OpArrayTM Protocol
Contents
1. In each AROS the wells A1 A2 B1 and B2 are null wells no synthesis is performed in these positions You may use these wells in a variety of ways Most researchers choose to leave them oligo free but they do add spotting buffer to the wells This serves two purposes the first allows a quick orientation of the scanned slide based on the empty well pattern and the second allows you to check if the spotting buffer may have been inadvertently contaminated or if the spotting pins have been rinsed insufficiently In these cases you ll experience fluorescence of the null wells Some AROS sets also contain the sequence opHsV04NC000001 TCAGTCGATCGCGACGTACGCTAGAACCTC This oligo will appear 4 times in each 384 well plate of the AROS set It provides rapid method for verifying the plate layout during the print run You may find these oligos useful for your experiments as negative controls Date 11 2 2009 OpArray Protocol Page 16 Review of Quality Control files for each Lot Number As an added feature to control the sources of variation within and among your experiments Microarrays Inc provides access to all the print and functional QC files for OpArrays The Print QC files a multiple work sheet Excel file is particularly useful for checking if a particular spot may yield suboptimal results because it did not print clearly in a specific lot Average OpArrays variation is typically between 0 1 and 0 2 variation in feature morphology QC2. Microarrays Inc OpArray Protocol When planning or preparing for an experiment please read through this protocol completely before proceeding When conducting your experiment remove only the OpArrays you plan to use immediately and immediately return the remaining OpArrays to the pouch leaving the desiccant pack in place For added protection OpArrays may be kept in their storage pouch in a desiccator OpArray Storage OpArrays are printed on epoxide slides pre processed and supplied ready to use o The microarray slides should be stored in their original container at room temperature in dry conditions preferably desiccated and protected from light o The slide box containing OpArrays is shipped in a re sealable storage pouch containing desiccant which is ideal for continued storage o Both the storage pouches and slide storage boxes are manufactured from materials that minimize out gassing and effectively block exposure to foreign contaminants that can elevate background levels in your experiments o When properly stored OpArrays will remain hybridization competent for 4 months or more Array Position on OpArray Slides OpArrays are printed on the same side as the barcode graphic to the right The array area is 18mm wide 54mm long and is located 8mm from the top of the slide barcode at bottom The size and location are compatible with standard 22mm x 60mm cover slips and other equipment for handling microarrays printe
3. First Strand cDNA Synthesis Materials 5 o O 0 0O Or O Aminoallyl Message Amp II kit Ambion Cat 1753 RNAase free tips tubes Refrigerated microcentrifuge DEPC treated H20 Thermocycler 100 ethanol Ice bucket Method Note The method described below is the recommended protocol by Ambion However we noticed that the reaction volume can be reduced by half without affecting the linearity of RNA amplification e g the reaction volume of the first strand synthesis can be reduced to 10 uL the reaction volume of second strand synthesis to 50 uL and aRNA amplification to 20 uL 25 26 Place up to 1 ug of total RNA if RNA is limited 100 500 ng is sufficient into an RNAase free microfuge tube Add 1 uL T7 Oligo dT Primer Note this is NOT the same as the Oligo dT primer used for total RNA target labeling Add DEPC treated H20 to a final volume of 12 uL Incubate for 5 minutes at 70 C in a thermocycler Centrifuge briefly 5 seconds to collect sample at bottom of tube Immediately transfer the tube to ice Prepare Reverse Transcription Master Mix It is prudent to include 5 overage to cover pipetting errors First Strand Reaction Mix Single Reaction Amount Component 2 uL 10X First Strand Buffer 1 uL Ribonuclease Inhibitor 4 uL dNTP Mix 1 ul Reverse Transcriptase 32 Mix well by gently pipetting up and down or flicking the tube a few times 33 Centrifuge briefly 5 seconds to collect this master
