Home

User and maintenance manual for generating sets

1. Replacing fuel filter element s Checking belt 3029 and 4039 Engines Checking belt 4045 and 6068 Engines with manual tensioner ooocconcccocccccnccncnncnnno Maintenance 1000 hours 1 year Cleaning crankcase vent tube cc 000 Checking air intake SysStem ooccconcccccnccnnnn Checking automatic belt tensioner 4045 and 6068 ENgIiNes occcoccccccncocncnnooo NOOO gt oR oa Continued on next page Original Instructions All information illustrations and specifications in this manual are based on the latest information available at the time of publication The right is reserved to make changes at any time without notice COPYRIGHT 2009 DEERE amp COMPANY European Office Mannheim All rights reserved A John Deere ILLUSTRUCTION Manual Previous Editions Copyright 2007 2008 103 290 072209 PN 1 Contents Check and adjust engine valve clearance 3029 and 4039 Engines Pressure testing cooling SysteM oo o Maintenance 2000 hours 2 years Check and adjust engine valve clearance 4045 and 6068 Engines Checking engine speed Mechanical fueliSystem essa Adjust speed droop governor Mechanical fuel system oocccoccccocncoo Checking crankshaft vibration damper 6 CYLINDER ENGINE ONLY 0 Maintenance 2500 hours 3 years Drain and flush cooling syst
2. Important risk of explosion Important Electrical risk Warning danger Important rotating or moving parts Important Important pressurised fluids toxic materials Important Important Danger automatic high temperature corrosive product start up Figure 1 Warning pictograms Entry prohibited to E NN Jet washing unauthorised fee e ATAN prohibited persons Wi Figure 2 Pictograms indicating prohibited activities 5 290 Reading the l l Wearing suitable j Wearing suitable manual for the l i protective goggles protective clothing equipment IS and ear defenders is compulsory compulsory is compulsory Lifting Forklift required for Battery charge required lifting must be checked Periodic maintenance TEEI compulsory Figure 3 Pictograms indicating compulsory operations IM OUT Battery isolating o 0 External fuel switch as y connections Diesel fuel Drain the fuel Inspection flap Mains supply connection prohibited before filling with water Fill the coolant Drain the coolant Fill the oil Drain the oil Retention container Drain the retention high level container Figure 4 Information pictograms 6 290 Flammable product Reading the manual for the equipment is Do not smoke or create sparks or flames compulsory ALIMENTATION FUEL GENSET FUEL SUPPLY ALIMENT ATION DU GROUPE PAR LE ee PESER VGE SOU RULE GENET F
3. 1 S7 1 3 8 1 S75 M95 t2 4 8 6 Dedicated single phase LSA 44 2 4 pole SHUNT excitation 60 Hz only Resistances at 20 C Q LSA 44 2 Stator L N Armature VS3 0 0194 0 5 VS45 0 0194 0 5 S7 0 0140 0 5 M95 0 0088 i i 0 5 Field excitation current i exc A 240 V 60 Hz i exc excitation current of the exciter field LSA 44 2 VS3 VS45 S7 M95 4 8 7 Table of weights values given for information only LSA 43 2 Total weight kg Rotor kg 220 220 220 S35 M45 L65 L8 LSA 44 2 Total weight kg VS3 405 140 VS45 405 140 S7 460 165 S75 460 165 M95 515 185 L12 570 210 Rotor kg After operational testing itis essential to replace all access panels or covers LEROY SOMER 17 239 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 5 SPARE PARTS 5 1 First maintenance parts Emergency repair kits are available as an option They contain the following items Emergency kit SHUNT ALT 432 KS 001 AVR R 250 Diode bridge assembly Surge suppressor Emergency kit AREP AVR R 450 Diode bridge assembly Surge suppressor ALT 432 KS 002 Single bearing kit ALT 432 KB 002 Non drive end bearing O ring Preloading Double bearing kit ALT 432 KB 001 Non drive end bearing Drive end bearing O ring EA Prel
4. bel A AAA 151356 UN 18MAR92 NOTE On engines with electronically controlled fuel system DE10 HPCR the air intake heater operates automatically controlled by the ECU An engine preheater indicator light comes on when the key switch is turned ON In warm weather the light comes on briefly for a light check In cold weather the light remains ON during the automatic operation of the air intake heater or glow plug s Operating time depends on temperature Do not crank engine until light goes OFF Handle starting fluid with care i e 3029 and 4039 engines are optionally equipped with the single glow plug B screwed in cylinder head intake manifold Activate the glow plug preheater position for 30 seconds maximum then start the engine e 4045 and 6068 engines except HPCR 4 valve head are optionally equipped with the grid type air heater A installed between cylinder head and air intake pipe For mechanical fuel system activate the heating element preheater position for 30 seconds maximum then start the engine For electronically controlled engines DE10 HPCR 2 valve head turn key switch ON but DO NOT crank engine until engine preheater indicator light turns OFF e HPCR 4 valve head engines are equipped with glow plugs one per cylinder C Turn key switch ON but DO NOT crank engine until preheater indicator light turns OFF CD30750 UN 03SEP99 A Grid Type heater 4045 and C Mul
5. as LO Oe b O x OURGP11 00000B1 19 03SEP03 12 18 13 Press the Enter key to select the parameter for inclusion in the Single Engine Parameter Display ENGINE SPEED 7 PERCENT LOAD AT CURRENT RPM 2 vv pevartiotens for tne cuter LU Display Pres his JSE OLERE URE p PORRI ENGINE COOLANT TEMP Menu key at any time to return to the Custom Setup menu Select Parameters For Display RG13220 UN 26SEP03 Continued on next page OURGP11 00000B1 19 O3SEP03 13 18 15 19 PN 56 154 290 Operating the Engine 15 Automatic Scan Selecting the scan function will allow the 1 Up Display to scroll through the selected USE DEFAULTS set of parameters one at a time Use the Arrow keys CUSTOM SETUP to scroll to the Automatic Scan function AUTOMATIC SCAN GFF RG13221 UN 26SEP03 Automatic Scan Off OURGP11 00000B1 19 03SEP03 14 18 16 Press the Enter key to toggle the Automatic Scan function on USE DEFAULTS CUSTOM SETUP AUTOMATIC SCAN ON Se O A LUI 0p i Z 2 N N N OE O X Automatic Scan On OURGP11 00000B1 19 03SEP03 15 18 17 Press the Enter key again to toggle the Automatic Scan function off USE DEFAULTS CUSTOM SETUP AUTOMATIC SCAN OFF Automatic Scan Off RG13223 UN 26SEP03 Continued on next page OURGP11 00000B1 19 O3SEP03 16 18 15 20 PN 57 155 290 Operating the Engine 18 Once the Use Defaults Custom Setup and
6. A Retaining ring B Final fuel filter element C Drain plug D Bleed plug Y teal eat Escaping fluid under pressure can penetrate the skin causing serious injury Relieve pressure before disconnecting fuel or other lines Tighten all connections before applying pressure Keep hands and body away from pinholes and nozzles which eject fluids under high pressure Use a piece of cardboard or paper to search for leaks Do not use your hand If any fluid is injected into the skin it must be surgically removed within a few hours by a doctor familiar with this type injury or gangrene may result Doctors unfamiliar with this type of injury may call the Deere amp Company Medical Department in Moline Illinois or other knowledgeable medical source NOTE Engines with mechanical fuel system have a single fuel filter while electronically controlled engines DE10 HPCR have two fuel filters primary and final Both the primary and the final filters have to be replaced together at the same time Thoroughly clean fuel filter assembly and surrounding area Loosen drain plug C and drain fuel into a suitable container NOTE Lifting up on retaining ring as it is rotated helps to get it past raised locators 30 4 X9811 UN 23AUG88 1E L E A JOHN DEE Sine ras PAT me JOHN DEF gt j ri AA Tk 1 AE CD30930 UN 07FEB07 Fuel filters E Water separator bowl F
7. Avoid creating dust Never use compressed air for cleaning Avoid brushing or grinding material containing asbestos When servicing wear an approved respirator A special vacuum cleaner is recommended to clean asbestos If not available apply a mist of oil or water on the material containing asbestos Dispose of Waste Properly Improperly disposing of waste can threaten the environment and ecology Potentially harmful waste used with John Deere equipment include such items as oil fuel coolant brake fluid filters and batteries Use leakproof containers when draining fluids Do not use food or beverage containers that may mislead someone into drinking from them Do not pour waste onto the ground down a drain or into any water source Air conditioning refrigerants escaping into the air can damage the Earth s atmosphere Government regulations may require a certified air conditioning service center to recover and recycle used air conditioning refrigerants Inquire on the proper way to recycle or dispose of waste from your local environmental or recycling center or from your John Deere dealer Keep bystanders away from the area 05 8 131 290 TS281 UN 23AUG88 DX RCAP 19 04JUN90 1 1 TS220 UN 23AUG88 DX DUST 19 15MAR91 1 1 151133 UN 26NOV90 DX DRAIN 19 O3MAR93 1 1 072209 PN 33 Fuels Lubricants and Coolant Diesel Fuel Consult your local fuel distributor for properties of t
8. Clean air filter element when restriction indicator is red Replace filter element after 6 cleanings or once a year Change oil and filter after the first 100 hours of operation then every 500 hours maximum thereafter see DIESEL ENGINE OIL information Change oil and filter at least once a year Check belt tension every 500 hours on 3029 and 4039 engines and on 4045 and 6068 engines with manual tensioner Check automatic belt tensioner every 1000 hours 1 year on 4045 and 6068 engines when equipped Have your authorized servicing dealer or engine distributor adjust valve clearance as follows After the first 500 hours of operation then every 1000 hours thereafter on 3029 and 4039 engines Every 2000 hours on 4045 and 6068 engines Have your authorized dealer or engine distributor replace the vibration damper every 4500 hours 5 years Drain and flush cooling system every 2500 hours 3 years when John Deere COOL GARD coolant is used Otherwise every 2000 hours 2 years 9Contact your dealer when thermostat or injection nozzles are suspected to be defective Replace injection nozzles every 5000 hours and thermostat every 10000 hours DPSG CD03523 26 19 25JANO7 1 1 072209 20 1 PN 67 165 290 Maintenance Daily or every 10 hours Daily prestarting checks O O O O O go gt D S S 1 Al Z Z 1 iT mM Y LO LO Mm N Oo Oo mM mM Q Q O O 3029 and 4039 engines O Co a re i Z gt 5 LO N N S D
9. LEROY SOMER 226 290 LSA 43 2 44 2 4 POLES ALTERNATORS 2 TECHNICAL CHARACTERISTICS 1 1 Electrical characteristics The LSA 43 2 44 2 alternator is a machine without sliprings or revolving armature brushes wound as 2 3 pitch 12 wire with class H insulation and a field excitation system available in either SHUNT AREP or PMG version see diagrams and AVR manuals 2 1 1 Electrical options Stator temperature detection sensors Space heater Interference suppression conforms to standard EN 55011 group 1 class B Europe SHUNT SYSTEM dido a EXCITER Varistor se Amature E 2 AREP SYSTEM dilo eae EXCITER Varistor Armature Aux windings MAIN FIELD PMG SYSTEM EXCITER Armature 2 2 Mechanical characteristics Steel frame Cast iron end shields Protected ball bearings greased for life Mounting arrangements IM 1201 MD 35 foot and flange mounted single bearing with SAE coupling disc IM 1001 B 34 double bearing with SAE flange and standard cylindrical shaft extension Drip proof machine self cooled Degree of protection IP 23 2 1 1 Mechanical options Air inlet filter Regreasable ball bearings only for LSA 44 2 and SHUNT or AREP version IP 44 protection STATOR 12 wire marking T1 to T 12 T1 17 T2 T8 T3 T9 T4 T10 TS T11 716 712 Power supply Detec
10. 2 5 R438 A V R options Current transformer for parallel operation of 1A 5 VACL 1 Remote voltage adjustment potentiometer 470 Q 0 5 W min adjustment range 5 range limited by internal voltage potentio meter P2 Remove ST4 to connect the po ten tiometer A 1 kQ potentiometer can also be used to extend the adjustment range For wiring up the external potentiometer the earth wires must be isolated as well as the potentiometer terminals wires at the same voltage as the power R731 external module sensing of 3 phase voltage 200 to 500 V compatible with parallel operation Disconnect ST1 to connect the module set the voltage via the module po tentiometer R 734 module detection of 3 phase current and voltage for parallel operation on unba lanced installations imbalance gt 15 R 726 module 3 functions mounted exter nally P F regulation 2F and voltage sensing cir cuit before paralleling 3 F Control through DC voltage used monito ring apply to the terminals for connection of a potentiometer DC voltage e internal impedance 1 5 KQ e 0 5V enable a voltage setting of 10 LEROY SOMER 266 290 LEROY SOMER R438 A V R 3 INSTALLATION COMMISSIONING 3 1 Electrical checks on the AVR Check that all connections have been made properly as shown in the attached wi ring diagram Check that the ST3 frequency selection jumper is on the correct freq
11. P3 if genset started P3 if genset P3 if genset started P3 if genset started P11 if genset started P11 if genset P11 if genset coupled P11 if genset coupled coupled coupled The screen is changed using the scrolling and validation wheel When the wheel is turned clockwise the screens scroll upwards and backwards The screens scroll in a loop Example in a 3P N network after screen 7 then screen 1 and in reverse 6 3 1 6 Display of messages in zone 4 The graphic zone zone 4 is used to display messages relating to the generating set s operation These messages are as follows Initialisation of the TELYS Data displayed Initialisation of the TELYS when switching on and or when loading a configuration SERIAL No 08030010000 l SOFTWARE 6 1 0 Generating set serial number NOMINAL VOLTAGE 400V TELYS software version Alternator nominal voltage FREQUENCY 50Hz Alternator nominal frequency NOMINAL KW 320kW l Nominal active power EARTH SYSTEM TNS Neutral speed Bar graph indicating the screen display time 71 290 Generating set stopped po Screen Data displayed Screen No MANUAL OPERATION Press START Operation mode genset in MAN mode ready to Date and time depending on settings 24 08 2005 AUTOMATIC OPERATION IMPORTANT Operation mode genset in AUTO mode ready to G4 start OO e Date and time depending on settings 24 08 2005 13 12 IMPORTANT Operation mode genset in AUTO mode with
12. gt insulation fault 2 1 Differential fault optional with a differential fault causing the activation of the differential relay the generating set stops immediately also causing the main circuit breaker to be tripped 2 Insulation fault optional with an insulation fault causing the activation of the control unit performing insulation the generating set stops immediately Underspeed fault indicates an incorrect rotation speed below 1000 rpm Emergency stop or external emergency stop fault STOP fault activated if the STOP button is pressed whilst the AUT LED is flashing to indicate that the generating set is operating in automatic mode List of alarms associated with a pictogram Low fuel level alarm Indicates the need to fill up with fuel Alternator charging fault alarm indicates a problem affecting the alternator charging rate 57 290 Associated message Associated message Associated message Associated message Associated pictogram To Sat Associated pictogram EN 6 2 6 MURPHY diagnostic module The fault finding module MDDM is an indicator for analysis and fault finding designed and manufactured for reading information available on the J1939 CAN Bus The fault finding module is easy to use and will enable you to view the values of the various engine parameters and engine operating status codes It shows two lines each o
13. valves and No 3 5 and 6 intake valves A Front of engine E Exhaust valve B No 1 Piston at TDC I Intake valve compression stroke C No 6 Piston at TDC compression stroke FSU e el In A Front of engine B No 1 Piston at TDC compression stroke C No 4 Piston at TDC compression stroke RG7409 UN 06AUG96 RG4776 UN 310CT97 E Exhaust valve I Intake valve 40 2 181 290 RG4777 UN 310CT97 DPSG CD03523 36 19 31JANO7 2 2 072209 PN 83 Maintenance 2000 hours 2 years Checking engine speed Mechanical fuel system NOTE Most engines for generator set application 1500 rom for 50 Hz or 1800 rpm for 60 Hz run only at fast idle and therefore they do not have slow idle Specification Fast idle 50 Hz Generator set 1550 1580 rpm 60 Hz Generator set 1865 1890 rpm NOTE Fast idle is settled by the factory then the idle adjusting screw A is sealed to prevent from tampering Fast idle adjustment can only be done by an authorized fuel system agent CD30763 UN 24SEP99 A Fast idle adjusting screw DPSG CD03523 38 19 31JANO7 1 1 Adjust speed droop governor Mechanical fuel system 1 Warm engine to normal operating temperature Run engine at fast idle 2 3 Apply full load 4 If specified power cannot be obtained turn screw B to adjust droop until the requested power is reached NOTE If surging exits upon removing the load tu
14. 072209 PN 98 Troubleshooting Symptom Engine runs irregularly or stalls frequently Below normal engine temperature Lack of power Low oil pressure Problem Low coolant temperature Clogged fuel filter Water dirt or air in fuel system Dirty or faulty injection nozzles Defective thermostat Defective temperature gauge or sender Engine overloaded Intake air restriction Clogged fuel filter Improper type of fuel Overheated engine Below normal engine temperature Improper valve clearance Dirty or faulty injection nozzles Injection pump out of time Turbocharger not functioning Leaking exhaust manifold gasket Defective aneroid control line Restricted fuel hose Low fast idle speed Low oil level Continued on next page 99 9 197 290 Solution Remove and check thermostat Replace fuel filter element Drain flush fill and bleed system Have authorized servicing dealer or engine distributor check injectors Remove and check thermostat Check gauge sender and connections Reduce load Service air cleaner Replace filter elements Use proper fuel See Engine Overheats Remove and check thermostat See your authorized servicing dealer or engine distributor Have authorized servicing dealer or engine distributor check injectors See your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine di
15. 110 V gt T11 R 438 voltage sensing 0 gt T3 380 V gt T2 LEROY SOMER 229 290 LSA 43 2 44 2 4 POLES ALTERNATORS Winding 50 Hz 60Hz 220 240 220 240 R 250 voltage sensing 0 gt T1 110 V gt T4 R 438 voltage sensing 0 gt T10 220 V gt T1 220 240 220 240 R 250 voltage sensing 0 gt T8 110 V gt T11 R 438 voltage sensing 0 gt T3 220 V gt T2 R 250 voltage sensing 0 gt T8 110 V gt T11 R 438 voltage sensing 0 gt T3 110 V gt T2 Winding Winding A FOR LSA 44 2 THE COUPLING B IS NOT POSSIBLE Connection not 50 Hz 60 Hz 6 220 240 220 240 R 250 voltage sensing 0 gt T8 110 V gt T11 R 438 voltage sensing LM voltage 1 2 LL voltage 0 gt T3 220 V gt T2 LEROY 8 SOMER 230 290 LSA 43 2 44 2 4 POLES ALTERNATORS SINGLE PHASE 4 WIRE type M or M1 DEDICATED WINDING SERIAL CONNECTION PARALLEL CONNECTION Not possible with LSA 44 2 T3 T4 Voltage 50 60Hz 115 T2 T3 T2 T3 120 R 251 voltage sensing 0 gt T1 110 V gt T2 R 251 voltage sensing 0 gt T1 110 V gt T2 3 3 2 Exciter field connection Series connection shunt excitation Parallel connection AREP or PMG excitation AN Single phase dedicated SHUNT version R 251 AVR 2 wire output without terminal block 3 3 3 Option connection diagram R 791 T
16. Faults have priority over alarms Faults are displayed in the descending order of their appearance from the most recent to the oldest 6 3 4 2 Activation of an alarm or fault The appearance of an alarm or a fault causes the corresponding screen to be displayed examples below FAULT FAULT ALARM FAULT Low coolant Level Emergency Stop 06 10 06 10 30 06 10 06 15 30 OK HELP Esc RESET OK HELP Press OK on the scrolling and selection wheel to access the help message if it is available example below Check the level fuel Esc EXIT If the alarm is no longer active it is reset automatically cause disappears Press Esc to reset a fault reset acknowledged if the cause of the fault has been removed reset not performed if the cause of the fault is still present 78 290 6 3 4 3 Activation of an alarm and a fault The appearance of an alarm and a fault causes gt The yellow and red LEDs to flash gt the related screen to be displayed example below FAULTS 1 2 Emergency Stop If several faults are present the number of faults is 25 12 05 15 30 displayed at the top of the screen Esc RESET OK LIST The faults list can be accessed by pressing OK of the scrolling and selection wheel examples below FAULTS Press Esc to return to the previous screen FAULT 25 12 05 15 30 Press OK to go to the HELP screen help on the highlighted fault Emergency Stop Use the scrolling and selection wheel to scr
17. If engine has a rubber dust unloader valve C inspect the valve on bottom of air filter for cracks or plugging Replace as necessary 5 Service air filter as necessary Checking automatic belt tensioner 4045 and 6068 Engines Belt drive systems equipped with automatic spring belt tensioners cannot be adjusted or repaired The automatic belt tensioner is designed to maintain proper belt tension over the life of the belt If tensioner spring tension is not within specification replace tensioner assembly e Checking belt wear The belt tensioner is designed to operate within the limit of arm movement provided by the cast stops A and B when correct belt length and geometry is used If the tensioner stop on swing arm A is hitting the fixed stop B check mounting brackets alternator belt tensioner idler pulley etc and the belt length Replace belt as needed see REPLACING FAN AND ALTERNATOR BELTS A Swing arm stop B Fixed cast stop Continued on next page 35 2 176 290 RG4687 UN 20DEC88 DPSG CD03523 33 19 22JANO7 2 2 RG8098 UN 18NOV97 y 15 Be lt E Earlier design tensioner pro RG13744 UN 11NOV04 Later design tensioner DPSG CD03523 34 19 30JANO7 1 2 072209 PN 78 Maintenance 1000 hours 1 year e Checking tensioner spring tension A belt tension gauge will not give an accurate measure of the belt tension when automatic spring tensioner is used Measure tensione
18. Select Custom Setup OURGP11 00000B1 19 03SEP03 8 18 9 Press the Enter key to display a list of engine CUSTOM SETUP AUTOMATIC SCAN OFF Se O A Lu Nn Re Z D O Oe O x ODO Engine Parameters OURGP11 00000B1 19 03SEP03 9 18 10 Use the Arrow keys to scroll to and highlight a KET selected parameter parameter with a number to right PERCENT LOAD AT CURRENT RPM a 0 ENGINE OIL PRESSURE This number indicates ENGINE COOLANT TEMPERATURE the order of display lor the parameters and 8 A that the parameter is selected for display Select Parameters RG13150 UN 24SEP03 Continued on next page OURGP11 00000B1 19 O3SEP03 10 18 15 18 PN 55 153 290 Operating the Engine 11 Press the Enter key to deselect the selected parameter removing it from the list of parameters ENGINE SPEED being displayed on the 1 Up Display PERCENT LOAD AT CURRENT RPM 3 ENGINE OIL PRESSURE 2 ENGINE COOLANT TEMPERATURE oe Deselect Parameters RG13219 UN 26SEP03 OURGP11 00000B1 19 03SEP03 11 18 12 Use the Arrow keys to scroll and highlight the desired fencing SPEED parameter that has not been selected for display PERCENT LOAD AT CURRENT RPM 2 parameter without a number to right of it ENGINE OIL PRESSURE 4 Note hat tite numbers ENGINE COOLANT TEMP now indicate the new order of display for pS the parameters Select Desired Parameters e O A Lu 09 Z gt
19. mm mm kW hp kW hp kW hp kW hp mm mm mm kg 3029DF120 Diesel 106 5 110 2 9 17 2 1 27 36 30 41 30 41 35 47 519 716 819 316 6 14 5 4039DF008 Diesel 106 5 110 3 9 17 8 1 35 48 38 52 41 56 47 64 588 1016 960 475 12 16 5 3029DF128 Diesel 106 5 110 2 9 17 2 1 26 35 30 41 30 41 34 46 582 888 931 345 6 14 5 4039TF008 Diesel 106 5 110 3 9 17 8 1 55 75 61 83 67 91 73 99 588 1016 979 487 12 16 5 3029TF120 Diesel 106 5 110 2 9 17 2 1 38 51 42 56 43 58 48 64 519 716 819 316 8 14 5 4045DF158 Diesel 106 5 127 4 5 17 6 1 41 56 42 57 48 65 51 69 606 1038 959 493 8 20 Continued on next page 65 1 207 290 3029TF158 Diesel 106 5 110 2 9 17 2 1 36 49 40 54 40 54 45 61 582 888 979 350 8 14 5 4045HF120 Diesel 106 5 127 4 5 17 0 1 91 122 102 137 598 861 980 396 12 28 4045HF158 Diesel 106 5 127 4 5 17 0 1 88 120 96 131 108 147 120 163 798 1209 1197 599 12 28 DPSG CD03523 55 19 08JULO9 1 3 072209 PN 109 Specifications Approximate ITEM UNIT OF MEASURE 4045TF120 4045TF158 4045TF220 4045TF258 Number of Cylinders 4 4 4 4 Fuel Diesel Diesel Diesel Bore mm 106 5 106 5 106 5 106 5 Stroke mm 127 127 127 127 4 5 4 5 4 5 4 5 17 0
20. 11NOV04 A Serial Number Plate 1 EN Record High Pressure Fuel Pump Serial Number CD03523 000018A 19 O6FEBO7 1 1 0 3 z 5 072209 PN 25 123 290 Safety Recognize Safety Information This is a safety alert symbol When you see this symbol on your machine or in this manual be alert to the potential for personal injury Follow recommended precautions and safe operating practices Understand Signal Words A signal wrd DANGER WARNING or CAUTION is used with the safety alert symbol DANGER identifies the most serious hazards DANGER or WARNING safety signs are located near specific hazards General precautions are listed on CAUTION safety signs CAUTION also calls attention to safety messages in this manual Do Not Open High Pressure Fuel System High pressure fluid remaining in fuel lines can cause serious injury Do not disconnect or attempt repair of fuel lines sensors or any other components between the high pressure fuel pump and nozzles on engines with High Pressure Common Rail HPCR fuel system Only technicians familiar with this type of system can perform repairs See your John Deere dealer 05 1 124 290 T81389 UN 07DEC88 DX ALERT 19 29SEP98 1 1 DANGER A WARNING TS187 19 30SEP88 A CAUTION DX SIGNAL 19 O3MAR93 1 1 TS1343 UN 18MAR92 DX WW HPCR1 19 07JANO3 1 1 072209 PN 26 Engine lifting procedure Ma The only recommended method fo
21. 1500 1204 764 32 32 ITEM UNIT OF MEASURE 6068TF158 6068TF220 6068TF258 Number of Cylinders 6 6 6 Continued on next page DPSG CD03523 55 19 08JULO9 2 3 072209 65 2 PN 110 208 290 Specifications ITEM UNIT OF MEASURE 6068TF158 6068TF220 6068TF258 Fuel Diesel Diesel Diesel Bore 106 5 106 5 106 5 Stroke 127 127 127 Displacement 6 8 6 8 6 8 Compression Ratio 17 0 1 17 0 1 17 0 1 POWER 1500 rpm 92 125 109 146 105 143 Prime POWER 1500 rpm 101 137 121 162 116 158 Standby POWER 1800 rpm 108 147 124 169 Prime POWER 1800 rpm 119 162 137 186 Standby Width overall 652 652 Length overall 1364 1364 Height overall 1070 1070 Weight dry 651 651 Engine oil quantity L 20 20 Engine coolant quantity L 28 28 With Fan Approximate DPSG CD03523 55 19 08JULO9 3 3 6 5 2 3 072209 PN 111 209 290 Specifications General engine pack specifications Stage Il Emission Certified Engines ITEM UNIT OF 3029HFS70 3029HFU70 3029TFS70 3029TFU70 MEASURE Number of Cylinders 3 3 3 3 Fuel Diesel Diesel Diesel Diesel Bore mm 106 5 106 5 106 5 106 5 Stroke mm 110 110 110 110 Displacement L 2 9 2 9 2 9 2 9 Compression Ratio 2 17 2 1 17 2 1 17 2 1 POWER 1500 kW hp 37 50 37 50 28 37 28 37 rom Prime POWER 1500 kW hp 41 56 41 56 31 41 31 41 rpm Standby POWER 1800 kW hp rom Prime POWER 1800 kW hp rpm Standby Width overall mm 582
22. 50 50 Drain cooling system and refill with recommended glycol base engine coolant as soon as possible COOL GARD is a trademark of Deere amp Company DX COOL6 19 03NOV08 1 1 4 0 pe 4 072209 PN 37 135 290 Operating the Engine Using Diagnostic Gauge to Access Engine Information Optional equipment 2 Diagnostic Gauge A Diagnostic Gauge C Arrow Keys E Red STOP ENGINE B Menu Key D Enter Key Indicator Light F Amber WARNING Indicator Light NOTE Generator sets powered by an electronically e Coolant temperature controlled engine DE10 or HPCR fuel system e Oil pressure can be optionally equipped with the diagnostic e Throttle position gauge shown Depending on the generator e Intake manifold temperature set manufacturer other instrumentations e Current fuel consumption can be used Refer to the generator set e Active service diagnostic codes documentation for more information e Stored service diagnostic codes from the engine e Set the units for display The diagnostic gauge A allows the operator to view e View the engine configuration parameters many readouts of engine functions and trouble codes E DTCs The gauge is linked to the electronic control NOTE Engine parameters which can be accessed system and its sensors This allows the operator to will vary with the engine application Six monitor engine functions and to troubleshoot the engine languages for readouts are a
23. A A A eee 40 4 Viewing active Service CODES cooccocononcnonrnrnrararonono 15 7 Diagnostic PDroced fe nesiou ooien leonel loli 55 10 Viewing configuration data oomommmmmmmmm 15 3 Using diagnostic gauge 15 1 Viewing stored service COMES ooococcocncanononrananencnraos 15 5 Diagnostic trouble codes DTCs Intermittent fault diagnosticS ooccconconnconnconncos 55 13 Active engine service codes VIEWING 15 7 Stored service codes viewinQ ooooccccinincinccoo 15 5 L Diagnostic Trouble Codes DTCS occoocccccnccccncocncnos 55 11 Diagnostic gauge nesccaine A 55 10 Listing of DIES a 55 11 Dieselengine Olivas ld 10 2 Lubricant Diesel fuel ennaa A 10 1 A E ncodartarmtagastan 10 3 DTCs Diagnostic Trouble Codes OAS a i 10 3 View active service COU8S occoccoccccocccnccoconocononononos 15 7 View stored Service codes ccccoccccccccccccconcnicononnnos 15 5 M E Maintenance 1000 hours 1 year Engine Check and adjust valve clearance 3029 OPE at 15 29 e 35 3 Engine Control Unit ECU serial number 03 5 Checking air intake system oocccncccncccnnconnco 35 1 Engine oil Checking automatic belt tensioner RES AI tease eatin crol ltd 10 2 4045 and 6068 Engines coocoonccccccccccconcnnnoo 35 2 re Tn 10 2 Cleaning crankcase vent tube oocccccco cc 35 1 e tes 30 1 Pressure testing cooling systemM 35 5 Engine speed Mechan
24. Automatic Scan functions have been set press the USE DEFAULTS Menu key to return to the main menu CUSTOM SETUP AUTOMATIC SCAN ON RG13224 UN 26SEP03 Menu Key OURGP11 00000B1 19 03SEP03 17 18 19 Press the Menu key to exit the main menu and return F to the engine parameter display aan 1000 RPM 1800 RPM 14 2 27 PSI BAT WOLT AL PRES RG13159 UN 26SEP03 Exit Main Menu OURGP11 00000B1 19 03SEP03 18 18 Setup 4 Up Display Bae REN LOA PA ENG RPM 1 Turn the key switch to the ON position From the single or four engine parameter display press the 1300 RPM 14 2 57 PSI Menu key BAT VOLT CIL PRES RG13159 UN 26SEP03 Menu Key OURGP11 00000B2 19 03SEP03 1 14 The main menu will be displayed Use the Arrow keys to scroll through the menu until Setup 4 Up Display is highlighted GO TO 1 UP DISPLAY STORED CODES ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT RG13225 UN 020CT03 Select Setup 4 Up Display Continued on next page OURGP11 00000B2 19 03SEP03 2 14 15 21 PN 58 156 290 Operating the Engine 3 Once the Setup 4 Up Display menu item has been a i E GO TO 1 UP DISPLAY highlighted press the Enter key to activate the STORED CODES Setup 4 Up Display menu ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT A RS E E AA OCIO Press Enter Key RG13226 UN 020CT03
25. Battery voltage 19 290 EN 2 3 Identifying sets Generating sets and their components are identified by means of identification plates The precise rules for identifying each major component engine alternator etc are set out in each manufacturer s documentation contained in the appendices of this manual 6 12 10 2 1 7 3 14 16 y ACTROGEWNE GENERATING SET PRESSION ACOUSTIQUE SOUND PRESSURE z i im Tm 415m A 74 9 E oz 2 65 61 Version Masse Kg Cos Phi PUISSANCE ACOUSTIQUE SOUND POWER h 7 rom r z sl EL 2000414 aoso Yso gs oe gt EN i i hy 7 a gt 1 Generating set 9 Maximum ambient temperature for the rated power 2 Manufacturer name C 3 Model 10 Rated frequency Hz 4 Serial number 11 Generating set rotation speed RPM 5 Year of manufacture 12 Rated voltage V 6 Rated output kVA and kW according to the ISO 13 Rated current A 8528 1 standard 14 Weight kg PRP main power 15 CE marking ESP emergency power 16 Non CE standard marking e g GOSSTANDART 7 Rated power factor 17 Sound pressure 8 Maximum altitude of the site above sea level m 18 Sound power for the rated power Figure 10 Example of a generating set identification plate 20 290 EN 2 4 Fluid retention Any outflow of the fluids contained in the generating sets fuel oil and coolant or rainwater or condensation will be coll
26. Check Wiring OURGP12 00001E2 19 15MAR06 1 2 072209 PN 105 Troubleshooting SPN 000627 000629 000636 000637 000639 000651 000652 000653 000654 000655 000656 000898 000970 000971 001069 001079 001080 001109 001110 001347 001568 001569 002000 FMI 01 13 02 08 10 02 07 08 10 13 05 06 07 05 06 07 05 06 07 05 06 07 05 06 07 05 06 07 09 31 31 09 31 03 04 03 04 31 31 03 05 07 02 31 13 Description of Fault All Injector Currents Are Low ECU Programming Error Engine Position Sensor Signal Unreliable Engine Position Sensor Signal Missing Engine Position Sensor Signal Rate of Change Abnormal Engine Timing Sensor Signal Unreliable Engine Timing and Position Sensors Out of Sync Engine Timing Sensor Signal Missing Engine Timing Signal Rate of Change Abnormal CAN Bus Error Communication network problem Injector Number 1 Circuit Has High Resistance Injector Number 1 Circuit Has Low Resistance Injector Number 1 Not Responding Injector Number 2 Circuit Has High Resistance Injector Number 2 Circuit Has Low Resistance Injector Number 2 Not Responding Injector Number 3 Circuit Has High Resistance Injector Number 3 Circuit Has Low Resistance Injector Number 3 Not Responding Injector Number 4 Circuit Has High Resistance Injector Number 4 Circuit Has Low Resistance Injector Number 4 Not Responding Injector Number 5 Circuit Has High Resistance
27. ENGINE OIL PRESSURE LOW CORRECTIVE ACTION CHECK OIL LEVEL NEXT gt RG13239 UN 29SEP03 Redisplay Trouble Code OURGP11 00000AE 19 03SEP03 5 6 6 The single or four parameter screen will display the shutdown icon until the trouble code condition is corrected IMPORTANT Ignoring the shutdown message can a curse result in severe engine damage RG13180 UN 26SEP03 Shutdown Icon OURGP11 00000AE 19 03SEP03 6 6 Adjusting Backlighting 03 DUREN LOA LPM ENG AFA 1 Turn the key switch to the ON position Starting at 1800 RPM the single or four engine parameter display press the Menu key HIE cool Temp Ea o RG13159 UN 26SEP03 Menu Key OURGP11 0000237 19 210CT03 1 6 2 The main menu will be displayed Use the Arrow TAA baat GO TO 1 UP DISPLAY keys to scroll through the menu until Adjust Backlight STORED CODES Is highlighted ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT RG13181 UN 020CT03 Select Adjust Backlight Continued on next page OURGP11 0000237 19 210CT03 2 6 15 10 mn 145 290 Operating the Engine 3 Once the Adjust Backlight menu item has been highlighted press the Enter key to activate the e nl ata Adjust Backlight function ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT COG Press Enter Key RG13182 UN 020CT03 OURGP11 0000237 19 210CT03 3 6 4 Use
28. ae ime kel Es Pump control valve fuel flow not detected Pump control valve 2 status Only for 6081HF070 Pump control valve 2 error mismatch Pump control valve 2 fuel flow not detected 285 290 EN i O Pump power relv statis ECU main relay of VOLVO dd y EMS EDC ECU main relay short circuit high Torque curve selection Torque curve selection invalid E AAA i Torque curve input voltage high leal Torque curve selection missing cm fd a 2 E c o9 cO O O 70a Sa A lt O 2 Fase o Fan speed zero or absent 1 2 GME soson ee setpoint for at least 180s a MEA setpoint for at least 180s 200 A EcUstatus O Vehicle ID missing 13 MN Security violation o o 2630 J Artemperature atthe air cooler outlet Air temperature extremely high J Sensor input voltage high ShorttoVe Sensor input voltage low ShorttoW PO A a z ATT Fow level ore EG valve Calculates EGR ownotvaid SYS Calculated EGR owrathertigh OOOO a A CAM P Calculated EGR flow rather low Air temperature at turbo compressor outlet Temperature at compressor outlet moderately high E Statuses of the EGR valve Valve position signal not valid A AAA Tj Input voltage of the position sensor high Short to V ne Input voltage of the position sensor low Short to V Inability of the EGR valve to reach the expected position SEA The EGR valve is
