop Solution mixture from Table 11 Add 100 ul of the homogeneous bead suspension mixture to all sample wells of the Nunc DeepWell plate Prepare the Ligation Master Mix Source Plate 1 Prepare a 1 mM rATP solution by diluting the provided 10 mM rATP 1 10 with nuclease free water Prepare the amount of 1 mM rATP needed for your run size according to Table 12 2 Prepare the appropriate amount of Ligation Master Mix according to Table 12 Mix well by gentle vortexing then spin the tube briefly Table 12 Preparation of Ligation Master Mix Reagent Volume for Volume for Volumefor Volumefor Volumefor Volume for Volume for 1 Library 1 Column 2Columns 3Columns 4 Columns 6 Columns 12 Columns Nuclease free water 36 9 pl 470 541 784 1 yl 1097 8yl 1411 4 ul 2038 7 yl 4077 5 yl 1 mM rATP from step 1 0 6 ul 7 7 yl 12 8 ul 17 9 ul 23 0 pl 33 2 yl 66 3 pl HS Ligation Solution 10 pl 127 5 yl 212 5 ul 297 5 ul 382 5 yl 552 5 yl 1105 ul HS DNA Ligase 2 5 yl 31 9 ul 53 1 ul 74 4 ul 95 6 ul 138 1 pl 276 3 pl Total Volume 50 pl 637 6 pl 1062 5 pl 1487 6 pl 1912 5 pl 2762 5 pl 5525 1 pl 3 Using the
63. target library 64 Step 6 Purify the amplified target DNA 69 Step 7 Validate enrichment and quantify enriched target DNA 73 Step 8 Pool samples with different indexes for multiplexed sequencing 77 This section contains instructions for gDNA library target enrichment for sequence analysis using the Ion Torrent PGM platform For each sample to be sequenced an individual target enriched indexed library is prepared The target region can vary from 1 kb to 2 5 Mb Custom HaloPlex HS probes must be designed before purchasing the kit using Agilent s SureDesign tool at www agilent com genomics suredesign HaloPlex designs for the Ion Torrent platform include sequences that hybridize to both strands of target DNA This results in bidirectional sequencing of the enriched target DNA providing a single end sequencing approach that yields coverage similar to paired end sequencing The HaloPlex HS Target Enrichment System amplifies thousands of targets in the same reaction incorporating standard Ion Torrent sequencing motifs in the process During hybridization each sample can be uniquely indexed allowing for pooling of up to 16 samples per sequencing chip The indexing primers incorporated during hybridization also include degenerate molecular barcode sequences allowing tracking of individual target amplicons during sequence analysis RE Agilent Technologies 33 3 34 Sample Preparation Step 1 Digest genomic DNA with restriction enzym
64. the Barcode Set field contains IonXpress d From the task menu at left now select Command Line Args Advanced Locate the Basecaller Args field and add the text extra trim left 25 to the end of the existing text string as shown below z e n Beadfind args justBeadrind Analysis Options Reference m Analysis args Analysis trom bead Ind use altemative etbR equation Command Line Args Advanced Pre Basecaller Args for BaseCaller barcode filter 0 01 barcode filter minreads 20 calibration training 100000 f calibration Recalibration Args calibrate skipDroor Basecaller Args SaseCaller barco e When setup steps are complete click the Start Analysis button at the bottom right corner of the screen 78 HaloPlex HS Target Enrichment System ION Sample Preparation 3 4 Use Agilent s SureCall NGS data analysis software to analyze the sequencing data To learn more about this resource and download the SureCall software free of charge visit www agilent com genomics surecall To optimize SureCall performance with Ion PGM sequencing data follow the recommendations outlined in the Application Note available online at http www chem agilent com en US Search Library _layouts Agilent Pub licationSummary aspx whid 85337 amp liid 7480 HaloPlex HS Target Enrichment System ION 79 3 Sample Preparation Step 8 Pool samples with different indexes for multiplexed sequencing 80 HaloPlex