4. If NanoDrop is not available a spectrophotometer may be used to measure dye incorporation Incorporation for Cy5 is measured as its absorption at 650 nm and incorporation of Cy3 at 550 nm To calculate the amount of dye incorporated in your sample please use following web links http www pangloss com seidel Protocols percent_inc html http www prontosystems com technical_support calculator ResultsView Microarray Hybridization Materials o OpArray Hybridization Buffer kit OPHYB 1 o Microscope slide staining dish Ted Pella Cat 21078 1 or mBox Erie scientific Cat BX IM 20ERIE Microscope slide holders Ted Pella Cat 21078 10 mL disposable pipette Sterile measuring cylinder Extra deep Hybridization Cassette Telechem International Cat AHCXD LifterSlip Erie Scientific Company Cat 24X601 2 4733 50 mL Falcon tubes Incubator set to 42 C Boekel Shake N Bake Hybridization Oven Sterile diH20 O O O 00 0800 0 OpArrays are always printed on the same side as the barcode on the slide The array area is 18mm wide 54mm long and is located 9mm from the top of the slide barcode at bottom OpArray slides are supplied in a pre processed ready to use format Date 11 2 2009 OpArray Protocol Page 13 Pre Hybridization If you have a centrifuge equipped with a microplate centrifugation use mBox Erie scientific Cat BX IM 20ERIE or Microscope slide holder to dry the slides this will speed up the process and prod
5. aa aRNA from 2 pg of total RNA as starting material If the amplification is significantly less it is likely that either inhibitory contaminants present in the total RNA sample or there may have been partial degradation of the starting RNA sample or traces of washing buffer ethanol in the cDNA from step 60 Sample Preparation Prepare an aliquot for Bioanalyzer 5 uL of aRNA 150 200 ng uL concentration 86 87 88 89 Aliquot 4 ug aRNA in 1 5 mL microfuge tube if aRNA is limited as little as 1 ug should be enough Completely dry the sample using a Speedvac centrifuge set at 45 C or lower Store the remaining aRNAs samples at 80 C for further use aRNA Analysis using the Bioanalyzer Follow the procedure recommended by the manufacturer for analysis of the RNA samples In general 1 uL of RNA sample 100 200 ng uL is sufficient for analysis using a Nano chip x lt a Ss 5 h 4 000 20 200 Figure 3 Typical results of aRNA Analysis using the Bioanalyzer Date 11 2 2009 OpArray Protocol Page 9 Coupling of AA aRNA to the Cy Dye Ester Materials o o o o Cy3 Monoreactive dye Amersham Pharmacia Cat PA23001 Cy5 Monoreactive dye Amersham Pharmacia Cat PA25001 DMSO Sigma Cat D8418 Hydroxylamine Sigma Cat 159417 0 2 M Sodium Carbonate Buffer Note Typically the Sodium Bicarbonate Buffer is supplied with the Aminoal
6. at 12 000xg for 1 minute 123 Repeat the elution with an additional 20 uL of warm DEPC water 55 C Measure the amount of dye incorporated into aRNA using a NanoDrop or conventional spectrophotometer Estimation of Dye Incorporation Overview The Beer Lambert equation is used to correlate the calculated absorbance with concentration A E b c where A is the absorbance represented in absorbance units E is the wavelength dependent molar absorption coefficient or extinction coefficient with units of liter mol cm b is the path length in cm and c is the analyte concentration in moles liter or molarity M Dye Incorporation Use the table below to estimate the amount of dye incorporation The NanoDrop instrument contains built in software the Microarray Concentration module that uses the general form of the Beer Lambert equation to automatically calculate the fluorescent dye concentrations Table of Extinction Coefficients for Typical Dyes Used in Microarray Experiments Dye Type Extinction Coefficient liter mol cm Measurement Wavelength nm Cy3 150000 550 Cy5 250000 650 Alexa Fluor 488 71000 495 Alexa Fluor 546 104000 556 Alexa Fluor 555 150000 555 Alexa Fluor 594 73000 590 Alexa Fluor 647 239000 650 Alexa Fluor 660 132000 663 Cy3 5 150000 581 Cy5 5 250000 675 Date 11 2 2009 OpArray Protocol Page 12 Figure 4 Estimation of Cy3 and Cy5 incorporation into aRNA targets using the NanoDrop spectrophotometer Note
7. the dried aRNA sample in 5 uL 0 2 M NaHCO3 buffer make sure the aRNA completely dissolved in to the solution by pipetting the buffer along the sides of the tube 91 Incubate the tube at RT for at least 20 minutes 92 Add 5 uL Cy3 or Cy5 in DMSO to each aRNA sample 93 Mix thoroughly by flicking the tube several times 94 Centrifuge the tube at 1 000xg for 30 seconds 95 Cover each tube with aluminum foil or otherwise protect the samples from light exposure 96 Incubate the aRNA dye mixture at RT for 2 hours Date 11 2 2009 OpArray Protocol Page 10 Post Dye Coupling aRNA Purification Materials RNeasy MinElute column Qiagen Cat 74204 o RNAase free tips and tubes o Refrigerated centrifuge o Hydroxylamine Sigma Cat 159417 Preparation of 4 M Hydroxylamine o Dissolve 2 7g of Hydroxylamine Hydrochloride salt in 7 mL DEPC treated water o Bring the solution to 10 mL total volume o Aliquot the 4 M hydroxylamine solution into 100 uL aliquots in RNAase free microfuge tubes o Store excess tubes at 20 C Quenching Reaction This optional step involves quenching any unreacted Cy dye by adding an excess of primary amines 97 Add 4 5 uL 4 M hydroxylamine into the dye coupling reaction 98 Mix well 99 Incubate for 15 minutes in the dark at RT Removal of Unincorporated Dye Note The Qiagen RNeasy MinElute column is used for this purpose Become familiar with the steps before proceeding and have all reagents ready to u