29. defined in this manual The machine is tested and set up at the factory When first used with no load make sure that the drive speed is correct and Stable see the nameplate With the regreasable bearing option we recommend greasing the bearings at the time of commissioning see 4 2 2 On application of the load the machine should achieve its rated speed and voltage however in the event of abnormal operation the machine setting can be altered follow the adjustment procedure in section 3 5 If the machine still operates incorrectly the cause of the malfunction must be located see section 4 4 3 5 Setting up The various adjustments during tests must be made by a qualified engineer Ensure that the drive speed specified on the nameplate is reached before commencing adjustment After operational testing replace all access panels or covers The AVR is used to make any adjustments to the machine LEROY 10 SOMER 232 290 LSA 43 2 44 2 4 POLES ALTERNATORS 4 SERVICING MAINTENANCE 4 1 Safety measures Servicing or troubleshooting must be carried out strictly in accordance with instructions so as to avoid the risk of accidents and to maintain the machine in its original state All such operations performed on the alternator should be undertaken by personnel trained in the commissioning servicing and maintenance of electrical and mechanical components who must wear personal protective equipme
30. petrol oil cloth etc It is prohibited to put combustible materials on the hot parts of the equipment for example exhaust pipe Avoid any contact with the hot parts of the equipment for example exhaust pipe Use appropriate ventilation to allow the equipment to cool correctly Wait for the engine to stop and cool down completely before removing the radiator cap Wait for the equipment to stop and cool down completely before covering the equipment if necessary Depressurise the air oil and cooling circuits before removing or disconnecting all the fittings pipes or connected components ot RA A A ES Ensure that the equipment in operation is fixed in a stationary position When installing the equipment on a vehicle or other mobile equipment a study must be conducted beforehand in order to take into account the various specific uses of the generating set IMPORTANT 11 290 Fuels Respect current local regulations regarding the equipment and fuel used petrol diesel and gas Top up the engine with fuel when the engine has stopped except for equipment with an automatic filling system Smoking using a flame or producing sparks are forbidden while the fuel tank is being filled Use protection suitable against fires and explosions Pipes must be replaced as soon as their condition demands it Oils Check that the system is no longer pressurised before carrying out any procedures Avoid contact w
31. the Fault Lamp CODES DTCS later in this Group will flash a code 88 1 Press down Override Shutdown Switch while turning Once complete this sequence will repeat the Ignition switch ON 6 When complete turn ignition OFF times long pause This example is code 32 flash three times short pause flash two times long The ECU begins the flashing sequence by flashing pause flash one time short pause flash eight a code 32 this indicates the start of blinking active times long pause flash three times short pause flash codes If there are any active DTCs the ECU will flash three times long pause flash five times short its 2 digit number If there is more than one active pause flash three times DTC the ECU will flash each code in numerical order CD03523 0000191 19 O2FEBO7 1 1 072209 55 9 PN 103 201 290 Troubleshooting Using diagnostic gauge for retrieving Diagnostic Trouble Codes DTC s NOTE The method below applies on applications having the optional diagnostic gauge shown refer to the generator documentation for more information 1 Make sure all engine mechanical and other systems not related to the electronic control system are operating properly See ENGINE TROUBLESHOOTING in this section NOTE Diagnostic gauge A uses the menu key B to access various engine functions two arrow keys C to scroll through the engine parameter list and view the menu list and an
32. 1 17 0 1 17 0 1 17 0 1 63 84 61 83 75 101 72 98 Diesel Displacement L Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall mm 598 606 598 652 Length overall mm 861 1191 861 1225 Height overall mm 980 1027 980 1027 Weight dry kg 396 505 396 520 Engine oil quantity L 12 12 12 12 Engine coolant L 25 25 25 25 quantity kW hp kW hp 70 94 68 92 83 111 80 109 kW hp 72 98 90 121 80 109 kW hp 79 107 100 134 88 120 With Fan Approximate ITEM UNIT OF MEASURE 6068HF120 115 6068HF120 183 6068HF158 6068HF258 Number of Cylinders Fuel Bore Stroke Displacement Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate kW hp kW hp kW hp kW hp 6 Diesel 106 5 127 6 8 17 0 1 140 188 155 208 623 1141 1009 569 20 32 6 Diesel 106 5 127 6 8 17 0 1 166 223 183 245 623 1141 1009 569 20 32 6 Diesel 106 5 127 6 8 17 0 1 134 182 148 201 164 223 187 254 798 1500 1136 705 20 32 6 Diesel 106 5 127 6 8 17 0 1 160 218 177 241 179 243 200 272 798
33. 1 3 Unloaging the Generating Selina A A A ot 36 4 1 3 1 A i pe celal Sil aa an a a EE 36 4 1 3 2 Ss ol aaus Se Menten en cece eae he a Meee Set Rene MERE MEP e aeen amet ee mere Mate eT eee etree eT Mente ce weet ieee 37 4 1 4 Moving the generalidad anaatalave eed innate Geeks iietlannabs bse samanentsbdeva dea cunauksbawnadCetouretabiened avs 37 4 2 Connectina he generatna Sel cone A A oia 38 42 1 Connection SUMMA Visiter Gents e IS end add A E r e oes 38 4 2 2 Protecting people a a egumen tul ii a a ween sGeckues ances as Saas as ee ee ends cece 39 4 2 2 1 Earihnind systentoraciple syrerne ee e a e ea 39 4 2 2 2 IES AA A E et ret ed E OER A SEE AA eae ae E OAA E E AE TE EEE EEE 39 4 2 2 3 Installing the differential protection oooomoiionnii ii ia aaa abad dia 40 4 2 2 4 Setting the generating set differential protectiON oocccoonncncoccncnoconcnnonononnnnnnonononcnonrcnnonnrnnnnnnrnrnnnnnnnnnnnnrnnnnnncnnnnos 41 4 2 2 5 Eann the generating Str A AA AAA A AA a 43 4 23 Making the Conneccion Sii ide 44 4 2 3 1 Connections General IMOMMAUOM issis tescas eii a a e i E a a dene meudenstumiens 44 4 2 3 2 Selecting the DOWETCADIES iii A aaa a A a a tb 45 4 2 3 3 Connecting the generating set to the Installation ooooccccoonnnncnocnnnonononononcnnnnnnnnnnnononnonnrnnnnnnncnnnnnnnnnnnnrnnonnncnnos 46 4 2 3 4 Connecting the battery or batteries to the generating S t oocccccconcncoconnnoconcnnononon
34. 2 2 1 Earthing system principle The Earthing system or SLT formerly Neutral system of the electrical installation defines the situation of the generating set neutral in relation to earth and the grounds of the electrical installation at the user end Our generating sets are designed to operate with the TT system or EDF application depending on the option for France only 4 2 2 2 TT system In the TT earthing system automatic power cut off via a Residual Current Device RCD is obligatory at the upstream part of the installation to ensure that personnel are protected additionally a maximum 30 mA device must be installed on outlet circuits Ph 1 Ph 2 Ph 3 PE Ground connected to earth T Neutral earth Ground earth A Equipment Figure 15 TT earthing system The alternator neutral is earthed the grounds of the user equipment have their own earth connection 39 290 4 2 2 3 Installing the differential protection The generating set is equipped with a residual current device in order to guarantee individuals are protected from electric shocks with the TT system This may be fixed vigi unit or adjustable Resys depending on the option chosen e If the generating set s residual current device is fixed and the activation threshold is set to 30 mA it is guaranteed to protect people e If the generating set s residual current device is fixed and the activation threshold has been set at 300 mA a 30mA re
35. 423 N 85 94 Ib force l NOTE Belt is considered used after 10 minutes S of operation O b Use of tension tester B and straightedge C A 89 N 20 Ib force applied halfway between pulleys should deflect belt by 19 mm 0 75 in 3 If adjustment is necessary loosen alternator nuts D and E Pull alternator frame outward until belt is o correctly tensioned z IMPORTANT Do not pry against the alternator 7 rear frame Do not tighten or loosen gt belts while they are hot o 4 Tighten alternator bracket nuts firmly 5 Run engine for 10 minutes then recheck belt tension A JDG529 Tension Gauge D Upper nut B Tension tester E Lower nut C Straightedge 1 F DPSG CD03523 31 19 30JANO7 1 1 3 0 5 072209 PN 75 173 290 Maintenance 500 hours Checking belt 4045 and 6068 Engines with manual tensioner Inspect belts for cracks fraying or stretched out areas Replace if necessary NOTE Belt adjustment is measured using a gauge stamped on the top edge of the alternator bracket Loosen cap screws B and C Slide alternator in slot by hand to remove all excess eh y J f E O slack in belt Scribe a reference mark D on line with NA k S notch E on upper alternator bracket RG9132 UN 040CT99 a en y Manual belt tensioner on 4045 and 6068 engines IMPORTANT Do not pry against alternator rear frame 3 Using the gauge A on the alternator bracket stretch belt by prying outward
36. 480V 60Hr 3 gt 440 BOs Configuration selector 2093 A08 MENU 1 gt 400V 50H 2 450W 60H 3 gt 440 OKs Potentiometer 200308 Warning when switching to 60Hz do not use sockets if fitted to the generating set IMPORTANT 92 290 9 2 Neutral system Turn the switch to the desired neutral system Select the neutral system with the generating set switched off 9 3 Fuel supply valve The 3 way valve is used to select between the generating set fuel tank and an external fuel supply Valve in vertical position no 1 generating set supplied by the daily service tank Valve in horizontal position no 2 generating set supplied by the external tank 93 290 94 290 EN 10 Appendix 10 1 Appendix A Engine user and maintenance manual 95 290 96 290 User guide and maintenance manual JOHN DEERE OMCD16564 06 07 2009 Engine 3029TF120 3029DF120 6068TF220 4045TF220 4045HF120 4045TF120 6068HF120 153 3029TFS70 TF270 3029HFS70 HF270 4045HFS72 HF275 4045HFS73 HF279 4045HFS80 HE280 4045HFS82 HF285 4045HFS83 HE285 4045TFS70 TF270 6068HFS72 HF275 6068HFS73 HF279 6068HFS76 HF475 6068HFS82 HF285 6068HFS83 HF285 6068HFS77 HF475 6068HFS89 HF485 97 290 33522039401 4 1 98 290 Engines amp Power Units for Generator Sets Saran Built OPERATOR S MANUAL Engines amp Power Units for Generato
37. 582 582 582 Length overall mm 888 888 888 888 Height overall mm 974 974 974 974 Weight dry kg 350 350 350 350 Engine oil quantity L 8 8 8 8 Engine coolant 14 5 14 5 14 5 14 5 quantity With Fan Approximate ITEM UNIT OF 4045HFS72 4045HFS73 4045HFU72 4045HFU79 MEASURE Number of Cylinders 4 4 4 4 Fuel Diesel Diesel Diesel Diesel Bore mm 106 5 106 5 106 5 106 5 Stroke mm 110 110 127 127 Displacement L 4 5 4 5 4 5 4 5 Compression Ratio 17 0 1 19 0 1 17 0 1 19 0 1 POWER 1500 kW hp 75 100 94 126 75 100 94 126 rpm Prime POWER 1500 kW hp 83 111 103 138 83 111 103 138 rpm Standby POWER 1800 kW hp rpm Prime POWER 1800 kW hp rpm Standby Width overall mm 751 765 751 765 Length overall mm 1362 1365 1362 1365 Height overall mm 1137 1162 1137 1162 Weight dry kg 505 505 505 505 Engine oil quantity L 16 16 16 16 Engine coolant 28 32 28 32 quantity With Fan Approximate Continued on next page 65 4 210 290 CD03523 0000194 19 08JULO9 1 3 072209 PN 112 Specifications ITEM Number of Cylinders Fuel Bore Stroke Displacement Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 01800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate ITEM Number of Cylinders Fuel Bore S
38. Air intake system o e eet 35 1 Fuel rn cp tat hel hate eget 10 1 B Handling and sStoring occooccooncconcocnnocnnononanonnnos 10 1 Fuel filter Belt Replace Meis ide eet re lee tele 30 4 Check automatic tensioner 35 2 Fuel pump model nUMDeT ccccccccccccnnccccncnnncnnnannnnnnss 03 5 Check tensiON sia ideado 30 5 Fuel system Replace 4045 and 6068 engines oooocci 50 5 A emer rene tenner te entre ee Sem etre ester at eee nner 50 5 Bolt and screw torque values ISH cach cheater eee cece NA 65 9 H DAME WCE raras 65 8 Break in engine Olil cocooooccnccccnininncinnnncnnnnos 10 2 Hardware torque values Met dio dea 65 9 C UNMSd IC 65 8 Configuration data viewing oocccocnccocncocncnncncnnnos 15 3 Coolant Diesel engine carr a 10 3 Instrument panel Drain and flush cooling system cece 45 1 Adjust backlighting a acota 15 10 Pressure testing cooling system ccoocccccnccncc 35 5 AQJUSFCONTAS Eeoae iaaa 15 12 Warm temperature climates occcocnconnconnco 10 4 Changing units of measure oococcccocccocnconiconiconons 15 13 Crankcase vent tube Main menu NavigatiON occooccccncccncconcocicnconnnnnonos 15 1 A enn S 35 1 Setup 1 p diS picadito 15 15 Setup 4 up display occooccoccnccccncconccncnccncnonanonos 15 21 D SnutdoOWNCOJES issia e E S 15 9 Using diagnostic JaUYE oocccccccocccncococonoconononanonanos 15 1
39. Cover with Gears Balancer Shaft Cylinder Block With Liners and Camshaft Crankshaft and Bearings Connecting Rods and Pistons Valve Actuating Mechanisms Record the fuel injection pump model and serial information found on the serial number plate A Model No RPM Manufacturer s No Serial No Description Exhaust Elbow Turbocharger Temperature Switch Electronic Tachometer Sensor Damper Engine Serial Number Plate ECU Electronic Software Option Air conditioner Compressor Mounting Air Restriction Indicator Oil Pressure Switch Primary Fuel Filter Electronic Software Electrical Wiring Harness Fan Pulley Automatic Belt Tensioner Oil Filter Special Equipment Factory Installed Vehicle Timing Identification label Special Equipment Field Installed Shipping DPSG CD03523 14 19 22JANO7 2 2 CD30749 UN 24SEP99 DPSG CD03523 15 19 22JANO7 1 1 072209 PN 24 Serial Numbers Record Engine Control Unit ECU Serial Number Record the part number and serial number information found on the serial number label A on the Engine Control Unit ECU mounted on or near the engine Part No Serial No RG14635 UN 13APR06 A Serial Number Label ecord Record High Pressure Fuel Pump Model Number Record the high pressure fuel pump model and serial number information found on the serial number plate A Model No Y CC RPM Manufacturer s No Serial No RG13718 UN
40. EE E Sauna son E Gos eae nine Peace snda TE E 5 2 2 U F FONCTION and LAM ccccccececececccccccucccucucuauacaeaenecacueuuauauausenenecaeucueauavavaeaeneneeenacenas 5 2 30 TAZ OO ANV ROPI Siew ira tose eshte O 5 24 LAM GiatracteriStiCs a e eae 6 2 52 TYpical CMECIS Ol TGA tp lis 7 3 INSTALLATION COMMISIONING cccccecccceccecececcecececcecccnscececnscesaensceeueesceeuensaeenensaeensnss 8 3 1 Electrical checks on the AVR ee eee ape cs a cando do ats 8 Oe AOC LIN E E T E ice utente AE N A A NE E ET 8 OO a A a a a A 9 A SPARE PAR VS AE EE E a 10 A r a a a O 10 4 2 Technical support service ai dead innen aca dcadeetiaestdaanciseebeteseGaner 10 Any maintenance or breakdown operations on the A V R are to be done by personnel trained on commisioning servicing and maintenance for the electrical and mechanical elements The R250 is an IPOO product It must be installed inside a unit so that this unit s cover can provide IP20 minimum total protection it must only be installed on LS alternators in the appropriate location so that when viewed externally it has a higher degree of protection than IP20 Copyright 2005 MOTEURS LEROY SOMER This document is the property of MOTEURS LEROY SOMER It may not be reproduced in any form without prior authorization All brands and models have been registered and patents applied for LEROY SOMER 3 249 290 LEROY SOMER R250 A V R 1 SUPPLY The regulator controls
41. Exists Engine Speed Extremely High Engine Speed Moderately High Injector Shorted to Power Injector Shorted to Ground Sensor Supply 2 Voltage High Sensor Supply 2 Voltage Low Continued on next page 99 11 203 290 Trouble Codes Corrective Action Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Contact Servicing Dealer Check Switch and Wiring Check Switch and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Contact Servicing Dealer Contact Servicing Dealer Contact Servicing Dealer Contact Servicing Dealer Check Sensor and Wiring Check Sensor and Wiring Stop and Drain Water Separator Check Oil Level Check Sensor and Wiring Check Sensor and Wiring Check Oil Level Check Air Cleaner Aftercooler or Room Temperature Check Sensor and Wiring Check Sensor and Wiring Check Air Cleaner Aftercooler or Room Temperature Check for plugged air filter Check Cooling System Reduce Power Check Sensor and Wiring Check Sensor and Wiring Check Cooling System Reduce Power Check Cooling System Reduce Power Check Operator s Manual Adding Coolant Contact Servicing Dealer Contact Servicing Dealer Add Fuel or Switch Fuel Tanks Check Sensor and Wiring Check Sensor and Wiring Add Fuel or Switch Fuel Tanks Check Fault Codes or Contact Servicing Dealer Reduce Engine Speed Reduce Engine Speed Check Wiring Check Wiring Check Wiring
42. Graisse Grease Valeurs excit Excit values en charge full load po vide atnoload e J excitation system C AREP J SHUNT or PMG e 6 4 winding number number of poles 1 3 1 Nameplate So that you can identify your machine quickly and accurately we suggest you write its specifications on the nameplate below 1 4 Storage Prior to commissioning machines should be stored Away from humidity lt 90 after a long period of storage check the machine insulation section 3 2 1 To prevent the bearings from becoming marked do not store in an environment with significant vibration 1 5 Application These alternators are mainly designed to produce electricity in the context of applications involving the use of generators 1 6 Contraindications to use Use ofthe machine is restricted to operating conditions environment speed voltage power etc compatible with the characteri stics indicated on the nameplate e i Q SM arreenarzues NUIT ALTERNATORS PUISSANCE RATING Tension v Voltage O Th x Connex B o ZAS Continue kVA N Continuous kW 40C la Secours kVA Std by 7 Do Po kW 27C Tension maxi maximum voltage A 166631 C Conforme C E I 60034 1 According to I E C 60034 1 Cc US
43. Injector Number 5 Circuit Has Low Resistance Injector Number 5 Not Responding Injector Number 6 Circuit Has High Resistance Injector Number 6 Circuit Has Low Resistance Injector Number 6 Not Responding Vehicle Speed or Torque Message Unreliable External Shutdown Commanded External Fuel Derate Switch Active Tire Size Invalid Tire Size Error Sensor Supply 1 Voltage High Sensor Supply 1 Voltage Low Fuel Rail Pressure Sensor Supply Voltage High Fuel Rail Pressure Sensor Supply Voltage Low Engine Protection Shutdown Warning Engine Protection Shutdown High Pressure Fuel Pump Control Valve Signal Out of Range High High Pressure Fuel Pump Solenoid Number 1 Circuit Has High Resistance High Pressure Fuel Pump Not Able to Meet Required Rail Pressure Requested Torque Curve Signal Unreliable Engine in Derate Condition Security Violation 95 12 204 290 Corrective Action Check Battery Voltage and Wiring Contact Service Dealer Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Check Sensor and Wiring Contact Servicing Dealer Check Injector Wiring or Injector Solenoid Check Injector Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Check Injector Wiring or Injector Solenoid Check Injector Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Check Injector Wiring or Injector Solenoid Check Injector
44. Nem Ib in Nim Ib in Nem _ Ib in Nem Ib in Nem Ib in N m Ib in 1 4 3 7 33 4 7 42 6 53 7 5 66 9 5 84 12 106 13 5 120 17 150 Nm Ib ft N m Ib ft 5 16 7 7 68 9 8 86 12 106 15 5 137 19 5 172 25 221 28 20 5 35 26 Nm Ib ft Nm Ib ft 3 18 13 5 120 17 5 155 22 194 27 240 35 26 44 32 5 49 36 63 46 Nim Ib ft Nm Ibft Nm Ib ft 7 16 22 194 28 20 5 35 26 44 32 5 56 41 70 52 80 59 100 74 N m Ib ft 1 2 34 25 42 31 53 39 67 49 85 63 110 80 120 88 155 115 9 16 48 35 5 60 45 76 56 95 70 125 92 155 115 175 130 220 165 5 8 67 49 85 63 105 17 135 100 170 125 215 160 240 175 305 225 3 4 120 88 150 110 190 140 240 175 300 220 380 280 425 315 540 400 7 8 190 140 240 175 190 140 240 175 490 360 615 455 690 510 870 640 1 285 210 360 265 285 210 360 265 730 540 920 680 1030 760 1300 960 1 1 8 400 300 510 375 400 300 510 375 910 670 1150 850 1450 1075 1850 1350 1 1 4 570 420 725 535 570 420 725 535 1280 945 1630 1200 2050 1500 2600 1920 1 3 8 750 550 950 700 750 550 950 700 1700 1250 2140 1580 2700 2000 3400 2500 1 1 2 990 730 1250 930 990 730 1250 930 2250 1650 2850 2100 3600 2650 4550 3350 Torque values listed are for general use only based on the strength of the bolt Replace fasteners with the same or higher grade If higher or screw DO NOT use these values if a different torque value or tightening grade fasteners are used tighten these to the strength of the procedure is given for a specific application For
45. O Continued on next page DPSG CD03523 36 19 31JANO7 1 2 072209 40 1 PN 82 180 290 Maintenance 2000 hours 2 years 3 Check and adjust valve clearance to specifications according to following procedures Specification Valve clearance engine Cold SIALAK Chcscantatc steven ccna man hedsicawe ssa AEN 0 35 mm 0 014 in EX arado 0 45 mm 0 018 in 4 lf valves need adjusting loosen the locknut on rocker O arm adjusting screw Turn adjusting screw until feeler gauge slips with a slight drag Hold the adjusting screw from turning with screwdriver and tighten locknut to 27 N m 20 Ib ft Recheck clearance after tightening locknut Readjust clearance as necessary Reinstall rocker arm cover and crankcase vent tube e 4 Cylinder Engine NOTE Firing order is 1 3 4 2 a Lock No 1 piston at TDC compression stroke B b Adjust valve clearance on No 1 and 3 exhaust valves and No 1 and 2 intake valves c Rotate flywheel 360 Lock No 4 piston at TDC compression stroke C d Adjust valve clearance on No 2 and 4 exhaust valves and No 3 and 4 intake valves e 6 Cylinder Engine NOTE Firing order is 1 5 3 6 2 4 a Lock No 1 piston at TDC compression stroke B b Adjust valve clearance on No 1 3 and 5 exhaust valves and No 1 2 and 4 intake valves c Rotate flywheel 360 Lock No 6 piston at TDC compression stroke C d Adjust valve clearance on No 2 4 and 6 exhaust
46. S Q 5 FD000047 A Do the following BEFORE STARTING THE ENGINE for E IMPORTANT DO NOT fill above the crosshatch area the first time each day Oil levels anywhere within crosshatch are IMPORTANT DO NOT add makeup oil until the oil considered in the acceptable operating range level is BELOW the add mark 1 Check engine oil level on dipstick A Add as required using seasonal viscosity grade oil See DIESEL ENGINE OIL Add oil at rocker arm cover filler cap B Continued on next page DPSG CD03523 27 19 07FEBO7 1 4 25 1 072209 PN 68 166 290 Maintenance Daily or every 10 hours TS281 UN 23AUG88 CD30756 UN 26AUG99 Remove radiator cap E and check coolant level which should be at bottom of filler neck Fill radiator P ited Explosive release of fluids with proper coolant solution if level is low See from pressurized cooling system can DIESEL ENGINE COOLANT Check entire cooling cause serious burns system for leaks Only remove filler cap when engine is cold or when cool enough to touch with bare hands Slowly loosen cap to first stop to relieve pressure before removing completely DPSG CD03523 27 19 07FEBO7 2 4 3 If air filter has a dust unloader valve C squeeze valve tip to release any trapped dirt particles 4 Check air intake restriction indicator D When indicator is red air filter needs to be cleaned IMPORTANT Maximum air intake restriction is 6 25 kPa 0 06 bar 1 0 psi 25
47. Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Check Injector Wiring or Injector Solenoid Check Injector Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Check Injector Wiring or Injector Solenoid Check Injector Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Check Injector Wiring or Injector Solenoid Check Injector Wiring or Injector Solenoid Injector Failed or Flow Limiter Closed Contact Servicing Dealer Not Engine Fault Check Other Shutdown Devices Not Engine Fault Check Other Shutdown Devices Contact Servicing Dealer Contact Servicing Dealer Check Wiring Check Wiring Check Wiring Check Wiring Shut Down Engine Check Fault Codes Shut Down Engine Check Fault Codes Contact Servicing Dealer Check Pump Wiring Check Fuel Filter and Lines Contact Servicing Dealer Check Fault Codes Contact Servicing Dealer OURGP12 00001E2 19 15MAR06 2 2 072209 PN 106 Troubleshooting Intermittent Fault Diagnostics With Electronic Controls Intermittent faults are problems that periodically go away A problem such as a terminal that intermittently doesn t make contact can cause an intermittent fault e f the problem is intermittent try to reproduce the Other intermittent faults may be set only under certain operating conditions that were present when the operating conditions such as heavy load extended idle diagnostic trouble code DTC set etc When diagnosing i
48. a fault occurs Operating phase genset operating stable voltage and frequency Warning message for setting offset on all of the power plant s generating sets 6 3 2 Starting A Check that the generating set circuit breaker has triggered Connect the generating set battery 0 Turn the key switch to the ON position without forcing it to the ON position the ON lamp will light up if the lamp does not light up check and replace the fuse if necessary Test the Alarm and Fault LEDs menu 15 TEST LAMPS 1 ACTIONS 1s 11 MANUAL lt gt AUTO 12 CONTROL LOAD 13 TEST GENERATING SET 14 PROGRAMS 15 TEST LAMPS GS OK Esc O Press Esc several times to return to the following home menu OPERATION MANUAL Press START to start 24 08 2005 O Check the battery voltage A O Press START o co oO AVAILABLE POWER AIR PREHEATING START UP 100 0 10 seconds 24 08 2005 24 08 2005 24 08 2005 13 12 The following pictogram is displayed If the engine is equipped with an Warning the number of successive l air preheating system there is a and automatic starting attempts is delay adjustable before the limited to 3 E engine starts preheating o A activation period The following pictogram will flash The following information is displayed If the motor is not fitted with an air preheating system or once the Lam preheating delay has elapsed i the engine starts up start of a cycle compr
49. connections Reversed polarity will damage electrical system Always connect positive to positive and negative to ground Always use 12 volt booster battery for 12 volt electrical systems and 24 volt booster battery ies for 24 volt electrical systems RG4678 UN 14DEC88 1 Connect booster battery or batteries to produce the required system voltage for your engine application NOTE To avoid sparks DO NOT allow the free ends of jumper cables to touch the engine 2 Connect one end of jumper cable to the POSITIVE post of the booster battery 3 Connect the other end of the jumper cable to the POSITIVE post of battery connected to starter 4 Connect one end of the other jumper cable to the NEGATIVE post of the booster battery 5 ALWAYS complete the hookup by making the last connection of the NEGATIVE cable to a good ground on the engine frame and away from the battery ies RG4698 UN 14DEC88 24 Volts System 6 Start the engine Disconnect jumper cables immediately after engine starts Disconnect NEGATIVE cable first A 12 Volt Machine battery C Booster cable ies D Cable to starter motor B 12 Volt Booster battery ies DPSG CD03523 20 19 22JANO7 1 1 15 28 PN 65 163 290 Operating the Engine Engine operation Warming engine Operate engine at high idle for 1 to 2 minutes before applying the load NOTE This procedure does not apply to standby generator sets whe
50. elements of the lubricated component 2 5 3 Coolant specifications The engine s internal cooling system allows the engine to operate at a precise temperature The table below lists the coolants recommended for each engine manufacturer Make Type Mitsubishi GenPARTS GENCOOL PC 26 w DE E EOI E E III IEC EIN OO a ICAIC o O aa 25 290 Specifications of GENCOOL PC 26 coolant Performance GENCOOL PC 26 coolant is a ready to use cooling fluid which provides a high level of protection and is produced from an antifreeze approved by the majority of manufacturers Power Cooling concentrated antifreeze It offers the following Improved anticorrosion improves the effectiveness and service life of the cooling system High temperature feature promotes heat exchange Long term protection against overheating and corrosion under extreme conditions of use Compatible with the original fluid however it is recommended to drain the entire cooling system when replacing the fluid Specifications Specifications Characteristics Alkalinity reserve Freezing temperature Typical values given for information purposes 26 290 3 Transporting the equipment 3 1 Warnings concerning transport It is prohibited to operate generating sets whilst they are being transported IMPORTANT 3 2 Preparing for transport Before the equipment is transported perform the following operations Close the tap on the oil t
51. enter key D for selecting highlighted items 2 Read and record DTC s displayed on LCD of diagnostic gauge A For procedure to access diagnostic trouble codes refer to Using Diagnostic Gauge to Access Engine Information earlier in this manual 3 Go to the LISTING OF DIAGNOSTIC TROUBLE CODES DTCs later in this section to interpret the DTC s present t o gt O Z Z gt o vt N m pal O X Trouble Code Display On Instrument Panel A Diagnostic Gauge B Menu Key C Arrow Keys D Enter Key 4 Contact your nearest engine distributor or servicing dealer with a list of DTC s so that necessary repairs can be made 95 10 202 290 CD03523 0000192 19 02FEB07 1 1 072209 PN 104 Troubleshooting Listing of Diagnostic Trouble Codes DTCs NOTE Not all of these codes are used on all OEM engine applications SPN 000028 000029 000084 000091 000094 000097 000100 000105 000107 000110 000111 000158 000160 000174 000174 000189 000190 000611 000620 FMI 03 04 03 04 31 03 04 09 03 04 10 13 17 00 03 04 16 01 03 04 18 00 03 04 16 00 00 03 04 15 16 01 17 02 00 03 04 16 00 00 16 03 04 03 04 Description of Fault Throttle 3 Signal Out of Range High Throttle 3 Signal Out of Range Low Throttle 2 Signal Out of Range High Throttle 2 Signal Out of Range Low Vehicle Speed Signal Unrelia
52. for example Volvo uses a set of codes called PID Parameter Identifier or SID System Identifier these two names relate to standards J1587 or J1979 but in the case of VOLVO engines they relate to standard J1587 These two codes find their equivalent in standard J1939 SPN The attached List of engine fault codes indicates the SPN equivalent to Volvo s SID and PID John DEERE complies with standard J1939 and uses SPN codes 61 290 E display of machine codes programmed The MDDM can display the codes of services programmed in the ECU memory These programmed service codes are useful for generating set fault finding and maintenance To display the programmed codes scroll through the parameters until you reach the following sub menus In the event that there are no programmed codes to display the following screen will appear The purpose of programmed codes is to create a fault log which is used to determine recurrent faults and thereby carry out effective corrective and preventive maintenance on the engine also it not desirable to delete these when the generating set is in operation onsite Note that at the test bench outlets the EEPROM memory in which the programmed codes are stored is reset to zero The following diagram shows the structure of the STORCODE programmed code menu and how to go to each parameter Enter Storcode a No 7 Codes gt S available NS NN we a Lamp status Yes Fir
53. in H20 A clogged air cleaner element will cause excessive intake restriction and a reduced air supply to the engine 5 Make a thorough inspection of the engine compartment RG4687 UN 20DEC88 NOTE Wipe all fittings caps and plugs before performing any maintenance to reduce the chance of system contamination CD30757 UN 26AUG99 Continued on next page DPSG CD03523 27 19 07FEBO7 3 4 072209 25 2 PN 69 167 290 Maintenance Daily or every 10 hours 6 NOTE Engines with mechanical fuel system have a single fuel filter while electronically controlled engines DE10 and HPCR fuel systems have two fuel filters primary and final Moreover these electronically controlled engines may be equipped with a water sensor at the fuel filters An indicator light on the instrument panel will signal the operator that water should be drained from filter bowls Check fuel filters C and D for water and debris as follows CD30929 UN 07FEBO7 Loosen drain plug s A at bottom of fuel filter s or bowl s two or three turns Drain fuel filter s Loosen air bleed plug s B two full turns and drain water into a suitable container A Drain plug C Primary fuel filter l l l B Air bleed plug D Final fuel filter When fuel starts to drain out tighten drain plug s securely Bleed fuel system DPSG CD03523 27 19 07FEBO7 4 4 072209 25 3 PN 70 168 290 Maintenance 500 hours Cha
54. interference suppression kit standard for CE marking Voltage potentiometer OOO WM Voltage adjustment by remote potentiometer 130 C Blue wire 150 C Black wire 180 C Red white wire LSA 43 2 44 2 LEROY SOMER 9 231 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 3 3 4 Connection checks Electrical installations must comply with the current legislation in force in the country of use Check that The residual circuit breaker conforms to legislation on protection of personnel in force in the country of use and has been correctly installed on the alternator power output as close as possible to the alternator In this case disconnect the wire of the interference suppression module linking the neutral Any protection devices in place have not been tripped If there is an external AVR the connections between the alternator and the cabinet are made in accordance with the connection diagram There is no short circuit phase phase or phase neutral between the alternator output terminals and the generator set control cabinet part of the circuit not protected by circuitbreakers or relays in the cabinet The machine should be connected with the busbar separating the terminals as shown in the terminal connection diagram aot anion 3 4 Commissioning The machine can only be started up and used if the installation is in accordance with the regulations and instructions
55. just purchased We wish to draw your attention to the contents of this maintenance manual By following certain important points during installation use and servicing of your A V R you can look forward to many years of trouble free operation SAFETY MEASURES Before using your machine for the first time it is important to read the whole of this installation and maintenance manual All necessary operations and interventions on this machine must be performed by a qualified technician Our technical support service willbe pleased to provide any additional information you may require The various operations described in this manual are accompanied by recommendations or symbols to alert the user to potential risks of accidents It is vital that you understand and take notice of the following warning symbols WARNING Warning symbol for an operation capable of damaging or destroying the machine or surrounding equipment Warning symbol for general danger to personnel Warning symbol for electrical danger to personnel Note LEROY SOMER reserves the right to modify the characteristics of its products at any time in order to incorporate the latest technological developments The information contained in this document may therefore be changed without notice LEROY 2 SOMER 248 290 LEROY SOMER R250 A V R SUMMARY AS A o a a a a 4 tta SAHUNT excitation syste Massie e ea E e EE 4 A AI A A Aa 5 A A o coe ass
56. load applied is reduced by approximately 25 to 50 until the speed reaches its rated value again Hence the LAM can be used either to reduce the speed variation frequency and its dura tion for a given applied load or to increase the applied load possible for one speed va riation turbo charged engine To avoid voltage oscillations the trip thres hold for the LAM function should be set ap proximately 2 Hz below the lowest frequen cy in steady state LEROY 6 SOMER 264 290 LEROY SOMER Installation and maintenance R438 A V R LAM action eliminated by cutting the ST5 2 4 Typical effects of the LAM with jumper a diesel engine with or without a Voltage LAM U F only Underspeed and LAM ST5 disconnected UN ca ce Be cs 2 4 1 Voltage U f without LAM i 2 3 2 Gradual voltage return function During load impacts the function helps the genset to return to its rated speed faster thanks to a gradual increase in voltage ac cording to the principle If the speed drops between 46 and 50 Hz the rated voltage follows a fast gradient as it i without is restored Gl If the speed drops below 46 Hz since the engine needs more help the voltage follows a slow gradient as it returns to the reference value prop N lt 46 Hz Time Load on the shaft kW Drop N gt 46 Hz LEROY SOMER T 265 290 LEROY SOMER R438 A V R
