Mint-2 cDNA synthesis kit, User Manual - Bio
Contents
1. Lp 8 y A A O i gn Vo Oo ES L C O Nn nN 2 C A E A N supporting life sciences Mint 2 CDNA synthesis kit User Manual Interest in any of the products request or order them at Bio Connect all Bio Connect B V T NL 31 0 26 326 4450 TBE 32 0 2 503 03 48 m m Begonialaan 3a F NL 31 0 26 326 4451 F BE 32 0 2 503 03 27 3 s 6851 TE Huissen E info bio connect nl N The Netherlands W www bio connect nl fa evrogen Mint 2 cDNA synthesis kit Cat SKOOS User manual PLEASE READ THE ENTIRE MANUAL BEFORE STARTING Contents Il III IV VI VII VIII IX X Intended USB wob w om se cea kok oa tad a Method overview o or Applications and adapters o Kit components and storage conditions IV A Listof kit components a a a IV B Reagents required but not included General considerations RNA requirements 0 00008 eee e ee ee CDNA preparation protocol 2 08 8 ee ae VILA First strand cDNA synthesis and PlugOligo incorporation VII B ds cDNA synthesis and amplification VII B 1 Evaluative PCR VII B 2 Full scale preparation of ds cDNA Recommendations for further processing of amplified ds cDNA Troubleshooting 2 eee References ss so Appendix A Recommendations for performing non de2. form extraction 1 with one variation all procedures should be performed at neutral pH instead of the acidic pH originally sug gested 3 Following RNA isolation RNA quality should be controlled using denaturing formaldehyde agarose gel electrophore SiS as described by Sambrook 4 Alternatively standard agarose ethidium bromide EtBr gel electrophoresis can be used to quickly estimate RNA quality see Appendix A for recom mendations on non denaturing agarose gel electrophoresis of RNA 2 The following characteristics indicate successful RNA preparation For mammalian total RNA two intensive bands at approximately 4 5 and 1 9 kb should be observed against a light smear These bands represent 28S and 18S rRNA The ratio of intensities of these bands should be about 1 5 2 5 1 Intact mammalian poly A RNA appears as a smear sized from 0 1 to 4 7 or more kb with faint 28S and 18S rRNA bands Normal smears of RNA from other sources plants insects yeast and amphibians usually do not exceed 2 3 kb on the non dena turing agarose gel Moreover many invertebrates have 28S rRNA Mint 2 cDNA synthesis kit VI RNA requirements with a so called hidden break 2 In some organisms the inter action between the parts of 28S rRNA is rather weak so the total RNA preparation exhibits a single 18S like rRNA band even on a non denaturing gel In other species the 28S rRNA is more ro bust so it is still visible as a second ban
3. heat the RNA samples at 65 C for 1 2 min mix the contents by gently flicking the tube to prevent RNA aggregation and then spin the tube briefly in a microcentrifuge 2 For each RNA sample combine the following reagents in a sterile PCR tube 3 uL RNA solution in Sterile RNase free water 1 2 ug of total RNA or 0 5 1 ug of poly A RNA For the control reaction use 3 uL of the control RNA 1 ul CDS Adapter 10 uM 1 uL PlugOligo Adapter 10 uM 9 uL Total volume See Section Ill Applications and adapters to choose the adapter pair suitable for your task 3 Gently pipette the reaction mixtures and spin the tubes briefly in a microcentrifuge If the utilized thermal cycler is not equipped with a heated lid overlay each reaction with a drop of molecular biology grade mineral oil to prevent the loss of volume due to evaporation 10 Mint 2 cDNA synthesis kit 10 VII cDNA preparation protocol Incubate the mixture in a thermal cycler at 70 C for 2 min use heated lid Decrease the incubation temperature to 42 C Keep the tubes in the thermal cycler at 42 C while preparing the RT master mix 1 to 3 min While steps 4 and 5 are ongoing prepare an RI master mix for each reaction tube by combining the following reagents in the or der shown 2 uL 5X First strand buffer 1 uL DTT 20 mM 1 uL dNTP 10 mM each 1 uL Mint reverse transcriptase 9 uL Total volume Note Optionally 0 5 uL of
4. 159 pmid 2440339 H Ishikawa 1977 Evolution of ribosomal RNA Comp Biochem Physiol B 58 1 1 7 pmid 400949 M V Matz 2002 Amplification of representative cDNA samples from microscopic amounts of invertebrate tissue to search for new genes Methods Mol Biol 183 3 18 pmid 12136765 J Sambrook E F Fritsch and T Maniatis Molecular Cloning A Lab oratory Manual 2nd edition Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 1989 W M Schmidt and M W Mueller 1999 CapSelect a highly sen sitive method for 5 CAP dependent enrichment of full length cDNA in PCR mediated analysis of mRNAs Nucleic Acids Res 27 21 e31 pmid 10518626 Mint 2 cDNA synthesis kit Appendix A Appendixes Appendix A Recommendations for performing non denaturing agarose gel electrophoresis of RNA 1 The following gel electrophoresis conditions are recommended e use 1X TAE buffer instead of 1X TBE e use agarose gel in the concentration of 1 1 1 2 e add ethidium bromide EtBr to the gel and electrophoresis buffer to avoid the additional potentially RNAse prone step of gel stain ing e always use fresh gel and buffer as well as clean electrophoresis equipment for RNA analysis Wear gloves to protect RNA samples from degradation by nucleases and avoid a hand contact with EtBr use running voltage up to 10 V cm 10 V per each cm of space between the electrodes in electrophoretic cha