8. 25 C RT for 10 minutes Transfer the slide tray into a dish with Wash Solution 4 Incubate at RT for 5 minutes Transfer the slide tray into another dish with fresh Wash Solution 4 Incubate at RT for 5 minutes Dry the slides by either using an oil free nitrogen or air jet or by centrifugation 200xg for 5 minutes Protect the array from light dust and abrasion of the array surface Scan as soon as practical Note There are several reports regarding reduction of Cy5 signal due to the atmospheric ozone above 5 ppb The Ozone induced Cy5 degradation is prudent particularly in the summer months We advise taking appropriate preventive measures such as increasing the Nitrogen in the microarray lab or setting up appropriate AIR filtration system to eliminate the Ozone As a general practice we also recommend completing the scanning as soon as the washing process is completed Date 11 2 2009 OpArray Protocol Page 15 Scanning of the Microarray Slides Please follow all manufacturer recommendations for Microarray scanner operation and maintenance o Turn on the scanner at least 20 minutes before the scanning to warm up the scanner o Place the slide into the slide cartridge and close the scanner o If the slides are hybridized with two color targets select Cy5 channel 650 nm and Cy3 channel 532 nm otherwise select appropriate wavelength o If the option is available select the preview scan and scan entire slide o Exa
9. 500 uL prepared cDNA Wash Buffer with added ethanol see note above to each cDNA filter cartridge Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter Discard the liquid from the collection tube Centrifuge the cDNA filter cartridge for an additional minute to remove trace amounts of ethanol Transfer cDNA Filter Cartridge to a clean cDNA Elution tube Apply 10 uL DEPC treated H2O preheated to 55 C to the center of filter of the cDNA Filter cartridge Incubate at room temperature for 2 minutes Centrifuge at 10 000xg for at least 1 5 minutes or until the liquid has passed through the filter Repeat the elution steps 56 58 with an additional 10 uL DEPC treated H20 preheated to 55 C Discard the filter Place your double stranded cDNA sample tube s 18 uL on ice In Vitro Transcription for aRNA Synthesis An Overview OpArrays require labeled negative strand targets for hybridization Since the first round of amplified aRNAs represents the negative strand it is recommended to label the aRNA aRNA labeling can be done using two methods 1 direct incorporation of Cy dye modified UTP during the process of in vitro transcription or 2 indirect labeling by incorporating aminoallyl modified UTPs during in vitro transcription followed by mono reactive Cy dye coupling The OpArray protocol takes advantage of the second approach Aminoallyl UTP aaUTP does not contain a bulky side chai
10. con and oligonucleotide array elements respectively certain constraints are placed on the methods of amplification that can be employed Amplicon based microarrays are particularly flexible in terms of the targets that can be hybridized since either strand of the cDNA can be fluorescently labeled In contrast hybridization to oligonucleotide based microarrays is restricted to the use of negative strand targets Since the Eberwine based RNA amplification methods generate only negative strands after the one round of amplification it is essential to label the aRNA for microarray hybridization Alternatively a second round of amplification can be used to generate RNA corresponding to the positive strand of the gene which can then be reverse transcribed to generate a labeled target Both methods have advantages and disadvantages Labeling aRNA forces use of riboprobe hybridization methods which can be challenging under certain conditions using two rounds of amplification is time consuming and may cause truncation Microarrays Inc consequently recommends the use of direct labeling of aRNA rather than second round amplification unless the extra level of amplification is required New methods have been recently described for linear aRNA amplification which are specific to the positive strand of the gene BD Biosciences Total RNA purified using the Qiagen RNeasy columns performs very well for RNA amplification Date 11 2 2009 OpArray Protocol Page 4