57. m must be in the ground 4 2 3 Making the connections 4 2 3 1 Connections general information When connecting always comply with standard NFC 15 100 and the application guide NFC 15 401 in France or follow standards based on the international standard IEC 60364 countries outside France The cable cross section and number of connection cables should be determined according to the type of connection cable and the current standards to be observed in the country of installation The choice of connection cables must comply with international standard IEC 60364 5 52 44 290 EN 4 2 3 2 Selecting the power cables The calculation rules used to choose the power connection cable size are defined below Identify the current shown on the generating set s identification plate From the table below select the circuit breaker rating directly above the current shown on the generating set s identification plate Choose the corresponding cable size Three phase Permitted drop in voltage 5 Multi core conductors or connected single core conductors where rating 4X 1 Cable type PVC 70 C e g HO7RNF Ambient temperature 30 C rating 51 100m 101 160m mm2 AWG mm2 AWG mm2 AWG 4X 1X50 0 4X 1X50 0 4X 1X70 2 0 4X 1X70 2 0 4X 1X95 4 0 4X 1X150 2350MCM 4X 1X150 2350MCM 4X 1X185 0400MCM 4X 1X185 0400MCM 4X 2X1X150 2x 2350MCM 4X 2X1X150 2x 2350MCM Single phase Permitted drop in vo
58. machine RIGHT HAND AND LEFT HAND sides are determined by standing at the drive or flywheel end rear of the engine and facing toward the front of the engine SETTING FUEL DELIVERY beyond published factory specifications or otherwise overpowering will result in loss of warranty protection for this engine Information relative to emissions regulations Depending on final destination this engine can meet the emissions regulations according to the US Environmental Protection Agency EPA California Air Resources Board CARB and for Europe the Directive 97 68 EC relating the measures against the emissions of gaseous and particulates pollutants from internal combustion engines In this case an emission label is stuck on the engine Emission regulations prohibit tampering with the emission related components listed below which would render that component inoperative or to make any adjustment on the engine beyond published specifications It is also illegal to install a part or component where the principal effect of that component is to bypass defeat or render inoperative any engine component or device which would affect the engine conformance to the emissions regulations To summarize it is illegal to do anything except return the engine to its original published specifications Continued on next page DPSG CD03523 1 19 O6JULO9 1 2 072209 PN 2 100 290 Introduction List of emission related components Piston Fuel
59. machine clean of accumulated trash grease and debris Always clean up spilled fuel co O lt Se i Z o o N 09 E DX FIRE1 19 03MAR93 1 1 Prepare for Emergencies Be prepared if a fire starts Keep a first aid kit and fire extinguisher handy Keep emergency numbers for doctors ambulance service hospital and fire department near your telephone TS291 UN 23AUG88 DX FIRE2 19 03MAR93 1 1 072209 05 3 PN 28 126 290 Safety Handle Starting Fluid Safely Starting fluid is highly flammable Keep all sparks and flame away when using it Keep starting fluid away from batteries and cables To prevent accidental discharge when storing the pressurized can keep the cap on the container and store in a cool protected location Do not incinerate or puncture a starting fluid container TS1356 UN 18MAR92 DX FIRE3 19 16APR92 1 1 Wear Protective Clothing Wear close fitting clothing and safety equipment appropriate to the job Prolonged exposure to loud noise can cause impairment or loss of hearing Wear a suitable hearing protective device such as earmuffs or earplugs to protect against objectionable or uncomfortable loud noises Operating equipment safely requires the full attention of the operator Do not wear radio or music headphones while operating machine TS206 UN 23AUG88 DX WEAR 19 10SEP90 1 1 Protect Against Noise Prolonged exposure to loud noise c
60. of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 74 19 22JANO7 1 1 10000 Hours of operation o Engine oil drain o Cooling system drain and flush o Engine oil filter replace o Valve clearance adjust POWERTech o Fuel filter replace o Thermostat replace o Check belt and tensioning system o Vibration damper check o Crankcase vent tube clean o Injection nozzles replace o Air intake system check Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 75 19 22JANO7 1 1 02 11 PN 20 118 290 Serial Numbers PowerTech label A label is located on the rocker arm cover which identifies each engine as a John Deere PowerTech engine DIA DIE ME POWERIECH AS liter RG8041 UN 15JAN99 DPSG CD03523 11 19 10JULO9 1 1 Engine serial number plate 3 o A Z W lt 7 B N i Z Z 5 7 E lt o N o o O Q X O 4045 and 6068 Engines 3029 and 4039 Engines Each engine has a 13 digit John Deere serial number The first two digits identify the factory that produced the engine Your engine s serial number plate A is located on the right hand side of cylinder block behind the fuel filter for 4045 and 6068 engines and near the fuel supply pump CD indicates the engine was built in Saran France on 3029 and 4039 engines DPSG CD03523 12 19 22JANO7 1 1 0 3 1 072209 PN 21 119 29
61. on alternator front frame Stretch the belt 1 gauge unit for a used belt and 1 5 gauge units for a new belt 4 Tighten cap screws B and C A Belt gauge D Reference mark B Cap screw E Alternator upper bracket C Cap screw notch CD30843 UN 10JAN03 CD30843 Reference marks DPSG CD03523 57 19 30JANO7 1 1 3 0 6 072209 PN 76 174 290 Maintenance 1000 hours 1 year Cleaning crankcase vent tube If you operate the engine in dusty conditions clean the tube at shorter intervals 1 Remove and clean crankcase vent tube A 2 Install the vent tube Be sure the O ring fits correctly in the rocker arm cover for elbow adapter Tighten hose clamp securely CD30773 UN 27AUG99 DPSG CD03523 32 19 22JANO7 1 1 Checking air intake system O O O D lt N 1 Z gt N lo N O m Q O IMPORTANT The air intake system must not leak Any leak no matter how small may result in engine failure due to abrasive dirt and dust entering the intake system Check clamps on piping A which connect the air filter engine and if present turbocharger and air to air radiator Tighten clamps as necessary Test air restriction indicator B for proper operation 1 Inspect all intake hoses piping for cracks Replace Replace indicator as necessary as necessary Continued on next page DPSG CD03523 33 19 22JANO7 1 2 072209 35 1 PN 77 175 290 Maintenance 1000 hours 1 year
62. operating terminals see the alternator manual Voltage disappears during operation Check the A V R the surge suppressor the rotating diodes and replace any defective components The voltage does not return to the rated value Exciter winding open circuit Faulty induced excitation Faulty A V R Main field open circuit or short circuited Warning after setting up or trouble shooting replace all access panels or covers LEROY SOMER 255 290 LEROY SOMER R250 A V R 4 SPARE PARTS 4 1 Designation Description Code A V R AEM 110 RE 019 4 2 Technical support service Our technical support service willbe pleased to help you with any information needed For replacement part orders it is necessary to indicate the type and the code number of the A V R Please contact your usual correspondant An extensive network of service centres is available to rapidly supply any necessary parts In order to ensure the correct operation and safety of our machines we strongly recommend that original manufacturer s spare parts are used Failure to do so will discharge the manufacturer from liabilty in the case of damage LEROY 10 SOMER 256 290 LEROY SOMER R250 A V R LEROY SOMER 11 257 290 LEROY SOMER MOTEURS LEROY SOMER 16015 ANGOULEME CEDEX FRANCE 338 567 258 RCS ANGOULEME S A au Capital de 62 779 000 www leroy somer com
63. or engine distributor Check thermostat DPSG CD03523 49 19 22JANO7 4 4 072209 PN 101 Troubleshooting Electrical troubleshooting Symptom Undercharged system Battery uses too much water Batteries will not charge Starter will not crank Starter cranks slowly Entire electrical system Problem Excessive electrical load from added accessories Excessive engine idling Poor electrical connections on battery ground strap starter or alternator Defective battery Defective alternator Cracked battery case Defective battery Battery charging rate too high Loose or corroded connections Sulfated or worn out batteries Solution Remove accessories or install higher output alternator Increase engine rom when heavy electrical load is used Inspect and clean as necessary Test battery Test charging system Check for moisture and replace as necessary Test battery Test charging system Clean and tighten connections See your authorized servicing dealer or engine distributor Stretched poly V belt or defective belt Adjust belt tension or replace belts tensioner Engine under load Loose or corroded connections Low battery output voltage Faulty start circuit relay Blown fuse Low battery output Crankcase oil too heavy Loose or corroded connections Faulty battery connection Continued on next page 95 8 200 290 Remove load Clean and tighten loose co
64. out of calibration MA i Error in position of the EGR valve SS 16 286 290 Position of TGV actuator OO The actuator does not respond or is not in the expected position Common supply voltage O output 1 Supply voltage of the sensor too high voltage Supply voltage of the sensor too high the sensor too high Exceeding 5 volts Supply voltage of the sensor shorted to ground Common supply voltage sensors output 2 Supply voltage of the sensor too high voltage Supply voltage of the sensor too high the sensor too high Exceeding 5 volts Supply voltage of the sensor shorted to ground sensors output 3 _ Supply voltage of the sensor too high voltage Supply voltage of the sensor too high the sensor too high Exceeding 5 volts Supply voltage of the sensor shorted to ground Common supply voltage sensors output 4 _ Supply voltage of the sensor too high Exceeding 5 volts Supply voltage of the sensor shorted to ground Common supply voltage sensors output 5 _ Supply voltage of the sensor too high Exceeding 5 volts a si Supply voltage of the sensor shorted to ground Cooling status of the piston sd MT Status ofthe staring request zos 68 SiR Stoprequestoncu 287 290 SAE J1939 73 March 2004 FMI and Description FMI 0 DATA VALID BUT ABOVE NORMAL OPERATIONAL RANGE MOST SEVERE LEVEL The signal communicating information is within a defined acceptabl
65. plastic insert or crimped steel original Make sure fastener threads are clean and that you type lock nuts for stainless steel fasteners or for nuts on U bolts see the properly start thread engagement When possible lubricate tightening instructions for the specific application Shear bolts are designed to fail plain or zinc plated fasteners other than lock nuts wheel bolts under predetermined loads Always replace shear bolts with identical grade or wheel nuts unless different instructions are given for the specific application Grade 2 applies for hex cap screws not hex bolts up to 6 in 152 mm long Grade 1 applies for hex cap screws over 6 in 152 mm long and for all other types of bolts and screws of any length gt ubricated means coated with a lubricant such as engine oil fasteners with phosphate and oil coatings or 7 8 in and larger fasteners with JDM F13C zinc flake coating Dry means plain or zinc plated without any lubrication or 1 4 to 3 4 in fasteners with JDM F13B zinc flake coating 65 8 214 290 DX TORQ1 19 24MARO09 1 1 072209 PN 116 Specifications Metric Bolt and Screw Torque Values TS1670 UN 01MAY03 Bolt or Class 4 8 Class 8 8 or 9 8 Class 10 9 Class 12 9 Screw Lubricated Dry Lubricated Dry Lubricated Dry Lubricated Dry Size Nm l
66. powered ensuring the live and neutral wires are correctly connected AR Our generating sets are factory set with a conventional direction of phase rotation A phase converter not supplied can be used to ensure correspondence of phases between IMPORTANT the generating set and the installation N LO Li L2 L3 ou Ou ou ou N2 R2 S2 T2 Installation to be powered e g cabinet distribution box installation etc To limit the risk of falls caused by obstacles on the floor it is recommended to suspend cables and ventilation ducts As necessary ensure that cables which remain on the floor are protected by burying or covering them IMPORTANT 47 290 EN 4 2 3 4 Connecting the battery or batteries to the generating set Always ensure that the polarities of the battery and starter motor correspond Never swap the positive and Oo negative battery terminals when connecting them This could cause severe damage to the electrical equipment To connect the battery 1 Connect the red connecting cable to the positive battery terminal 2 Then connect the black cable to the negative battery terminal To disconnect the battery 1 First disconnect the black cable 2 Then disconnect the red cable 4 2 4 Overvoltage Generating sets are not equipped with devices that protect against voltage surges from atmospheric discharges or due to handling operations The company disclaims all liability fo
67. resetestfaiore SSS n E Main ana fut ASIC estfal 1 AAA s II vistes to faiure a METER pap commiato Sears veaa 0 error ee VP44 EH UEM E E or or P Data set memory EEPROM AA AA a S A SaO E CET CI ae e Pump postion or CAM Pump position sensor cam position ao input noise _ Permanent loss Permanent loss of signal Permanent loss of signal High impedance of the position sensor CE circuit open Sensor short to ground short to Sensor short to ground me position sensor cam S sensor input missing 9 MN Not informed by VOLVO Cs 10 Pump position sensor cam position sensor input pattern error position in function of the el of injection 280 290 EN Crank position sensor Speed sensor flywheel Crank position input noise Ld Pome ioss of spat O a High impedance of the position sensor or i a an E bed q UN BaN wm Ee a open circuit Sensor short to ground Crank position Cam position out of synchronisation Not informed by VOLVO Crank position input missing ME Crank position sensor input pattern error ae e EN Ml me EA o a reo Jara Ea a E eeso a W sorser STS sewers S w _ Erone shutdown venice status A e MN Engine shutdown vehicle request SS Status of the Turbo with variable N geometry 4 Supply voltage of the Turbo actuator low 45 Error in communication between the ECU N and the TGV actuator 16 Temperature o
68. should be atleast5 C BEFORE using diesel fuel with sulfur content greater 9 F below the expected lowest temperature or Cloud than 0 50 5000 ppm contact your John Deere Point below the expected lowest ambient temperature dealer Fuel lubricity should pass a maximum scar diameter of IMPORTANT Do not mix used diesel engine oil or any 0 45 mm as measured by ASTM D6079 or ISO 12156 1 other type of lubricating oil with diesel fuel Improper fuel additive usage may cause damage on fuel injection equipment of diesel engines DX FUEL1 19 28APRO9 1 1 Handling and Storing Diesel Fuel CAUTION Handle fuel carefully Do not fill the When using bio diesel fuel the fuel filter may require more fuel tank when engine is running frequent replacement due to premature plugging DO NOT smoke while you fill the fuel tank Check engine oil level daily prior to starting engine A or service the fuel system rising oil level may indicate fuel dilution of the engine oil IMPORTANT The fuel tank is vented through the filler cap If a new filler cap is required always replace it with an original vented cap Fill the fuel tank at the end of each day s operation to prevent water condensation and freezing during cold weather Keep all storage tanks as full as practicable to minimize When fuel is stored for an extended period or if there is a condensation slow turnover of fuel add a fuel conditioner to stabilize the l fuel and prevent water con
69. start up is desired See Starting The Engine All of the engine values illustrated on the diagnostic gauge indicate the engine is running Menu Key RG13159 UN 26SEP03 Turn the key switch to the ON position Starting at the single or four engine parameter display press the Menu key OURGP11 00000AB 19 03SEP03 1 6 The main menu will be displayed Use the Arrow GO TO UP DISPLAY keys to scroll through the menu until Engine Config is highlighted ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS RG13164 UN 070CT03 Select Engine Configuration Continued on next page OURGP11 00000AB 19 03SEP03 2 6 072209 15 3 PN 40 138 290 Operating the Engine 3 Once Engine Config menu item has been highlighted GO TO 1 UP DISPLAY 7 TO 1 UP DISPLAY press the Enter key to view the engine configuration STORED CODES data ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT RG13165 UN 020CT03 ae Enter Key OURGP11 00000AB 19 03SEP03 3 6 4 Use the Arrow keys to scroll through the engine configuration data ENGINE SPEED PT 1 1000 RPM Se O A Lu 09 D 1 Z gt co gt oe DE O X Use Arrow Keys To Scroll OURGP11 00000AB 19 03SEP03 4 6 5 Press the Menu key to return to the main menu ENGINE SPEED PT 1 1000 RPM RG13167 UN 29SEP03 Return To Main Menu Continued on next page OURGP11 00000AB 19 0
70. stator current compound charac teristic Booster effect The power supply voltage is rectified and filtered before being used by the AVR moni toring transistor This principle ensures that regulation is not affected by distortions ge nerated by the load STATOR 6 wires marked T1 to T6 STATOR 12 wires marked T1 to T12 according voltage 4 x holes 5 8 x 175x 115 mm 200 mm pros ST9 aE Ph 1 P1 ST4 Option External potentiometer for adjusting the voltage P2 1 Option R731 3 ph x A in 3 ph detection ST1 open E voltage LEROY SOMER 262 290 LEROY SOMER R438 A V R 1 2 PMG excitation system alternator winding As a result the machine veer has a short circuit current capacity and This excitation system consists of a PMG l permanent magnet generator This is fitted a oe to distortions generated by gt dl Ea foe MAr NNE en come ciego The AVR monitors and corrects the alterna The PMG supplies ihe AUR witoeonstant pe voltage by adjusting the excitation eral eae f current voltage which is independent of the main 50 60 Hz selection via the ST3 jumper STATOR 6 wires marked T1 to T6 MAIN FIELD STATOR 12 wires marked T1 to T12 PMG SYSTEM T3 WES lO x2 21x1 22 E ov 10 220 380 o pa 4 x holes 5 8 x 175x 115 mm Slow fuse F1 250V 8A Ola ST5 ty ue m A witA
71. the Arrow keys to select the desired backlight intensity ADJUST BACKLIGHT Om 1 S OPO Adjust Backlight Intensity e O A Lu 09 D 1 Z gt N c oe ils O X OURGP11 0000237 19 210CT03 4 6 5 Press the Menu key to return to the main menu ADJUST CONTRAST RG13184 UN 26SEP03 Return To Main Menu Continued on next page OURGP11 0000237 19 210CT03 5 6 15 11 PN 48 146 290 Operating the Engine 6 Press the Menu key to exit the main menu and return to the engine parameter display 1000 RPM 1800 RPM TSG COOL TEMP 14 2 o7 ESI RG13159 UN 26SEP03 Exit Main Menu OURGP11 0000237 19 210CT03 6 6 Adjusting Contrast EN ENG APM 1 Turn the key switch to the ON position Starting at 1800 RPM the single or four engine parameter display press the Menu key ENG cool Temp ds palin RG13159 UN 26SEP03 Menu Key OURGP11 00000AF 19 03SEP03 1 6 2 The main menu will be displayed Use the Arrow GO TO 1 UP DISPLAY keys to scroll through the menu until Adjust Contrast STORED CODES is highlighted ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT RG13161 UN 020CT03 Select Adjust Contrast OURGP11 00000AF 19 03SEP03 2 6 3 Once the Adjust Contrast menu item has been highlighted press the Enter key to activate the E a Adjust Contrast function SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BA
72. the engine coolant temperature to fall below its normal range This in turn causes crankcase oil dilution due to incomplete fuel combustion and permits formation of gummy deposits on valves pistons and piston rings It also promotes rapid accumulation of engine sludge and unburned fuel in the exhaust system If an engine will be idling for more than 5 minutes stop and restart later NOTE Generator set applications have the governor locked at a specified speed and do not have a Slow idle function These engines idle at no load governed speed fast idle DPSG CD03523 21 19 22JANO7 weeks DO NOT allow engine to run extended period of time with no load 1 1 DPSG CD03523 22 19 22JANO7 1 1 2 Stop the engine DPSG CD03523 23 19 22JANO7 1 1 Refer to the generator set documentation for more information CD03523 000018C 19 26JANO7 1 1 PN 072209 66 Maintenance Observe service intervals Using hour meter as a guide perform all services at the hourly intervals indicated on following pages At each scheduled maintenance interval perform all previous maintenance operations in addition to the ones specified Keep a record of hourly intervals and services performed using charts provided in Maintenance Records Section Use correct fuels lubricants and coolant IMPORTANT Use only fuels lubricants and coolants meeting specifications outlined in Fuels Lubricants and Coolant Section when servicing your
73. the excitation current 7 ati according to the alternator s output voltage dida EXCIEA Ion SYSE With a very simple conception the SHUNT The SHUNT excitation alternator is auto excitation alternator does not have a short excited with a R 250 voltage regulator circuit capacity MAIN FIELD STATOR 12 wires marking T1 to T12 T1 T7 T2r T8 T3 T9 T4 T10 T5 eT11 T6 T12 GOMER R250 4 x holes Y 5 8 x 50 x 115 mm 140 mm Slow fuse F1 250V 8A P1 Voltage Frequency selector 50 Hz 60 Hz for U F fonction and LAM adjustement BANOO W v 18 0383 Pd amp Stability D ST4 Option External potentiometrer for voltage adjusting 4 LEROY SOMER 250 290 LEROY SOMER R250 A V R 2 R250 A V R 2 1 Characteristics Storage 55 C 85 C Operation 40 C 70 C Voltage regulation around 0 5 Supply range voltage detection 85 to 139 V 50 60HZ Rapid response time 500 ms for a transient voltage variation amplitude of 20 Voltage setting P1 Stability setting P2 Power supply protected by 8 A fuse replacement product Ferraz Shawmut T084013T fast blow fuse 8 A FA 250 V breaking capacity 30 kA 2 2 U F Fonction and LAM The threshold position 50 Hz 60 Hz to action the U F fonction as well as the LAM setting type is selected using the potentionmeter WARNING The jumper settings must corres
74. the generating set the radiator is at the front Note some user and maintenance manuals for engines fitted to generating sets cover control units and include the start up and shut down procedures for the engines As our generating sets are fitted with control units that are specific to the generating sets only the information that appears in the documentation for the generating set control units should be taken into consideration In addition depending on the manufacturing criteria of the generating sets some engines may be fitted with specific electrical wiring different to that described in the engine documentation 1 2 Warnings In this manual the warning messages are used as follows Immediate danger Indicates an imminent danger which may result in death or serious injury Failure to follow the instruction shown may pose serious risks to the health and life of those concerned Potential danger Indicates a dangerous situation if the warning is not heeded Failure to follow the instruction indicated may Cause minor injuries to those concerned or damage to equipment IMPORTANT 4 290 1 3 Pictograms and their meanings The aim of the pictogramas is as follows To draw the attention of the operator or maintenance technician to the potential dangers To explain how to act in the interest of personal safety and to avoid damaging the equipment The safety pictograms present on the equipment are explained below
75. the generating set is displayed O Zone 2 in this zone pictograms relating to dimensions measured are displayed as well as Alarm and Fault pictograms Zone 3 in this zone the measured values corresponding to the measured dimensions are displayed with the corresponding units of measurement O Zone 4 in this zone messages relating to the control of the generating set and the menus are displayed Note the information displayed on measurements alarms and faults as well as messages and menus relating to control of the generating set will depend on the equipment level of each generating set Certain screens may therefore not be present 66 290 EN 6 3 1 3 Description of the pictograms in zone 1 Zone 1 pictograms Display Activation conditions Fixed TELYS in manual mode MAN gt l For 5 seconds when switching from Flashing Fixed AUTO Flashin For 5 seconds when switching from j MAN to AUTO mode Flashing Genset starting Fixed Genset started AUTO mode Genset stabilised voltage and Fixed frequency gong Umpressloin Or constant The genset is generating and in use movement from left to right 9 9 g Fixed Usage supplied Not used Fixed Synchronisation Flashing Fixed Genset synchronised or coupled 67 290 EN 6 3 1 4 Description of the pictograms in zone 2 Alarm and fault pictograms in zone 2 All the pictogramas in this zone are activated when TELYS is initialised
76. to discharge particularly in humid weather 1 Clean any signs of oxidation on the battery terminals and the cable terminals using a brass brush 2 Fully tighten the cable terminals and lubricate them with grease for battery terminals or vaseline A terminal which is not secured correctly may cause sparks and therefore lead to an explosion 88 290 8 5 Fault finding Fault observed Probable origin Measures or observations Incorrect composition Incorrect storage Prolonged storage in a damp place The acid heats up when a new battery is filled Cool Charge the battery Check the acid density The acid escapes through the filler holes The battery is too full Reduce the battery fluid level Battery tray not leaktight Considerable formation of gas due to a very high charging voltage Acid level too low Insufficient charge Short circuit in the power circuit Consumption fault Acid level too low Incorrect operation from start up The battery has been filled with acid Acid density too high cado water Battery empty Battery exhausted or faulty Capacity too low Battery sulphated Starting problems Starting test incorrect Incorrect electrical connection Battery cabling incorrect One or two cells release a lot of gas at high charge Faulty cell s Charge status too low Battery terminals melted Short circuit in the power circuit High self discharge for example through electrolyte contamination
77. towing vehicle 8 Remove the parking brake Remove the wheel chocks if necessary and store them Perform the following operations simultaneously on the parking brake gt Press the unlocking button 9 gt Lower the handle 10 fully 30 290 Unhitching a trailer fitted with a hitching ring 1 Immobilise the trailer Chock the wheels Apply the parking brake gt Raise the parking brake lever 10 fully 2 Disconnect the electrical cable plug controlling the lights indicators etc from the socket on the towing vehicle Remove the unlocking cable on the towing vehicle Release the hitching ring M3126 M3127 type trailers M3128 M3129 type trailers Disengage the jockey wheel from the notches in the Remove the safety pin from the position lock 8 on the tube 6 with its handle 5 jockey wheel Loosen the jaw of the tube 7 with its lever Remove the position lock 8 Lower the tube until the jockey wheel touches the Place the jockey wheel in the bottom position ground Fit the position lock 8 Tighten the jaw of the tube 7 with its lever Fit the position lock pin Lower the jockey wheel to the ground with its handle Support the load on the jockey wheel gt Lower the jockey wheel with its handle gt When you are sure that the wheel can bear the load the towbar rises unhitch the trailer from the vehicle 5 Fit the stabiliser 1 Loosen the jaw of the stabilise
78. two display modes available for units English or metric To change your units of measurement use the A and Y scroll buttons until you get to the sub menu Press the A and Y arrows simultaneously if you want to retain the current designation va Press one of the scroll buttons to show the second mode for displaying units If you want to retain the second display mode confirm this by pressing the A and Y buttons simultaneously 60 290 EN D Displaying the active service codes The fault finding module enables the machine faults and alarms to be displayed in real time When a fault appears the display shows the message SrvcCode every five seconds between displaying the current parameters The orange LED will light up when an alarm code is displayed engine does not stop the red LED will light up when a fault code is displayed SPN and FMI codes are used in standard J1939 to identify faulty equipment SPN Suspect Parameter Number FMI Failure Mode Indicator Enter Srvccode First SPN FMI combination Alvi alv Exit Fla ai fal Last SPN FMI combination In the event that there are no active fault codes the following screen will appear Depending on the SPN FMI code refer to the attached List of engine fault codes and Engine user and maintenance manual for help on fault finding and maintenance Note that the manufacturer documents do not always stipulate the SPN used
79. unlocking cable s movement trap any electrical cables IMPORTANT M3126 M3127 type trailers M3128 M3129 type trailers Position the jockey wheel at the rear Remove the safety pin from the position lock 8 Raise the jockey wheel with its handle 5 into the Remove the position lock 8 OMIC Place the jockey wheel in the towing position Loosen the jaw of the tube 7 with its lever Fit the position lock 8 A Raise the tube fully Fit the safety pin in the position lock 8 i a T Sever Raise the jockey wheel with its handle fully and at right angles to the towbar 29 290 6 Attach the unlocking cable to the hitching plate on the towing vehicle Examples of how to attach the hitching cable If the hitching ring is not correctly connected to the hitching hook the trailer will become separated from the towing vehicle In this case the unlocking cable actuates the parking brake which then becomes an emergency brake To ensure that the device fulfils its function correctly the unlocking cable MUST NOT be wound around the jockey wheel as this will disable emergency braking IMPORTANT MUST NOT be taut or obstructed as this could activate emergency braking during towing MUST be routed as straight as possible and not be obstructed at any point MUST be sufficiently long to allow cornering 7 Connect the electrical cable plug controlling the lamps indicators etc to the socket on the
80. wavy washer 79 and the new O ring seal 349 have been fitted on the NDE shield 36 Refit the NDE shield and pass the bundle of wires between the top bars of the shield Refit the DE shield 30 and tighten the 4 fixing screws Check that the machine assembly is correctly mounted and that all screws are tightened 4 6 7 Accessing the main field and stator 4 6 7 1 Dismantling Follow the procedure for dismantling the bearings see sections 4 6 5 1 and 4 6 6 1 Remove the coupling disc single bearing alternator or the DE shield two bearing alternator and insert a tube of the corresponding diameter on the shaft end Rest the rotor on one of its poles then slide it out Use the tube as a lever arm to assist dismantling After extraction of the rotor be careful not to damage the fan If the fan is dismantled it is essential that it is replaced for the 43 2 NOTE If intervention is required on the main field rewinding replacement of components the rotor assembly must be rebalanced 4 6 7 2 Reassembling the main field Follow the dismantling procedure in reverse order Take care not to knock the windings when refitting the rotor in the stator If the fan is being replaced on the 43 2 assemble the parts as shown in the following diagram Fit a tube and a threaded screw On the 44 2 the fan is fixed by screws on the hub Follow the procedure for reassembling the bearings see sections 4 6 5
81. your regular parts channel e PC2451 Parts Catalog for Non Emission Certified engines e PC3235 Parts Catalog for Stage ll Emission Certified engines e CTM3274 Component Technical Manual for 3029 and 4039 engines English e CTM104 Component Technical Manual for 4045 and 6068 base engines English e CTM207 Component Technical Manual for e CTM502 C t Technical Manual for HPCR Mechanical Fuel Systems on 4045 and 6068 engines Fuel System al a with ala Head English Engi English e CTM320 Component Technical Manual for HPCR CTA al Tenei anar rio OEN Fuel System on 4045 and 6068 with 4 Valve Head Engine accessories English only Engines English e CTM77 Component Technical Manual for Alternators e CTM331 Component Technical Manual for DE10 and Starter Motors English only Fuel Systems on 4045 and 6068 engines English RG4624 UN 15DEC88 DPSG CD03523 42 19 31JANO7 1 1 Do not modify fuel system IMPORTANT Modification or alteration of the injection pump the injection pump timing or the fuel injectors in ways not recommended by the manufacturer will terminate the warranty obligation to the purchaser Do not attempt to service injection pump or fuel injectors yourself Special training and special tools are required See your authorized servicing dealer or engine distributor CD30768 UN 24SEP99 DPSG CD03523 43 19 22JANO7 1 1 072209 50 1 PN 88 186 290 Maintenanc
82. 0 Serial Numbers Record engine serial number Record all of the numbers and letters found on your engine serial number plate in the spaces provided below JOHN DEERE This information is very important for repair parts or ENGINE SERIAL NUMBER A warranty information E al D4039D1 23456 D Engine Serial Number B _ 40 39D FO O8 cer Abs a D P S G SARAN MADE IN FRANCE CD30705B UN 24AUG99 Coefficient of Absorption Value D 3029 and 4039 engine plate JOHN DEERE Engine Serial Number CD80686123455 Levene DEERE amp COMPANY MOLINE ILLINOIS MADE IN FRANCE CD30747A UN 22JANO7 4045 and 6068 engine plate DPSG CD03523 13 19 22JANO7 1 1 0 3 2 072209 PN 22 120 290 Serial Numbers Engine option codes JOHN DEERE Order 2B0000000 NUMBER CD6068H123456 6068HF158 6 8 L 171ECD 1100 1200 1300 1400 1500 1600 1700 1800 1900 2100 2300 2400 2500 2700 2800 2900 3000 3100 3500 4000 4300 5200 5500 5600 5700 6000 6200 6400 6500 6600 7500 7600 8600 8700 8800 000000 OPTION CODES CD30748A UN 26AUG99 Engine option code label In addition to the serial number plate OEM engines have an engine option code label affixed to the rocker arm cover These codes indicate which of the engine options were installed on your engine at the factory When in need of parts or service furnish your authorized servicing dealer or engine distributor with these numbers An add
83. 0 C with or without abnormal bearing noise If the bearing has turned blue or if the grease has turned black change the bearing Bearing not fully locked abnormal play in the bearing cage Check the end shield alignment flange not properly fitted Abnormal temperature Excessive temperature rise in the alternator housing more than 40 C above the ambient temperature Air flow intake outlet partially clogged or hot air is being recycled from the alternator or engine Alternator operating at too high a voltage gt 105 of Un on load Alternator overloaded Excessive vibration Misalignment coupling Defective mounting or play in coupling Rotor balancing fault Engine Alternator Excessive vibration and humming noise coming from the machine Phase imbalance Stator short circuit Alternator damaged by a significant impact followed by humming and vibration 4 5 Electrical faults Fault Action Effect __ _ CheckCause ee O No voltage at no load on Start up Connect a new battery of 4 to 12 volts to terminals E and E respecting the polarity for 2 to 3 seconds System short circuit Mis paralleling Possible consequences Broken or damaged coupling Broken or bent shaft extension Shifting and short circuit of revolving field winding Fan fractured or coming loose on shaft Irreparable damage to rotating diodes AVR surge suppressor The al
84. 0 19 03SEP03 2 7 3 Once the Select Units menu item has been GOTO 1 UP DISPLAY highlighted press the Enter key to access the Select STORED CODES Units function ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT OIG Press Enter Key RG13189 UN 020CT03 OURGP11 00000B0 19 03SEP03 3 7 4 There are three choices for units of measurement English Metric kPa or Metric Bar ENGLISH English is for Imperial units with pressures displayed in PSI and temperatures in F Metric kPa and Metric bar are for IS units with pressures displayed in kPa and bar respectively and temperatures in C Use the Arrow keys to highlight the desired units of measurement RG13190 UN 26SEP03 Select Desired Units Continued on next page OURGP11 00000B0 19 O3SEP03 4 7 15 14 PN 51 149 290 Operating the Engine 5 Press the Enter key to select the highlighted units ENGLISH METRIC KPA METRIC BAR RG13191 UN 30SEP03 224 Press Enter Key to Select OURGP11 00000B0 19 03SEP03 5 7 6 Press the Menu key to return to the main menu ENGLISH e O A Lu 109 i Z 2 A D oe O 14 Return To Main Menu OURGP11 00000B0 19 03SEP03 6 7 Press the Menu key to return to the engine parameter display 1000 RPM 14 2 a7 PSI GAT WOLT TIL PRES RG13159 UN 26SEP03 Press Menu Key OURGP11 00000B0 19 03SEP03 7 7 Setup 1 Up Display 1