5. 29 VN 3 CDS 4M adapter 10 uM 25 uL 5 AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCC T 4G T 6 C T 413 VN 3 Shipping amp Storage Encyclo polymerase mix Mint reverse transcriptase PlugOligo adapters and control RNA are shipped at 20 C or below All other components of the kit can be shipped at ambient temperature Upon arrival the kit must be stored at 20 C IV B Reagents required but not included Biology grade mineral oil RNase inhibitor 20 U uL Ambion optional Agarose gel electrophoresis reagents DNA size markers 1 kb DNA ladder QlAquick PCR purification kit Cat 28104 or 28106 QIAGEN Inc Mint 2 cDNA synthesis kit V General considerations V General considerations Wear gloves to protect RNA and cDNA samples from degradation by nucleases If possible perform cDNA synthesis PCR reaction preparation and post PCR analysis in separate laboratory areas to avoid cross con tamination of samples Use PCR pipette tips containing hydrophobic filters to minimize con tamination We recommend that you perform a positive control cDNA synthesis from the total RNA provided in the kit in parallel with your experiment This control is performed to verify that all components are working properly After the solution is just thawed we strongly recommend that you mix it by gently flicking the tube then spin the tube briefly in a microcent rifuge to deposit contents at the bottom before use Add enzyme
6. 7 Analyze 4 uL aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration Digestion of ds cDNA with Sfil restriction endonuclease 8 For each cDNA sample from step 6 above combine the following reagents in a sterile 0 5 ml tube 44 uL Amplified ds cDNA from step 6 5 uL 10X reaction buffer 1 uL Sfil restriction endonuclease 10 20 U SO uL Total volume 9 Incubate the tubes for 3 h at 50 C 10 After digestion purify cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water The resulting ds cDNA can be applied for ABI SOLiD or Illumina Solexa sequencing Please contact your sequencing facility for further instruction on ds cDNA processing 26 Mint 2 cDNA synthesis kit Appendix D Appendix D Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before Roche 454 sequencing Reagents required e Amplified ds cDNA from step 24 of the protocol flanked by Plug Oligo 3M and CDS 4M adapter sequences e Encyclo PCR Kit Evrogen Cat 4 PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder cDNA amplification 1 Combine 2 uL of the ds cDNA from step 24 of the protocol with 78 uL of sterile RNase free water in a n
7. RNase inhibitor 20 U uL can be added to the reaction to prevent RNA degradation during cDNA synthesis Gently pipette the RT master mix and spin the tube briefly in a mic rocentrifuge Add 5 uL RT master mix to each reaction tube from step 5 Gently pipette the reaction mix and spin the tubes briefly in a microcentri fuge to deposit contents at the bottom Note Do not remove the reaction tubes from the thermal cycler ex cept for the time necessary to add the RT master mix Incubate the tubes at 42 C for 30 min and then proceed immedi ately to step 10 Add 5 uL IP solution to each reaction tube mix by gently pipetting if required spin the tubes briefly in a microcentrifuge and incubate for 1 5 hat 42 C Note Do not remove the reaction tubes from the thermal cycler ex cept for the time necessary to add IP solution www evrogen com aa VII cDNA preparation protocol 11 After incubation place the tubes on ice to terminate the first strand CDNA synthesis Note Brown sediment may be generated in the reaction s It does not affect following procedures First strand cDNA can be stored at 20 C for up to one month and used for ds cDNA synthesis and amplification Section VII B VII B ds cDNA synthesis and amplification Important note Use of the optimal number of PCR cycles ensures that the ds cDNA re mains in the exponential phase of amplification PCR overcycling yields nonspecific PCR products
8. and is extremely undesirable for many applica tions PCR undercycling results in a lower yield of PCR product The optimal number of PCR cycles must be determined individually for each experimental sample This protocol includes the procedure of evaluative PCR in a small reaction volume to determine the optimal number of PCR cycles section VII B 1 and subsequent full scale preparation of ds cDNA section VII B 2 VII B 1 Evaluative PCR 12 For each first strand cDNA sample from step 11 prepare a PCR mix ture by combining the following reagents in the order shown 80 uL Sterile RNase free water 10 uL 10X Encyclo buffer 2 ul dNTP mix 10 mM each 4 uL PCR primer M1 10 uM 2 ul First strand cDNA from step 11 2 uL 50X Encyclo polymerase mix 100 uL Total volume gt Note lf the first strand cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining first strand cDNA at 20 C fizi Mint 2 cDNA synthesis kit 13 14 115 16 17 18 VII cDNA preparation protocol Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge Aliquot 24 uL into four 0 2 ml PCR tubes Label the tubes as lt S gt 1 lt S gt 2 lt S gt 3 and lt S gt 4 wherein lt S gt is a sample identifier Note Four tubes containing 24 uL of the PCR mixture should be prepared for each first strand cDNA sample O