11. d on this substrate size A list of previously tested equipment can be found in Appendix A Technical Note To reduce possible sources of experimental variation which may effect experimental results Microarrays Inc strongly advises OpArray users to gather completed OpArray experimental data by scanning the OpArrays as soon as practical once the experiment is completed Please schedule your experiments appropriately Degradation of fluorescent dyes is reported post hybridization these effects are attributed to a variety of sources There are several reports regarding reduction of Cy5 signal intensity relative to Cy3 due to the concentration of atmospheric ozone above 5 ppb in the atmosphere The major consideration in preventing this effect seems to be in the transition from a wet to dry array surface This protocol is designed to minimize these effects Date 11 2 2009 18mm 3 5mm lt 3 5mm gt lt lt A 8mm A Samm V A UpArmay 13 6 mm MY UL UMMM ETA Actual Siza OpArray Protocol Page 1 Target Preparation for OpArray Isolation of Total RNA Total RNA can be isolated employing commonly described procedures such as Sambrook et al 2000 However depending on the organism and tissue type the method of choice may require different modifications Microarrays Inc recommends selecting a procedure that is best suited for the tissue type that you are working with If you are having problems iso
12. ethods van Gelder et al 1990 employing double stranded cDNA synthesis using oligo dT primers incorporating one of the T3 or T7 viral promoters followed by in vitro transcription IVT as a means to linearly increase the concentration of messenger RNA The optimized Eberwine method is capable of amplifying mRNA up to 10 fold for one round of amplification and up to 10 fold for two rounds of amplification Wang et al 2000 Baugh et al 2001 Employing two rounds of RNA amplification one can successfully perform a microarray experiment using as little as 10 ng of starting RNA corresponding to the total RNA content of a few isolated cells Unless it is absolutely required we do not recommend two rounds of RNA amplification as this has been shown to reduce the number of detectable genes by as much as 20 due to truncation of the 5 complexity of the RNA population Luzzi et al 2003 A variety of alternatives to Eberwine based methods have been described Iscove et al 2002 Aoyagi et al 2003 Ginsberg and Che 2002 Seth et al 2003 The major advantage of the Eberwine RNA amplification method over other methods is attributed to its linear mode of amplification which helps preserve the relationships between the abundances of different transcripts Xiang et al 2003 demonstrated that this linear relationship can be maintained over five cycles of RNA amplification In terms of the two major types of microarray platforms cDNA ampli
13. ing Buffer to each aRNA sample mix by pipetting up and down three times Add 250 uL ACS grade 100 ethanol to each aRNA sample Mix by pipetting the mixture up and down three times Quickly transfer the sample onto the center of the filter in the aRNA spin column Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter Discard the liquid from the collection tube Replace the aRNA filter cartridge back into the aRNA collection tube Apply 650 uL Wash Buffer to each aRNA filter cartridge Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter Discard the liquid from the collection tube Centrifuge the aRNA filter cartridge for an additional 3 minutes to remove trace amounts of Wash Buffer 80 Transfer filter cartridge s to a fresh aRNA collection tube 81 Add 100 uL DEPC treated H20 to 55 C to the center of the filter 82 Incubate at room temperature for 2 minutes 83 After incubation centrifuge at 10 000xg for at least 1 5 minutes or until the liquid has passed through the filter 84 Discard the aRNA filter 85 Place your aRNA sample tube s 100 uL volume on ice Date 11 2 2009 OpArray Protocol Page 8 Quantitation Determine the concentration of aRNA using either the NanoDrop or a conventional spectrophotometer In general you can expect a yield of 40 60 ug amplified aa aRNA from 1 ug total RNA as starting material and 80 120 ug of
14. lating suitable RNA samples you may wish to refer to the collection of RNA isolation methods described by Farrell 2005 Total RNA Cleanup After isolating total RNA using the method of your choice a subsequent RNA purification helps to remove most of the inhibitory contaminants such as organic phenol and cytosolic polysaccharide polyphenols Microarrays Inc recommends using Qiagen s RNeasy MinElute kit to purify total RNA samples This method works consistently well for RNA samples isolated from a wide range of tissue types such as brain kidney liver testis and ovary from human mouse and rat Arabidopsis seedlings roots leaves flower Maize leaves roots and endosperm rice leaves and roots and the leaves of Medicago truncatula and Vitis vinifera grape Additional details concerning the capacity of the columns and other technical details can be found in the Qiagen RNeasy Mini Handbook Materials o RNeasy MinElute Column Qiagen Cat 74204 Agilent RNA 6000 Nano LabChip Kit Refrigerated microcentrifuge RNAase free microfuge tubes and tips 100 Ethanol DEPC treated H20 80 Ethanol prepared with DEPC treated water O O 0 090 0 Method Note Buffer RPE is supplied with the RNeasy MinElute kit as a concentrate Ensure that ethanol was added prior to use Preheat 50 uL RNAase free DEPC treated H20 to 55 C Adjust sample 10 ug total RNA to a volume of 100 uL with RNAase free water Add 350 uL RLT buffer and mix thor