85. 0 23 0 23 0 23 0 23 0 23 Field excitation current i exc A 400 V 50 Hz i exc excitation current of the exciter field LSA 43 2 S1 S15 S25 S35 M45 L65 L8 4 8 3 Dedicated single phase LSA 43 2 4 pole SHUNT excitation 60 Hz only Resistances at 20 C Q LSA 43 2 Stator L N S1 0 058 S25 0 058 S35 0 046 M45 0 037 L65 0 027 L8 0 019 Field excitation current i exc A 240 V 60 Hz i exc excitation current of the exciter field LSA 43 2 no load at load LSA 43 2 no load at load S1 S1 0 59 1 44 S15 S25 0 59 1 68 S25 S35 0 66 1 65 M45 0 61 1 48 S35 na M45 L65 L8 1 ER 238 290 LSA 43 2 44 2 4 POLES ALTERNATORS 4 8 4 3 phase LSA 44 2 4 pole SHUNT excitation Resistances at 20 C Q LSA 44 2 Stator L N Armature 0 5 0 5 0 5 0 5 05 0 5 Field excitation current i exc A 400 V 50 Hz i exc excitation current of the exciter field LSA 44 2 no load at load VS3 0 5 1 8 VS45 0 5 2 1 S7 0 5 1 9 S75 0 5 2 1 M95 0 6 2 L12 0 5 1 9 4 8 5 3 phase LSA 44 2 4 pole AREP excitation Resistances at 20 C Q LSA Stator Field excitation current i exc A 400 V 50 Hz i exc excitation current of the exciter field LSA 44 2 no load at load VS3 3 6 VS45 4 2
86. 000 RPM ENG APM 1 Turn the key switch to the ON position Starting at the 1800 RPM single engine parameter display press the Menu key 14 2 57 PSI ENTE cool temp wat veny OIL PRES RG13159 UN 26SEP03 Menu Key Continued on next page OURGP11 00000B1 19 03SEP03 1 18 15 15 PN 52 150 290 Operating the Engine 2 Use the Arrow keys to scroll through the menu until GO TO 1 UP DISPLAY Setup 1 Up Display is highlighted STORED CODES ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITSD ADJUST BACKLIGHT epa Setup 1 Up Display RG13193 UN 020CT03 OURGP11 00000B1 19 03SEP03 2 18 3 Once Setup 1 Up Display menu item has been highlighted press the Enter key to access the Setup GO TO 1 UP DISPLAY i i STORED CODES 1 Up Display function ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITSD ADJUST BACKLIGHT DODGE Press Enter Key co a H O O A 1 Z gt en o e O x OURGP11 00000B1 19 03SEP03 3 18 4 Three options are available for modification of the 1 Up Display USE DEFAULTS CUSTOM SETUP a Use Defaults This option contains the following AUTOMATIC SCAN OFF engine parameters for display Engine Hours Engine Speed Battery Voltage Load Coolant Temperature and Oil Pressure Custom Setup This option contains a list of engine parameters Engine parameters from this list can be selected to replace any or all of th
87. 15 25 x 15 29 Valve clearance 19 28 Adjust 3029 and 4039 engines 35 3 Adjust 4045 and 6068 engines cceeeee 40 1 W 03 5 Wiring harness 03 5 With Denso High Pressure Common Rail 55 3 03 With Stanadyne DE10 pUMP cccocncccnnnncncncncnncncnnoo 55 2 Index 2 aes 218 290 EN 10 2 Appendix B Alternator user and maintenance manual 219 290 220 290 User guide and maintenance manual LEROY SOMER Alternator 43 2 amp 44 2 SHUNT AREP amp PMG 3434 33522059401 7 1 01 06 2011 222 290 LEROY SOMER 3434 en 2011 06 j LSA 43 2 44 2 4 POLES ALTERNATORS Installation and maintenance 223 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS This manual concerns the alternator which you have just purchased We wish to draw your attention to the contents of this maintenance manual SAFETY MEASURES Before using your machine for the first time it is important to read the whole of this installation and maintenance manual All necessary operations and interventions on this machine must be performed by a qualified technician Ourtechnical support service will be pleased to provide any additional information you may require The various operations described in this manual are accompanied by recommenda tions or symbols to alert the user to the potential risk of accidents It is vit
88. 2 and 4 6 6 2 LEROY SOMER 15 237 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 4 7 Installation and maintenance of the PMG For the LSA 43 2 and LSA 44 2 the PMG reference is PMG 1 See the PMG maintenance manual ref 4211 WARNING Mounting is impossible with the regreasable bearings option with the LSA 44 2 4 8 Table of characteristics Table of average values Alternator 2 and 4 poles 50 Hz 60 Hz Winding n 6 and M or M1 connected in dedicated single phase 400 V for the excitation values The voltage and current values are given for no load operation and operation at rated load with separate field excitation All values are given at 10 for exact values consult the test report and are subject to change without prior warning For 60 Hz machines the resistance values are the same and the excitation current i exc is approximately 5 to 10 weaker 4 8 1 3 phase LSA 43 2 4 P SHUNT excitation Resistances at 20 C Q LSA 43 2 Stator L N Rotor Armature S1 0 155 1 35 0 23 S15 0 155 1 35 0 23 S25 0 155 1 35 E 0 23 35 0 128 1 41 0 23 M45 0 105 1 57 i 0 23 L65 0 083 1 76 0 23 L8 0 063 1 96 Field excitation current i exc A 400 V 50 Hz i exc excitation current of the exciter field 4 8 2 3 phase LSA 43 2 4 P AREP excitation Resistances at 20 C Q Armat 0 23 0 23
89. 205 290 Storage Engine storage guidelines 1 John Deere engines can be stored outside for up to three 3 months with no long term preparation IF COVERED BY WATERPROOF COVERING John Deere engines can be stored in a standard overseas shipping container for up to three 3 months with no long term preparation John Deere engines can be stored inside warehoused for up to six 6 months with no long term preparation Preparing engine for long term storage The following storage preparations are good for long term engine storage up to one year After that the engine should be started warmed up and retreated for an extended storage period IMPORTANT Any time your engine will not be used for over six 6 months the following recommendations for storing it and removing it from storage will help to minimize corrosion and deterioration Change engine oil and replace filter Used oil will not give adequate protection See CHANGING ENGINE OIL AND FILTER Service air cleaner See CLEAN OR REPLACE AIR FILTER Draining and flushing of cooling system is not necessary if engine is to be stored only for several months However for extended storage periods of a year or longer it is recommended that the cooling system be drained flushed and refilled Refill Removing engine from long term storage Refer to the appropriate section for detailed services listed below or have your authorized servicing dealer or engine dis
90. 258 290 LEROY SOMER 3971 en 2010 11 f T1 T7 T4 T10 R438 A V R Installation and maintenance 259 290 LEROY SOMER R438 A V R This manual concerns the alternator A V R which you have just purchased We wish to draw your attention to the contents of this maintenance manual By following certain important points during installation use and servicing of your A V R you can look forward to many years of trouble free operation SAFETY MEASURES Before using your machine for the first time itis important to read the whole of this instal lation and maintenance manual All necessary operations and interventions on this machine must be performed by a qualified technician Ourtechnical support service will be pleased to provide any additional infor mation you may require The various operations described in this manual are accompanied by recommen da tions or symbols to alert the user to potential risks of accidents It is vital that you unders tand and take notice of the following warning symbols This A V R can be incorporated in a ma chine marked C E WARNING Warning symbol for an operation ca pable of damaging or destroying the ma chine or surround ing equipment Warning symbol for general danger to personnel Warning symbol for electrical danger to personnel Note LEROY SOMER reserves the right to mod
91. 3SEP03 5 6 072209 15 4 PN 41 139 290 Operating the Engine 6 Press the Menu key to exit the main menu and return 1000 RPM to the engine parameter display de 1300 RPM NAO CooL TEMP 14 2 o7 ESI RG13159 UN 26SEP03 Exit Main Menu OURGP11 00000AB 19 03SEP03 6 6 Accessing Stored Trouble Codes 1000 RPM ENG APM NOTE The engine does not need to be running to navigate the diagnostic gauge screens If engine 14 2 57 PSI start up is desired See Starting The Engine All BaT VOLT iia of the engine values illustrated on the diagnostic gauge indicate the engine is running RG13159 UN 26SEP03 For description of trouble codes see chart in Troubleshooting Section Menu Key 1 Turn the key switch to the ON position Starting at the single or four engine parameter display press the Menu key OURGP11 00000AC 19 03SEP03 1 6 The main menu will be displayed Use the Arrow keys to scroll through the menu until Stored Codes is highlighted GO TO 1 UP DISPLAY STORED CODES ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT RG13168 UN 020CT03 Select Stored Codes Continued on next page OURGP11 00000AC 19 03SEP03 2 6 072209 15 5 PN 42 140 290 Operating the Engine 3 Once the Stored Codes menu item has been highlighted press the Enter key to view the stored codes GO TO 1 UP DISPLAY STORED CODES ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4
92. 5 W min setting range 5 Remove the ST4 jumper For wiring up the external potentiometer the earth wires must be isolated as well as the potentiometer terminals wires at the same voltage as the power 2 4 LAM characteristics Load Acceptance Module 2 4 1 Voltage drop The LAM system is integrated in the A V R It is active as standard It can be adjusted to 13 or 25 Role of the LAM Load Adjustment Module On application of a load the rotation speed of the generator set decreases When it passes below the preset frequency threshold the LAM causes the voltage to drop by approximately 13 or 25 and consequently the amount of active load applied is reduced by approximately 25 to 50 until the speed reaches its rated value again Hence the LAM can be used either to reduce the speed variation frequency and its duration for a given applied load or to increase the applied load possible for one speed variation turbo charged engines To avoid voltage oscillations the trip threshold for the LAM function should be set approximately 2 Hz below the lowest frequency in steady state It is advised to use the LAM at 25 for load impacts gt at 70 of the genset rated power 2 4 2 Gradual voltage return function During load impacts the function helps the genset to return to its rated speed faster thanks to a gradual increase in voltage according to the following principl
93. 9 11JUNO9 1 1 072209 50 2 PN 89 187 290 Maintenance As required Clean or replace air filter one piece Clean air filter when restriction indicator A is red Air filter can be cleaned up to six times Thereafter or at least once a year it must be replaced Proceed as follows 1 Thoroughly clean all dirt around air filter area 2 Loosen clamp B then remove air filter IMPORTANT Never reinstall an air filter which shows evidence of bad condition punched dented allowing no filtered air to enter the engine CD30766 UN 06SEP99 3 Clean air filter with compressed air working from clean to dirty side NOTE Compressed air pressure must not exceed 600 kPa 6 bar 88 psi Mark air filter to keep track of each cleaning operation Fully depress air restriction indicator reset button and release to reset indicator Check air system entirely for proper condition see CHECKING AIR INTAKE SYSTEM RG9912 UN 25FEB99 DPSG CD03523 44 19 22JANO7 1 1 072209 50 3 PN 90 188 290 Maintenance As required Clean or replace air filter element CD30772 UN 27AUG99 A Primary element B Secondary safety element C Air restriction indicator D Wing nut Clean air filter when restriction indicator C is red Replace both primary A and secondary B filter elements after primary element has been cleaned six times or at least once a year IMPORTANT If primary elemen
94. 90 Operating the Engine 2 The first seven items of the Main Menu will be displayed GO TO 1 UP DISPLAY RG13160 UN 020CT03 Menu Display OURGP11 00000A9 19 03SEP03 2 5 3 Pressing the Arrow keys will scroll through the menu selections GO TO 1 UP DISPLAY STORED CODES ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT se O E Q O A 1 Z a co e O x Main Menu ltems OURGP11 00000A9 19 03SEP03 3 5 4 Pressing the right arrow key will scroll down to reveal the last items of Main Menu screen highlighting the next item down ADJUST CONTRAST UTILITIES RG13162 UN 26SEP03 Last Items On Main Menu Continued on next page OURGP11 0000049 19 03SEP03 4 5 072209 15 2 PN 39 137 290 Operating the Engine 5 Use the arrow keys to scroll to the desired menu item GO TO 1 UP DISPLAY 98 or press the Menu Button to exit the main menu and 8f 9D CODES 25 1000 RPM return to the engine parameter display A p SELECT UNITS 14 2 57 PSI ADJUST BACKLIGHT BAT YOLT On PRES RG13163 UN 020CT03 Use Arrow Buttons To Scroll Quadrant Display OURGP11 00000A9 19 03SEP03 5 5 Engine Configuration Data 98 1000 RPM LOAD ALP ENG AFA NOTE The engine configuration data is a read 1800 RPM TSG COOL TEMP 14 2 o7 ESI only function NOTE The engine does not need to be running to navigate the diagnostic gauge screens If engine
95. ACM 8 Volt DC supply open short to ground s je W 723 32 po I Regulation sensor of the injection pressure control ell CIRE Secondary engine speed sensor data intermittent Secondary engine speed sensor loss of signal Secondary speed sensor a 283 290 EN Description Comment John Deere Volvo 723 ii oe A detection ee ee e A a E A a U Calculates vehicle speed input noise Popidon Mn Co i a a ES a Pl diagnostic ouputshortio ground i SSS AAA S E E ee vale invalid ormissing 970 Auxiliary engine shutdown switch status EMS _ EA N ee NOM Auxiliary engine shutdown switch active EOI E DS PU UE TO IPUR 31 MM External engine de rate switch active Notused tos ooo tive size status ff Tire sizeerror S o T e size invad o nn is MO rresieeror A ee A Feed pump Feed pump of the fuel circuit the fuel circuit ME t enad ia M pump or open circuit Pump coil shortto ground a IEEE LN Fuctinjection pump status Pump control valve closure too long Injection DETO Pump contol vave closure too short Injection DE1O Pump detected detect Injection VP44 Pump solenoid currenthigh Injection DEtO Pump solenoid circuit open Injection DE1O Pump solenoid circuit severely shorted Injection DETO Pump control valve closure not detected Injection DE1O Pump solenoid circuit moderately shorted Injection DEO Pump current decay t
96. ANT The tightness check must nonetheless be carried out whenever you have towed the trailer 32 290 Lights signalling Warning lights are obligatory for on road driving Signalling must comply with regulations in force in the country of use Front reflective devices white Red rear lights direction indicators stop lights Rear reflective devices red triangle Side reflective devices orange Figure 12 Example of French signalling 3 4 Rail transport 3 4 1 Generating sets with and without an enclosure Generating sets must be transported by rail in accordance with the specific rules governing rail transport When transporting generating sets in containers by rail the following steps must be observed 1 Puta plastic cover over non enclosed generating sets during transportation 2 Choose transport equipment appropriate for this usage and having all the safety guarantees both in terms of load bearing capacity and securing devices 33 290 3 5 Shipping 3 5 1 Generating sets with and without an enclosure Transportation must be carried out in accordance with the rules of shipping Generating sets must be transported in a shipping container When shipping generating sets in containers the following steps must be observed 1 Choose transport equipment appropriate for this usage and having all the safety guarantees both in terms of load bearing capacity and securing devices 2 In the case of a grouped l
97. AUTOMATIC starting programmed start G5 19min30 Countdown of micro disconnection delay OR EJP for France only Date and time depending on settings 24 08 2005 72 290 Generating set start up pC Screen Data displayed Screen No G6 STARTING Operating phase genset starting IN PROGRESS Date and time depending on settings 24 08 2005 AIR PREHEATING Operating phase air preheating prior to genset starting Countdown of the air preheating delay 10sec Date and time depending on settings 24 08 2005 Generating set started ScreenNo Screen Data displayed AVAILABLE POWER Operating phase genset operating stable G8 15 voltage and frequency oe A Available power screen Date and time depending on settings 24 08 2005 AUTOMATIC STOP Operation mode operation in AUTO mode IN PROGRESS Power supply device opens motorised circuit breaker or changeover switch controlled by the LOAD SUPPRESSION TELYS Countdown of the Mains Return delay OR Test on load delay Date and time depending on settings 1min30 24 08 2005 13 12 73 290 Screen No Screen AUTOMATIC STOP IN PROGRESS COOLING 1min30 24 08 2005 COUPLING IN PROGRESS 24 08 2005 POWER TRANSFER Grid Generating set l r Y 24 08 2005 POWER TRANSFER Grid Generating set G 10 3 lmi M ae A A E o A 24 08 2005 74 290 Data displayed Operation mode operation in AUTO mode Genset coolin
98. CD6068HFS72 DE10 Fuel System CD6068HFS73 HPCR System 2 Valve Head CD6068HFS76 HPCR System 4 Valve Head CD6068HFS77 HPCR System 4 Valve Head CD6068HFU72 DE10 Fuel System CD6068HFU74 HPCR System 4 Valve Head CD6068HFU79 HPCR System 2 Valve Head Emission Certified Engines EPA Tier 2 CD3029TF270 Mechanical Fuel System CD4045TF270 Mechanical Fuel System CD6068HF275 VP44 Fuel System CD6068HF475 HPCR System 4 Valve Head Introduction Emission Certified Engines EPA Tier 3 CD4045HFS80 Mechanical Fuel System CD4045HFS82 HPCR System 2 Valve Head CD4045HFS83 HPCR System 2 Valve Head CD6068HFS82 HPCR System 2 Valve Head CD6068HFS83 HPCR System 2 Valve Head CD6068HFS89 HPCR System 4 Valve Head READ THIS MANUAL carefully to learn how to operate and service your engine correctly Failure to do so could result in personal injury or equipment damage THIS MANUAL SHOULD BE CONSIDERED a permanent part of your engine and should remain with the engine when you sell it MEASUREMENTS IN THIS MANUAL are given in metric Use only correct replacement parts and fasteners Metric and inch fasteners may require a specific metric or inch wrench WRITE ENGINE SERIAL NUMBERS and option codes in the spaces indicated in the Serial Number Section Accurately record all the numbers Your dealer also needs these numbers when you order parts File the identification numbers in a secure place off the engine or
99. CKLIGHT ADJUST CONTRAST Press Enter Key RG13185 UN 020CT03 Continued on next page OURGP11 00000AF 19 03SEP03 3 6 15 12 PN 49 147 290 Operating the Engine 4 Use the Arrow keys to select the desired contrast intensity ADJUST CONTRAST RG13186 UN 29SEP03 Adjust Contrast Intensity OURGP11 00000AF 19 03SEP03 4 6 5 Press the Menu key to return to the main menu ADJUST CONTRAST O MS lt A gt ioe Oo A Lu op oO i Z D N 00 ioe ps O X Return To Main Menu OURGP11 00000AF 19 03SEP03 5 6 6 Press the Menu key to exit the main menu and return to the engine parameter display 1000 RPM 1800 RPM NAO CooL TEMP 14 2 o7 ESI RG13159 UN 26SEP03 Exit Main Menu OURGP11 00000AF 19 03SEP03 6 6 Selecting Units Of Measurement 98 1000 RPM LOA CAPM ENG AFA 1 Turn the key switch to the ON position Starting at the single or four engine parameter display press the 1800 RPM 14 2 57 PSI Menu key BAT VOLT GIL PRES RG13159 UN 26SEP03 Menu Key Continued on next page OURGP11 00000B0 19 O3SEP03 1 7 15 13 PN 50 148 290 Operating the Engine 2 The main menu will be displayed Use the Arrow GO TO 1 UP DISPLAY keys to scroll through the menu until Select Units is STORED CODES highlighted ENGINE CONFIG SETUP 1 UP DISPLAY SETUP 4 UP DISPLAY SELECT UNITS ADJUST BACKLIGHT OPO Select Units RG13188 UN 020CT03 OURGP11 00000B
100. Data displayed Fuel level indicator Alarm Fault Alarm Fault lt low fuel level gt high fuel level Coolant level temperature indicator Alarm High aJ Po 4 No preheating igh Low level level fault Ne fault fault q alarm p alarm lt fault m Battery charge lon en a Max battery a eon dedo NNS voltage flashing DW fiashingibars Oil pressure temperature indicator High or low oil I lt flashing Min battery a 7 voltage DA Oil pressure level Alarm Fault gt Alarm J Fault js Alarm Fault Emergency stop High or low oil ih temperature d dy Emergency stop fault Overload or short circuit Tripping of circuit breaker following an overload or short circuit Engine speed Underspeed fault Non starting fault 68 290 EN 6 3 1 5 Description of the pictograms in zone 3 Zone 3 pictograms All the pictograms for these zones are activated when the TELYS is initialised The pictograms below are shown for information only Generating set stopped Fuel Level Indication High temperature HT coolant temperature indication units as per settings menu at Battery Voltage indication Oil Temperature Indication units as per settings menu m Genset start up or genset started or genset stoppage in progress O E 1 RPM Engine Speed Indication High temperature HT coolant temperature Cl i i C indication units as per settings menu P2 Oi
101. E A E EN T AE ET A E E DE EET E EE S E AI e E 86 7 8 INO 1OaG and UNOS IO AC TSS IS ii a e e ates ends a E A a 86 LALO Halere dci ad 87 8 1 Checking the electrolyte level nin a 87 8 2 Ghecking the voltage acid dns a da eii cias 87 8 3 A A sent eed a we secenaumeceuaraceceanaece eeececaces 88 8 4 Cleaning the batery iii A ania eai 88 8 5 FAUNA a o e e eee ett de e eee eae ea ese ree eee eee 89 O cataracts asec ccentasioae a A aae ec a ae aw Sin oe sana aR EASE cpa aceon oes aS ae eaves 90 9 1 Dual ING queno is 90 9 2 A o On go e a a aaa 93 9 3 A O A A aay ee en ee oon eee ee ee eee 93 A RR eh ee ee gee ER ee mee ee ee 95 10 1 Appendix A Engine user and maintenance Manual cccccccceccceeeeeeeece cece eeeee cece eeeeeeeseeeseeeseeeeseeeseeeseeseesaeesaueeseeseeteeeaes 95 10 2 Appendix B Alternator user and maintenance Manual c oocccocncocccnccccocnconnnoncnoncnnonnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnrnnnnrnnnnnnnaninnninos 219 10 3 Appendix C List of John Deere Volvo and Perkins fault COJeS c occconnccoccconncooonconcncocnconnconnnononononconnnnonnnonnncnrncnnnnnnnnnns 275 2 290 TABLE OF ILLUSTRATIONS Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 Figure 19 Figure 20 Figure 21 Figure 22 Figure 23 Warning OIC T
102. ERATURE 1 BATTERY POTENTIAL 3 Note the number fo the right of the selected parameter nd cating that the parameter ig now assigned to that display location RG13232 UN 26SEP03 Return To 4 Up Custom Setup OURGP11 00000B2 19 03SEP03 11 14 12 The selected quadrant has now changed to the new selected parameter 125 F 1000 RPM COOL TEMP ENG RPM 143 F 57 PSI OIL TEMP OIL PRES RG13153 UN 24SEP03 4 Up Display Continued on next page OURGP11 00000B2 19 03SEP03 12 14 15 24 PN 61 159 290 Operating the Engine 13 Repeat the parameter selection process until all spaces are as desired o 125 F 1000 RPM 14 Press the Menu key to return to the main menu COOL TEMP ENG RPM 14 3PPF of PSI OIL TEMP GIL PRES RG13154 UN 24SEP03 Return To Main Menu OURGP11 00000B2 19 03SEP03 13 14 15 Press the Menu key to exit the main menu and return 3 to the engine parameter display 125 1000 RPM SETUP 4 UP DISPLAY SELECT NITS 57 PSI ADJUST BACKLIGHT lL PRES RG13155 UN 07O0CT03 Select Remaining Parameters OURGP11 00000B2 19 03SEP03 14 14 Break in period Within first 100 hours of operation After the first 100 hours drain the crankcase and change During the first 100 hours of operation avoid overloading the oil filter see CHANGING ENGINE OIL AND FILTER excessive idling and no load operation Fill crankcase with seasonal viscosity grade oil see DIESEL ENGINE OIL If o
103. EVERE LEVEL The signal communicating information is within a defined acceptable and valid range but the real world condition is above what would be considered normal as determined by the predefined least severe level limits for that particular measure of the real world condition Region of the signal range definition Broadcast of data values is continued as normal FMI 16 DATA VALID BUT ABOVE NORMAL OPERATING RANGE MODERATELY SEVERE LEVEL The signal communicating information is within a defined acceptable and valid range but the real world condition is above what would be considered normal as determined by the predefined moderately severe level limits for that particular measure of the real world condition Region k of the signal range definition Broadcast of data values is continued as normal FMI 17 DATA VALID BUT BELOW NORMAL OPERATING RANGE LEAST SEVERE LEVEL The signal communicating information is within a defined acceptable and valid range but the real world condition is below what would be considered normal as determined by the predefined least severe level limits for that particular measure of the real world condition Region h of the signal range definition Broadcast of data values is continued as normal FMI 18 DATA VALID BUT BELOW NORMAL OPERATING RANGE MODERATELY SEVERE LEVEL The signal communicating information is within a defined acceptable and valid range but the real world condition is below what would be conside
104. J p required Short circuit high side to low side or low side to B aa beers AA A MA E Deere 282 290 z CID FMI Description Comment Volvo Cylinder 5 injector status Recalibration of the injectors required Recalibration of the injectors required njector outside the specifications Injector outside the specifications Short circuit high side to B Short circuit high side to low side or low side to B Short circuit high or low side to ground Cylinder 5 circuit open Cylinder 5 circuit shorted Cylinder 5 balancing error mechanical failure Cylinder 5 unknown error mechanical failure Cylinder 6 injector status Recalibration of the injectors required Recalibration of the injectors required Injector outside the specifications Injector outside the specifications Short circuit high side to B Short circuit high side to low side or low side to B Short circuit high or low side to ground Cylinder 6 circuit open Cylinder 6 circuit shorted Cylinder 6 balancing error mechanical failure Cylinder 6 unknown error mechanical failure Glow plug relay status alsje eie leel ee AA E A AA A Deere 3 N O Glow plug relay voltage high 5s im Glow plug relay voltage low rev Je J stan relay stats S PL en tay control sor circuito high a PR ar etay conrotshortcicutow MN ASAS Cor JT evotpowersuppy aJJ
105. John Deere Engine Consult your John Deere engine distributor servicing dealer or your nearest John Deere Parts Network for recommended fuels lubricants and coolant Also available are necessary additives for use when operating engines in tropical arctic or any other adverse conditions Maintenance interval chart IMPORTANT Recommended service intervals are for normal operating conditions Service MORE OFTEN if engine is operated under adverse conditions Neglecting maintenance can result in failures or permanent damage to the engine DPSG CD03523 24 19 22JANO7 1 1 p Fi TUL ae TH TS100 UN 23AUG88 DPSG CD03523 25 19 22JANO7 1 1 Item 500 H 1000 H 1 year 2000 H 2 years 2500 H 3 years As required 10 H daily Check engine oil and coolant level Check air filter restriction indicator Change engine oil and filter Replace fuel filter element s Check belt tension and automatic tensioner Check and adjust valve clearance Clean crankcase vent tube Check air intake hoses connections and system Pressure test cooling system Check vibration damper 6 cyl Check engine speed and speed drop governor Drain and flush cooling system Drain water and sediment from fuel filter Clean filter element see note a Test thermostat and injection nozzles see your dealer 9 Test glow plugs HPCR 4 valve head
106. LAM without LAM CIA _ gt ST3 T I I T m da Frequency U50Hz 60Hz ST9 ra a of ID ST10 a E t LAM 13 25 J dh ra P p P1 Excitation EP53 ceiling pS ST4 Option F Y open External potentiometer ST 1 1 knee point 65 Hz for adjusting the voltage Response FA normal ST2 time ra fast A K P3 Stability N 1 3 SHUNT or separate excitation system A V R can be operated with SHUNT supply with a transformer secondary 50V or a 48V battery L LI Option R731 3 ph detection Ni in 3 ph detection ST1 open Single phase detection LEROY SOMER 263 290 LEROY SOMER R438 A V R 2 R438A V R 2 1 Characteristics Storage 55 C 85 C Operation 40 C 70 C Standard power supply AREP or PMG Rated overload current 8A 10s Electronic protection overload short cir cuit on opening of voltage sensing circuit excitation overload current for 10 seconds then return to approximately 1A The alter nator must be stopped or the power switched off in order to reset the protection Fuse F1 on X1 X2 8A slow 250V Voltage sensing 5 VA isolated via trans former e 0 110 V terminals 95 to 140 V e 0 220 V terminals 170 to 260 V e 0 380 V terminals 340 to 520 V Voltage regulation 1 Normal or rapid response time vi
107. O 19 22JANO7 1 1 072209 05 5 PN 30 128 290 Safety Practice Safe Maintenance Understand service procedure before doing work Keep area clean and dry Never lubricate service or adjust machine while it is moving Keep hands feet and clothing from power driven parts Disengage all power and operate controls to relieve pressure Lower equipment to the ground Stop the engine Remove the key Allow machine to cool Securely support any machine elements that must be raised for service work Keep all parts in good condition and properly installed Fix damage immediately Replace worn or broken parts Remove any buildup of grease oil or debris On self propelled equipment disconnect battery ground cable before making adjustments on electrical systems or welding on machine On towed implements disconnect wiring harnesses from tractor before servicing electrical system components or welding on machine oe O lt 2 i Z N 09 E DX SERV 19 17FEB99 1 1 Work In Ventilated Area Engine exhaust fumes can cause sickness or death If it is necessary to run an engine in an enclosed area remove the exhaust fumes from the area with an exhaust pipe extension If you do not have an exhaust pipe extension open the doors and get outside air into the area TS220 UN 23AUG88 DX AIR 19 17FEB99 1 1 072209 05 6 PN 31 129 290 Avoid High Pressure Fluids Escaping fluid und
108. O gras tras iii coo 5 Pictograms INdICatIind prohibited ACHVINISS oseca tua cabunasadadee tiadanuenecualandaenasdacaeaiarednnsesieladanduadabhasdavadanacaeks 5 Pictograms indicating compulsory operations vscssciis dived teysencanuteundesoveor vader daentouaamisiwedd tuaiaeceuhcdutecneausers 6 information pico IAS ssis tnaa ana e e aa e ceneatiedestentshswiedGedoiasstdivevestedes 6 919 lolo A eh ee the a a a Ae ie ei a 7 Pictograms relating To batlery OperaliOnS wuciwavasiansiieval nia anneal a 7 General description of the generating Ci o a ado ad gases 15 General description of the generating Selt ooccccoconnncccncnnoconnnconononononcnnnnnrnnononnnnnnnnnnnnnnnrnnnnnnnnnnnnnnnnrnnrnnnrnnnnnnrnnnnnnenrnnenaness 16 General description of the generating Set CONTTOl oooccccconnncccocnnnonncnnnnoncnnnnnncnnnnnrnnnnnncnnonnncnnnnnrrnnrnnnnnrnnnrnnrrnnrnnonnrnnnnnneos 17 Example of a generating set identification plate essiensa iea a aaaea eia SEAE Taa E LLa 20 PIO Fete ALON COMINO ads 21 Example Ol Franca SINO ii iaa 33 Examples of problems that may be encountered occcocccccccnccccnccccnnconcncnncncnncnononnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnennnnnnnninonos 35 Ponte US CIAO MIA AN O de eee Uat bocas 37 Nel CAMO Sy Sta laa ia dl 39 Meweotihe TONT SIOE sii ida 53 D scriptiorof me LEDS is 54 ENTE WO DIGIO GANS es o dd a a A a 54 View orhe tont pane Loca o tt 64 Description ore LEDS la ee elias Dido 65 A
109. OURGP11 00000B2 19 03SEP03 3 14 4 Two options are available for the 4 Up Display USE DEFAULTS a Use Defaults This option contains the following CUSTOM SETUP engine parameters for display Engine Speed Battery Voltage Coolant Temperature and Oil Pressure Custom Setup This option contains a list of engine parameters Engine parameters from this list can be selected to replace any or all of the default ER parameters E Select Factory Defaults co O E O O A 1 Z gt y y N 92 A O x OURGP11 00000B2 19 03SEP03 4 14 To reset the display parameters to the factory defaults scroll to and highlight Use Defaults Press the Enter key to activate the Use Defaults function RESTORED TO A message indicating the display parameters are DEFAULTS reset to the factory defaults will be displayed then the display will return to the Setup 4 Up Display menu Restored To Defaults RG13149 UN 24SEP03 Continued on next page OURGP11 00000B2 19 03SEP03 5 14 15 22 PN 59 157 290 Operating the Engine 6 Custom Setup To perform a custom setup of the 4 Up Display use the arrow buttons to scroll to and a ee highlight Custom Setup on the display RG13227 UN 26SEP03 oe Custom Setup OURGP11 00000B2 19 03SEP03 6 14 The quadrant with the highlighted parameter value is the current selected parameter Use the Arrow keys to highlight the value in the quadrant you wish to c
110. Only use flexible durable cables with a rubber covering which conform to ECI 245 4 or equivalent cables Refit the protective plates blanking covers after each maintenance operation Note The electrical equipment supplied with the equipment complies with standard NF C 15 100 France or with the standards of the countries in question 10 290 EN 1 4 3 Safety precautions in case of electrical shock In the event of an electric shock observe the following instructions 1 Avoid direct contact both with the live conductor and the victim s body 2 Shut off the power immediately and activate the emergency stop for the equipment concerned Note the live wire may be cut with an axe Take extreme care to avoid the electric arc that will be generated by this 3 If it is impossible to access the equipment move the victim away from the live conductor using a dry piece of wood dry clothing or other non conducting material Move the victim away from any situations where there is a danger of death Contact the emergency services If breathing has stopped begin artificial respiration at once S o OS In the event of cardiac arrest carry out cardiac massage 1 4 4 Safety precautions relating to fire burns and explosions A DANGER FUELS FLAMMABLE PRODUCTS PRESSURISED FLUID RISK OF BURNS RISK OF FIRE RISK OF EXPLOSION Before starting the equipment move any flammable or explosive products away
111. POWER 1800 rpm kW hp 67 90 85 114 107 143 Prime POWER 1800 rpm kW hp 74 99 94 126 118 158 Standby Width overall mm 600 765 765 Length overall mm 1230 1365 1365 Height overall mm 1010 1162 1162 Weight dry kg 505 505 505 Engine oil quantity L 12 16 16 Engine coolant quantity L 25 32 32 With Fan Approximate ITEM UNIT OF MEASURE 6068HFS82 6068HFS83 6068HFS89 Number of Cylinders 6 6 6 Fuel Diesel Diesel Diesel Bore mm 106 5 106 5 106 5 Stroke mm 127 127 127 Displacement L 6 8 6 8 6 8 Compression Ratio 19 0 1 19 0 1 17 0 1 POWER 1500 rpm kW hp Prime POWER 1500 rpm kW hp Standby POWER 1800 rpm kW hp 134 180 161 216 214 287 Prime POWER 1800 rpm kW hp 147 197 177 237 235 315 Standby Width overall mm 784 784 960 Length overall mm 1500 1500 1509 Height overall mm 1137 1137 1381 Weight dry kg 764 764 764 Engine oil quantity L 32 32 32 Engine coolant quantity L 32 32 35 With Fan Approximate CD03523 00001D4 19 08JUL09 1 1 65 7 bate PN 115 213 290 Specifications Unified Inch Bolt and Screw Torque Values TS1671 UN 01MAY0O3 O O 16008 Bolt or SAE Grade 1 SAE Grade 2 SAE Grade 5 5 1 or 5 2 SAE Grade 8 or 8 2 Screw Lubricated Dry Lubricated Dry Lubricated Dry Lubricated Dry Size N m Ib in Nm _ lbin
112. PP un ee ee eee Sen rae ere ee 65 Description of the screen CXAMPIE ccccseeccccescecceeececceuseecseueeecsuseecseueeecseueeecsuseeseussesecseseeessueeeeseuseessaueeessusessagesesseneeenas 66 hrailer IUDriGallOn Greasing PONS see alo le a ie dad at O anal ote eb Cl eek a O 83 3 290 1 Preface 1 1 General recommendations The information contained in this manual is taken from technical data available at the time of print In line with our policy of continually improving the quality of our products this information may be amended without warning Read the safety instructions attentively in order to prevent any accident incident or damage These instructions must be adhered to constantly In order to obtain optimum efficiency and the longest possible service life for the generating sets maintenance operations must be carried out according to the periods indicated in the attached maintenance tables lf the generating set is used under dusty or unfavourable conditions some of these periods will be shorter Ensure that all adjustments and repairs are carried out by personnel who have received appropriate training Our agents possess this qualification and can answer all of your questions They can also supply you with spare parts and other services and they have qualified staff to carry out preventive and corrective maintenance or even total reconditioning of generating sets The left and right sides can be seen from the back of