65. the captured target library In this step the Bravo completes the liquid handling steps to prepare the captured DNA target libraries for PCR amplification To expedite thermal cycler warm up for the subsequent PCR program on page 67 you can enter and initiate the PCR program on the thermal cycler now and then pause the program until you are instructed to transfer the reaction plate Be sure to pause the thermal cycler before the initiation of the 98 C denaturation segment Release the pause immediately after transferring the plate to the thermal cycler in step 15 Prepare the NGS Bravo 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place a red insert on Bravo deck position 6 Place the silver Nunc plate insert on Bravo deck position 9 4 Pre set the temperature of Bravo deck position 6 to 4 C using the Inheco Multi TEC control touchscreen as described in Setting the Temperature of Bravo Deck Heat Blocks 5 Turn on the chiller set to 0 C at position 9 of the Bravo deck Be sure that the chiller reservoir contains at least 300 ml of 25 6 ethanol 64 HaloPlex HS Target Enrichment System ION Sample Preparation 3 Prepare the PCR Master Mix Source Plate for Amplification_v1 0 pro 6 Prepare the appropriate amount of PCR Master Mix according to Table 21 below Mix well by gentle vortexing then spin the tube briefly Table 21 Preparation of PCR Master Mix for Amplification_v1 0 pro Reagent Volume
66. the hybridization process molecular barcodes and Ion Torrent sequencing motifs including sample indexing sequences are incorporated into the targeted fragments HaloPlex HS and ClearSeq HS probes are designed to hybridize selectively to fragments originating from target regions of the genome and to direct circularization of the targeted DNA fragments The duration of the hybridization reaction is determined by the probe density of your design Refer to the Certificate of Analysis provided with your kit to determine the hybridization conditions appropriate for your design For sample indexing primer assignments see the Reference chapter for nucleotide sequences of the 16 indexes used in the HaloPlex HS Target Enrichment System for Ion Torrent sequencing Prepare the NGS Bravo 1 Gently wipe down the Bravo deck with a NucleoClean decontamination wipe 2 Place a red insert on Bravo deck position 1 3 Place a silver Nunc plate insert on Bravo deck position 9 4 Turn on the chiller set to 0 C at position 9 of the Bravo deck Be sure that the chiller reservoir contains at least 300 ml of 25 ethanol 5 For all run sizes place a 384 well adapter insert on Bravo deck position 4 Pre set the temperature of Bravo deck position 4 to 4 C using the Inheco Multi TEC control touchscreen as described in Setting the Temperature of Bravo Deck Heat Blocks For 12 column runs only place a second 384 well adapter insert on Bravo deck position 6 and
67. urce plate Empty red insert empty Empty tip box Ligation Master Mix source plate Nunc DeepWell plate seated on silver insert Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup region of the form Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the tip boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run When verification is complete click Start to start the run Controls str i Pause Screen HaloPlex HS Target Enrichment System ION 55 3 Sample Preparation 8 When prompted by VWorks as shown below obtain the hybridization plate from the thermal cycler and spin the plate briefly to collect the liquid Unseal the plate then place the plate on position 6 of the Bravo deck seated on the red insert r Place Hybridization Plate Place Hybridized DNA in 96 Eppendorf twin tec half skirted plate on red insert at position 6 The NGS Bravo completes the liquid handling steps for purification of the hybridized probe target DNA 56 HaloPlex HS Target Enrichment System ION Sample Preparation 3 9 When prompted by VWorks as shown below remove and discard the hybridization plate from position 6 of the Bravo deck Seat a fresh half skirted 96 well Eppendorf twin tec plate on the red insert at position 6 for use in the ligation segm