15. lyl Message Amp II kit Ambion Cat 1753 If the buffer is not provided with the kit follow the procedure described below to make RNAase free 0 2 M Sodium Bicarbonate buffer Preparation of 0 2 M Sodium Carbonate Buffer pH 9 0 o o o o Solution I Dissolve 0 84g NaHCO3 in 50 mL DEPC H20 in a disposable sterile Falcon tube Solution II Dissolve 1 05g Na2CO3 in 50 mL DEPC H 0O in a disposable sterile Falcon tube Mix 45 mL of Solution I and 2 75 of mL Solution II in a disposable sterile Falcon tube Check the pH by aliquoting 5 mL into a new 15 mL Falcon tube if needed adjust the pH by adding appropriate amount of Sol I or Sol II Never check the pH directly in the stock solution as that is a common source of RNAase contamination Aliquot 0 2 mL into RNAase free tubes store at 20 C Discard the tube after use or 24 hours whichever comes first Preparation of Cy3 and Cy5 Monoreactive Dye These dyes are supplied in 5 aliquots the content of each tube is sufficient for at least 4 5 labeling reactions Preparation of Cy dyes Prior to Reaction o Dissolve the entire contents of a single tube in 27 uL DMSO by flicking the tube several times Leave at RT for at least 30 minutes protected from light Centrifuge at 1 000xg for 30 seconds to collect the dye at the bottom of the tube The dye is now ready for use but can be stored at 20 C for up to one month Protect the dye from light by wrapping with aluminum foil Dissolve
16. mine the image and if the option is available check the histogram o Adjust the laser power or PMT settings to obtain ration of 1 between these two channels If the microarrays hybridized with targets with single color make sure to follow a single setting or similar setting to obtain a consistent result o After adjusting the setting to get a ratio of 1 between the Cy5 and Cy3 channel perform high resolution scanning usually 10 microns o Save a multicolor TIFF image otherwise save single channel TIFF images Feature Extraction Feature extraction is one of the most critical steps in any microarray experiment In this step you will convert the optical image to numerical values for comparing the results among samples and for drawing conclusions from your experiment To facilitate feature extraction with any of the commercially or publicly available microarray analysis software Microarrays Inc provides files in the standard gal configuration Other configurations may be available through the Microarrays Ine website or upon request Control oligos and empty wells The AROS and CoRe oligo probe sets come with a variety of positive negative and spiking control oligos All OpArrays contain the control oligos which are offered with the specific AROS oligo probe set Many also include the Stratagene s SpotReport Alien Amine Oligo Array Validation System The mRNA Spikes 1 through 10 can be purchased directly from Stratagene La Jolla CA USA
17. mix at the bottom of tube 34 Place prepared Reverse Transcription Master Mix on ice 35 Transfer 8 uL Reverse Transcription Master Mix to each RNA sample from step 30 mix thoroughly by flicking the tube a few times 36 Incubate the sample tubes at 42 C for 2 hours in a PCR machine with the lid temperature set at 48 C 37 After the 2 hour incubation centrifuge the tubes briefly 5 seconds to collect the reaction at the bottom of the tube Place the tubes on ice and proceed to Second Strand cDNA Synthesis Date 11 2 2009 OpArray Protocol Page 5 Second Strand cDNA Synthesis Materials o Aminoallyl Message Amp II kit Ambion Cat 1753 o RNAase free tips tubes o Refrigerated Microfuge centrifuge o DEPC treated H20 o Thermocycler incubators set at 16 C Method 38 Work on ice to prepare the Second Strand cDNA Synthesis Mix by adding following ingredients Single Reaction Amount Ingredient 63 uL Nuclease free Water 10 uL 10X Second Strand Buffer 4 uL dNTP Mix 2 uL DNA Polymerase 1 ul RNAase H Note When processing more than one sample include 5 overage to cover pipetting error 39 Gently mix by pipetting up and down or by flicking the tube a few times 40 Centrifuge the tubes briefly 5 seconds 41 Add 80 uL second strand mix to 20 uL cDNA sample step 37 42 Gently mix by pipetting up and down or by flicking the tube a few times 43 Centrifuge the tubes briefly 5 seconds 44 Incuba