113. Preferred John Deere PLUS 50 Preferred ACEA E7 ACEA E6 ACEA E5 ACEA E4 ACEA E7 ACEA E6 Multi viscosity diesel engine oils are preferred If diesel fuel with sulfur content greater than 0 5 is used or if oil does not meet the classification above reduce the service interval by 50 DO NOT use diesel fuel with sulfur content greater than 1 PLUS 50 is a trademark of Deere amp Company 10 2 After the break in period use John Deere PLUS 50 or other diesel engine oil as recommended in this manual IMPORTANT Do not use PLUS 50 oil or engine oils meeting any of the following during the first 100 hours of operation of a new or rebuilt engine API CJ 4 ACEA E7 API Cl 4 PLUS ACEA E6 API Cl 4 ACEA E5 API CH 4 ACEA E4 API CG 4 ACEA E3 API CF 4 API CF 2 API CF These oils will not allow the engine to break in properly DX ENOIL4 19 13SEP06 1 1 SAE 15W 40 SAE 10W 40 SAE 0W 40 SAE 5W 30 Oil Viscosities for Air Temperature Ranges TS1675 UN O09O0CT06 CD ENOIL 19 01JULO9 1 1 072209 PN 35 133 290 Fuels Lubricants and Coolant Lubricant Storage Your equipment can operate at top efficiency only when clean lubricants are used Make certain that all containers are properly marked to identify their contents handle all lubricants ae A UONGANtS Properly dispose of all old containers and any residual Whenever possible store lubricants and contain
114. Primary fuel filter element 3 Firmly grasp the retaining ring A and rotate it clockwise 1 4 turn Remove ring with filter element B IMPORTANT Do not dump the old fuel into the new filter element This could cause fuel injection problem A plug is provided with the new element for plugging the used element 4 Inspect filter mounting base for cleanliness Clean as required NOTE Raised locators on fuel filter canister must be indexed properly with slots in mounting base for correct installation Install new filter element dry onto mounting base Be sure element is properly indexed and firmly seated on base It may be necessary to rotate filter for correct alignment Install retaining ring onto mounting base making certain dust seal is in place on filter base Hand tighten ring about 1 3 turn until it snaps into the detent DO NOT overtighten retaining ring NOTE The proper installation is indicated when a click is heard and a release of the retaining ring is felt 7 Bleed the fuel system DPSG CD03523 30 19 07FEBO7 1 1 072209 PN 74 172 290 Maintenance 500 hours Checking belt 3029 and 4039 Engines 1 Inspect belt for cracks fraying or stretched out areas Replace as necessary 2 Check belt tension using one of following methods a Use of JDG529 Tension Gauge A Specification z Belt tension New belt 578 622 N 130 140 Ib force Z Used belt unripe E 378
115. S ANGOULEME S A au Capital de 62 779 000 www leroy somer com 274 290 EN 10 3 Appendix C List of John Deere Volvo and Perkins fault codes Description Comment Thor 43 Position Trote 42 Position O O o o oOo Trote Voltage high shontove Sroniove Trote Voltage low shottov sroto 14 Throttle voltage out of range ray CE 2 Vehicle invalid or missing Not possible with Genset a ot ome ME p ya courier a VOLVO s s E oreo high shor toe Trote Voltage low shoto m application codes declared VOLVO Throttle votage out ofrangeiow UA Throttle calibration aborted Trot votage out ofrange Fuel rail pressure sensor PO i Fuer supply pressure extremelyiow s BEE Fuctrailpressure input voltage high Shor toV Fuet ral pressure input voltage low ShorttoV 5 BB Fuctraitpressure sensor open cret Fuctrailpressurelostdetected E Fuctraitpressure higher than expected Fuel supply pressure moderatelyhigh ar Fuctraitpressure not developed O O O o oOo Fuel supply pressure moderatelyiow Per oe J Waterintuctsensor o MIMI Waterin tual continuouslydetected a MI Water infuetinputvotagerigh sorov Waterintuelinputvotage low srono e Waterinfueldetetea weern re Je W ottevetsensor oo Ao evet ato beiownoma a E ot evet sensor input voltage Figh Shormto WE 4 BR ot evet sensor input vot
116. SHOCK Before use the generating set must always be earthed Protection against electric shocks is only effective once the earthing connection has been made Disconnect the battery leads starting with the negative lead or use the battery isolating switch before carrying out any operations on the generating set 1 Open the door to the power section no 1 then the access door to the cable router flap and to the connection terminal box no 2 2 Connect the earth cable supplied to the terminal rep 3 on the generating set located on the connection terminal box 43 290 Nature of ground cal er caras rod in metres 3 Check the length of the earthing rod depending on the nature of the ground and adapt if necessary Thick arable land damp 4 compact backfill The equipment supplied is not suitable for Thin arable land gravel rough 4 bare stony soils dry sand or impermeable backfill IMPORTANT rock Bare stony soils dry sand er eee impermeable rock 4 Plant the earthing rod in the ground and connect it to the earth cable Earth cable ground 1 metre Note For the United States National Electrical Code ref NFPA 70 use a copper wire with a minimum cross section of 13 3 mm or AWG 6 at most connected to the generating set s earth connection and a galvanised steel earthing rod completely buried in the ground in an upright position This earthing rod must be at least 2 5 m long of which at least 1
117. Sulphation storage of discharged battery The battery discharges very quickly Incorrect battery part no OSes Repeated deep discharging Battery stored too long without charge Replace the battery Check the charger necessary and repair if Recharge the battery Check the electrical installation Reduce the acid level and fill with distilled water Repeat the operation if necessary Recharge the battery Replace the battery Tighten the ends of the battery cables or replace them if necessary and replace the battery Replace the battery Check the load Replace the battery Define the correct battery part no for the recommended use It is recommended to charge the battery using a regulator High water consumption ES Check the ch lt lat g p Charging voltage too high eck the charger voltage regulator Sparks after battery charging Short circuit Connection or charging Internal fault for example interruption and low electrolyte level The battery explodes disconnection during 89 290 Replace the battery 9 Options 9 1 Dual frequency This operation must be carried out by a qualified electrician These operations must only be carried out when the generating set is stopped until you are instructed to start up the generating set IMPORTANT e Close the battery isolating switch to turn on the TELYS 2 e Turn the supply switch of the TELYS 2 to the ON position e Press the MENU k
118. There can bea maximum of 2 triplets in the winding at 2 levels warning and trip and 1 or 2 thermistors in the shields These sensors must be linked to adapted sensing relays Supplied optionally Cold resistance of cold thermistor sensors 100 to 250 Q per sensor 5 3 3 Connection accessories 12 wire machines coupling F 3 flexible SHUNTS After operational testing itis essential to replace all access panels or covers LEROY 18 SOMER 240 290 LSA 43 2 44 2 4 POLES ALTERNATORS 5 4 Exploded view parts list and tightening torque 5 4 1 LSA 43 2 44 2 single bearing 44 2 coupling LEROY 19 SOMER 241 290 20 LSA 43 2 44 2 4 POLES ALTERNATORS 5 4 2 LSA 43 2 44 2 double bearing 1 A Ww A fit QA gt ROROboeoonRaacQan DOOR VO VO VO NONE NANO VO ENE VE VENA WPEVAENONE VE VANA LSA 44 2 LEROY SOMER 242 290 LSA 43 2 44 2 4 POLES ALTERNATORS Description Description Stator assembly NDE bearing Preloading wavy washer Fan Exciter field Fixing screws Exciter field fixing 44 2 only screw Earth terminal Exciter armature DE shield Diode crescent support Terminal block support AREP Shield on exciter end Terminal block Tie rod 43 2 Voltage regulator Tie rod 44 2 AVR Cover front panel AVR damper seal Cover rear panel Terminal block Cover top panel Hub 43 2 L7 amp 44 2 Fixing screws Coupling dis
119. Ton temperatare senor a E Ot temperature extremely high ooo a MIM otemperature sensorinpat voltage high a EE otemperature sensorinput voltage low A a a7 J transmission oil temperature sensor Transmission oil temperature invalid hopian gt Ma Genset ro Ratedengine speed oT e Pe ss ee iso 190 190 Engine specdsensor S o Woe TS a MM E a Pl engine speed sensor abnormal update OP eraine speed sensorsignaliost ee Ss ee ref CMA CI ES Overspeed Overspeed moderate 278 290 EN John Deere Volvo ot ce m me me m F EE OE MR Engine timing abnormal caieto O DA I S T Sofware La Ml rcorrect engine sofware la TT eneek system parameters O OOo dL 2 ff Ml rcorrectparameters Pa a _ Action alert output status S 3 en ater output openisnontoBr fT a peon alert output shor to ground i Ts Ml Acton alert output opencrcut ae a vere output tas O Ss as Bi CA of EE a A SCT ul temperature lamp open short to A Mi gt grou nd 286 286 f J0 pressure output status coo EE Ol pressure output openishotlo BH a Ot pressure output short to ground 5 Mill Ot pressure output open crcut aja shutdown output status MEA srutcown output openishontioBe pF Shutdown output short to ground Ts il stucown output opencreut aja Warming opt st
120. UEL SUPPLY FROM DALY TAME ALIMEWTATION DU AAA PAR LA CUVE EXTERIGURE GENSET FUEL SUPPLY FROM EXTERNAL TANK Fuel supply Selection valve Securing straps routing point Figure 5 Specific pictograms Rinse any splashes of acid on the skin or in the eyes using clean water Wearing suitable protective clothing and Consult a doctor immediately goggles is compulsory Wash contaminated clothing with water Figure 6 Pictograms relating to battery operations 7 290 EN 1 4 Safety instructions RETAIN THIS MANUAL This manual contains important instructions which must be followed when installing or carrying out maintenance on a generating set and batteries IMPORTANT SAFETY ADVICE If any parts of this manual are not understood or in case of doubt contact your nearest agent in order to receive an explanation or demonstration to allow the equipment to be used correctly The guidelines listed below must always be respected to ensure the safety of personnel and equipment In addition to this information it is essential to refer to the local and national regulations applicable according to the jurisdiction 1 4 1 General guidelines Installing the equipment The installer of the equipment must create a document describing any modifications made to the equipment during installation Using the equipment Before starting any operations on the equipment gt Nominate an operations manager gt The role o
121. UP DISPLAY SELECT UNITS ADJUST BACKLIGHT IF Enter Key RG13169 UN 020CT03 OURGP11 00000AC 19 03SEP03 3 6 4 Ifthe word Next appears above the Arrow keys there are more stored codes that may be viewed Use FOLA the Arrow key to scroll to the next stored code SPN 94 FMI 18 FAULT FUEL DELIVERY PRESSURE CORRECTIVE ACTION CHECK FUEL FILTER AMD LINES NEXT gt HIDE RG13245 UN 020CT03 Use Arrow Keys To Scroll OURGP11 00000AC 19 03SEP03 4 6 5 Press the Menu key to return to the main menu Tofx SPN 110 FMI 16 FAULT ENGINE COOLANT TEMERATURE HIGH CORRECTIVE ACTION CHECK COOLING SYSTEM REDUCE POWER NEXT gt HIDE Qee Return To Main Menu RG13246 UN 020CT03 Continued on next page OURGP11 00000AC 19 03SEP03 5 6 072209 15 6 PN 43 141 290 Operating the Engine 6 Press the Menu key to exit the main menu and return to the engine parameter display 1000 RPM 14 2 of PSI GAT WOLT TAL PRES RG13159 UN 26SEP03 Exit Main Menu OURGP11 00000AC 19 03SEP03 6 6 Accessing Active Trouble Codes NOTE The engine does not need to be running to navigate the diagnostic gauge screens If engine Start up is desired See Starting The Engine All of the engine values illustrated on the diagnostic gauge indicate the engine is running RG13172 UN 26SEP03 For description of trouble codes see chart in Troubleshooting Section Normal Operation Duri
122. User and maintenance manual for generating sets oe ar ww ga EE B j Rental Power Ue solutions P rovider OS eM kD Translation of the original instructions R66C2C 33504041801NE 2 1 CONTENTS o A ee aes E eee yee rte ee eee ate 4 NR Genera MECO MMEnd as e ad e eo e do e e ad ta las O aaa 4 1 2 A E N IE E E dead ears E E A E deat E E A 4 1 3 Pictograms and meme aniNdS tarta ta li bib EEEE 5 1 4 Sale ASTUCIA a e e ener a nn a a an e dd 8 LAT General guidelines tes a A A ead ae nese aes eee 8 1 42 Electrical sately PrecauO AS iaa 10 1 4 3 Safety precautions in case of electrical SNOCK oococcoooncococononcccnconoconcnconononononcnnononcnnononnnnnnnrrnnnrnnnnnonnnnnnrnnrnnornnnnnonananinnns 11 1 4 4 Safety precautions relating to fire burns and explosions oooccccooccncccccnncnoncnnonononononcnnnnnnrnnonnnnnnonnnnnnnnnnrnnnnnnrnnennnrnnnnnrnnenannnns 11 1 43 POXICGIISK SAICLY DO CAULIONS A AS A A A oa 13 1 4 6 Precautions for risks relating to handling phases cccseecccceeeecceeececceeseccceueeeceuuceccaueeecseuseessueeeeseeeesseuseeseueeeesaueeessaeeesaaes 14 141 Precautions tor risks relating to NOISE eiii ias 14 De ene ral des cra a oi 15 2M o A eee es mTOR EMC a ream EOE ema eee eT oe eee een eee eon tee ere ee 15 De Technical Specmnca los rt ds ltda ote ctt 18 2 3 o eo E crc en Ne ee ee ee eee Oe 20 2 4 EII ete nio a A Sela Stn sic ne We cio ae iets Saldatnabed an
123. a ST2 jumper see below Voltage adjustment via potentiometer P2 other voltages via adapter transformer Current sensing parallel operation C T 2 5 VA cl1 secondary 1 A optional Quadrature droop adjustment via potentio meter P1 Max excitation current adjustment via P5 see below 2 1 1 Configuration jumpers function Delivrery config Open Closed ST1 Suh Open for module pn installation tri detection ST2 Fast Response time ST3 50 ou 60 Hz Frequency selection External ST4 potentio meter ST5 Without with LAM Others PMG Une Potentiometer LAM voltage drop amplitude U f function bend position 13 or 25 2 1 2 Setting potentiometers function Delivrery position NE Quadrature droop operation with C T Voltage S tability xcitation current ceiling 2 2 Frequency compared with voltage without LAM Voltage A Bend 57 5 Hz 48 HZ 4 4 100 U UN 50 Hz A 60 Hz Frequency Hz 60 Hz 2 3 LAM Load Acceptance Module characteristics 2 3 1 Voltage drop The LAM system is integrated in the R 438 AVR as standard Role of the LAM Load Adjustment Mo dule On application of a load the rotation speed of the generator set decreases When it passes below the preset frequency thres hold the LAM causes the voltage to drop by approximately 13 or 25 and conse quently the amount of active
124. age iow Shortto e MM ttevetsensoropencicut 275 290 Description Comment los pressure sensor open creut Manifold air pressure above normal Manifold air pressure below normal Incoherent measurement of the oil pressure Manifold air pressure sensor input voltage high Manifold air pressure sensor input voltage low Short to V Short to V Sensor shorted to earth Short to V Speed signal invalid Intermittent problem with speed information Manifold air temperature sensor Manifold air temperature extremely high Manifold air temperature sensor input voltage high Manifold air temperature sensor input voltage low Manifold air temperature sensor open circuit a Manifold air temperature moderately high a 3 Air inlet pressure sensor input voltage high 276 290 EN Comment Volvo i Description UN Air filter differential pressure sensor E Air filter restriction high Air filter differential pressure sensor input voltage high 4 Air filter differential pressure sensor input voltage low 5 Air filter differential pressure sensor open N circuit Not use with EDC lil and 274 Barometric pressure sensor EMS2 MN Air pressure invalid a High barometric pressure sensor short to A high 4 High barometric pressure sensor short to low 17 ECM option sensor not mojno no EN connected Coolant temperature sensor input voltage low a cootant temperature sensoropen creut 15 PI i cootan
125. al number Engine Control Unit ECU ccoocccoccccccncccncnnono High pressure fuel pUMP cccoccccncccccnccncncncncnncncnnnos Serial numbers Engine Control Unit ECU serial number Page Page Engine Option codes occooccconcccnoconoconooncconononos 03 3 Engine serial number plate o ccooccocccccnno 03 1 40 3 Fuel pump model nUMbeT ooccoccccncncccccnncnccncncnooos 03 5 POWERTech laDOlnsacioniiisca naciendo ida 03 1 40 1 Record engine serial nuMber occccccccccnccocccncoo 03 2 Record fuel injection pump model number 03 4 40 3 Specifications 40 4 Engine Pack EPA Tier 2 Emission Certified Engines 65 6 45 1 EPA Tier 3 Emission Certified Engines 65 7 Non Emission Certified Engines o 65 1 30 1 Stage ll Emission Certified Engines 65 4 30 5 Storage 30 4 EN Socovos ad 60 1 SUOMING el ciao 10 1 50 1 Storing lubricantS oocccocccccocncccnnconncconnnnnnonanonanoss 10 3 50 3 50 4 T 50 1 Torque charts 50 5 A ee ee eer 65 9 25 1 Unified aa 65 8 20 1 Trouble codes a le dais 55 11 20 1 Troubleshooting 02 1 e 55 8 65 9 A adalat cence 55 4 10 3 General information 0 0 cccccccseseeeseeseeeseeeeeeees 55 1 U Unified inch bolt and screw torque values 65 8 15 25 Units of measure Changin9Q ooconccinnnicicnnnoncnnncnos 15 13 15 29 15 29
126. al that you understand and take notice of the different warning symbols used WARNING Warning symbol for an operation capable of damaging or destroying the machine or surrounding equipment Warning symbol for general danger to personnel Warning symbol for electrical danger to personnel WARNING SYMBOLS We wish to draw your attention to the following 2 safety measures which must be complied with a During operation do not allow anyone to stand in front of the air outlet guards in case anything is ejected from them b Do not allow children younger than 14 to go near the air outlet guards Aset of self adhesive stickers depicting the various warning symbols is included with this maintenance manual They should be positioned as shown in the drawing below once the machine has been fully installed WARNING The alternators must not be put into service until the machines in which they are to be incorporated have been declared compliant with Directives EC and plus any other directives that may be applicable Note LEROY SOMER reserves the right to modify the characteristics of its products at any time in order to incorporate the latest technological developments The informa tion contained in this document may therefore be changed without notice Copyright 2004 MOTEURS LEROY SOMER This documentis the property of MOTEURS LEROY SOMER It may not be reproduced in any form without prior authorization All br
127. alas Se etude ae ee 21 2 Fuels IMD rICaNntS anOsCOOlA MiS taa eee a a 22 23A cal ot 672 ot U 11 a ence ae ome nen ee ee ne eee ee Re eee ne ee RE cc nd a en er eer ene eae 22 202 Lubricant SPEC INC AVOMS anita 24 2 93 OOlANE SPECIGI NONS ud a ir ata 25 3 WARS porno Ne SCHUH INN TMU e a ie a EE A e o ao o ad ace eee al 27 3 1 Warnings c onceming ans pOr AA A A nana 27 3 2 Prepanna Tortas por sisi ds 27 3 3 or e unc vesdulende lea gcelactieat afte a td oh taedeotasae 2 27 3 3 1 Generating sets with and without an enclosure coooonccccocccnccnocnncnnnnnnnnnnnnnonnccnnnnncnnnnnnrnnnnnnnrnnnrnnnnnnrnnnrnnnnnnnnnnrnrrrnnrnrnnnrnirnnaninos 27 33 2 6Generating Selsson ale A A A A A ocean eee ee eee 28 3 3 21 Hitchmd ana UAANCAINd Tetra ler A AAA A A a taba 28 3 322 Aro de A retegeess ecttecds 32 3 3 2 3 O e Poe O A 32 3 4 PRIN TAINS OOM etnies tte a cet e Mee eee 33 3 4 1 Generating sets with and without an enclosure ccccecccecseeeee ce eeeee eee eee seen sees eee sees a eeesa eee esa assets aa eeeesaaaeeeesaaeeeeaaeeesaaeeessaeeeeeas 33 3 5 A eee 34 3 5 1 Generating sets with and without AN enclosure c cccccccssececceeseecceseeccauececcaeeecseeeeseusecssaecesseueeeessuaeeessegeeesseseeessuesesseneeesas 34 3 6 AI llocs 34 AOS tala COMME CONS saai aya a a a a a a Era 35 4 1 Unloading t hegenerating Seteone A Aa A A AA A EEA A a A TR 35 AL OASOsSINg Me IOCAUOM sa A A IAS AA AS SA AA 35 a Se UA A 36 4
128. an cause impairment or loss of hearing Wear a suitable hearing protective device such as earmuffs or earplugs to protect against objectionable or uncomfortable loud noises TS207 UN 23AUG88 DX NOISE 19 O3MAR93 1 1 072209 05 4 PN 29 127 290 Safety Handle Chemical Products Safely Direct exposure to hazardous chemicals can cause serious injury Potentially hazardous chemicals used with John Deere equipment include such items as lubricants coolants paints and adhesives A Material Safety Data Sheet MSDS provides specific details on chemical products physical and health hazards safety procedures and emergency response techniques Check the MSDS before you start any job using a hazardous chemical That way you will know exactly what the risks are and how to do the job safely Then follow procedures and recommended equipment TS1132 UN 26NOV90 See your John Deere dealer for MSDS s on chemical products used with John Deere equipment DX MSDS NA 19 O3MAR93 1 1 Stay Clear of Rotating Drivelines Entanglement in rotating driveline can cause serious injury or death Keep master shield and driveline shields in place at all times Make sure rotating shields turn freely Wear close fitting clothing Stop the engine and be sure AA the PTO driveline is stopped before making adjustments or En performing any type service on the engine or PTO driven equipment TS1644 UN 22AUG95 CD PT
129. andby Width overall Length overall 123 165 Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate General engine pack specifications EPA Tier 2 Emission Certified Engines ITEM UNIT OF MEASURE 3029TF270 Number of Cylinders 3 Fuel Diesel Bore 106 5 Stroke 110 Displacement 2 9 Compression Ratio 17 2 1 POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate 65 6 212 290 6068HFU74 6 8 17 0 1 166 223 188 252 184 247 207 277 191 256 201 269 960 1509 1381 764 32 35 4045TF270 4 Diesel 106 5 127 4 5 17 0 1 6068HFU79 6 8 19 0 1 139 186 153 205 CD03523 0000194 19 08JULO9 3 3 6068HF475 6 Diesel 106 5 127 6 8 17 0 1 213 286 234 314 627 1161 1044 587 32 35 CD03523 00001D3 19 08JULO9 1 1 072209 PN 114 Specifications General engine pack specifications EPA Tier 3 Emission Certified Engines ITEM UNIT OF MEASURE 4045HFS80 4045HFS82 4045HFS83 Number of Cylinders 4 4 4 Fuel Diesel Diesel Diesel Bore mm 106 5 106 5 106 5 Stroke mm 127 127 110 Displacement L 4 5 4 5 4 5 Compression Ratio 19 0 1 19 0 1 19 0 1 POWER 1500 rpm kW hp Prime POWER 1500 rpm kW hp Standby
130. ands and models have been registered and patents applied for LEROY 2 SOMER 224 290 LEROY SOMER Installation and maintenance LSA 43 2 44 2 4 POLES ALTERNATORS CONTENTS 1RECGBIP Pura alot oo 4 1 1 Standards and safety MEASULES ccccssescecceeeeceesceeeeeeceusececcesecessesseeessaaesesseeneeeesas 4 A Sn A 4 AAA nn rn 4 A A seascecatiedasuauseacncauenecey 4 10 ADICON ense ips 4 1 6 Contraindications tO USO sports soittiass 4 2 TECHNICAL CHARACTERISTICS nusisionida aa ad cobos 5 2 1 Ele trical characteriStiCS said teen 5 2 2 Mechanical characteristics riscos 5 gt INSTALLATION cocoa clas palos 6 e EOI EE T 6 3 2 Checks prior to first use sico ide pis T 3 3 Terminal connection IMSS cada area aia T A en 10 ds CNO UN nad cae 10 4 SERVICING MAINTENANCE ooooocccococccncnccnonanonnnanononanonnnnnnnnnannnonarennnnrernnnnennnnrrrnnnnnnnannns 11 4 1 Safety measures eisai ctecccsaniaupdeniciatcbcenenssdenndbscecntceitedatuanseaainndeoniaeniedardanectadaassoredsebeuscds 11 4 2 Routine maintenance uni es 11 4 3 Fault dele COM sisi aorta 11 4 4 Mechanical defects usais ida 12 4 5 EIS CIC AN fauls Soc sce tetedete ceseete tec teesencequencneaade2enccesasacetusasasanemeenieicedeboc ieni iEn ani ii 12 4 6 Dismantling reassembly sti lirica 14 4 7 Installation and maintenance of the PMG oocccccccncccccncccccnnonocnncnocnnnnnnnnonannnonanonononinos 16 4 8 Table of characteristics es
131. at least 2 minutes for starter to cool before trying again 6 Crank engine for 20 seconds with starter do not allow the engine to start Wait 2 minutes and crank engine an additional 20 seconds to assure bearing surfaces are adequately lubricated Start engine and run at no load for several minutes Warm up carefully and check all gauges before placing engine under load On the first day of operation after storage check overall engine for leaks and check all gauges for correct operation DPSG CD03523 54 19 22JANO7 1 1 072209 PN 108 Specifications General engine pack specifications Non Emission Certified Engines ITEM Number of Cylinders Fuel Bore Stroke Displacement Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate ITEM Number of Cylinders Fuel Bore Stroke Displacement Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan UNIT OF MEASURE mm mm kW hp kW hp kW hp kW hp mm mm mm kg UNIT OF MEASURE
132. ats ma ouput penis BE pF Warning output shor to ground op Mooon raz J Temperature sensor inthe EGR valve o Temperature in the EGR extremely high pen 09S of he Fempsratire Sensor shortio e ert votiege of he Femperatire Sensor Shortio vo MA TemperatueintheEGRhigh temperature in the EGR moderately high ras JENGINERUN outputstaus PO Eor run output openishon tobe a PBB Enone run output shorttoB oo pee ear selection ee Not possible with Genset Gear selection invalid ed application 279 290 O Data link faulty J1587 Start Stop redundancy J1939 communication bus Redundancy of the Stop start information Injector wiring status Injector wiring shorted to power source Cae Injector wiring shorted to ground 5 Volt sensor power supply FMI not informed by VOLVO Sensor power supply short to ground Start enable device intake heater and ether Start enable device output short to B enable device Start enable device output short to B short to B N es enable device output short to Dl a me conte pane is in charge of managing the ground l start enable device Start enable device output open circuit AA Power supply Loe A Injector supply voltage problem For 6125HF070 only ECU unswitched power missing For 6068HF275 VP44 only E ent voltage Se ae n Memory fauitin EMSZ O ME MEET a PM cPUwatcndog
133. atus are in good operating condition Respect the handling instructions described in the present documentation and the pictograms displayed on the equipment to be handled 4 Be sure never to stand under the load being handled Note the lifting rings provided on the equipment are designed to handle the generating set alone If additional equipment is fitted to the generating set a study should be conducted in order to define the centre of gravity of the assembly and to check the correct mechanical performance of the structure and its lifting rings 1 4 7 Precautions for risks relating to noise HIGH SOUND LEVEL RISK OF HEARING LOSS Always use suitable ear defenders when working in close proximity to a generating set which is in operation Note for generating sets used inside for which the ambient noise levels are dependent upon the installation conditions it is not possible to specify these ambient noise levels in the operating instructions As prolonged exposure to high sound pressure levels can cause permanent damage to hearing it is necessary to measure the acoustics after installation in order to determine the sound pressure level and if necessary to implement the appropriate preventive measures 14 290 2 General description 2 1 Description Overview Figure 7 General description of the generating set Control unit Product information plate Lifting ring Forklift grooves Access to maintenan
134. bin Nm lbin Nm Ib in Nm lbin Nm lbin Nem lbin Nem Ib in N m Ib in M6 4 7 42 6 53 8 9 79 11 3 100 13 115 16 5 146 15 5 137 195 172 N m lb ft Nm Ib ft Nim Ib ft Nm Ib ft M8 11 5 102 14 5 128 22 194 27 5 243 32 23 5 40 29 5 37 27 5 47 35 Nm Ibft Nm Ib ft Nm lb ft M10 23 204 29 21 43 32 55 40 63 46 80 59 75 55 95 70 Nm Ib ft M12 40 29 5 50 37 75 55 95 70 110 80 140 105 130 95 165 120 M14 63 46 80 59 120 88 150 110 175 130 220 165 205 150 260 190 M16 100 74 125 92 190 140 240 175 275 200 350 255 320 235 400 300 M18 135 100 170 125 265 195 330 245 375 275 475 350 440 325 560 410 M20 190 140 245 180 375 275 475 350 530 390 675 500 625 460 790 580 M22 265 195 330 245 510 375 650 480 725 535 920 680 850 625 1080 800 M24 330 245 425 315 650 480 820 600 920 680 1150 850 1080 800 1350 1000 M27 490 360 625 460 950 700 1200 885 1350 1000 1700 1250 1580 1160 2000 1475 M30 660 490 850 625 1290 950 1630 1200 1850 1350 2300 1700 2140 1580 2700 2000 M33 900 665 1150 850 1750 1300 2200 1625 2500 1850 3150 2325 2900 2150 3700 2730 M36 1150 850 1450 1075 2250 1650 2850 2100 3200 2350 4050 3000 3750 2770 4750 3500 Torque values listed are for general use only based on the strength of Shear bolts are designed to fail under predetermined loads Always the bolt or screw DO NOT use these values if a different torque value or replace shear bolts with identical property class Replac
135. ble Throttle 1 Signal Out of Range High Throttle 1 Signal Out of Range Low Throttle 1 Communication Signal Erratic Low Pressure Fuel Signal Out of Range High Low Pressure Fuel Signal Out of Range Low Low Pressure Fuel Rate of Change Abnormal Low Pressure Fuel Out of Calibration High Pressure Fuel System Pressure Slightly Low Water in Fuel Continuously Detected Water in Fuel Signal Out of Range High Water in Fuel Signal Out of Range Low Water in Fuel Detected Engine Oil Pressure Signal Extremely Low Engine Oil Pressure Signal Out of Range High Engine Oil Pressure Signal Out of Range Low Engine Oil Pressure Signal Moderately Low Intake Manifold Air Temperature Signal Extremely High Intake Manifold Air Temperature Signal Out of Range High Intake Manifold Air Temperature Signal Out of Range Low Intake Manifold Air Temperature Signal Moderately High Air Filter Pressure Differential Extremely High Engine Coolant Temperature Signal Extremely High Engine Coolant Temperature Signal Out of Range High Engine Coolant Temperature Signal Out of Range Low Engine Coolant Temperature Signal Slightly High Engine Coolant Temperature Signal Moderately High Engine Coolant Level Low ECU Power Down Error Internal ECU Problem Axle Speed Signal Unreliable Fuel Temperature Signal Extremely High Fuel Temperature Signal Out of Range High Fuel Temperature Signal Out of Range Low Fuel Temperature Signal Moderately High Engine Speed Derate Condition
136. c Fixing screws 43 2 Fixing screws 44 2 Clamping washer 43 2 S1 to L6 Spacer shim 43 2 L7 amp 44 2 only Bearing retainer fixing Diode bridge screw assembly Cable gland washer 43 2 only Circlips O ring Inner bearing retainer End shield Rotor assembly Air outlet grille Air intake grille Inspection door DE bearing Surge suppressor LEROY SOMER 21 243 290 LSA 43 2 44 2 4 POLES ALTERNATORS Electric Power Generation Division Declaration of CE compliance and incorporation This Declaration applies to the generators designed to be incorporated into machines complying with the Machinery Directive Nr 2006 42 CE dated 17 May 2006 MOTEURS LEROY SOMER MLS HOLICE STLO SRO MOTEURS LEROY SOMER Boulevard Marcellin Leroy SLADKOVSKEHO 43 1 rue de la Burelle 16015 ANGOULEME 772 04 OLOMOUC Boite Postale 1517 France Czech Republic 45800 St Jean de Braye France Declares hereby that the electric generators of the types LSA 36 37 40 42 2 43 2 44 2 46 2 47 2 49 1 50 2 51 2 as well as their derivatives manufactured by Leroy Somer or on Leroy Somer s behalf comply with the following International Standards and Directive EN and IEC 60034 1 and 60034 5 ISO 8528 3 Reciprocating internal combustion engine driven alternating current generating sets Part 3 Alternating cur
137. cconco Preparing engine for long term storage Removing engine from long term storage Specifications General engine pack specifications Non Emission Certified Engines General engine pack specifications Stage Il Emission Certified Engines Page Q1 Ol PP ok Page General engine pack specifications EPA Tier 2 Emission Certified Engines 65 6 General engine pack specifications EPA Tier 3 Emission Certified Engines 65 7 Unified Inch Bolt and Screw Torque Values 65 8 Metric Bolt and Screw Torque Values 65 9 104 290 072209 PN 2 Identification Views Identification views S Z lt 4 T S S CD30840 A O 3029DF128 Continued on next page DPSG CD03523 3 19 22JAN07 1 3 072209 01 1 PN 7 105 290 Identification Views iL L i E i a J j te i W A I J i i i a ew 1 Hi i y ey a HER E S Z lt 3 2 D E CD30841 gt O 4045HF158 Continued on next page DPSG CD03523 3 19 22JAN07 2 3 072209 01 2 PN 8 106 290 Identification Views A gt CD30842 CD30842 UN 10JANO3 6068HF258 DPSG CD03523 3 19 22JANO7 3 3 072209 0 1 3 PN 9 107 290 Maintenance Records Using maintenance records To obtain the best performance economy and service life from your engine ensure service is carried out according 90hn Deere oils an
138. ce area 15 290 N Figure 8 General description of the generating set Charging alternator Air filtration Protective grille Alternator Starter battery 6 Battery isolating switch 16 290 EN Control eee ex a ay wits o LIA co o ze jma meme l Figure 9 General description of the generating set control Control unit Working hours counter Emergency stop Power circuit breaker Socket control panel 6 Connection terminal block Note Photo presented with the Nexys control unit 17 290 EN 2 2 Technical specifications Range Generating set type RENTAL POWER R66C2C Weights and Dimensions Dimensions with high autonomy tank Dimensions x w x h 2545 mm x 1150 mm x 1824 mm Weight 1650 kg dry weight 2024 kg in operating configuration Sound pressure level LpA at 1 m 72 dB A Measurement uncertainty 0 70 Emergency 2 Voltage Hz Phase Load factor jure MTS power l a ias mergency KW kVA kW kVA 400 230 so 3 08 9 528 66 48 60 1 ESP Stand by output available for emergency use under variable charge up to 200hrs per year as per ISO 8528 1 no overload available under these service conditions 2 PRP Main output available continuously under variable load for an unlimited time period per year as per ISO 8528 1 an overload of 10 one hour every 12 hours is available as per ISO 3046 1 Term of use Standard reference
139. ck the speed or AVR LAM set too high Faulty rotating diodes Short circuit in the revolving field coil Check the resistance Faulty exciter armature Check the resistance Voltage between E and E SHUNT gt 30V AREP PMG gt 15V Voltage disappears during operation 12 Check the AVR the surge suppressor the rotating diodes and replace any defective components Exciter winding open circuit Faulty exciter armature Faulty AVR Revolving field coil open circuit or short circuited The voltage does not return to the rated value LEROY SOMER 234 290 LSA 43 2 44 2 4 POLES ALTERNATORS 4 5 1 Checking the winding You can check the winding insulation by performing a high voltage test In this case you must disconnect all AVR wires WARNING Damage caused to the AVR in such conditions is not covered by our warranty 4 5 2 Checking the diode bridge A diode in good working order should allow the current to flow only in the anode to cathode direction A G Anode oo o Cathode OL O La A C TIAS edo Sele OFe A Ogee o FY C C C gt 88 A C A AA 4 5 3 Checking the windings and rotating diodes using separate excitation During this procedure make sure that the alternator is disconnected from any external load and inspect the terminal box to check that the connections are fully tightened 1 Stop the unit disconnect an
140. cnnanononnncnnnonnnnnnnnnnnnnnnnrnnnnnncnnss 48 JIA ONCE iS 48 MS tala A A ia 48 Delis Warnings concerning COMMISSIONING st ii A aan eas 48 52 Checking the generating Set installation ooooccccnonccnononnnncnnnncnnnonnnnnnnnnnnnrnnnnoncnnonnnrnnnnnrrnrnnnnrnnnnnnrnnrnnnrnnnnnrrnrnnnrnnrnnnnnnnnos 48 3 3 Preparing for operation of the generating Set cccoocccccconococononcnnnconononcnnononnnnonnnnnnnnnrnnnrnnnnnnnnrnnnnnrnnnnnernnnnnnnrnnoranranenananess 49 5 4 Checking the generating Set before startup t ainro E EAE a Ea EEEE wets EENE TETEE es 49 5 3 Checking ihe Generating Sel after startup assieme enna e ea cnc aeai ea E E da ban fue E AEE a a 49 1 290 AD SING TAS generator SO tri A AAA AA AAA A 50 6 1 FREAD TANT LVS OC CUOMO eh o di le dd ao a o le ade de a O he 50 6 2 Generator set witht NEXYS control panel aa 53 621 Control panel presentan pa cta one sia 53 6 2 1 1 LPOG UCTION TO PISO a MS sess e AA 54 A O ROT 55 o2 gt WICHIA O OM E a E E a a 56 624 AMS anda TUS ea E E E A E ce eee 56 0231 aulis ankaa Deal 1 ido aN 56 6 20 MURP EY diagnostic Mod lea tii di 58 6 3 Generator set with TELYS Control panel oocccocccccccnccocnncccnnnoncnononnnonnnnnnnnnnnnrnnnnnnnnnnnnnnnnnnnnrnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnss 64 63 1 GOntrol panel ORESSMlAUON seraa ia Races saueaeue deeded octal Mares aa ti e 64 6 3 1 1 vViewotihe TON lc ee ee at eer ee ee 64 6 3 1 2 Description ot Me SEEN nn a a o