9. decrease the prevalence of cDNA representing abundant transcripts CDNA normalization should be performed before further processing of am plified ds cDNA Refer to the Evrogen Trimmer kit user manuals for further instructions on use of amplified ds cDNA from step 24 of the protocol for normalization www evrogen com IX Troubleshooting IX Troubleshooting Agarose gel electrophoresis of PCR products obtained from both control and experimental RNA samples reveals low molecular weight products poor yield or no products Possible cause RNA may have degraded during storage and or first strand cDNA synthesis Electrophoresis data might be incorrect because amplified cDNA was frozen before electrophoresis You may have made an error during the procedure such as omitting an essential component If the PCR reaches its plateau after 25 or more cycles the PCR conditions may not be optimal The optimal number of PCR cycles may vary with different PCR machines and RNA templates Some reagents do not work properly Solution Use gel electrophoresis to estimate the concen tration and quality of the RNA If RNA degradation during cDNA synthesis is sus pected add 0 5 uL RNase inhibitor 20 u ul Ambion to the first strand synthesis reaction Check that your work area equipment and solu tions are free from RNase contamination lf amplified samples are frozen before elec trophoresis heat them at 72 C for 2 m
10. kept to a minimum which improves the quality of the resulting cDNA Applications 5 end adapter 3 end adapter e Directional cloning of cDNA library PlugOligo 3M CDS 4M e SOLID or Illumina Sequencing e cDNA normalization followed by directional cloning of normalized cDNA library for functional screenings or SOLID and Illumina sequencing Commentary The adapters contain asymmetric sites for Sfil restriction SfiA and SfiB Fig 2 Being incorporated at the 5 and 3 ends of the cDNA the sites allow directional cloning of the cDNA library After digestion with Sfil restriction endonuclease and size fractionation synthesized cDNA can be ligated into an appropriate Sfil digested vector Since Sfil digestion cuts off the excessive parts of flanking adapters it also makes the resulting cDNA perfectly suitable for SOLID or Illumina Sequencing www evrogen com III Applications and adapters Applications 5 end adapter 3 end adapter e Roche 454 sequencing PlugOligo 3M CDS 4M or e cDNA normalization followed by CDS Gsu Roche 454 sequencing Commentary The presence of long poly A T tails in cDNA may result in sequencing reads of low quality when using Roche 454 sequencing platform The Mint 2 kit con tains two alternative 3 end adapters designed to overcome this problem CDS 4M adapter contains a poly T part built of thymidines interspersed with other nucleotides The adapter works well for cDNA synthesis and
11. the very high complexity of the starting RNA to be continued Mint 2 cDNA synthesis kit IX Troubleshooting Possible cause Solution The 72 C elongation step Concatemers may be confirmed by cDNA se may be too long An quencing If this is the case repeat the cDNA extended elongation may synthesis using modified PCR parameters in promote concatemerization which the 72 C elongation step is decreased by of the cDNA adapter up to 2 min sequences The gel running parameters Attempt to improve your electrophoretic results may alter band visibility by testing the use of the following 1X TAE buffer instead of 1X TBE a gel concentration of 1 1 1 5 agarose and a running voltage up to 10 V cm 10 V per each cm of space between the electrodes in the electrophoretic chamber lf amplified samples were frozen before elec trophoresis heat them at 72 C for 2 min and mix before loading onto the agarose gel Fig 5 Result of agarose gel electrophoresis of cDNA that has been PCR amplified using a too long extension step 6 min No bright bands are visible and a smear starting from the high molecular weight region of the gel is shown Lane M 1 kb DNA ladder www evrogen com 21 X References X 1 2 3 4 9 References P Chomczynski and N Sacchi 1987 Single step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform ex traction Anal Biochem 162 1 156
12. three additional PCR cycles plus one extra final extension cycle and recheck the products If a low yield of PCR product is still observed this could indicate a low yield of first strand cDNA Repeat the experiment using more RNA Note Wedo not recommend that you use cDNA samples obtained after more than 25 PCR cycles because these samples may be not representative Even if the total RNA concentration appears ac ceptable based on spectrophotometric analysis a high content of tRNA may result in the mis es timation of the MRNA concentration If you have not already done so use denaturing formalde hyde agarose gel electrophoresis to estimate the concentration and quality of your RNA If there is a high tRNA content remove the low molecular weight RNA fraction using RNA purifi cation columns Following agarose gel electrophoresis the PCR product is visualized as a very intense smear none of the expected bright bands are distinguishable see Fig 5 for an example of this and or the smear appears in the high molecular weight region of the gel Possible cause If bands are expected but not visible and the background smear is very intense PCR overcycling may be an issue Solution Repeat the PCR amplification with a fresh first strand cDNA sample using two or three fewer PCR cycles Please note that cDNA prepared from some mammalian tissues e g human brain spleen and thymus may not show bright bands due to