18. mount of labeled target causes precipitation of Cy3 leading to very high background on the microarray Therefore we recommend using a maximum of 0 8 pmol Cy5 labeled target ul of hybridization solution and 0 8 pmol of Cy3 abeled target uL hybridization solution 131 132 133 134 135 136 137 138 139 140 141 Mix 2 5 uL of Cy5 labeled targets 40 pmol 2 5 uL of Cy3 labeled targets 40 pmol and 45 uL of OpArray Hyb Buffer Note The OpArray Hyb Buffer can be diluted to a maximum of 90 v v therefore if necessary concentrate the labeled targets using a speedvac Store the tubes in ice until the next step Rinse the Hybridization Cassette with sterile diH2O and dry thoroughly Make sure the flexible rubber gasket is seated evenly in gasket channel Add 15 uL sterile diH20 to the lower groove inside the cassette chamber Insert the OpArray into the cassette chamber DNA side up barcode side up Place the LifterSlip over the microarray slide Make sure the white stripe of the LifterSlip is at the lower side and properly positioned on the slide surface Denature labeled target solution from Line 131 by incubating in the tube at 65 C for 5 minutes Apply the labeled target solution directly onto the slides or place on ice immediately Apply the denatured target solution slowly to one end of the LifterSlip and let it disperse across the OpArray surface Quickly place the clear plastic cassette lid on top of the ca
19. n modification which allows 100 replacement of the UTP with aaUTP during RNA synthesis Microarrays Inc recommends using a 1 1 ratio of UTP aaUTP 61 62 64 Prepare the IVT Reaction Master Mix by adding the reagents in the following order Single Reaction Amount Ingredient 2 uL aaUTP Solution 50 mM 12 uL ATP CTP GTP Mix 25 mM 2 uL UTP Solution 50 mM 4 uL T7 10X Reaction Buffer 4 uL T7 Enzyme Mix Note When processing more than one sample include 5 overage to cover pipetting error Add 24 uL IVT Reaction mix to 16 uL double stranded cDNA sample Mix the reaction mix by pipetting up and down several times Centrifuge at 3 000xg for 30 seconds Date 11 2 2009 OpArray Protocol Page 7 65 66 67 68 Incubate the tube for 4 14 hours at 37 C in a PCR machine with lid temperature set at 40 C After incubation stop the reaction by adding 60 uL DEPC treated H2O to each sample bringing the final volume to 100 uL Mix thoroughly by gentle vortexing Proceed to aRNA Purification or store the reaction tubes at 80 C aRNA Purification Materials o Aminoallyl Message Amp II kit Ambion Cat 1753 o RNAase free tips tubes o Refrigerated Microfuge centrifuge o 100 EtOH o DEPC treated H20 Method Become familiar with the steps before proceeding and have all reagents ready to use This procedure will remove all the unincorporated nucleotides from the aRNA 69 Add 350 uL aRNA Bind
20. oughly by pipetting Add 250 uL 100 ethanol to the sample and mix thoroughly by pipetting Prepare the RNeasy MinElute spin column for use by placing it in a 2 mL collection tube Add the sample to the RNeasy MinElute and spin column Close the tube gently Centrifuge for 1 minute at 10 000xg Discard the liquid from the 2 mL collection tube Pipette 500 uL RPE buffer to the RNeasy MinElute spin column Close the tube gently 10 Centrifuge for 1 minute at 10 000xg 11 Discard the liquid from the 2 mL collection tube 12 Add 500 uL 80 ethanol to the RNeasy MinElute spin column Close the tube gently 13 Centrifuge for 1 minute at 10 000xg 14 Discard the liquid from the 2 mL collection tube 15 Close the RNeasy MinElute spin column 16 Centrifuge the spin column at 10 000xg for 3 5 minutes 17 Discard the 2 mL collection tube 18 Transfer the RNeasy MinElute spin column to a new 2 mL or 1 5 mL RNAase free microfuge tube So oP wie Date 11 2 2009 OpArray Protocol Page 2 19 Pipette 40 uL DEPC treated H2O pre heated to 55 C in step 1 directly onto the center of the membrane Close the tube gently 20 Incubate at room temperature RT for 2 minutes 21 Centrifuge for 1 minute at maximum speed to elute 22 Immediately place the RNA solution on ice after elution Note Since RNA samples are labile it is important to keep RNA solutions on ice after elution 23 Measure the RNA amount using a NanoDrop 24 Analyze
21. parameters require less than 0 5 of features in any lot to exhibit poor morphology For each OpArrays lot you are working with Microarrays Inc suggests that you review the print QC files for the lot to eliminate analysis of missing spots The size of QC files make them likely to be rejected by email systems so we cannot send QC files directly by email OpArrays QC data are available for download at the Microarrays Inc web site Date 11 2 2009 OpArray Protocol Page 17 References Biochem Biophys Res Commun 300 915 920 Aoyagi K Tstsuta T Nishigaki M Akimoto S Tanabe C Omoto Y Hayashi S Sakamoto H Sakamoto M Yoshida T Terada M and Sasaki H 2003 A faithful method for PCR mediated global mRNA amplification and its integration into microarray analysis on laser captured cells Nucleic Acids Res 29 No5 E29 Baugh LR Hill AA Brown EL Hunter CP 2001 Quantitative analysis of MRNA amplification by in vitro transcription Nucleic Acids Res 29 No5 E29 Farrell R 2005 RNA Methodologies A Laboratory Guide for Isolation and Characterization 3rd ed Elsevier Academic Press 2005 Neurochem Res 10 981 992 Ginsberg SD and Che S 2002 RNA amplification in brain tissues Nat Biotechnol 20 940 943 Iscove NN Barbara M Gu M Gibson M Modi C and Winegarden N 2002 Representation is faithfully preserved in global cDNA amplified exponentially from sub picogram quantities of MRNA J Mol Diagn 5 9 14 L