141. conditions ESP PRP 40 40 Air Intlet Temp 1000m 1000m mA S L 60 relative humidity Engine data Manufacturer model Type Turbo Cylinder configuration 4XL Cubic capacity 4 48 L Rotation speed 1500 Rpm Max emergency prime power at nominal speed 61 55 kW Adjustment type Fuel consumption 110 emergency power 100 main power 75 main power 50 main power Fuel Fuel type High autonomy fuel tank Diesel 390 L Lubrication Oil consumption 100 load 0 040 L h 0 7 kW Refrigerant type Thermostat 82 94 C Engine capacity with radiator 8 50 L Max coolant temperature 105 C 18 290 Alternator data Alternator data e The alternator is protected against short circuits VDE 0530 BS 4999 IEC 34 1 CSA e Vacuum impregnation epoxy winding IP23 protection rating Power factor cos Phi AB SS Control unit s Standard specifications Frequency meter Voltmeter Ammeter Alarms and faults Oil pressure Coolant temperature Fail to start Overspeed Alternator min max Fuel level low Emergency shutdown Engine parameters Working hours counter Engine speed Battery voltage Fuel Level Air Preheating Standard specifications Voltmeter Ammeter Frequency meter Alarms and faults Oil pressure Water temperature Start failure Overspeed Alternator min max Battery voltage min max Emergency stop Engine parameters Timer Oil pressure Water temperature Fuel level Engine speed
142. ctual operating power derated machine which is safer for the alternator and the installation Disconnect power supply wires X1 X2 and Z1Z2 and the voltage reference 0 110V 220V 380V on the alternator Connect the mains power supply using a transformer 200 240V as indicated X1 X2 48V Install a 10A D C ammeter in series with the exciter field Turn P5 fully anti clockwise and activate the power supply If there is no output current from the AVR turn potentiometer P2 voltage clockwise until the ammeter indicates a stable current Switch the power supply off then on again turn P5 clockwise until the required max current is obtained no more than 8 A LEROY 10 SOMER 268 290 LEROY SOMER R438 A V R Checking the internal protection Open switch D the excitation current should increase to its preset ceiling remain at that level for 10 seconds and then drop to lt 1A To reset switch off the power supply by ope ning switch A Note After setting the excitation ceiling as described adjust the voltage again see section 2 1 1 In some countries itis a legal requirement to have a short circuit current of 3 IN so as to offer selective protection 3 2 3 Special type of use WARNING Excitation circuit E E must not be left open when the machine is running AVR damage will occur 3 2 3 1 R438 field weakening SHUNT The exciter is switched off by disconnecting the AVR p
143. d an A C voltmeter cal 300 500 or 1000V on the alternator output terminals c Make sure that the ST3 jumper is positio ned on the desired frequency 50 or 60 Hz d Voltage potentiometer P2 at minimum fully anti clockwise e Stability potentiometer P3 to around 1 3 of the anti clockwise limit f Start the engine and set its speed to a fre quency of 48 Hz for 50 Hz or 58 for 60 Hz g Set the output voltage to the desired va lue using P2 Rated voltage UN for solo operation eg 400 V Or UN 2 to 4 for parallel operation with C T eg 410 V If the voltage oscillates use P3 to make ad justments try both directions observing the voltage between E and E approx 10V D C LEROY SOMER 9 267 290 LEROY SOMER R438 A V R The best response times are obtained at the limit of the instability If no stable position can be obtained try disconnecting or repla cing the ST2 jumper normal fast h Check LAM operation ST5 closed i Vary the frequency speed around 48 or 58 Hz according to the operating frequency and check the change in voltage from that observed previously 15 j Readjust the speed of the unit to its rated no load value Adjustments in parallel operation Before any intervention on the alterna tor make sure that the speed droop is identical for all engines k Preset for parallel operation with C T connected to S1 S2 Potentiometer P1 quadrature d
144. d coolants have been formulated to this present manual and recorded in the following to give maximum protection and performance to your _ pages It is recommended that your engine Distributor engine We recommend only genuine John Deere service or your Dealer carry out this service work and stamp the Products and replacement parts appropriate case To protect your rights under the warranty ensure all Keeping an accurate account of all service performed on scheduled services are carried out and recorded If your your engine will give more value to the machine when engine Is covered by extended warranty It is important to tesellit maintain this record for the duration of the warranty DPSG CD03523 6 19 22JANO7 1 1 100 Hours of operation o Engine oil drain o Engine oil filter replace o Hose connections check Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 7 19 22JANO7 1 1 0 2 a 1 072209 PN 10 108 290 Maintenance Records 500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace o Belt check tension and wear 300 Series and POWERTech with manual tensioner o Valve clearance adjust 300 Series Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 8 19 22JANO7 1 1 1000 Hours of operation o Engine oil drain o Air intake system check o E
145. d isolate the AVR wires 2 There are two ways of creating an assembly with separate excitation Assembly A Connect a 12 V battery in series with a rheostat of approximately 50 ohms 300 W and a diode on both exciter field wires 5 and 6 ASSEMBLY A 6 Exciterfield 5 4 Rh 50Q 300W 12V battery Assembly B Connect a Variac variable power supply and a diode bridge on both exciter field wires 5 and 6 Both these systems should have characteristics which are compatible with the field excitation power of the machine see the nameplate 3 Run the unit at its rated speed 4 Gradually increase the exciter field current by adjusting the rheostat or the variac and measure the output voltages on L1 L2 L3 checking the excitation voltage and current at no load see the machine nameplate or ask for the factory test report When the output voltage is at its rated value and balanced within 1 for the rated excitation level the machine is in good working order The fault therefore comes from the AVR or its associated wiring ie sensing auxiliary windings ASSEMBLY B 6 Exciterfield 5 4 Diode 1A 12V LEROY SOMER 13 235 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 4 6 Dismantling reassembly see sections 5 4 1 amp 5 4 2 WARNING During the warranty period this operation should only be carried out in an LEROY SOMER approved workshop or in our factory ot
146. d protective adhesive strips have been removed Ensure that the anti humidity bags have been removed from the electrical sections cabinet or control console alternator etc Check the insulation of the alternator see the alternator s maintenance manual Check the levels see the engine s maintenance manual gt coolant gt oil gt fuel Open the oil filler tap if fitted to the generating set Check the starter battery or batteries connecting and charge see the paragraph entitled Starter batteries Check the starter battery charging system if fitted to the generating set 5 5 Checking the generating set after startup Off load tests Carry out the safety checks emergency shutdown oil pressure coolant temperature etc Check the mechanical parameters gt engine parameters oil pressure coolant temperature gt absence of abnormal vibrations gt absence of abnormal noises gt absence of leaks Check the electrical parameters gt voltage frequency current gt rotating field On load tests Check the mechanical parameters gt engine parameters oil pressure coolant temperature gt absence of abnormal vibrations gt absence of abnormal noises gt absence of leaks Check the electrical parameters gt voltage frequency current gt rotating field 49 290 6 Using the generator set 6 1 Pre Start Inspection Inspecting the engine compartment gt Make sure there i
147. densation Contact your fuel Ensure that all fuel tank caps and covers are installed supplier for recommendations properly to prevent moisture from entering Monitor water content of the fuel regularly DX FUEL4 19 19DEC03 1 1 072209 10 1 PN 34 132 290 Fuels Lubricants and Coolant Diesel Engine Break In Oil New engines are filled at the factory with John Deere ENGINE BREAK IN OIL During the break in period add John Deere ENGINE BREAK IN OIL as needed to maintain the specified oil level Change the oil and filter after the first 100 hours of operation of a new or rebuilt engine After engine overhaul fill the engine with John Deere ENGINE BREAK IN OIL If John Deere ENGINE BREAK IN OIL is not available use a diesel engine oil meeting one of the following during the first 100 hours of operation e API Service Classification CE e API Service Classification CD e API Service Classification CC e ACEA Oil Sequence E2 e ACEA Oil Sequence El PLUS 50 is a trademark of Deere amp Company Diesel Engine Oil Use oil viscosity based on the expected air temperature range during the period between oil changes Depending on Emission Regulation requirements the oil recommendations are different Refer to the chart to identify the proper oil to be used Non Emission Certified Engines and Stage Il or EPA Tier 2 Emission Certified Engines EPA Tier 3 Emission Certified Engines John Deere PLUS 50
148. e To ensure this availability enter the third and fourth digits shown on your engine option code label in the spaces provided on the following page NOTE NOTE Your engine option code label may not contain all option codes if an option has been added after the engine left the producing factory If option code label is lost or destroyed consult your servicing dealer or engine distributor selling the engine for a replacement Option Description Option Description Codes Codes Engine Base Code 11 Rocker Arm Cover 50 Oil Pump 12 Oil Filler Neck 51 Cylinder Head With Valves 13 Crankshaft Pulley 52 __ Auxiliary Gear Drive 14 Flywheel Housing 53 Fuel Heater 15 Flywheel 54 Oil heater 16 Fuel Injection Pump 59 Shipping stand 17 Air inlet 56 Paint Option 18 Air cleaner 57 Coolant Inlet 19 Oil pan 59 Oil Cooler 20 __ Coolant pump 60 Add on Auxiliary Drive Pulley ZN Thermostat Cover 62 __ Alternator Mounting 22 __ Thermostat 63 Low Pressure Fuel Line Continued on next page 03 3 121 290 DPSG CDO03523 14 19 22JANO7 1 2 072209 PN 23 Serial Numbers Record fuel injection pump model number Description Fan Drive Fan Belt Fan Engine Coolant Heater Radiator Exhaust Manifold Ventilator System Starting Motor Alternator Instrument Panel Fuel Filter Front Plate Fuel Transfer Pump Thermostat Housing Oil Dipstick Belt Driven Front Auxiliary Drive Starting Aid Timing Gear
149. e default parameters This option can be used to add parameters available for scrolling in the 1 Up Display 1 Up Display Options RG13196 UN 26SEP03 Automatic Scan Selecting the scan function will allow the 1 Up Display to scroll through the selected set of parameters one at a time momentarily pausing at each Continued on next page OURGP11 00000B1 19 03SEP03 4 18 15 16 PN 53 151 290 Operating the Engine 5 Use Defaults To select Use Defaults use the Arrow keys to scroll to and highlight Use Defaults in the USE DEFAULTS menu display CUSTOM SETUP AUTOMATIC SCAN OFF RG13195 UN 26SEP03 Select Defaults OURGP11 00000B1 19 03SEP03 5 18 6 Press the Enter key to activate the Use Defaults USE DEFAULTS function CUSTOM SETUP AUTOMATIC SCAN OFF ioe Oo A W N O 1 Z D N O ioe pe O X Defaults Selected OURGP11 00000B1 19 03SEP03 6 18 7 The display parameters are reset to the factory defaults then the display will return to the Setup 1 Up Display menu RESTORED TO DEFAULTS Restored To Defaults RG13149 UN 24SEP03 Continued on next page OURGP11 00000B1 19 03SEP03 7 18 15 17 PN 54 152 290 Operating the Engine 8 Custom Setup To perform a custom setup of the USE DEFAULTS 1 Up Display use the arrow buttons to scroll to and CUSTOM SETUP highlight Custom Setup on the display AUTOMATIC SCAN OFF RG13198 UN 26SEP03 Opa
150. e As required Welding Near Electronic Control Units IMPORTANT Do not jump start engines with arc welding equipment Currents and voltages are too high and may cause permanent damage A Disconnect the negative battery cable Disconnect the positive battery cable NW a Pm Short the positive and negative terminals together Do Lo not attach to vehicle frame TS953 UN 15MAY90 Clear or move any wiring harness sections away from welding area Connect welder ground close to welding point and away from control units 6 After welding reverse Steps 1 5 DX WW ECU02 19 11JUNO9 1 1 Keep Electronic Control Unit Connectors Clean IMPORTANT Do not open control unit and do not clean with a high pressure spray Moisture dirt and other contaminants may cause permanent damage Keep terminals clean and free of foreign debris Moisture dirt and other contaminants may cause the terminals to erode over time and not make a good electrical connection RG16946 UN 31MARO9 lf a connector is not in use put on the proper dust cap or an appropriate seal to protect it from foreign debris and moisture es l 5 The wiring harness terminals and connectors for Control units are not repairable electronic control units are repairable Since control units are the components LEAST likely to fail isolate failure before replacing by completing a diagnostic procedure See your John Deere dealer DX WW ECU04 1
151. e E ode hoe 66 6 3 1 3 Deseripion othe pictogrames ZoNe lia 67 6 3 1 4 Description of the PIClOGramsS IN ZONE 2 ias 68 6 3 1 5 Description of the pictograms in ZONE occooonnnconocnncconcncocnnnncnnnconononcnnnnnnnnnnnnnnn nn rnnn nn nnnnrnnnnnnnnrnnnnnrnnnnnonnnnnnnnnranenaness 69 6 3 1 6 Display OF Messages In ZONA aca AA A AA A DAA 71 OB SAUTE ces shel E as ah A rN A ae ea 76 O53 Sy SWLCIING ON cesta ee ect ash aa A eee 77 63 41 Alarms ana AUS 02st oi atte e oe a oo daa alent Eo oca aN 77 6 3 4 1 VIEWING Alaris and quis es A an 77 6 3 4 2 Activation of an alarm Or fault c ccc ccccceccccecceeeececeecece cece eeeaeeeeseeeseeeeseeceseeeeseeeesseeeeseecesseseeeseucessueessueeeseeeesaeeesaaess 78 6 3 4 3 PACTIV ATION Ol an ala IMM ell PAA Uva cs ot oP dsc a set a aida 79 6 3 4 4 Engine taultcodes displasia etic ceeds oct ge aeons pets nes Sate acd heen ce ee Ses 80 6 3 4 5 PIO MOS Cb aiteis scecss ct code encase ea occa se athe a E a Aas ech alert ee hae teas Sete Sales oh koa area eee en 81 SAVANE MAN CO SOMO AS 81 Tele AA o Metab a sot tablets tate Relea cia utes de ee tincte a rw oeance eet ade oan Soecwttedeceeaeae 81 Teds Malhtenance Satety INSTUCIONS ei ces onc ya A nd iad edd cet A ee en tes 81 Tos Table Of mainte manCe O OCK AOS cise ss eee elas ee Al esta ae see dae 82 7 4 COver ma ltenancs ni A a a o os Ne a 83 o Traler MmaltenancOs cl oie 83 7 6 COMMON Spare Parsons a 84 7 7 RECITE ge ARA EME IE EE E T AE
152. e and valid range but the real world condition is above what would be considered normal as determined by the predefined most severe level limits for that particular measure of the real world condition Region e of the signal range definition Broadcast of data values is continued as normal Broadcast of data values is continued as normal FMI 1 DATA VALID BUT BELOW NORMAL OPERATIONAL RANGE MOST SEVERE LEVEL The signal communicating information is within a defined acceptable and valid range but the real world condition is below what would be considered normal as determined by the predefined least severe level limits for that particular measure of the real world condition Region e of the signal range definition Broadcast of data values is continued as normal FMI 2 DATA ERRATIC INTERMITTENT OR INCORRECT Erratic or intermittent data includes all measurements that change at a rate that is not considered possible in the real world condition and must be caused by improper operation of the measuring device or its connection to the module Broadcast of data value is substituted with the error indicator value Incorrect data includes any data not received and any data that is exclusive of the situations covered by FMis 3 4 5 and 6 Data may also be considered incorrect if it is inconsistent with other information collected or known about the system FMI 3 VOLTAGE ABOVE NORMAL OR SHORTED TO HIGH SOURCE a A voltage signal data or otherw
153. e battery is removed Check the connection of the voltage reference to the A V R Faulty diodes Induced short circuit The alternator starts up but its voltage disappears when the battery is removed Faulty A V R Exciter field short circuited Short circuit in the main field Check the resistance Voltage too low Check the drive speed Correct speed Check the A V R connections A V R may be faulty Field windings short circuited Rotating diodes burnt out Main field winding short circuited Check the resistance Speed too low Increase the drive speed Do not touch the A V R pot P1 before returning to the correct speed Voltage too high Adjust A V R potentiometer Adjustment ineffective Faulty A V R 1 faulty diode Voltage oscillations Adjust A V R stability potentiometer Check the speed possibility of cyclic irregularity Loose terminals Faulty A V R Speed too low on load or U F gradient set too high Voltage correct at no load and too low when on load Run at no load and check the voltage between E and E on the A V R Check the speed or U F gradient set too high Faulty rotating diodes Short circuit in the main field Check the resistance Faulty induced excitaion Warning For single phase operation check that the sensing wires coming from the A V R are correctly connected to the
154. e fasteners with tightening procedure is given for a specific application For stainless steel the same or higher property class If higher property class fasteners are fasteners or for nuts on U bolts see the tightening instructions for the used tighten these to the strength of the original Make sure fastener specific application Tighten plastic insert or crimped steel type lock nuts threads are clean and that you properly start thread engagement When by turning the nut to the dry torque shown in the chart unless different possible lubricate plain or zinc plated fasteners other than lock nuts instructions are given for the specific application wheel bolts or wheel nuts unless different instructions are given for the specific application Lubricated means coated with a lubricant such as engine oil fasteners with phosphate and oil coatings or M20 and larger fasteners with JDM F13C zinc flake coating Dry means plain or zinc plated without any lubrication or M6 to M18 fasteners with JDM F13B zinc flake coating DX TORQ2 19 24MARO09 1 1 072209 65 9 PN 117 215 290 Specifications 65 10 PN 118 216 290 Index Page Page A Engine wiring layout With Denso High Pressure Common Rail 55 3 Air filter With Stanadyne DE10 pUMP ccccccccccncccccnncccnnnanos 55 2 Clean or replace one piece occcocccccccccccncococoncnnos 50 3 Clean or replace eleMent cccccecsesseseeeeeeeeeees 50 4 F
155. e half wave rectifier or a three phase full wave bridge rectifier full wave bridge rectifier between phases with or without phase angle check independent of the polarity r a ae a o oo o o o oo o o o o o o o o o o o o o oo o o o o oo o oo o o oo o ooo ooo o o Use a screwdriver to adjust the current threshold using the setting potentiometer 1 and the micro switches 4 to 0 03 A 30 mA Use a screwdriver to adjust the time delay using the setting potentiometer 2 and the micro switches 4 to Os automatic Test the residual current device using the Test button on the relay SOCOMmMEC RESYS B 470 y TEST RESET Me Test Button 3 Sensitive area 4 white position of micro switches Time setting potentiometer 2 Current threshold potentiometer 1 m_a Risk of electric shock The generating set s differential relay is factory set with a current threshold of 0 03 A 30 mA and with an automatic time delay 0 s Any change to the setting on the residual current device could pose a risk to personal safety The user will be held liable any changes must only be made by trained qualified engineers If the setting is modified it is essential to restore the original settings after use 42 290 4 2 2 5 Earthing the generating set RISK OF ELECTRIC
156. ected in a retention container The containers have a capacity which allows 110 of the fluids contained in the generating set fitted with this option to be collected Figure 11 Fluid retention container The generating sets are fitted with a visual alarm warning when the upper limit of the retention container has been reached In all cases the retention containers must be regularly checked to ensure they contain no fluid fuel oil and coolant or rainwater or condensation If necessary drain the containers via the drain port Y Note Never allow these fluids to drain onto the ground ensure they are collected in a designated container 21 290 EN 2 5 Fuels lubricants and coolants All specifications product features are given in the engine and alternator maintenance manuals attached to this manual In addition to these we recommend the fuels lubricants and coolants mentioned in the Specifications section 2 5 1 Fuel specifications General quality requirements The quality of the fuel is essential for engine performance It affects the technical performances such as the service life power supplied and fuel consumption as well as the ability to respect the requirements issued by authorities relating to pollutant emissions Only fuels which conform to the current legal requirements and national and international standards should be used Consult the local fuel distributor to find out the characteristics of the diesel f
157. em Maintenance As required Additional service information ccooccoc Do not modify fuel systeM oocccocccocnccoo Welding Near Electronic Control Units Keep Electronic Control Unit Connectors Clean ccocccccccoccconcconiconiconononos Clean or replace air filter one piece Clean or replace air filter elemen t Replacing fan and alternator belt 4045 and 6068 ENQINES coocccccoccconccncononcnnncnnnnnos Bleeding the fuel system cccoccccccncccnccncncnnnos Troubleshooting General troubleshooting information Engine Wiring Layout Electronic Fuel System With Stanadyne DE10 Injection PUMP ccccocccconccocncccnncncnonancnnanonon Engine Wiring Layout Electronic Fuel System With Denso High Pressure COMMON Rall ccoooccccoccnccncnccnccnnoncnnnnos Engine troubleshootino occooccocncocnconncnconos Electrical troubleshooting coooccooncocccoconos Displaying Of Diagnostic Trouble GOdESADTES io card Using blink code method for retrieving Diagnostic Trouble Codes DTC s Using diagnostic gauge for retrieving Diagnostic Trouble Codes DTC S Listing of Diagnostic Trouble Codes DTCs Intermittent Fault Diagnostics With Electronic Controls occcoooccococncoconnnnos Storage Engine storage guidelines occooccccncccn
158. engine oil in a specially provided container fuel distributors can collect your used oil gt Burning of waste in the open air is prohibited gt Remove waste water sludge and other waste in a specialised processing centre 1 4 2 Electrical safety precautions ELECTRICAL EQUIPMENT RISK OF ELECTRIC SHOCKS DANGER Read the manufacturer s identification plate carefully The values for voltage power current and frequency are shown Check that these values match the installation being supplied The electrical connections must be made in accordance with current standards and regulations in the country of use and the neutral system sold Ask a qualified electrician to intervene when there are specific cases requiring equipment to be connected to an existing electrical network Disconnect the power to the equipment equipment voltage battery voltage and network voltage before any installation or maintenance operation is performed Connect the equipment wires by respecting the wiring diagram supplied by the manufacturer Always handle the equipment with dry hands and feet Take all the necessary precautions to avoid touching stripped cables or disconnected connectors Use and maintain the cables in good condition well insulated and connected correctly and securely Only replace equipment that provides protection against electric shock with identical equipment specifications and nominal values
159. ening torques Y PASOS IESO IESO IESO FE oo IESO S IES AAA e Check condition and connections of electrical equipment ETE SA Pp e Oooo d e ME e Clean with compressed air the relays and o contactors E NN a ANA A MEA poe IESO NES AA Engine e Change engine oil and filter eo e Check belt tension and tensioner__ l e e Replace fuel filter element s o e Pressure test cooling system Clean crankcase vent tube e Check air intake hoses connections and system e Check and adjust valve clearance __ Check engine speed and speed drop governor __ Drain and flush cooling system Testglowplugs gt e Replace injection nozzles es Replace thermostat Z o o o do To o Yoo esos A A NS ESA a ES e Alternator ss y py e Check the various electrical connections of the installation e Grease the bearings Clean air filter element when restriction indicator is red Replace filter element after 6 cleanings or once a year After the first 100 hours of operation Change oil and filter at least once a year After the first 500 hours of operation C 82 290 7 4 Cover maintenance The sealing between the cover and the frame and between the frame and the retention tank is ensured by a gasket It is essential to replace the gasket if the cover has been removed IMPORTANT Users must maintain the enclosures and base frames to e
160. er or engine distributor Use proper fuel Service air cleaner Reduce load See your authorized servicing dealer or engine distributor see your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine distributor Reduce load Fill radiator to proper level check radiator and hoses for loose connections or leaks Have serviceman check Check automatic belt tensioner and check belts for stretching Replace as required DPSG CD03523 49 19 22JANO7 3 4 072209 PN 100 Troubleshooting Symptom High fuel consumption Problem Low engine oil level Cooling system needs flushing Defective thermostat Defective temperature gauge or sender Incorrect grade of fuel Improper type of fuel Clogged or dirty air cleaner Engine overloaded Improper valve clearance Injection nozzles dirty Engine out of time Defective turbocharger Low engine temperature 55 7 199 290 Solution Check oil level Add oil as required Flush cooling system Remove and check thermostat Check water temperature with thermometer and replace if necessary Use correct grade of fuel Use proper type of fuel Service air cleaner Reduce load See your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine distributor See your authorized servicing dealer
161. er pressure can penetrate the skin causing serious injury Avoid the hazard by relieving pressure before disconnecting hydraulic or other lines Tighten all connections before applying pressure Search for leaks with a piece of cardboard Protect hands and body from high pressure fluids If an accident occurs see a doctor immediately Any fluid injected into the skin must be surgically removed within a few hours or gangrene may result Doctors unfamiliar with this type of injury should reference a knowledgeable medical source Such information is available from Deere amp Company Medical Department in Moline Illinois U S A Avoid Heating Near Pressurized Fluid Lines Flammable spray can be generated by heating near pressurized fluid lines resulting in severe burns to yourself and bystanders Do not heat by welding soldering or using a torch near pressurized fluid lines or other flammable materials Pressurized lines can accidentally burst when heat goes beyond the immediate flame area Remove Paint Before Welding or Heating Avoid potentially toxic fumes and dust Hazardous fumes can be generated when paint is heated by welding soldering or using a torch Remove paint before heating e Remove paint a minimum of 100 mm 4 in from area to be affected by heating If paint cannot be removed wear an approved respirator before heating or welding e If you sand or grind paint avoid breathing the dust Wear an approved respi
162. ers lubricant they may contain in an area protected from dust moisture and other contamination Store containers on their side to avoid water and dirt accumulation DX LUBST 19 18MAR96 1 1 Mixing of Lubricants In general avoid mixing different brands or types of oil Oil manufacturers blend additives in their oils to meet certain specifications and performance requirements Consult your John Deere dealer to obtain specific information and recommendations Mixing different oils can interfere with the proper functioning of these additives and degrade lubricant performance DX LUBMIX 19 18MAR96 1 1 Diesel Engine Coolant The engine cooling system is filled to provide year round protection against corrosion and cylinder liner pitting and winter freeze protection to 37 C 34 F John Deere COOL GARD is preferred for service If John Deere COOL GARD is not available use a low silicate ethylene glycol or propylene glycol base coolant concentrate in a 50 mixture of concentrate with quality Water quality is important to the performance of the water cooling system Distilled deionized or demineralized water is recommended for mixing with ethylene glycol and propylene glycol base engine coolant concentrate A 50 mixture of propylene glycol engine coolant in water provides freeze protection to 33 C 27 F If protection at lower temperatures is required consult your John Deere dealer for recommendations Water quali
163. ervicing and maintenance of electrical and mechanical components The R438 is an IPOO product It must be installed inside a unit so that this units cover can provide IP20 minimum total protection it must only be installed on LS alternators in the ap propriate location so that when viewed externally it has a higher degree of protection than IP20 Copyright 2005 MOTEURS LEROY SOMER This document is the property of MOTEURS LEROY SOMER It may not be reproduced in any form without prior authorization All brands and models have been registered and patents applied for LEROY SOMER 3 261 290 LEROY SOMER R438 A V R 1 SUPPLY 1 1 AREP excitation system For both AREP 8 PMG excitation systems the alternator voltage regulator is the R438 With AREP excitation the R438 electronic AVR is powered by two auxiliary windings which are independent of the voltage match circuit The first winding has a voltage in proportion AREP SYSTEM MAIN FIELD Slow fuse F1 250V 8A STs ff aie with LAM without LAM ST3 mA d Frequency 50Hz 60Hz LAM 13 25 Excitation P5 3 ceiling open knee point 65 Hz Response f 1 normal ST2 time FA fast K P3 Stability Single phase detection Aux windings 10 Yellow to that of the alternator characteristic Shunt the second has a voltage in propor tion to the
164. ery Highly discharged or sulphated batteries formation of whitish lead sulphate deposit on the plates which becomes hard can no longer regenerate or be charged in a generating set A discharged battery should be recharged immediately or else it will suffer irreparable damage IMPORTANT Battery charge A Example of charge ona 12V 60 Ah battery 6 A charging current E Charge status 50 acid density 1 19 and voltage when idle 12 30V s NDA de The battery is short 30 Ah and this must be recharged Charge factor 1 2 30 Ah x 1 2 36 Ah to be charged Charging current 6A approximately 6 hours charging required the charging current must always be 1 10 of the nominal capacity of the battery Recharging is complete when the battery voltage and the acid density stop increasing The power of the charger must be suitable for the battery to be charged and the charging time available Note if several batteries connected together are being recharged the following points must be checked Are the batteries connected in series Is the voltage chosen exact 1 battery x 12 V 3 x 36V batteries Adjust the charge current to the lowest battery The power difference between the batteries must be as low as possible 8 4 Cleaning the battery a ee Keep the batteries clean and dry The presence of impurities and rust on the battery and terminals may cause the current jumps voltage drops and the battery
165. es if the speed drops between 46 Hz and 50 Hz the rated voltage follows a fast gradient as it is restored if the speed drops below 46 Hz since the engine needs more help the voltage follows a slow gradient as it returns to the reference value prop N lt 46 Hz Time Drop N gt 46 Hz LEROY 6 SOMER 252 290 LEROY SOMER R250 A V R 2 5 Typical effects of the LAM with a diesel engine or without a LAM U F only 2 5 1 Voltage U f without LAM ee Load on shaft kW LEROY SOMER 7 253 290 LEROY SOMER R250 A V R 3 INSTALLATION COMMISSIONING 3 1 Electrical checks on the AVR Check that all connections have been made properly as shown in the attached wiring diagram Check that the position of the jumper corresponds to the operating frequency Check whether the ST4 jumper or the remote adjustment potentiometer have been connected 3 2 Settings The different settings made during the trial areto be done by qualified personnel Respecting the load speed specified on the nameplate is vital in order to start a settings procedure After operational testing replace all access panels or covers The only possible settings on the machine are to be done with the A V R 3 2 1 R250 settings SHUNT system Initial potentiometer positions voltage setting potentiometer P1 for the A V R full left rem
166. ey MENU e Using the knob select 3 SETTINGS and press the knob to confirm 1 ACTIONS 2 INFORMATION 3 SETTINGS 4 COUNTRY G5 OK Esc 90 290 EN e Asnotall the settings are available go to the 37 INSTALLER ACCESS menu to enter the code 1966 3 SETTINGS using the knob to call up the desired menus 417 34 50Hz lt gt 60Hz 35 NOMINAL VOLTAGE 36 PARAMETERS 37 INSTALLER ACCESS G9 OK Esc INSTALLER ACCESS Enter password e Using the knob select 34 50Hz lt gt 60Hz and press the 3 SETTINGS knob to confirm 2 2 31 COMMUNICATION 32 FREQUENCY 33 VOLTAGE 34 50Hz lt gt 60Hz Gs OK Esc e Select and confirm the desired frequency using the knob to scroll and confirm 50 Hz or 60 Hz ____SOHz lt gt 60HZ __ GS OK e Return to the 3 SETTINGS screen and use the knob 3 SETTINGS to select 35 NOMINAL VOLTAGE then press the 4 7 knob to confirm 34 50Hz lt gt 60Hz 36 PARAMETERS 37 INSTALLER ACCESS G5 OK Esc e Set the desired voltage then confirm using the scroll NOMINAL VOLTAGE and confirm knob E ve al oe F Min 380 Max 480 G5 OK Esc 91 290 EN e Select the desired configuration using the configuration option selector located next to the TELYS 2 control unit e Start up the generating set by pressing the START button e Adjust the voltage after starting up the generating set using the 2003R08 potentiometer 1 gt 400V 50Hz 2
167. f 8 characters on a backlit LCD display Two scroll buttons enable you to navigate in the menus and parameters Two LEDs one red and one orange indicate the fault or alarm status of the engine or ECU DISPLAY SCROLL BUTTONS A Machine Parameters The following parameters are available on the Murphy fault finding module working hours counter engine speed battery voltage engine speed coolant temperature oil pressure fuel economy air manifold temperature actual consumption active status codes status codes recorded coming from the engine MDDM20 parameter configuration for display display of the engine configuration parameters etc depending on the type of engine B Use The Murphy module MDDM offers simple menu navigation 1 To browse the list of parameters press the Up and Down buttons A 2 To enter or exit a sub menu press both arrows simultaneously 58 290 ar dl AY ajo al aja am jay a aly Ay an Aly AY alv lalo EN The Parameter menu to navigate in this menu simply use the arrow buttons separately The sub menus The sub menus are available at the end of the parameter menu To go to these sub menus scroll through the parameters using the A and Y buttons until you reach the required sub menu C The Sub menus The sub menus enable certain aspects of the fault finding module display to be modified Changing the unit of measurement There are
168. f the actuator moderately high ro EF supply LT oms S ress 4 1 ot MC e Recalibration of the injectors Injector outside specifications required l l Eo Recalibration of the injectors Injector outside specifications i required Short circuit high side to B Short circuit high side to low side or low side to B Short circuit high or low side to ground ME Cylinder 1 circuit shorted failure A failure 281 290 z CID FMI Comment Description Volvo Cylinder 2 injector status Injector outside the specifications AO S EROS required Injector outside the specifications Recalibration of the injectors required Short circuit high side to B Short circuit high side to low side or low side to B Short circuit high or low side to ground Cylinder 2 circuit open Cylinder 2 circuit shorted Cylinder 2 balancing error mechanical failure Cylinder 3 injector status Recalibration of the injectors Injector outside the specifications required Cylinder 2 unknown error mechanical failure Short circuit high side to B failure Cylinder 3 unknown error mechanical failure Cylinder 4 injector status Injector outside the specifications PeT AONANE MECOS required l Recalibration of the injectors Injector outside the specifications i required Short circuit high side to B side to B MA failure failure Injector outside the specifications r EOS