13. C MGGGG yey a oo KAA e IP solution Din AAAA lt Zn wer ms _ cicicie Pi AAAA MA One ds cDNA preparation by PCR PCR primer M1 Po Boia AAAAT E TMC TIU Amplified cDNA Intended downstream application Fig 1 Schematic outline of Mint 2 cDNA synthesis The rectangles represent the adapter and primer sequences and their complements Within the rectangles grey in dicates the common external parts of the adapters while black and white correspond to the internal parts that differ between the 3 end and 5 end adapters 2 Mint 2 cDNA synthesis kit III Applications and adapters Ill Applications and adapters Mint 2 cDNA synthesis kit contains different PlugOligo and CDS adapters allowing synthesis of cDNA with different flanking sequences The choice of the adapter pair to use for a particular cDNA preparation depends on intended application Please refer to the section below to choose the pair of adapters suitable for your needs Applications 5 end adapter 3 end adapter e Non directional cDNA library cloning PlugOligo 1 CDS 1 e Sanger sequencing e Isolation of full length cDNAs RACE e cDNA normalization followed by non directional cloning of normalized CDNA library and or Sanger sequencing Commentary The adapters contain extensive common parts and Rsal restriction sites They allow synthesis of cDNA flanked by identical sequences at 3 and 5 ends The length of the adapters is
14. DNA at 20 C 2 Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge 3 Aliquot 50 uL of PCR mixture into five sterile 0 2 ml PCR tubes If the thermal cycler used is not equipped with a heated lid overlay www evrogen com 29 Appendix E each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler 4 Subject the tubes to PCR cycling using the following program Initial denaturation 1 cycle 95 C 1 min Cycling 6 cycles 95 C 15 sec 66 C 20 sec 2 C 3 min 5 When cycling is complete pool the reaction mixtures from all five tubes into a new sterile tube 6 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water 7 Analyze 4 uL aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to check cDNA quality and concentration Digestion of the ds cDNA with Gsul restriction endonuclease 9 For each cDNA sample from step 6 above combine the following reagents in a sterile 0 5 ml tube 43 ul Amplified ds cDNA step 6 of this appendix 5 uL 10X Reaction buffer 2 uL Gsul restriction endonuclease 10 U SO uL Total volume 10 Incubate the tubes for 3 h at 30 C 11 After digestion purify ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water The resulting ds cDNA is suita
15. T sequence that anneals to poly A stretches of RNA When Mint RT reaches the 5 end of the mRNA it adds several non tem plate nucleotides primarily deoxycytidines to the 3 end of the newly synthesized first strand cDNA 5 This oligo dC stretch base pairs to complementary oligo dG sequence located at the 3 end of a special deoxyribooligonucleotide adapter called PlugOligo Mint RT identifies PlugOligo as an extra part of the RNA template and continues first strand cDNA synthesis to the end of the oligonucleotide thus incorpo rating PlugOligo sequence into the 5 end of cDNA The last 3 dG residue of the PlugOligo is a terminator nucleotide con taining a 3 phosphate group This blocking group prevents unwanted extension of the PlugOligo Under standard conditions Mint RT can hardly use PlugOligo as a template however a specially tailored P so lution solution for Incorporation of PlugOligo sequence dramatically increases the efficiency of this process At the final step ds cDNA is amplified by PCR Use of Encyclo poly merase and specially designed primers allows synthesis of full length enriched cDNA that is flanked by PlugOligo and CDS adapter se quences www evrogen com En li Method overview RNA AAAA First strand cDNA synthesis 3 end CDS adapter TTT n AAAA lt gt TT Mint RT AAAA CCC ATT TTT LT lt 5 end PlugOligo adapter PlugOligo Incorporation DEN T
16. action with a drop of mineral oil Close the tubes and place them into a thermal cycler www evrogen com 18 VII cDNA preparation protocol 23 Subject the tubes to PCR cycling using the following program Initial denaturation 1 cycle 95 C 1 min Cycling X cycles 95 C 15 sec 66 C 20 sec 12 C 3 min Final extension 1 cycle 66 C 20 sec 12 C 3 min X is the optimal number of PCR cycles determined in steps 18 19 24 When cycling is complete immediately proceed with purification of the amplified ds cDNA to remove primer excess dNTPs salts and enzymes using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water 25 Analyze 4 uL aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder and a 4 pL aliquot of the Control cDNA sample on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration Now you have obtained amplified ds cDNA The resulting amount of ds cDNA per reaction is anticipated to be in a range of 0 75 1 35 ug In general this amount of ds cDNA is sufficient for such downstream applications such as directional or non directional cloning of cDNA libraries subtractive hybridization and cDNA normalization using Evrogen Trimmer kits If the ds cDNA is prepared for direct application in next generation sequenc ing we recommend performing additional re amplification of ds cDNA in order to obtain higher amounts of the product Please refer
17. after 15 cycles lane 2 after 18 cycles lane 3 after 21 cycles lane 4 after 24 cycles C control CDNA sample M 1 kb DNA ladder SibEn zyme After 21 cycles a smear appeared in the high molecular weight region of the gel indicat ing that the reaction is overcycled Because the plateau was reached after 20 cycles the opti mal cycle number for this experiment is 18 19 JEN IT PCR cycles of the expected size distribution with several bright bands corre sponding to abundant transcripts In general for most mammalian tissues a visible smear of full length enriched cDNA should be within the range of 0 5 7 kb while normal cDNA size for many non mammalian species is less than 3 kb Fig 4 e If the cDNA smear appears in the high molecular weight region of the gel especially if no bright bands are distinguishable e g as Fig 3 lane 4 PCR overcycling may be an issue see Troubleshoot ing Section IX e f the smear is faint Fig 3 lane 1 this indicates that too few PCR cycles were used for amplification In the case of PCR undercycling in all lt S gt 1 lt S gt 4 samples subject the samples to two or three more cycles and repeat steps 17 18 The representative abundances of the resulting amplified cDNA pop ulation and the number of PCR cycles required to amplify the cDNA to about 5 10 ng L i e a level that is visible on an agarose EtBr gel strongly depend on the initial number of tar