22. se RPE buffer is supplied as a concentrate ensure that ethanol is added before use Work through this procedure to remove all the unincorporated dye 100 Adjust sample volume to 100 uL with DEPC treated H20 101 Add 350 uL of RLT kit buffer 102 Mix thoroughly 103 Add 250 uL 100 ethanol to the sample 104 Mix thoroughly by pipetting 105 Apply the sample to an RNeasy MinElute Spin Column in a 2 mL collection tube 106 Close the tube gently 107 Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter 108 Discard the liquid from the collection tube 109 Pipette 500 uL RPE buffer onto the spin column 110 Close the tube gently 111 Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter 112 Discard the liquid from the collection tube 113 Add 500 uL of 80 ethanol to the RNeasy MinElute Spin Column 114 Close the tube gently 115 Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter 116 Discard the liquid from the collection tube Date 11 2 2009 OpArray Protocol Page 11 117 Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter 118 Transfer the spin column to a new microfuge tube 119 Apply 20 uL warm DEPC water 55 C to the center of the spin column 120 Close the tube gently 121 Incubate at RT for 2 minutes 122 Centrifuge
23. ssette chamber 142 Apply downward pressure and manually tighten clockwise the four sealing screws 143 Check all four screws again to confirm a tight seal 144 Place the cassette into a hybridization oven set at 42 C 145 Hybridize for 14 16 hours Date 11 2 2009 OpArray Protocol Page 14 Post Hybridization Washing Note Do not allow the slides to dry during the hybridization and washing procedure Wash Solutions 2 3 and 4 should be prepared in advance Use at least 50 mL solution per slide 146 147 148 149 150 151 152 153 154 155 156 157 158 Prepare all post hybridization washing solutions Wash Solution 2 o 50 mL OpArray Wash A o 25 mL OpArray Wash B o Bring Wash Solution 2 final volume to 500 mL with sterile diH 0 Wash Solution 3 o 50 mL OpArray Wash A o Bring Wash Solution 3 final volume to 500 mL with sterile diH2O Wash Solution 4 o 5 mL OpArray Wash A o Bring Wash Solution 4 final volume to 500 mL with sterile diH 0 Pre warm the Wash Solution 2 to 42 C After hybridization remove cassette from the hyb oven and manually loosen the four sealing screws counterclockwise to remove the lid Place the hybridized OpArray slides into a slide rack removing them from the cassette chamber using forceps Place the slide tray containing the OpArrays into a dish with Wash Solution 2 at 42 C for 10 minutes Transfer the slide tray into a dish with Wash Solution 3 Incubate at 20
24. te the tubes at 16 C for 2 hours use either a water bath in a cold room or a thermocycler do NOT use a heat block in a 4 C refrigerator because the temperature will fluctuate too much 45 After the 2 hour incubation proceed to cDNA Purification below or immediately freeze reactions at 20 C Do not leave the reactions on ice for long periods of time cDNA Purification Use the cDNA purification kit supplied with the MessageAmp II kit You can also use other DNA purification systems like Qiaquick PCR purification kit The protocol described below is essentially recommended by Ambion with MessageAmp II kit for double 46 47 stranded cDNA purification Note1 Before beginning the cDNA purification preheat a 10 mL bottle of DEPC treated H20 to 55 C Note2 Prepare the aRNA Wash Buffer by adding the appropriate amount of 100 ethanol ACS grade or better to the bottle labeled aRNA Wash Buffer Mix well and mark the label to indicate that the ethanol has been added Add 250 uL of cDNA Binding Buffer to each cDNA sample and mix thoroughly by repeated pipetting Transfer the cDNA sample with added buffer onto the center of the cDNA filter cartridge Date 11 2 2009 OpArray Protocol Page 6 48 49 50 51 52 53 54 55 56 57 58 59 60 Centrifuge at 10 000xg for at least 1 minute or until the liquid has passed through the filter Discard the liquid from the collection tube Apply