169. f the operations manager is to monitor either directly or indirectly any operations performed on the equipment and to ensure that the safety and operating instructions are respected gt The operations manager should read and understand all the documentation supplied with the equipment Information for personnel gt Regularly reiterate the safety and operating instructions to the operating personnel gt Contact your dealer if you have any questions regarding the equipment and any training requests for personnel gt Make the manufacturer s instructions available to the users if possible on site Protection for individuals and equipment gt Wear suitable clothing gt Move away from equipment in operation v Ensure that persons who are not authorised to intervene as well as animals are kept away from the equipment Observe this guideline regardless of whether the equipment is in operation or stopped Protect the equipment from any fluid splashes and bad weather Before starting the equipment refit the enclosures and close all the access doors Before starting the engine check that the air filter is present and the correct extraction circuit for the exhaust gas Respect the current regulations relating to fuel use Under no circumstances use seawater or any other corrosive or electrolytic product in the cooling circuit Adjust the equipment according to the manufacturer s prescriptions Check that the equipment opera
170. fuels whose additives have been added in a refinery over those modified in the storage tank 22 290 General specifications for diesel fuel The fuel used must have the following characteristics non exhaustive list Sulphur content Viscosity density Lubricity capacity lubrication oiliness Cetane index Water contaminants The sulphur content must meet the current emissions regulations in the region where the generating set is used For the United States and countries respecting the EPA regulation Only use Ultra Low Sulphur Diesel ULSD fuel with a maximum sulphur content of 15 mg kg for Interim Tier 4 and Tier 4 certified engines For the European Union Directive 2009 30 CE whose aim is to limit atmospheric pollution imposes the use of a diesel fuel with a very low sulphur content of 10 mg kg for non road mobile machinery In France this obligation has resulted in the development of a diesel fuel called off road diesel fuel or GNR The maximum admissible sulphur content is 10 mg kg However member states allow these diesel fuels to contain up to 20 mg kg of sulphur when they are distributed to the final users It is recommendable to avoid storing off road diesel fuel for long periods of time over 6 months The viscosity and density directly affect the performance power and fuel consumption emissions and service life of the engine A low level of viscosity and density reduces engine power and increases fue
171. g in progress Countdown of the Engine Stop delay cooling OR Gradual Stop delay Water temperature OR Overload Gradual Stop delay OR No Load Test delay Date and time depending on settings Operation mode operation in AUTO mode Synchronisation of the genset with the grid or another genset Date and time depending on settings Operation mode operation in AUTO mode Transfer of power from the generating set to the grid Date and time depending on settings Operation mode operation in AUTO mode Transfer of power from the grid to the generating set Date and time depending on settings Generating set stoppage J Screen Data displayed STOPPAGE IN PROGRESS Genset stoppage Date and time depending on settings 24 08 2005 Change of operation mode switch from MAN mode to AUTO mode when an automatic start demand is issued po Screen Data displayed AUTOMATIC start demand Do you want to switch to AUTO mode IMPORTANT Immediate start Operation mode operation in MAN mode AUTOMATIC start demand OK Esc Generating set stop demand if a fault occurs or if STOP is pressed in AUTO mode ScreenNo Screen Data displayed MAN mode activated Operation mode operation in AUTO mode genset Do you want to switch to AUTOMATIC mode OK Esc The 51 Hz offset must be applied to all of the power plant s gensets Esc 75 290 running Warning message for switch to MAN mode if STOP is pressed or if
172. gine until fuel free from bubbles flows out of loosened connection Retighten connection to 27 N m 20 Ib ft c Repeat procedure for remaining injection nozzles if necessary until all air has been removed from fuel system If engine still will not start see your authorized servicing dealer or engine distributor RG7725 UN 08JAN97 TS1343 UN 18MAR92 RG12220 UN 24MAY02 B HPCR fuel system 2 or 4 valve head T High pressure fluid remaining in fuel lines can cause serious injury Do not disconnect fuel lines between the high pressure fuel pump and nozzles Only bleed the fuel system at the fuel filter bleed screw A 1 Loosen the air bleed screw A two full turns on final filter base only 2 Operate fuel supply pump primer lever B until fuel flow is free from air bubbles 3 Tighten bleed screw securely Continue operating primer until pumping action is not felt RG12221 UN 24MAY02 4 Start engine and check for leaks i Fuel supply pump primer lever If engine will not start repeat steps 1 4 DPSG CD03523 46 19 09FEBO7 3 3 072209 50 7 PN 94 192 290 Troubleshooting General troubleshooting information Troubleshooting electronically controlled engine problems can be difficult The first thing to do is to identify the type of problem which can be mechanical or electrical e Know the engine and all related systems e Study the problem thoroughly e Relate the symptoms t
173. h the Shutdown SPN 100 FMI 1 message The SPN and FMI number will be displayed a GiNE Ca PRESSURE rove along with a description of the problem and the CORRECTIVE ACTION corrective action needed CHECK OIL LEVEL If the word Next appears above the arrow keys there are more trouble codes that can be viewed by using the arrow keys to scroll to the next trouble code RG13238 UN 29SEP03 Shutdown Message OURGP11 00000AE 19 03SEP03 2 6 To acknowledge and hide the trouble code and return to the single or four parameter display press the tofx SHUTDOWN Enter key SPN 100 FMI 1 FAULT 5 ENGINE OIL PRESSURE LOW IMPORTANT Ignoring the shutdown message can CORRECTIVE ACTION result in severe engine damage CHECK OIL LEVEL NEXT gt RG13239 UN 29SEP03 Hide Trouble Code OURGP11 00000AE 19 03SEP03 3 6 4 The display will return to the single or four parameter display but the display will contain the Shutdown 1900 RPM icon Pressing the Enter key will redisplay the hidden trouble code IMPORTANT Ignoring the shutdown message can result in severe engine damage RG13179 UN 26SEP03 Flashing Shutdown Icon Continued on next page OURGP 11 00000AE 19 03SEP03 4 6 072209 15 9 PN 46 144 290 Operating the Engine 5 Pressing the Enter key once again will hide the trouble code and return the screen to the single or four 1ofx SHUTDOWN parameter display SPN 100 FMI 1 FAULT
174. hange to a new parameter 1235 1000 RPM COOL TEMP ENG RPM 57 PSI BAT VOLT OIL PRES OPO Select Parameters e O A Lu 0p 1 Z gt leo N N OE lt O X OURGP11 00000B2 19 03SEP03 7 14 8 Press the Enter key and a list of engine parameters will be displayed 425 F 4000 RPM COOL TEMP ENG RPM MIO 57 PSI BAT VOLT OIL PRES OCO List Of Engine Parameters RG13229 UN 26SEP03 Continued on next page OURGP11 00000B2 19 03SEP03 8 14 15 23 PN 60 158 290 Operating the Engine The parameter that is highlighted is the selected ENGINE SPEED The numger to the right cf the parameter for the screen Use the arrow keys to ENGINE HOURS sarameser indicates ihe quadrati highlight the new parameter to be placed in the 4 Up ENSINE COOLANT TEMPERATURE 1 ele ci Disolav BATTERY POTENTIAL 1 Joper Left OLadrent ISplay 2 Lower Lem Duedrent 3 Upper Right Quadrent ds Lower Right Quadien RG13230 UN 26SEP03 Select Desired Engine Parameter OURGP11 00000B2 19 03SEP03 9 14 10 Press the Enter key to change the selected parameter in the quadrant to the new parameter ENGINE HOURS ENGINE COOLANT TEMPERATURE 1 BATTERY POTENTIAL 2 ENGINE OIL TEMPERATURE ENGINE OIL PRESSURE RG13231 UN 26SEP03 Enter Selected Parameter OURGP11 00000B2 19 03SEP03 10 14 11 Use the Menu keys to return to the 4 Up Custom ENGINE SPEED Setup screen ENGINE HOURS ENGINE COOLANT TEMP
175. have your dealer use the diagnostic as shown on the tables on the following pages procedure in the component technical manual for that 2 digit code The SPN identifies the system or the component that has the failure for example SPN 000110 indicates a failure in the engine coolant temperature circuit The first part is a six digit Suspect Parameter Number SPN followed by a two digit Failure Mode Identifier FMI Always contact your servicing dealer for help in correcting code In order to determine the exact failure both parts diagnostic trouble codes which are displayed for your SPN and FMI of the code are needed engine CD03523 0000190 19 02FEB07 1 1 Using blink code method for retrieving Diagnostic Trouble Codes DTC s NOTE The method below applies to applications having If there are no active DTCs the Fault Lamp will flash a fault lamp on instrument panel refer to the a code 88 tor d tation fi int tion IA CCH manatee shine res opal Following the active codes the Fault Lamp will flash de 33 This indicates the start of blinking stored The Electronic Control Unit ECU has the ability to display ee DTC na blink f the fault codes If there are any stored DTCs the Fault Lamp e ld eo will flash its 2 digit number If there is more than one NOTE The ECU blinks the codes in 2 digit codes stored DTC the ECU will flash each code in numerical only See LISTING OF DIAGNOSTIC TROUBLE order If there are no stored DTCs
176. he diesel fuel available in your area Sulfur Content for Interim Tier 4 and EU Stage IIIB Engines In general diesel fuels are blended to satisfy the low temperature requirements of the geographical area in e Diesel fuel quality and fuel sulfur content must comply which they are marketed with all existing emissions regulations for the area in which the engine operates Diesel fuels specified to EN 590 or ASTM D975 are e Use ONLY ultra low sulfur diesel ULSD fuel with a recommended Renewable diesel fuel produced by maximum of 0 0015 15 ppm sulfur content hydrotreating animal fats and vegetable oils is basically identical to petroleum diesel fuel Renewable diesel that Sulfur Content for Other Engines meets EN 590 or ASTM D975 is acceptable for use at all percentage mixture levels e Diesel fuel quality and fuel sulfur content must comply with all existing emissions regulations for the area in e Use of diesel fuel with sulfur content less than 0 10 In all cases the fuel shall meet the following properties 1000 ppm is STRONGLY recommended e e Use of diesel fuel with sulfur content 0 10 1000 ppm Cetane number of 45 minimum Cetane number greater to 0 50 5000 ppm may result in REDUCED oil and than 50 is preferred especially for temperatures below filter change intervals Refer to table in Diesel Engine 20 C 4 F or elevations above 1500 m 5000 ft Oil and at ae Service internals j Cold Filter Plugging Point CFPP
177. herwise the warranty may be invalidated Whilst being handled the machine should remain horizontal rotor not locked in position Check how much the machine weighs see 4 8 7 before choosing the lifting method 4 6 1 Tools required To fully dismantle the machine we recommend using the tools listed below 1 ratchet spanner extension 1 torque wrench 1 set of flat spanners 7 8 10 12 mm 1 socket set 8 10 13 16 18 21 22 24 mm 1 size 5 Allen key eg Facom ET5 6 Allen key ET6 10 Allen key ET10 14 Allen key ET14 1 120 and T30 TORX bit 1 puller U35 U32 350 4 6 2 Screw tightening torque See section 5 4 4 6 3 Access to diodes Remove the air intake grille 51 Remove the surge suppressor 347 Disconnect the 6 diodes using an ohm meter or a battery lamp see section 4 5 2 Replace the bridges respecting the polarity see section 4 5 1 Replace the surge suppressor 347 Refit the air intake grille 51 Replace the terminal box lid 48 4 6 4 Access to connections and the regulation system The terminals are accessed directly by removing the terminal box lid 48 To access the AVR adjustment potentiometers the side plate 367 should be removed 4 6 5 Replacing the NDE bearing 4 6 5 1 Dismantling Remove the terminal box lid 48 Remove the air intake grille 51 Unscrew the fixing clamps on the power output cables remove the c
178. ical fuel system 40 3 Continued on next page Index 1 072209 PN 1 217 290 2000 hours 2 years Adjust speed droop governor Mechanical fuel SysSteM ooccconcnccnccccnccnco o Adjust valve clearance 4045 and 6068 engines Check engine speed Mechanical fuel SA Damper CNGCK unica an 2500 hours 3 years Drain and flush cooling system 500 hours Changing engine oil and filter CHECKING DO loss iaaa Replace fuel filter ocooocccconcconncccncno As required Additional service information Clean or replace air filter one piece Clean or replace air filter element Do not modify fuel systeM occcoocccncccccccco Replace fan and alternator belts 4045 and 6068 EeNQiNesS ccccocccccncnconcccconcncnnccnnnncnnnos Daily or every 10 hours occoccccccnccncnccnccnncnnnnnnnnnnnos Observe service intervals oocccoccconnicccnconcnno Use correct fuel lubricant and coolant Maintenance recordS coocccoccoccocccononcnonicanonnonancanonnos Metric bolt and screw torque values MIXING NUDIICAINS iria Operating the engine Break IM DG OG acura adas Changing Generator Frequency Standby power units Starting the engine oocccoccoccnccccncconnoncnccncnonanonos Stopping the engine ccooccocccocccoccconiconcconcccnnononos Using a booster battery or charger S Seri
179. ifices and fill the cooling system with specified coolant see DIESEL ENGINE COOLANT When refilling cooling system loosen temperature sensor B or plug at the rear of cylinder head to allow air to escape Run engine until it reaches operating temperature then check coolant level and entire cooling system for leaks 45 2 185 290 CD30765 UN 27AUG99 Cooling system capacity Engine Model Cooling system capacity 3029DF 128 3029TF120 3029TF158 3029HFS70 3029TF270 3029TFS70 3029HFU7O 3029TFU70 14 5 L 15 5 qt 4039DF008 4039TF008 16 5 L 17 5 at 4045DF158 20 L 21 at 4045TF120 4045TF158 4045TF220 4045TF258 4045HFS80 4045TF270 4045TFS70 4045TFU7O 25 L 26 5 qt 4045HF 158 4045HFU72 6068TF158 6068TF258 28 L 29 5 qt 4045HFS73 4045HFS82 4045HF S83 4045HFU79 6068HF120 6068HF 158 6068HF220 6068HF258 6068HF275 6068HFS72 6068HFS73 6068HFS82 6068HFS83 6068HFU72 6068HFU79 32 L 34 qt 6068HF475 6068HFS76 6068HFS77 6068HFS89 6068HFU74 35 L 37 qt DPSG CD03523 41 19 15JULO9 4 5 o lt Tr if Z D m lt Le O 90 Q O DPSG CD03523 41 19 15JULO9 5 5 072209 PN 87 Maintenance As required Additional service information This manual does not allow a complete repair of your engine If you want want more detailed service information the following publications are available from
180. ify the characteristics of its products at any time in order to incorporate the latest tech nological developments The information contained in this document may therefore be changed without notice LEROY 2 SOMER 260 290 LEROY SOMER Installation and maintenance R438 A V R CONTENTS A PPP e POS POP nn UA 4 1 1 AREP excitation system wcssinioasinessvamiasusinesiadnati oniinscedhiassidadeianoolianeindahersandetieansiadeasnecs 4 1 2 PMG excitation SS usa rita 5 1 3 SHUNT or separate excitation SYSteM ocoooonccncocccccnnccnoncnnononcononnoncnnnnnnnnnnononnnnnonannnnnos 5 DISS ANV R iii oa TE E 6 2 o en A 6 2 2 Frequency compared with voltage without LAM ooooocccconccncccoccnncononocononoonononnnnconnononons 6 2 3 LAM Load Acceptance Module characteristiCS ooocccooooncccnccooccnnonnoncnnnnnnconnononons 6 2 4 Typical effects of the LAM with a diesel engine with or without a LAM U F only T 2 5 R438 A V R Options rro ninas M 3 INSTALLATION COMMISSIONING c0occcoooccocconcccccnncnnccononnconnnanoronnnnnnrrnnnnnrrrrnannnrrrnananennanas 8 3 1 Electrical checks on the AW Parranda dieta ne dd A 8 gA EEUN eere A 8 du 010 62 aU ea E E ea nc meee een ee eey eee enone 11 TA SPARE PARES sitiada iii taa 12 4 1 Designation A e E ON specs 12 4 2 Technical support service ra 12 All such operations performed on the A V R should be undertaken by personnel trained in the commissioning s
181. il has to be added during this time see ENGINE BREAK IN OIL Check tension of alternator belt NOTE During the break in period a higher than usual oil Check connections of air intake hoses consumption should be considered as normal A Check for proper tightening of cap screws all around the After first 100 hours of operation engine DPSG CD03523 17 19 22JANO7 1 1 Starting the engine Ay CAUTION Before starting engine in a confined Perform all prestarting checks outlined in building install proper outlet exhaust ventilation Maintenance Daily Section equipment Always use safety approved fuel storage and piping Open the fuel supply shut off valve if equipped POE Activate the starter motor switch to crank the engine NOTE If temperature is below 0 C 32 F it may and release it as soon as engine starts be necessary to use cold weather starting aids See COLD WEATHER OPERATION NOTE Do not operate the starter motor more than 20 seconds at a time DPSG CD03523 18 19 22JANO7 1 1 15 25 PN 62 160 290 Operating the Engine Cold weather operation Depending on equipment various cold weather starting aids are available to assist in starting the engine at temperature below 0 C 32 F Air intake heater MENO DO NOT use starting fluid on engines equipped with grid type air intake heater or glow plug s Ether starting fluid is highly flammable and may explode causing serious injury
182. iller cap when cool enough to touch with bare hands Slowly loosen cap to first stop to relieve pressure before removing completely TS281 UN 23AUG88 DPSG CD03523 41 19 15JULO9 1 5 1 Slowly open the radiator cap 2 Remove engine block drain plug A co O Lu Q Z D t Q 00 O x DPSG CD03523 41 19 15JULO9 2 5 3 On POWERTech engines remove oil cooler housing drain plug B ZX016192 UN 11JAN99 ZX016192 Continued on next page DPSG CD03523 41 19 15JULO9 3 5 072209 45 1 PN 86 184 290 Maintenance 2500 hours 3 years 10 11 12 13 Open radiator drain valve C Drain all coolant from radiator Close all drain orifices after coolant has drained Fill the cooling system with clean water Run engine until water passes through the thermostat to stir up possible rust or sediment Stop engine and immediately drain the water from system before rust and sediment settle After draining water close all drain orifices and fill the cooling system with cleaning product such as PMCC2610 or PMCC2638 Cooling System Cleaners available from your John Deere Dealer Follow manufacturer s directions on label After cleaning the cooling system drain cleaner and fill with water to flush the system Run engine until water passes through the thermostat then drain out flushing water Check cooling system hoses for proper condition Replace as necessary Close all drain or
183. ime invaia Injection DEtO Fuet injection pump controller status attempting to fuel without command Pump supply voltage out ofrange oo Pump seifiesteror Pump detected communication error Pump initated engine protection stove a oo po O a 284 290 Comment Description ECU Pump timing status ECU Pump timing moderately out of synchronisation ECU Pump timing speed out of synchronisation ECU Pump timing extremely out of synchronisation SW Tensor supe votage high gt vor Tensor sup votage ow SAA vor tooo fat Sensor supply voltage Oil pressure Coolant temp fuel pressure 5V sensor supply 2 EN MeO upp votoge iow saad vor awe Tenancy stats A Tenes verre Tesi stats pt BB Engine shutdown rtf ae TL ect parameters S i prerarmes pareneterfaut E OW eco temoerate exrenaiynin OOOO EGU temperature mederatlyhigh A 1172 Input temperature of the TGV compressor MN dE voltage of the temperature sensor Short to V 4 ae put voltage of the temperature sensor Short to V asof f Imputtemperature of the TGV turbine o MN Turbine temperature extremely high Shorttov E Turbine temperature moderately high Short to V UN Exhaust gas temperature sensor Status of the pressure system of the common rail Pump control valve status Pump control valve 1 status for 6081HF070 Purp col C rea caia
184. in parts protect metal parts against corrosion improve the sealing in particular between pistons piston rings and cylinders remove impurities to the filter It is recommendable to use a top of the range lubricant for diesel engines The table below lists the oils recommended for each engine manufacturer Make Type John Deere John Deere PLUS 50 John Deere All GenPARTS GENLUB TDX 15W40 GenPARTS GENLUB TDX 15W40 All All Fuel GenPARTS GENLUB TDX 15W40 Perkins MOBIL PEGASUS 705 Doosan GenPARTS GENLUB TDX 15W40 Mitsubishi A GenPARTS GENLUB TDX 15W40 Gas All eomberoin GenPARTS GENLUB TDX 15W40 or Kohler 5W40 Kohler or Kohler according to the model of the engine Viscosity Viscosity is a measure of the flow resistance of a fluid The viscosity of an engine oil is expressed by 2 SAE Society of Automotive Engineers grades One grade for cold weather and one grade for hot weather The grade for cold weather appears before the letter W The 1st grade represents dynamic viscosity in cold weather namely the ability to start the engine and to prime the oil pump and therefore to lubricate the various components quickly The lower the number the more fluid the oil The 2nd grade represents the kinematic viscosity in hot weather The higher the number the thicker the film of oil when hot which aids protection and sealing The lower the number the less friction there will be in hot weather it helps to save fue
185. ing Diagnostic Gauge to Access Engine Information Optional equipment Main Menu NavigatiON ocoocccocccoccccncconcnnncno Engine Configuration Data ooccocccccooccn Accessing Stored Trouble Codes Accessing Active Trouble Codes Engine Shutdown Codes cccccceseeeeeeeeeeees Adjusting Backlighting ooccocncocnconncocnnos Adjusting Contrast c oocccccnccccncocnconcnconcnnacnnnnos Selecting Units Of Measurement 06 setup 1 Up Display sci ce2se oicssde edie asnaat Setup 4 Up Display occooccccccccoccccocncccnccnnnnos Break in period oocooccconcconcconocononononononononanonns Starting the engine oocccocccncnccncnconcnnncncnoninnnonos Cold weather operation oocoocccocccocncocnconnnnono Using a booster battery or charger Engine operation cccccceceseesseeeseeseeeceeesens Standby power units coocccocccocccocnconccononono Stopping the engiNe ooccocccocccocicocnconnconinanononos Changing Generator Frequency 06008 Maintenance Observe service intervals c cceseeeeeeeeeeeees Use correct fuels lubricants and coolant Maintenance interval Chart ceeeeeeeeees Maintenance Daily or every 10 hours Daily prestarting checks ooccoccconconiociconioncos Maintenance 500 hours Changing engine oil and filter
186. injection pump CALIFORNIA PROPOSITION 65 WARNING Intake manifold Diesel engine exhaust and some of its constituents are known Turbocharger to the State of California to cause cancer Charge air cooling system birth defects and other reproductive harm DPSG CD03523 1 19 O6JULO9 2 2 072209 PN 3 101 290 Introduction 072209 PN 4 102 290 Contents Page Identification Views Identification VIEWS oocooocccocnconcnccononanoconcnnnos 01 1 Maintenance Records Using maintenance records ccccceeeeeeeees 02 1 100 Hours of Operation cocccoccccncncocnccncncnnnonos 02 1 500 Hours of Operation occcoocccccnconcncccnncnnnno 02 2 1000 Hours of operation oocccocccocnconcncocncnno 02 2 1500 Hours of operation ooccoccccccnccncococncnno 02 3 2000 Hours of OperatiON ooocoocccccccccocncconnno 02 3 2500 Hours of operation oooccoccccoccccocnccnnnno 02 4 3000 Hours of OperatiON ooccocccccccccccncccnccnnnnos 02 4 3500 Hours of Operation cccccseceeeeeeeeeeees 02 5 4000 Hours of operation ooccccccccocnconcnccnnnnno 02 5 4500 Hours of operation cccoocccoccccccnccncnnno 02 6 5000 Hours of Operation oocccocccoccccccnccnnnno 02 6 5500 Hours of OperatiON ooocccocccoccccccnccnnnno 02 7 6000 Hours of OperatiON oocccocccccnccccncconnno 02 7 6500 Hours of OperatiON oocccocccccccccccncon
187. installed in the slots in the housing Replace dust seal if damaged Install and tighten oil filter by hand until firmly against dust seal F DO NOT overtighten CD30760 UN 26AUG99 Oil filter seals CD30759A UN 29JANO7 Filter and mounting header A Oil filter element D Sealing surface B lInner seal E Sealing surface C Outer seal F Dust seal 5 Close oil pan drain valve CD30926 UN 30JANO7 RG11617 UN 240CT01 RG11618 UN 240CT01 Continued on next page DPSG CD03523 29 19 01JUL09 2 3 30 2 170 290 072209 PN 72 Maintenance 500 hours CD30927 UN 01FEBO7 meg Oil filler cap on rocker arm cover z 6 Fill engine crankcase with correct John Deere engine oil through opening on rocker arm cover C or on the side of the engine D See DIESEL ENGINE OIL Section for determining correct engine oil To determine the correct oil fill quantity for your engine see the Specifications Section NOTE Crankcase oil capacity may vary slightly ALWAYS fill crankcase to full mark or within crosshatch on dipstick whichever is present DO NOT overfill 7 Start engine and run to check for possible leaks FD000047 FD000047 UN 13MAR96 8 Stop engine and check oil level after 10 minutes If Oil dipstick necessary top up DPSG CD03523 29 19 01JUL09 3 3 3 0 3 072209 PN 73 171 290 Maintenance 500 hours Replacing fuel filter element s
188. ion Broadcast of data value is substituted with the error indicator value b Any signal external to an electronic control module whose current remains on when the ECM commands it off Broadcast of data value is substituted with the error indicator value FMI 7 MECHANICAL SYSTEM NOT RESPONDING OR OUT OF ADJUSTMENT Any fault that is detected as the result of an improper mechanical adjustment or an improper response or action of a mechanical system that with a reasonable confidence level is not caused by an electronic or electrical system failure This type of fault may or may be directly associated with the value of general broadcast information FMI 83 ABNORMAL FREQUENCY OR PULSE WIDTH OR PERIOD To be considered in cases of FMI 4 and 5 Any frequency or PWM signal that is outside the predefined limits which bound the signal range for frequency or duty cycle outside Region b or the signal definition Also if the signal is an ECM output any signal whose frequency or duty cycle is not consistent with the signal which is emitted Broadcast of data value is substituted with the error indicator value FMI 9 ABNORMAL UPDATE RATE Any failure that is detected when receipt of data via the data link or as input from a smart actuator or smart sensor is not at the update rate expected or required by the ECM outside Region c of the signal range definition Also any error that causes the ECM not to send information at the rate requi
189. ise is above the predefined limits that bound the range Region e of the signal range definition Broadcast of data value is substituted with the error indicator value b Any signal external to an electronic control module whose voltage remains at a high level when the ECM commands it to low Broadcast of data value is substituted with the error indicator value FMI 4 VOLTAGE BELOW NORMAL OR SHORTED TO LOW SOURCE a A voltage signal data or otherwise is below the predefined limits that bound the range Region e of the signal range definition Broadcast of data value is substituted with the error indicator value b Any signal external to an electronic control module whose voltage remains at a low level when the ECM commands it to high Broadcast of data value is substituted with the error indicator value FMI 5 CURRENT BELOW NORMAL OR OPEN CIRCUIT a A current signal data or otherwise is below the predefined limits that bound the range Region e of the signal range definition Broadcast of data value is substituted with the error indicator value b Any signal external to an electronic control module whose current remains off when the ECM commands it on Broadcast of data value is substituted with the error indicator value FMI 6 CURRENT ABOVE NORMAL OR GROUNDED CIRCUIT a A current signal data or otherwise is above the predefined limits that bound the range Region e of the signal range definit
190. ising 3 attempts to start up the engine 76 290 EN 6 3 3 Switching off Open the circuit breaker gt manually OR gt by selecting menu 12 CONTROL LOAD gt The following display will disappear supply stopped Ny gt gt gt gt gt O Press the STOP button 8 The following screen is displayed and the generating set will stop OFF IN PROGRESS 24 08 2005 Switch TELYS off by turning the key to OFF without forcing it to the OFF position 6 3 4 Alarms and faults 6 3 4 1 Viewing alarms and faults Alarms and faults are displayed as follows O Alarms All alarms will cause gt the yellow LED to flash General alarm In conjunction with this LED gt aflashing pictogram appears on the LCD screen gt message on graphic display example representing the circuit affected by the alarm and the associated indicator if present FAULT example ALARM Low Fuel Level 25 12 05 15 30 OK HELP 77 290 2 Faults All faults will cause gt the generating set to stop immediate or gradual stop coolant temperature and overload or short circuit gt the red LED to flash General fault In conjunction with this LED gt a flashing pictogram appears on the LCD screen gt message on graphic display example representing the circuit affected by the fault and the associated indicator if present FAULT example FAULT Oil Pressure Ip lt 25 12 05 15 30 OK HELP
191. isk damaging the equipment Replace any safety pictograms that are missing or illegible on the equipment Note the mounting bolts on the protective devices of the rotating parts are captive bolts equipped with retaining washers Also in order to ensure the integrity of this assembly it is prohibited to use electric or pneumatic screwdrivers to undo these mounting bolts Cleaning the equipment gt gt gt Clean off any trace of oil fuel or coolant using a clean cloth Use only approved cleaning solvents Cleaning products and methods that are strictly prohibited e petrol or other flammable substances e soapy solution containing chlorine or ammonia e high pressure cleaner Additional instruction gt If necessary contact the dealer for the following reasons e answers to any questions relating to the equipment e training requests for personnel e supplying the relevant documentation for maintenance operations e supplying spare parts e corrective or preventive maintenance operations 9 290 EN Operating site Maintenance gt Clean the entire operating site regularly with suitable cleaning materials gt The presence of dangerous or combustible materials inside premises must be limited to the operating requirements Access gt Prohibit free access to persons who are not part of the establishment except for those designated by the user Respecting the environment gt Drain and dispose of
192. ith hot oil 1 2 3 Wait for the engine to stop and cool down completely before topping up the oil 4 Before starting the engine refit the oil filler cap 5 It is prohibited to cover the generating set with a fine layer of oil for anti rust protection Battery Smoking using a flame or producing sparks are forbidden close to batteries particularly when the batteries are being charged Supply gas concerns generating sets running on gas Request the user technical notes and LPG or NG safety data sheets from your gas supplier For any operation on a gas installation ask a recognised specialist to intervene Gas supply procedures must be carried out in the open air outside in accordance with local regulations in an area well away from fires people or animals Check the sealing of the gas supply circuit using soapy water with the circuit pressurised or using a leak detector Itis forbidden to smoke bring flames near or create sparks when the tank is being filled and near to the generating set 12 290 1 4 5 Toxic risk safety precautions DANGER EXHAUST GAS TOXIC PRODUCTS TOXIC RISK Exhaust gas Use suitable ventilation to release the exhaust gas outside and prevent it from accumulating Respect current local regulations regarding the equipment and fuel used petrol diesel and gas Periodically examine the burnt gas exhaust Pipes must be replaced as soon as their conditi
193. itional sticker may be also delivered in a plastic bag attached to the engine or inserted in the machine documentation It is recommended to stick this option code list sticker either e On this page of your Operator s manual below this section or e On the Engine Owner s Warranty booklet under the title OPTION CODES Engine manufacturing configuration NOTE The Machine Manufacturer may have already stuck it at a specific accessible place inside the enclosure or close to a maintenance area The engine option code label includes an engine base code A This base code must also be recorded along with the option codes At times it will be necessary to furnish this base code to differentiate two identical option codes for the same engine model The first two digits of each code identify a specific group such as alternators The last two digits of each code identify one specific option provided on your engine such as a 12 volt 55 amp alternator NOTE These option codes are based on the latest information available at the time of publication The right is reserved to make changes at any time without notice If an engine is ordered without a particular component the last two digits of that functional group option code will be 99 00 or XX The list on the next page shows only the first two digits of the code numbers For future reference such as ordering repair parts it is important to have these code numbers availabl
194. l In order to ensure immediate protection when starting the engine the choice of viscosity grade when cold is essential More fluid oil is quicker to flow when oil begins to circulate through the engine It should be selected according to the ambient temperature See the table below o y 7 OF 40 104 35 95 30 85 S 20 lle 68 A s 10 lt 50 rl Gas 5 i z 23 10 14 15 5 20 4 25 13 24 290 Characteristics of GENLUB TDX 15W40 oil Performance GENLUB TDX oil is a 15W40 multigrade mineral oil which meets the following specifications ACEA E3 and API CG 4 ACEA E3 oil with superior viscosity stability suited to extended oil change intervals and severe conditions of use API CG 4 oil particularly effective to meet the emissions requirements ACEA European Automobile Manufacturers Association API American Petroleum Institute Specifications Specifications Grade SAE 15W 40 Kinematic viscosity at 100 C mm s cSt pt wow EI g eaw EIA EI Typical values given for information purposes TBN Total Base Number degree of alkalinity a measure of a lubricant s reserve alkalinity according to standard ASTMD 2896 This check makes it possible to assess the ability of the product to remain in service and to check the capacity of the lubricant to neutralise the acidity contained in the oil which may corrode the metallic
195. l Pressure Indication units as per settings menu BAR i 3 e Oil Temperature Indication units as per settings i menu Genset started Fuel Level Indication Alternator Compound Voltage Indication Operation default screen Total Active Power Indication Alternator Frequency Indication Alternator U12 compound Voltage Indication Alternator U23 compound Voltage Indication Alternator U31 compound Voltage Indication Alternator Frequency Indication 69 290 Alternator V1 single Voltage Indication Alternator V2 single Voltage Indication Alternator V3 single Voltage Indication Alternator Frequency Indication Alternator U12 compound Voltage Indication Alternator V2 single Voltage Indication Alternator V1 single Voltage Indication Alternator Frequency Indication Alternator V1 single Voltage Indication Alternator phase 1 Current Indication Alternator Frequency Indication Alternator phase 1 Current Indication Alternator phase 2 Current Indication Alternator phase 3 Current Indication Alternator Neutral Current Indication Total Active Power Indication Total Reactive Power Indication Total Apparent Power Indication Total Output Factor Indication inductive or capacitive 70 290 Fuel Level Indication Battery Voltage indication Battery Ammeter Indication Total Reactive Power Indication Alternator U12 compound Voltage Indication Total Active Power Indication Alternator Frequency Indication