18. aliquots of each ds cDNA sample alongside 0 1 ug of 1 kb DNA ladder on a 1 5 w v agarose EtBr gel run in 1X TAE buffer to estimate cDNA quality and concentration The resulting ds cDNA is suitable for Roche 454 sequencing Please con tact your sequencing facility for further instruction on ds cDNA processing 28 Mint 2 cDNA synthesis kit Appendix E Appendix E Processing of ds cDNA flanked with PlugOligo 3M and CDS Gsu adapters before Roche 454 sequencing Reagents required e Amplified ds cDNA from step 24 of the protocol flanked at 3 end with an adapter sequence containing a Gsul site e Gsul restriction endonuclease supplied with 10X reaction buffer e Encyclo PCR Kit Evrogen Cat PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder Amplification of ds cDNA 1 For each cDNA sample from step 24 of the protocol prepare PCR mixture combining the following reagents in the order shown 200 uL Sterile RNase free water 25 uL 10X Encyclo buffer 5 uL dNTP mix 10 uL PCR primer M1 5 uL Amplified ds cDNA from step 24 of the protocol 5 uL 50X Encyclo polymerase mix 250 uL Total volume Note If the amplified ds cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining ds c
19. allows 454 sequencing through the modified poly A T tails of cDNA CDS Gsu adapter contains a Gsul recognition site Fig 2 just upstream of the unmod ified poly T sequence Gsul is a type Il restriction enzyme that cuts cDNA within the poly A tail reducing its length so that all subsequent sequences start with a shorter run of thymidines Both CDS 4M and CDS Gsu adapters allow synthesis of cDNA suitable for Roche 454 sequencing The choice of a particular adapter should be made by the end user Use of CDS 4M adapter does not require an additional digestion step before cDNA sequenc ing however even modified poly A T tails of cDNA may affect the sequence quality on some Roche 454 platforms cDNA prepared with CDS Gsu adapter and digested by Gsul enzyme contains shorter poly A T tails that do not harm sequencing However cDNAs containing intrinsic Gsul recognition sites will be digested as well potentially resulting in difficulties with contig assembly SfilA site S SfilB site 5 GGCCATTACGGCC 3 5 GGCCGCCTCGGCC 3 3 CCGGTAATGCCGG 5 3 CCGGCGGAGCCGG 5 Gsul site V 9 CIGGAG N 16 3 3 GACCTC N 14 zj Fig 2 Sfil and Gsul recognition sites a Mint 2 cDNA synthesis kit IV Kit components and storage conditions IV Kit components and storage conditions IV A List of kit components Mint 2 cDNA synthesis kit provides components for 20 reactions of ds cDNA synthes
20. ble for Roche 454 sequencing Please con tact your sequencing facility for further instruction on ds cDNA processing 30 Mint 2 cDNA synthesis kit For notes www evrogen com Mint 2 cDNA synthesis kit Endnotes This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use Evrogen products may not be resold modified for resale or used to manufacture commercial products without written approval of Evrogen PCR is the subject of patents issued in certain countries The purchase of this product does not include a license to perform PCR However many researchers may not be re quired to obtain a license Other investigators may already have a license to perform PCR through use of a thermal cycler with the appropriate label license Material safety data sheet information EVROGEN JSC Moscow Russia hereby confirms that to the best of our knowledge this product does not require a Material Safety Data Sheet However all of the properties of this product and if applicable each of its components have not been thoroughly inves tigated Therefore we recommend that you use gloves and eye protection and wear a laboratory coat when working with this product ver June 10 2011 www evrogen com 33 Evrogen JSC Miklukho Maklaya str 16 10 117997 Moscow Russia Tel 7 495 988 4084 Fax 7 495 988 4085 www evrogen com
21. d gt Note Jf experimental RNA is shorter than expected and or degraded according to electrophoresis data prepare fresh RNA after checking the quality of RNA purification reagents If problems persist you may need to find another source of tissue cells In some cases partially degraded RNA is only available e g tumor samples or hard treated tissues This RNA can be used for cDNA preparation however the cDNA sample will contain a reduced number of full length molecules In general genomic DNA contamination does not affect cDNA synthesis meaning that DNase treatment is not usually required When necessary excess genomic DNA can be removed by LiCl precipitation or phenol chloroform extraction www evrogen com 9 VII cDNA preparation protocol VII cDNA preparation protocol PLEASE READ THE ENTIRE PROTOCOL BEFORE STARTING Important notes Before you begin the first cDNA synthesis procedure shake all solutions and spin the tubes briefly in a microcentrifuge To verify that all kit components are working properly perform a positive control cDNA synthesis with human RNA provided in the kit in parallel with the experimental samples VII A First strand cDNA synthesis and PlugOligo incorporation Note During the first strand cDNA synthesis the use of a thermal cycler for incubation steps is recommended Using the air thermostat may require additional optimization 1 Immediately before taking the aliquot for the cDNA synthesis