25. the total RNA quality of your sample using a Bioanalyzer or Experion follow the manufacturer s directions to operate the instrument Total RNA Analysis using the Bioanalyzer or Experion Only samples that have a large percentage of intact RNA will produce a uniform amplification Degraded samples will produce unpredictable RNA amplification which may cause variation in subsequent microarray hybridization experiments Therefore we insist that you check the RNA quality before proceeding to the next step Microarrays Inc recommends the use of the Bioanalyzer Agilent Technologies or Experion BioRad to verify the quality of the total RNA sample Typically these instruments require very small quantity of RNA for the analysis 100 150 ng sample wu Pas Figure 1 Electropherogram of total RNA from Arabidopsis leaf tissue was analyzed using the Bioanalyzer CP Chloroplast RNA Figure 2 Gel like image file output from the Bioanalyzer Sample 12 is the unpurified total RNA and samples 1 11 are the cleaned up RNA samples from Arabidopsis leaf tissues Date 11 2 2009 OpArray Protocol Page 3 aRNA Amplification An Overview A typical microarray experiment requires 30 50 ug total RNA that is equal to 1 ug polyA RNA This large amount of total RNA requirement makes RNA amplification techniques essential for experiments involving limited amounts of starting material Most RNA amplification techniques are based on Eberwine m
26. ts The items listed below have been specifically reviewed however additional equipment if configured to accept a standard microarray slide will likely be compatible with OpArrays Please contact Operon Technical Support with any specific questions regarding the OpArrays See contact information on page 16 Specifically Tested Equipment Compatible Microarray Scanners Axon 4000B Axon 4100A Axon 4200AL Agilent DNA Microarray Scanner PerkinElmer Scanarray GX PerkinElmer Scanarray HT PerkinElmer ProScann PerkinElmer Scanarray Express Telechem International Spotlight 2 Alpha Innotech NovaRay Genomic Solutions UC4 Scanner GE Healthcare ArrayWoRx Scanner Tecan Microarray Scanner Genetix aQuire scanner Innopsis Microarray Scanner O O 0 00 000 00 O O O 0 0 Microarray scanners NOT compatible with OpArray Slides o Affymetrix Scanner o Illumina Bead array Scanner o ABI 1700 Chemiluminescent Microarray Analyzer Compatible Automated Hybridization Stations o MAUI Hyb Station ArrayBooster GeneMachines HybStation GeneTAC Hybridization Station CapitalBio Biomixer a Hyb Hybridization Station Tecan HS400 Hyb station oOo O 0 0 0 O Compatible Manual Hybridization Chambers Cassettes o Glass array Hybridization Cassette Ambion o International Hybridization Chambers Telechem Date 11 2 2009 OpArray Protocol Page 20
27. uce less variation between the slides Note Do not allow the slides to dry during the pre hybridization and washing procedure Caution note mBox may require more buffer than described in the procedure 124 125 126 127 128 129 130 Pre warm an appropriate volume of OpArray Pre Hyb Solution to 42 C by placing the pre hyb buffer in a 42 C incubator for 30 minutes Using a large enough volume of buffer to ensure that all slides are completely covered incubate slides in OpArray Pre Hyb Solution for 60 minutes at 42 C During the pre hybridization step prepare Wash Solution 1 by diluting OpArray Wash B 1 40 with diH O Prepare 50 mL per slide i e 1 25 mL OpArray Wash B add diH20 to 50 mL Wash slides for 5 minutes in Wash Solution 1 at 20 25 C Immediately transfer the slides to a container with sterile DH O and rinse for 30 seconds Repeat this step for at least two times Dry the slides using a nitrogen or oil free air jet or dry by centrifugation at 200xg for 5 minutes using a microplate rotor If microplate rotor is not available use 50 mL Falcon tubes for drying Preparation of 50 mL Falcon tube for slide drying a Pack bottom of 50 mL plastic disposable centrifuge tube with Kimwipes b Using forceps carefully place slide into tube with label at the bottom c Spin the slides at 200xg for 5 minutes if any liquid remains on the slide repeat for an additional 5 minutes Hybridization Note Excessive a
28. uzzi V Mahadevappa M Raja R Warrington JA and Watson MA 2003 Accurate and reproducible gene expression profiles from laser capture microdissection transcript amplification and high density oligonucleotide microarray analysis Sambrook J Fritsch EF and Maniatis T 2000 Molecular Cloning A Laboratory Manual 2nd ed Cold Spring Harbor New York Cold Spring Harbor Laboratory Press J Biochem Biophys Methods 55 53 66 Seth D Gorrell MD McGuinness PH Leo MA Lieber CS McCaughan GW and Haber PS 2003 SMART amplification maintains representation of relative gene expression quantitative validation by real time PCR and application to studies of alcoholic liver disease in primates Proc Natl Acad Sci USA 87 1663 1667 Van Gelder RN von Zastrow ME Yool A Dement WC Barchas JD Eberwine JH 1990 Amplified RNA synthesized from limited quantities of heterogeneous cDNA Nat Biotechnol 18 457 459 Wang E Miller LD Ohnamacht GA Liu ET and Marincola FM 2000 High fidelity mRNA amplification for gene profiling Nat Biotechnol 18 457 459 Biotechniques 34 386 388 Xiang CC Chen M Kozhich OA Phan QN Inman JM Chen Y and Brownstein MJ 2003 Probe generation directly from small numbers of cells for DNA microarray studies Date 11 2 2009 OpArray Protocol Page 19 Appendix A There are many models of scanners hybridization stations and analysis software which are compatible with Operon OpArray produc
Download Pdf Manuals
Related Search