68. v1 0 pro VWorks Protocol 8 Onthe VWorks HaloPlex HS form under Step select 05 Amplification v1 0 pro 9 Select the number of columns of samples to be processed Runs must include 1 2 3 4 6 or 12 columns 10 Click Update layout and information 11 Load the Bravo deck according to Table 23 Table23 Initial Bravo deck configuration for Amplification v1 0 pro Location Content 1 empty New tip box 3 empty 4 empty 5 Captured washed DNA samples in Nunc DeepWell plate 6 Empty half skirted 96 well Eppendorf twin tec plate seated on red insert 7 empty 8 Empty tip box 9 Master Mix source plate Nunc DeepWell plate seated on silver insert 12 Verify that the NGS Bravo has been set up as displayed in the Bravo Deck Setup and Information regions of the form 13 Verify that the Current Tip State indicator on the form matches the configuration of unused and used tips in the tip boxes at Bravo Deck positions 2 and 8 respectively See page 23 for more information on using this segment of the form during the run 14 When verification is complete click Start to start the run Controls gt C ff Pause Seren HaloPlex HS Target Enrichment System ION Sample Preparation 3 15 When the NGS Bravo has finished preparing the PCR amplification reactions you will be prompted by VWorks as shown below r Plate ready to seal The PCR plate at Bravo Position 6 is ready to be sealed and pla
69. vo deck positions 4 and 6 to 4 C using the Inheco Multi TEC control touchscreen as described in Setting the Temperature of Bravo Deck Heat Blocks To expedite thermal cycler warm up for the restriction digest incubation on page 41 you can enter and initiate the digestion program on the thermal cycler now and then pause the program until you are instructed to transfer the reaction plate Be sure to pause the thermal cycler before the initiation of the 37 C incubation segment Release the pause immediately after transferring the plate to the thermal cycler in step 14 on page 41 Be sure that the 384 well block is in the thermal cycler before initiating the program for warm up HaloPlex HS Target Enrichment System ION Sample Preparation 3 Prepare the DNA Sample Source Plate In the protocol below 50 ng genomic DNA is split among eight different restriction digests with an additional 7 6 ng excess DNA included to allow for pipetting losses Using less DNA in the enrichment protocol can result in low yield and can potentiate rare allele dropouts Use a fluorometry based DNA quantitation method such as Qubit fluorometry or PicoGreen staining to accurately quantify the DNA starting material 1 Use the Qubit dsDNA BR Assay or PicoGreen staining kit to determine the concentration of your gDNA samples Follow the manufacturers instructions for the kits and instruments 2 Dilute each gDNA sample to concentration of 1 8 ng ul in 10 mM Tris buffer
70. y that it is safe to home aspirate dispense axis If there is fluid in the tips you kS may want to manually home the W axis in diagnostics over a waste position Choose Retry to continue homing the W axis Choose Ignore to leave the W axis unhomed Choose Abort to cancel initialization Ignore and Continue leaving device in current state Mee HaloPlex HS Target Enrichment System ION 25 2 Using the Agilent NGS Bravo for HaloPlex HS Target Enrichment Verifying the Simulation setting VWorks software may be run in simulation mode during which commands entered on screen are not completed by the NGS Bravo If NGS Bravo devices do not respond when you start a run verify the simulation mode status in VWorks using the following steps 1 Verify that Simulation is off is displayed on the status indicator accessible by clicking View Control Toolbar Simulation is off y x Diagnostics g e Log out Compile Start EE Pause a a 2 Ifthe indicator displays Simulation is on click the status indicator button to turn off the simulation mode If you cannot see the toolbar above the HaloPlex HS VWorks form click Screen in the Controls section of the form to exit full screen mode If the toolbar is still not visible right click on the form and then select Control Toolbar from the menu 26 HaloPlex HS Target Enrichment System ION Using the Agilent NGS Bravo for HaloPlex HS Target Enri

Download Pdf Manuals

Related Search

Related Contents

Manual do Usuário do Receptor GNSS SP60    

Copyright © All rights reserved. Failed to retrieve file