22. ds cDNA with Sfil restriction endonuclease 1 For each cDNA sample from step 24 of the protocol combine the following reagents in a sterile 0 5 ml tube 44 uL Amplified ds cDNA from step 24 of the protocol 5 uL 10X Reaction buffer 1 uL Sfil restriction endonuclease 10 20 U SO uL Total volume Note Mix the tubes with amplified cDNA by gently flicking before taking aliquots Store the remaining ds cDNA at 20 C 2 Incubate the tubes for 3 h at 50 C 3 After digestion purify cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water 4 Optional To enrich the cDNA samples with full length sequences perform size selection of large cDNA molecules gt 1350 bp using CHROMASPIN 1000 The resulting ds cDNA can be used for directional cloning into vectors containing asymmetric Sfil A and Sfil B sites for example pDNR LIB or pTriplEx2 vectors from Clontech linearized using Sfil restriction endonu clease 24 Mint 2 cDNA synthesis kit Appendix C Appendix C Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before SOLID or Illumina sequencing Reagents required e Amplified ds cDNA from step 24 of the protocol flanked by adapter sequences containing asymmetric Sfil A and Sfil B sites e Sfil restriction endonuclease supplied with 10X reaction buffer e Encyclo PCR Kit Evrogen Cat 4 PKOO1 or analogues e QlAquick PCR Purification Kit Qiagen e Ster
23. ew sterile 0 2 ml tube Mix the contents by gently flicking the tube Spin the tube briefly in a micro centrifuge gt Note If the amplified ds cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining ds cDNA at 20 C 2 For each cDNA sample from step 1 above prepare PCR mixture combining the following reagents in the order shown 195 uL Sterile RNase free water 25 uL 10X Encyclo buffer 5 uL dNTP mix 10 uL 454 PCR primer mix 10 uL ds cDNA from step 1 above 5 uL 50X Encyclo polymerase mix 250 uL Total volume 3 Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge www evrogen com Ea Appendix D 4 Aliquot 50 uL of PCR mixture into five sterile 0 2 ml PCR tubes 5 If the thermal cycler used is not equipped with a heated lid overlay each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler 6 Subject the tubes to PCR cycling using the following program Initial denaturation 1 cycle 95 C 1 min Cycling 3 cycles 95 C 15 sec 50 C 20 sec 12 C 3 min 10 13 95 C 15 sec cycles 63 C 20 sec 12 C 3 min T When cycling is complete pool the reaction mixtures from all five tubes into a new sterile tube 8 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water 9 Analyze 4 uL
24. get DNA molecules used for PCR amplification If the cDNA amplification requires more than 26 PCR cycles the cDNA may not contain rare transcripts If no PCR product is observed or the product is low yield after 25 cycles see Troubleshooting Section IX Mint 2 cDNA synthesis kit VII cDNA preparation protocol Fig 4 Agarose gel elect rophoresis of Mint 2 amp lified cDNA from differ ent sources 1 mouse liver 2 mouse skele tal muscle 3 mouse brain 4 human leuco cytes 5 human lung 6 human skeletal muscle T mosquito grub 8 copepod Pontella sp 9 tomato Lycopersicon escu lentum M 1 kb DNA ladder SibEnzyme VII B 2 Full scale preparation of ds cDNA 20 For each first strand cDNA sample from step 11 prepare a PCR mix ture by combining the following reagents in the order shown 40 uL Sterile RNase free water 9 uL 10X Encyclo buffer 1 ul dNTP mix 10 mM each 2 uL PCR primer M1 10 uM 1 ul First strand cDNA from step 11 1 ul 50X Encyclo polymerase mix SO LLL Total volume gt Note If the first strand cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining first strand cDNA at 20 C 21 Mix the contents by gently flicking the tubes Spin the tubes briefly in a microcentrifuge 22 If the thermal cycler used is not equipped with a heated lid overlay each re
25. ile molecular biology grade water sterile RNase free water e Agarose gel electrophoresis reagents e DNA size markers 1 kb DNA ladder Amplification of ds cDNA 1 For each cDNA sample from step 24 of the protocol prepare PCR mixture combining the following reagents in the order shown 200 uL Sterile RNase free water 25 uL 10X Encyclo buffer 5 uL dNTP mix 10 uL PCR primer M1 5 uL Amplified ds cDNA from step 24 of the protocol 5 uL 50X Encyclo polymerase mix 250 uL Total volume Note If the amplified ds cDNA samples were stored at 20 C pre heat them at 65 C for 1 min then mix by gently flicking the tubes before taking aliquots Store the remaining ds cDNA at 20 C 2 Mix the contents by gently flicking the tube Spin the tube briefly in a microcentrifuge 3 Aliquot 50 uL of PCR mixture into five sterile 0 2 ml PCR tubes If the thermal cycler used is not equipped with a heated lid overlay www evrogen com 25 Appendix C each reaction with a drop of mineral oil Close the tubes and place them into a thermal cycler 4 Subject the tubes to PCR cycling using the following program Initial denaturation 1 cycle 95 C 1 min Cycling 6 cycles 95 C 15 sec 66 C 20 sec 2 C 3 min 5 When cycling is complete pool the reaction mixtures from all five tubes into a new sterile tube 6 Purify the amplified ds cDNA using QlAquick PCR Purification Kit Elute ds cDNA with 50 uL of sterile RNase free water
26. in and mix before loading onto the agarose gel Carefully check the protocol and repeat the first strand synthesis and PCR One typical mis take is not mixing the RNA samples thoroughly after defrosting We recommend that you heat the RNA samples 65 C for 2 3 min prior to aliquotting Optimize the PCR parameters and repeat the PCR using a fresh aliquot of first strand cDNA Optimization of PCR parameters may include a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments Contact Evrogen technical support customer support evrogen com Mint 2 cDNA synthesis kit IX Troubleshooting Agarose gel electrophoresis of PCR products obtained from experimental RNA reveals low molecular weight products poor yield or no products while high quality PCR product is generated from the control RNA Possible cause The experimental RNA may be degraded e g due to RNase contamination or too diluted The RNA may contain impurities that inhibit cDNA synthesis If the PCR reaches its plateau after 25 or more cycles the PCR conditions may not be optimal The optimal number of PCR cycles may vary with different PCR machines and RNA templates Solution Use gel electrophoresis to estimate the concen tration and quality of the RNA Then check the Stabil
27. is The kit is supplied with adapters that allow synthe sis of CDNA with different flanking sequences The choice of adapters to use for a particular cDNA preparation depends on the intended ap plication Please refer to the section III Applications and adapters to choose the pair of adapters suitable for your needs Package of the kit includes a free sample of Mint reverse tran scriptase for first strand cDNA synthesis and a free Encyclo PCR kit Cat PKOO1 Component Amount 5X First strand buffer 80 uL DTT 20mM 30 uL dNTP mix 10mM each 120 uL Mint reverse transcriptase 20 pL IP solution 130 uL 50X Encyclo polymerase mix 100 uL 10X Encyclo buffer 600 uL PCR primer M1 10 uM 150 uL 5 AAGCAGTGGTATCAACGCAGAGT S 454 PCR Primer mix 10 uM each 100 uL 5 CAACGCAGAGTGGCCATTAC 3 5 ACGCAGAGT GGCCGAGGCGGCCTTTTGTCTTTTCTICTGTTTCTITT 3 Sterile RNase free water 2x1 8 ml Control total RNA template 0 35 ug uL SO uL to be continued www evrogen com 5 IV Kit components and storage conditions Component Amount Control cDNA sample for electrophoresis 25 uL 5 end PlugOligo adapters PlugOligo 1 adapter 15 uM 25 uL 5 AAGCAGTGGTATCAACGCAGAGTACGGGGG 3 PlugOligo 3M adapter 15 uM 25 uL 5 AAGCAGTGGTATCAACGCAGAGTGGCCAT TACGGCCGGGGG 3 3 end CDS adapters CDS 1 adapter 10 uM 5 AAGCAGTGGTATCAACGCAGAGTAC T 30VN 3 CDS Gsu adapter 10 uM 25 pL 5 AAGCAGTGGTATCAACGCAGAGTACTGGAG T
28. ity of the RNA by incubating a small aliquot in water for 1 hr at 42 C and running it on a dena turing formaldehyde agarose gel alongside an unincubated aliquot If the RNA is degraded during the incubation repeat the experiment using a fresh lot or prepa ration of RNA Perform several rounds of phe nol chloroform extraction as this can consider ably increase RNA stability If RNA degradation during cDNA synthesis is sus pected add 0 5 uL RNase inhibitor 20 U ul Ambion to the first strand synthesis reaction Check that your work area equipment and so lutions are free from RNase contamination In some cases ethanol or LiCl precipitation of RNA can remove impurities If this does not help re isolate the RNA using another method Optimize the PCR parameters and repeat the PCR using a fresh aliquot of first strand cDNA Optimization of PCR parameters may include a decreasing the annealing temperature in in crements of 2 4 C b optimizing the denaturation temperature by decreasing or increasing it in 1 C increments and or c increasing the extension time in 1 min increments www evrogen com IX Troubleshooting Agarose gel electrophoresis reveals that the concentration of the PCR product is low but the quality is good Possible cause PCR undercycling may have resulted in a low yield of PCR product The starting RNA concentration may have been low Solution Subject the samples to two or
29. mber Do not use high voltage to avoid RNA degradation during electrophoresis 2 Heat an aliquot of the RNA solution at 70 C for 1 min and place it on ice before loading on a gel 3 Load a known amount of DNA or RNA ladder alongside your RNA sample as a standard for determining the RNA concentration RNA concentration can be roughly estimated assuming that the effi ciency of EtBr incorporation in rRNA is the same as for DNA the ribosomal RNA may be considered a double stranded molecule due to its extensive secondary structure 4 The first sign of RNA degradation on the non denaturing gel is a slight smear starting from the rRNA bands and extending to the area of shorter fragments RNA showing this extent of degrada tion is still good for further procedures However if the downward smearing is So pronounced that the rRNA bands do not have a dis cernible lower edge this RNA should be discarded www evrogen com 25 Appendix B Appendix B Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before directional cloning Reagents required e Amplified ds cDNA from step 24 of the protocol flanked by adapter sequences containing asymmetric Sfil A and Sfil B sites e Sfil restriction endonuclease supplied with 10X reaction buffer e QlAquick PCR Purification Kit Qiagen e Sterile molecular biology grade water sterile RNase free water e CHROMASPIN 1000 columns Clontech or analogues optional Digestion of
30. naturing agarose gel electrophoresis of RNA Appendix B Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before directional cloning Appendix C Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before SOLID or Illumina sequencing Appendix D Processing of ds cDNA flanked with PlugOligo 3M and CDS 4M adapters before Roche 454 sequencing Appendix E Processing of ds cDNA flanked with PlugOligo 3M and CDS Gsu adapters before Roche 454 sequencing Endnotes ss ss nn non 23 24 25 21 29 33 For important information about the use of the Mint 2 kit please see the ENDNOTES at the end of this User Manual Intended use Intended use Mint 2 cDNA synthesis kit is designed to synthesize full length en riched double stranded ds cDNA from total or poly A RNA Synthe sized CDNA can be used in various applications including construction of cDNA libraries subtractive hybridization SSH cDNA normaliza tion using Evrogen Trimmer kits high throughput sequencing on the next generation sequencing platforms Roche 454 ABI SOLID or IIlu mina Solexa and other applications ll Method overview Mint 2 cDNA synthesis kit utilizes the specific features of Mint reverse transcriptase Mint RT The cDNA synthesis procedure is illustrated in Fig 1 First strand cDNA synthesis starts from the 3 end CDS adapter con taining an oligo d
31. to section VIII Recommendations for further processing of amplified ds cDNA to choose the protocol for further processing of amplified ds cDNA before use in intended downstream applications This amplified ds cDNA can be stored at 20 C for up to three months 16 Mint 2 cDNA synthesis kit VIII Recommendations for further processing of amplified ds cDNA VIII amplified ds cDNA Recommendations for further processing of Adapter pair used for ds cDNA preparation Intended application Recommendations PlugOligo 1 and CDS 1 adapters Non directional cDNA library cloning and Sanger sequencing TA cloning vectors can be used for non directional cloning of cDNA library The plasmid DNA isolated from individual clones can be used for Sanger sequencing Isolation of full length cDNAs RACE See Clontech SMARTer RACE CDNA Amplification Kit user manual Cat PT4096 1 Subtractive Hybridization SSH See Clontech SMARTer PCR cDNA Synthesis Kit user manual Cat PT409 7 1 Protocol for PCR Select cDNA Subtraction PlugOligo 3M and CDS 4M adapters PlugOligo 1 and CDS Gsu adapters Directional cDNA library cloning see Appendix B SOLID or Illumina sequencing see Appendix C Roche 454 sequencing Roche 454 sequencing see Appendix D see Appendix E CDNA normalization using Evrogen Trimmer kits is recommended before library con struction or sequencing to
32. to the reaction mixture last and thoroughly mix it by gen tly pipetting the reaction mixture up and down Do not increase the amount of enzymes added or concentration of RNA and cDNA in the reactions The amounts and concentrations have been carefully opti mized Thin wall PCR tubes are recommended These PCR tubes are opti mized to ensure more efficient heat transfer and to maximize ther mal cycling performance We recommend that you use 0 2 ml PCR tubes rather than 0 5 ml ones PCR cycling parameters in the protocol are optimized for an MJ Research PTC 200 DNA Machine Please note that the optimal pa rameters may vary when different thermal cyclers and templates are used www evrogen com hal VI RNA requirements VI RNA requirements 1 The sequence complexity and average length of the cDNA obtained largely depend on the quality and amount of the starting RNA mate rial used to prepare the cDNA For best results 1 2 ug of total RNA or 0 5 1 ug of poly A RNA should be used at the beginning of first strand cDNA synthe sis The minimum amount of starting RNA for cDNA synthesis is 250 ng of total RNA or 100 ng of poly A RNA The RNA may be isolated using a number of suitable methods that yield stable RNA preparations from most biological sources including the TRIzol method Gibco Life Technologies and the RNeasy kits Qiagen Total RNA can also be isolated by the well known method of guanidinium thiocyanate phenol chloro
33. verlay each reaction with a drop of mineral oil Note Because of the small reaction volume we recommend that you perform evaluative PCR under mineral oil even if you use a thermal cycler equipped with a heated lid Subject the tubes to PCR cycling using the following program Initial denaturation 1 cycle 95 C 1 min Cycling X cycles 95 C 15 sec 66 C 20 sec 12 C 3 min Final extension 1 cycle 66 C 20 sec 12 C 3 min X is anumber of cycles which is set as 15 for lt S gt 1 18 for lt S gt 2 21 for lt S gt 3 and 24 for lt S gt 4 tubes When cycling is complete analyze 4 uL of the PCR products along side 0 1 ug of 1 kb DNA ladder and 4 uL of Control cDNA sample on a 1 2 w v agarose EtBr gel run in 1X TAE buffer Determine the optimal number of cycles required for amplification of the cDNA as follows the optimal number of cycles should be one or two cycles less than that needed to reach the plateau For comparison Fig 3 shows the characteristic gel profiles of ampli fied cDNA synthesized on the basis of total human brain RNA after different numbers of PCR cycles e A typical electrophoresis result indicating an optimal number of PCR cycles should appear as a moderately strong cDNA smear www evrogen com 15 VII cDNA preparation protocol 19 Fig 3 A characteristic gel profile of ds cDNA synthesized from 1 ug of the control human brain total RNA following the Mint 2 proto col Lane 1 PCR product
Download Pdf Manuals
Related Search