196. l consumption Too high a level of viscosity and density seriously reduces the service life and operation of the fuel injection system In order to maintain adequate technical and environmental performance the viscosity and density must conform to the specifications indicated in the manufacturer s instructions for the engines fitted to our generating sets In order to protect the fuel injection system against excessive wear the fuel must have satisfactory lubricity refer to the manufacturer s instructions for the engines fitted to our generating sets The ignition behaviour of diesel fuels is described by the cetane index The cetane index is important for emissions the ability to start in cold weather and engine noises The minimum technical requirements are 45 The fuel and tank must not contain any water Water causes the engine parts to corrode and wear more rapidly particularly the injection system parts In addition water promotes the growth of bacteria and fungi in the tank which can clog the fuel filter The fuel must not contain any type of residue Organic contaminants bacteria fungi etc can block the fuel filters inorganic material in the fuel dust sand can cause serious damage to the injection equipment 23 290 EN 2 5 2 Lubricant specifications Essential for the correct operation of the engine The oil should be selected according to its use Besides the lubrication function oil should also cool certa
197. lly controlled system bleed air only from final filter engines DE10 and HPCR fuel systems have X9811 UN 23AUG88 Continued on next page DPSG CD03523 46 19 09FEB07 1 3 072209 50 5 PN 92 190 290 Maintenance As required A Mechanical and DE10 fuel systems 1 Loosen the air bleed screw A two full turns On DE10 fuel system loosen only air bleed screw on final fuel filter 2 Operate supply pump primer lever B until fuel flow _ is free from air bubbles gt Z 3 Tighten bleed screw securely continue operating hand 3 primer until pumping action is not felt z 4 Start engine and check for leaks 3 If engine does not start it will be necessary to bleed air from fuel system at fuel injection pump or injection nozzles as explained next gt lt if Z 1 S O o 2 2 D 8 CD30928 X 2 z O aff O Mechanical injection pump return line DE10 Fuel return line e At Fuel Injection Pump c Securely tighten return line connector a Slightly loosen fuel return line connector C at fuel injection pump b Operate fuel supply pump primer lever until fuel without air bubbles flows from fuel return line connection Continued on next page DPSG CD03523 46 19 09FEBO7 2 3 072209 50 6 PN 93 191 290 Maintenance As required e At Fuel Injection Nozzles a Using two open end wrenches loosen fuel line connection at injection nozzle b Crank engine over with starting motor but do not start en
198. ltage 5 Multi core conductors Cable type PVC 70 C e g HO7RNF Ambient temperature 30 C 7 ee 50 0 95 4 0 120 2250MCM AWG American Wire Gauge American standard for electrical cables 45 290 EN 4 2 3 3 Connecting the generating set to the installation A RISK OF ELECTRIC SHOCK Before use the generating set must always be earthed Protection against electric shocks is only effective once the earthing connection has been made Disconnect the battery leads starting with the negative lead or use the battery isolating switch before carrying out any operations on the generating set 1 Open the door to the power section no 1 then the access door to the power connection cable router flap and to the connection terminal box no 2 2 Loosen the two knobs no 3 on either side of the power connection cable router flap then slide the flap towards the outside of the generating set 3 Feed the power connection cables through the cable router flap Lan MT Power cables 46 290 4 Connect the power connection cables onto the bars N LO L1 L2 L3 or N2 R2 S2 T2 using the terminals no 4 or clamps no 5 5 Slide the cable router flap towards the inside of the generating set until it makes contact with the power connection cables then retighten the two knobs close the access door to the power section back up again 6 Connect the power connection cables to the installation to be
199. mponents The voltage does not return to the rated value Exciter winding open circuit Faulty exciter armature Faulty AVR Main field open circuit or short circuited Caution Internal protection may be activated overload open circuit short circuit 12 Warning after operational testing replace all access panels or covers LEROY SOMER 270 290 LEROY SOMER R438 A V R 4 SPARE PARTS 4 1 Designation Description Code A V R AEM 110 RE 017 4 2 Technical support service Our technical support service will be happy to provide any information you require When ordering spare parts you should in dicate the complete machine type its serial number and the information indicated on the nameplate Part numbers should be identified from the exploded views and their description in the parts list Our extensive network of service stations can dispatch the necessary parts without delay To ensure correct operation and the safety of our machines we recommend the use of original manufacture spare parts In the event of failure to comply with this ad vice the manufacturer cannot be held res ponsible for any damage LEROY SOMER 271 290 13 LEROY SOMER R438 NOTES LEROY 14 SOMER 272 290 LEROY SOMER R438 NOTES LEROY SOMER 15 273 290 LEROY SOMER MOTEURS LEROY SOMER 16015 ANGOUL ME CEDEX FRANCE 338 567 258 RC
200. n Pump Solenoid J Power and Ground Battery Harness V Optional Instrument Panel or Connector Connections P 23 pin Optional Feature Generator Instrument Panel D SAE 1939 CAN Connector K Fuse Holder Connector Extended feature E Crankshaft Position Sensor L Transient Voltage Protection ECU only Connector TVP Module Connector Q 21 pin Instrument Panel F ECU Connector Connector R Engine Wiring Harness CD03523 000018E 19 O2FEBO7 1 1 072209 55 2 PN 96 194 290 Troubleshooting Engine Wiring Layout Electronic Fuel System With Denso High Pressure Common Rail p gt de S D 3 2 T G CUE A O ag 6068HFU74 Engine shown A Engine Coolant Temperature E Optional Instrument Panel or I Fuel Rail Pressure Sensor M Fuel Temperature Sensor ECT Sensor Generator Instrument Panel J Crankshaft Position Sensor B Electronic Injector Connector F Engine Wiring Harness K Pump Position Sensor C Manifold Air Temperature G Engine Oil Pressure Sensor L Pump Control Valve Solenoid MAT Sensor Connector D ECU Connector H Power and Ground Battery Connections CD03523 000018F 19 02FEBO7 1 1 072209 55 3 PN 97 195 290 Troubleshooting Engine troubleshooting Symptom Engine cranks but will not start Engine hard to start or will not start Engine knocks Problem Incorrect starting procedure No fuel Exhaust restricted Fuel filter plugged or full of water Injection pump n
201. ndard has an equivalent in the J1939 standard PPID Parameter Identifier SPN PPID corresponds to PID but is only used by VOLVO This represents the type of fault that has occurred This may be an electrical FMI Failure Mode identifier mechanical or equipment fault VOLVO uses a SID FMI or PID FMI or PPID FMI combination Terminology used by JOHN DEERE SPN Suspect Parameter This represents the system or component at fault for example SPN 100 Number indicates an oil pressure problem or a problem with the oil pressure sensor This represents the type of fault that has occurred This may be an electrical mechanical or equipment fault FMI Failure Mode identifier 80 290 EN In the event of a fault the screen will display the following message Engine fault code Pressing OK will display fault finding information In addition appendix D indicate the meaning of the code The checking and maintenance operations to carry out in order to solve the fault are included in the user and maintenance manuals of the engines supplied with the generating set documentation OK HELP For JOHN DEERE JD and VOLVO VO engines the codes displayed are SPN and FMI codes 6 3 4 5 Horn reset Depending on the settings made menu 363 HORN the activation of an alarm and or a fault leads to the horn sounding and the following screen appearing HORN STOP PRESS OK This screen will display first any messages relating
202. nerating set Power ON LEDs and alarm fault warning LEDs Location of USB ports Mounting bolt 10 LCD for displaying alarms and faults operating statuses electrical and mechanical quantities 11 ESC button for returning to the previous selection and for default RESET function 12 MENU button for accessing the menus 13 Lighting for the emergency stop button OON OO BR WN 64 290 Figure 20 Description of the LEDs A lit LED indicates 1 Alarm activated flashing yellow 2 Fault found flashing red 3 Module on green on continuously Figure 21 Close up of USB ports mu USB key connection HOST file transfer between USB key and TELYS and vice versa 2 Connection for microcomputer DEVICE gt file transfer between PC and TELYS and vice versa gt main module power supply 3 Protective cover 65 290 EN 6 3 1 2 Description of the screen The screen is backlit and requires no contrast adjustments This screen is divided into 4 zones Dm EEE RPA LAI c i OA j J ss paa 0 y A a F f t O S a fa fa ILI Ea AAA RI El 29 JN JN io AA IME CF a Oda EEIEIE hair Oi NF AW iar ZBARF o SERIAL No 08030010000 SOFTWARE 5 3 5 NOMINAL VOLTAGE 400V FREQUENCY 50Hz NOMINAL KW 320kW EARTH SYSTEM TNS Figure 22 Description of the screen example O Zone 1 in this zone the status of
203. ng then detach it 36 290 4 1 3 2 Fork lift truck 1 Position the arms of the forklift truck in the forklift pockets no 2 2 Lift the equipment handling it gently 3 Set down the generating set in its unloading position Rental Power an Solutions provider Figure 14 Points used for lifting and moving 4 1 4 Moving the generating set Whenever moving the generating set ensure suitable equipment is used e g sling forklift etc and identify those parts on the generating set which can be used to move it lifting eye no 1 forklift grooves no 2 tow bar no 3 37 290 EN 4 2 Connecting the generating set 4 2 1 Connection summary This diagram can be used to retrace the different steps enabling the generating set to be correctly connected TT earthing system EDF application option France only Identify the type of differential protection fitted on the generating set Fixed differential protection Adjustable differential protection Set the differential protection of the generating set No operation required Add differential protection No operation required Add differential protection terminal circuits protected set to 30 mA to the terminal terminal circuits protected set to 30 mA to the terminal circuit output s circuit output s Earth the generating set Connect the generating set to the installation 38 290 4 2 2 Protecting people and equipment 4
204. ng normal operation the single or four parameter screen will be displayed OURGP11 00000AD 19 03SEP03 1 7 When the diagnostic gauge receives a trouble code from an engine control unit the single or four Tofa WARNING parameter screen will be replaced with the Warning SPN 94 FMI 18 message The SPN and FMI number will be displayed RL VERY PRESSURE along with a description of the problem and the CORRECTIVE ACTION corrective action needed CHECK FUEL FILTER AND LINES NEXT gt HIDE IMPORTANT Ignoring active trouble codes can result in severe engine damage RG13240 UN 30SEP03 Active Trouble Codes Displayed OURGP11 00000AD 19 03SEP03 2 7 3 Ifthe word Next appears above the arrow keys there are more trouble codes that can be viewed by using yore WARNING the arrow keys to scroll to the next trouble code SPN 94 FMI 18 FAULT FUEL DELIVERY PRESSURE CORRECTIVE ACTION CHECK FUEL FILTER AMD LINES NEXT gt HIDE RG13241 UN 30SEP03 Use Arrow Keys To Scroll Continued on next page OURGP11 00000AD 19 03SEP03 3 7 072209 15 7 PN 44 142 290 Operating the Engine IMPORTANT Ignoring active trouble codes can result in severe engine damage 1 of x WARNING SPN 94 FMI 18 FAULT 4 To acknowledge and hide the code and return to the FUEL DELIVERY PRESSURE single or four parameter display press the Enter Key CORRECTIVE ACTION CHECK FUEL FILTER AND LIMES NEXT gt CoG Hide T
205. ngine oil drain o Vibration damper replace 6 cyl o Fuel filter replace o Belt check tension and wear 300 Series and POWERTech with manual tensioner o Valve clearance adjust 300 Series Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 64 19 22JANO7 1 1 5000 Hours of operation o Engine oil drain o Injection nozzles replace o Engine oil filter replace o Air intake system check O Fuel filter replace o Cooling system drain and flush if COOL GARD is used o Check belt and tensioning system o Crankcase vent tube clean Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 65 19 22JANO7 1 1 0 2 A 6 072209 PN 15 113 290 Maintenance Records 5500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace manual tensioner o Valve clearance adjust 300 Series o Belt check tension and wear 300 Series and POWERTech with Number of hours Job done by Observation Dealer or distributor stamp 6000 Hours of operation DPSG CD03523 66 19 22JANO7 1 1 o Engine oil drain o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean o Cooling system drain and flush if COOL GARD is not used o Valve clearance adjust POWERTech o Air intake sys
206. ngine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 9 19 22JANO7 1 1 0 2 E 2 072209 PN 11 109 290 Maintenance Records 1500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace manual tensioner o Valve clearance adjust 300 Series o Belt check tension and wear 300 Series and POWERTech with Number of hours Job done by Observation Dealer or distributor stamp 2000 Hours of operation DPSG CD03523 10 19 22JANO7 1 1 o Engine oil drain o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean o Cooling system drain and flush if COOL GARD is not used o Valve clearance adjust POWERTech o Air intake system check o Vibration damper check Number of hours Job done by Observation Dealer or distributor stamp DPSG CD03523 59 19 22JANO7 1 1 02 3 110 290 072209 PN 12 Maintenance Records 2500 Hours of operation o Engine oil drain o Cooling system drain and flush if COOL GARD is used o Engine oil filter replace o Fuel filter replace o Belt check tension and wear 300 Series and POWERTech with manual tensioner o Valve clearance adj
207. ngines Install new belt making sure belt is correctly seated LT in all pulley grooves Refer to belt routing at right for your application Apply tension to belt See CHECKING BELT T Start engine and check belt alignment ALT Alternator I Idler Pulley CP Crank Pulley T Tensioner wr FD Fan Drive WP Water Pump O O A L 09 r g T Z D o we N O am Q O Installation on 6068 engines DPSG CD03523 45 19 31JANO7 1 1 Bleeding the fuel system CAUTION Escaping fluid under pressure can penetrate the skin causing serious injury Relieve pressure before disconnecting fuel or other lines Tighten all connections before applying pressure Keep hands and body away from pinholes and nozzles which eject fluids under high pressure Use a piece of cardboard or paper to search for leaks Do not use your hand If ANY fluid is injected into the skin it must be surgically removed within a few hours by a doctor familiar with this type injury or gangrene may result Doctors unfamiliar with this type of injury may call the Deere amp Company Medical Department in Moline Illinois or other two fuel filters primary and final Whenever the knowledgeable medical source fuel system has been opened up for service lines disconnected or filters removed it will be necessary NOTE Engines with mechanical fuel system have a to bleed air from the system On dual fuel filter single fuel filter while electronica
208. nging engine oil and filter IMPORTANT Filtration of oils is critical to proper lubrication Always change filter regularly Use filter meeting John Deere performance specifications NOTE Change engine oil and filter for the first time after 100 hours maximum of operation then every 500 hours thereafter Change oil and filter at leat once a year Run engine approximately 5 minutes to warm up oil Shut engine off CD30758 UN 26AUG99 Open oil pan drain valve A Drain crankcase oil from engine while warm Continued on next page DPSG CD03523 29 19 01JUL09 1 3 072209 30 1 PN 71 169 290 Maintenance 500 hours A 5 JN ee Oil filter on 3029 and 4039 engines Oil filter on 4045 and 6068 engines 4 Replace oil filter e 3029 and 4039 engines a b Remove and discard oil filter element B using a suitable filter wrench Oil new packing C and install new filter element Hand tighten element according to values printed on filter element If values are not provided tighten element approximately 3 4 1 1 4 turn after packing contacts filter housing DO NOT overtighten filter element e 4045 and 6068 engines a b C Remove and discard oil filter element A using a suitable filter wrench Apply clean engine oil to inner B and outer C seals and to filter threads Wipe both sealing surfaces of the header D E with a clean rag Ensure notches in dust seal F are properly
209. nnections See your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine distributor Replace fuse See your authorized servicing dealer or engine distributor Use proper viscosity oil Clean and tighten loose connections Clean and tighten connections DPSG CD03523 50 19 22JANO7 1 2 072209 PN 102 Troubleshooting Symptom Problem Solution Sulfated or worn out batteries See your authorized servicing dealer or engine distributor Blown fuse Replace fuse DPSG CD03523 50 19 22JANO7 2 2 Displaying Of Diagnostic Trouble Codes DTCs There are several different methods for displaying both stored and active DTCs from the ECU via a fault lamp or a diagnostic gauge on the electronic instrument panel 2 DIGIT CODES The FMI identifies the type of failure that has occurred Some engines display Service Codes or DTCs as 2 digit for example FMI 03 indicates value above normal codes read from a fault lamp which gives blink codes Combining SPN 000110 with FMI 03 yields engine coolant temperature input voltage too high or the equivalent of SPN FMI CODES 2 digit fault code 18 Stored and active diagnostic trouble codes are output on If diagnosing an application that shows DTCs as SPNs the diagnostic gauge on the Deere electronic instrument and FMIs using the following list determine the equivalent panel according to the J1939 standard as a two part code 2 digit code and
210. nnno 02 8 7000 Hours of OperatiON ccoocccoccncoccccccnccnnnno 02 8 7500 Hours of Operation ccoocccccnccccccocnccnnnno 02 9 8000 Hours of operation occocccccccccccncocnccnnnnos 02 9 8500 Hours of operation occoccccoccccocccccnccncnno 02 10 9000 Hours of Operation oocccoccccccccccnccncnno 02 10 9500 Hours of Operation oocccoccccccccccncconcno 02 11 10000 Hours of operation oocccocccocnccncnccononos 02 11 Serial Numbers Powertech label ninia 03 1 Engine serial number plate 03 1 Record engine serial numbet ooccocccccccccocc 03 2 Engine Option COJE8S occoocccocccccoccnononioncnononon 03 3 Record fuel injection pump model number 03 4 Record Engine Control Unit ECU Serial NUMber dond occ 03 5 Record High Pressure Fuel Pump Model NuMbDer coocccoccconcconocococococononononanonos 03 5 SE oan seared esse I se 05 1 Fuels Lubricants and Coolant Diesel UC ia dc aeeet st ay aeet oe ae ese 10 1 Handling and Storing Diesel Fuel 10 1 Diesel Engine Break In Oil ooo oo 10 2 Diesel Engine Oll oocccocccconccccnccncnoncninanos 10 2 Lubricant Storage ccccscccseeceseeseeeeseeeseeeess 10 3 Mixing Of EUDIICANIS esencia cnc ei leads Diesel Engine Coolant oocccccnccccncccnccocncnno Operating in Warm Temperature Climates Operating the Engine Us
211. ns before unloading IMPORTANT The lifting machinery or equipment is suitable for the work required and the weight of the generating set This is indicated on the generating set s identification plate The sling is correctly positioned in the central lifting eye or the lifting arms are correctly positioned in the fork lift pockets intended for this purpose The ground is able to bear the load of the generating set and its lifting machinery without stress otherwise lay down stabilising beams of sufficient strength The generating set is put down as close as possible to its place of use or transport in a clear space with free access Example of equipment to be used v crane slings lifting beam safety hook shackles Forklift truck X NX Y RAS 4 1 3 Unloading the generating set Before unloading or moving generating set check that the handling equipment used is able to bear the weight of the generating set shown on the generating set s identification plate IMPORTANT 4 1 3 1 Slings 1 Attach the sling on the lifting equipment to the ring on the generating set no 1 provided for this purpose Tension the slings slightly Check that the sling is correctly attached and the equipment is steady Lift the generating set carefully Direct the generating set towards the chosen location and stabilise it Carefully set down the equipment while continuing to position it DO Bl 2 28 10 Release the sli
212. nstream device terminal circuit must be set Current threshold the generating set s differential relay must be three times more sensitive than that of the terminal circuit Time delay the cut off of the generating set s differential relay must be longer than that of the terminal circuit Type A AC differential relay gt Use Differential relay for which operation is guaranteed e for residual sinusoidal alternating currents e for continuous pulsed residual currents e for continuous pulsed residual currents with a continuous component of 0 006 A with or without phase check independent of the polarity gt Setting 12393 4 50 7 AARLE 1 Use a screwdriver to set the current threshold potentiometer 1 to 0 03 A 30 A Aa mA gy gt E 2 Use a screwdriver to set the time delay Test Button potentiometer 2 to Os automatic 3 de Test the residual current device using the Time setting potentiometer Test button on the relay 3 2 Current threshold potentiometer 41 290 Type B differential relay gt Use Differential relay for which operation is guaranteed gt Setting as in the case of type A for residual sinusoidal currents up to 1000 Hz for residual sinusoidal currents superimposed on a pure continuous current for continuous pulsed currents superimposed on a pure continuous current for residual currents which could come from rectifier circuits e three phas
213. nsure that the paintwork retains all its protective properties 7 5 Trailer maintenance vnen Commissioning Every 6 months Every year Operations and before towing y di vehicle Tyre pressure CI O O Tighten the wheel nuts ASS geswem f ooe ooe brake Check brake distribution across all wheels lean y y a drums No play in the hubs PS OOO PA A Play in the clampingtube SSS S S i Play in the ball socket or ring Braking control hinges and Lubricate joints Stabilising Lubricate or grease the moving parts on the coupling device see lubrication point examples in the Figure 23 v Recommended lubricant general purpose grease compliant with DIN 51825 KTA 3KA Figure 23 Trailer lubrication greasing points 83 290 7 6 Common Spare Parts Starter motor brush 330362331 Radiator cap 31802000304 Charging alternator diode bridge 330360144 Fan belt 330360183 Thermostat 330360012 Thermostat seal 330361286 Alarm oil pressure sensor 330360059 Alarm water temperature sensor 330360060 330910115 330910095 330910098 330910099 GENCOOL 330910100 84 290 EN 330570092 330570118 330560611 330510015 330361669 330410713 330410335 For any need of spare parts please contact Spare Parts department O 33 0 02 98 41 13 07 e mail gen
214. nt appropriate for mechanical and electrical hazards Before any intervention on the machine ensure that it cannot be started by a manual or automatic system and that you have understood the operating principles of the system 4 2 Routine maintenance 4 2 1 Checks after start up After approximately 20 hours of operation check that all fixing screws on the machine are still tight plus the general state of the machine and the various electrical connections in the installation 4 2 2 Bearings The bearings are permanently greased and they have a life of 20 000 hrs or 3 years As an option they are regreasable for the LSA 44 2 It is advisable to lubricate the alternator during operation and when it is first commissioned The lubrication characteristics are given in the table below NDE DE bearing 6315 C3 6309 C3 30grorcm 15grorcm Quantity of grease Lubrication interval 6000 h 10 000 h Lubrication intervals are given for grease type LITHIUM standard NLGI 3 In the factory the grease used for lubrication is ESSO Unirex N3 Before using another grease check for compatibility with the original one Monitor the temperature rise in the bearings see section 4 4 4 2 3 Electrical servicing Commercially available volatile degreasing agents can be used WARNING Do not use trichlorethylene perchlo rethylene trichloroethane or any alkaline products These operations must be perf
215. ntermittent faults take special e lf a faulty connection or wire is suspected to be the note of the condition of wiring and connectors since a cause of the intermittent problem clear DTCs then high percentage of intermittent problems originate here check the connection or wire by wiggling it while Check for loose dirty or disconnected connectors Inspect watching the diagnostic gauge to see if the fault resets the wiring routing looking for possible shorts caused by contact with external parts for example rubbing against Possible causes of intermittent faults sharp sheet metal edges Inspect the connector vicinity looking for wires that have pulled out of connectors poorly positioned terminals damaged connectors and corroded or damaged splices and terminals Look for broken wires e Electromagnetic interference EMI from an improperly damaged splices and wire to wire shorts Use good installed 2 way radio etc can cause faulty signals to judgement if component replacement is thought to be be sent to the ECU required Suggestions for diagnosing intermittent faults e Faulty connection between sensor or actuator harness e Faulty contact between terminals in connector e Faulty terminal wire connection NOTE Refer also to generator documents for more NOTE The engine control unit ECU is the component information about connections and wirings LEAST likely to fail CD03523 0000193 19 O5FEBO7 1 1 95 13 PN 107
216. o your knowledge of engine and An engine wiring layout is provided in this section to systems identify electrical components engine controller sensors Diagnose the problem starting with the easiest things connectors first e Double check before beginning the disassembly Later in this section is a list of possible engine problems e Determine cause and make a thorough repair and diagnostic trouble codes that may be encountered e After making repairs operate the engine under normal accompanied by possible causes and corrections This conditions to verify that the problem and cause was troubleshooting information is of a general nature corrected See also the generator documentation for a complete information of your application A reliable program for troubleshooting engine problems should include the following basic diagnostic thought process CD03523 000018D 19 O8FEBO7 1 1 072209 55 1 PN 95 193 290 Troubleshooting Engine Wiring Layout Electronic Fuel System With Stanadyne DE10 Injection Pump RG12201 UN 24MAY02 A Coolant Temperature Sensor G Starter Relay Connector M Remote ON OFF Connector S Fuel Heater Connector Connector H Oil Pressure Sensor N CAN Network Diagnostic T Manifold Air Temperature B Fuel Temperature Sensor Connector Connector MAT Sensor Connector Connector I Main System Fuse 10 amp O Instrument Panel Connector U Alternator Ignition Connector C lInjectio
217. oad container SEI cases must be used for packing 3 6 Air transport Containers must be transported by air in accordance with the specific rules governing air transport The UN has classified generating sets as dangerous goods listed under UN code 3166 class 9 Engine internal combustion flammable liquid powered Any air shipment of generating sets must be subject to prior declaration to the air freight company in accordance with form MOD3909 For air transport observe the following steps 1 Choose transport equipment appropriate for this usage and having all the safety guarantees both in terms of load bearing capacity and securing devices 2 For control boxes packing in an SEI 4 C case solid case with waterproof cover is obligatory 34 290 4 Installation Connections 4 1 Unloading the generating set 4 1 1 Choosing the location When choosing where to site the generating set bear in mind the proximity to the electrical distribution panel nuisance caused by the noise fuel supply burnt gas evacuation direction of these gases and the noise generated Incorrect ventilation and exhaust Building or terrain too rough Generating set incorrectly seated hen Somat 0 Impossible to open enclosure doors Impossible to fill with fuel Figure 13 Examples of problems that may be encountered 35 290 4 1 2 Safety during unloading Always follow the safety instructio
218. oading wavy washer Single bearing kit ALT 442 KB 002 Non drive end bearing O ring Preloading Double bearing kit Non drive end bearing Drive end bearing O ring Preloading ALT 442 KB 001 5 2 Technical support service Ourtechnical support service will be pleased to provide any additional information you may require When ordering spare parts you should indicate the complete machine type its serial number and the information given on the nameplate Address your enquiry to your usual contact Part numbers should be identified from the exploded views and their description from the parts list Our extensive network of service centres can dispatch the necessary parts without delay To ensure correct operation and the safety of our machines we recommend the use of original manufacturer spare parts In the event of failure to comply with this advice the manufacturer cannot be held responsible for any damage 5 3 Accessories 5 3 1 Space heater for use when stopped The space heater must run as soon as the alternator stops It is installed at the rear of the machine Its standard power is 250W with 220V or 250W with 110V on request Warning the power supply is present when the machine has stopped 5 3 2 Temperature sensors with thermistors PTC These are thermistor triplets with a positive temperature coefficient installed in the stator winding 1 per phase
219. object Risk of injury Battery electrolyte is extremely corrosive Always protect your eyes skin and clothing when handling batteries Always wear protective goggles and gloves In the event of contact with the skin wash thoroughly with water and soap If the eyes are splashed rinse thoroughly with water and consult a doctor immediately 8 1 Checking the electrolyte level The electrolyte level must be approximately 10 mm above the battery plates 1 Top up with distilled water if necessary 2 Pour the distilled water carefully to avoid any splashes Wear protective goggles and rubber gloves when handling the battery adding water charging etc Note some batteries requiring no maintenance form the subject of specific instructions which must be respected After the battery has been topped up it must be recharged for at least 30 minutes 8 2 Checking the voltage acid density Every 2 months the following checks must be performed 1 Check the density of the acid contained in the cells all the battery cells must have the same density if this is not the case the battery must be replaced 2 Check the voltage when idle Acid density Charge status Voltage when idle Observation action 6 The results of the density and voltage measurements make it possible to define the charge status of the battery If the charge status is less than 60 the battery must be recharged 87 290 EN 8 3 Charging the batt
220. of pictograms The fuel level pictogram is used to display the fault the alarm and the fuel level The operating temperature and oil pressure pictograms are used to display the fault and analog value The overspeed and non starting fault pictograms are used to display the fault The battery pictogram is used to display the alternator charge fault and to indicate the battery voltage YYYY 54 290 6 2 2 Manual starting Check that the generating set circuit breaker has triggered O connect the generating set battery 2 turn the key switch to the ON position without forcing it All of the LEDs light up for 2 seconds to confirm that they are operating correctly If the LEDs do not light up check the protection fuse and replace it if necessary All the items on the screen are displayed for 2 seconds Only the ON LED remains lit to indicate that the module is powered up The following screen appears AANA The first line displays the motor speed in RPM oy The second line displays the battery voltage in volts V v Check the battery voltage min 12 V Press once briefly the green START button v Ifthe motor is equipped with an air preheating system there is a 10 second delay before the motor starts preheating activation period v The following screen appears i RI 2c The third line displays the air preheating time del y remaining with pictograms representing a OY Ht 5 resistor and an ho
221. oling system drain and flush if COOL GARD is not used o Engine oil filter replace o Valve clearance adjust POWERTech o Fuel filter replace o Air intake system check o Check belt and tensioning system o Vibration damper check o Crankcase vent tube clean Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 71 19 22JANO7 1 1 072209 02 9 PN 18 116 290 Maintenance Records 8500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace manual tensioner o Valve clearance adjust 300 Series o Belt check tension and wear 300 Series and POWERTech with Number of hours Job done by Observation Dealer or distributor stamp 9000 Hours of operation DPSG CD03523 72 19 22JANO7 1 1 o Engine oil drain o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean o Air intake system check Number of hours Job done by Observation Dealer or distributor stamp 02 10 117 290 DPSG CD03523 73 19 22JANO7 1 1 072209 PN 19 Maintenance Records 9500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace o Belt check tension and wear 300 Series and POWERTech with manual tensioner o Valve clearance adjust 300 Series Number
222. oll through ALARM 25 12 05 15 30 the list of faults Low Fuel Level GDS OK HELP Esc Check Emerg Stop Pos Connector s Esc If the alarm is no longer active it is reset automatically cause disappears Press Esc to reset a fault reset acknowledged if the cause of the fault has been removed reset not performed if the cause of the fault is still present 79 290 EN 6 3 4 4 Engine fault codes display Certain alarms and engine faults generate specific fault codes These codes are standardised according to the J1939 and or J1587 standards Terminology used by the SAE CAN J1939 standard SPN Suspect Parameter This represents the system or component at fault for example SPN 100 Number indicates an oil pressure problem or a problem with the oil pressure sensor This represents the type of fault that has occurred This may be an electrical mechanical or equipment fault Terminology used by VOLVO FMI Failure Mode identifier This term used in the J1587 standard has an equivalent in the J1939 standard SPN However this term corresponds more particularly to an assembly of components for example the injection system SID System Identifier This term used in the J1587 standard has an equivalent in the J1939 standard SPN However this term corresponds more particularly to a specific component for example a sensor PID Parameter Identifier This term used in the J1587 sta
223. on demands it Note the carbon monoxide present in the exhaust gas may lead to death by inhalation if the concentration levels in the atmosphere are too high Corrosion inhibitor in the coolant contains alkali Read the instructions on the packaging Keep the product out of the reach of children Do not swallow it Avoid prolonged or repeated contact with the skin Never allow contact with the eyes In the event of contact with the eyes 1 Rinse immediately with plenty of water for at least 15 minutes 2 Consult a doctor immediately In the event of contact with the skin 1 Wash thoroughly with water and soap 2 Consult a doctor immediately Fuels and oils Do not swallow it Ensure proper ventilation Use a suitable protective mask 13 290 Battery electrolyte Avoid all contact with the skin and eyes Wear suitable protective goggles and clothing and strong alkali resistant gloves for handling the electrolyte If splashes get into the eyes 1 Rinse immediately with running water and or a 10 diluted boric acid solution 2 Consult a doctor immediately 1 4 6 Precautions for risks relating to handling phases A DANGER HANDLING PHASES RISK OF DROPPING 1 Select the appropriate handling equipment and apparatus according to the type of equipment being handled Check that there is sufficient handling capacity 2 Check that the handling equipment and appar
224. onnector from the exciter and the R 791 module Remove the 4 nuts on the tie rods Remove the NDE shield 36 using a puller eg U 32 350 FACOM Remove the ball bearing 70 using a screw puller 4 6 5 2 Reassembly Heat the inner slipring of a new bearing by induction or in a drying oven at 80 C do not use an oil bath and fit it to the machine Place the preloading wavy washer 79 in the shield and fit a new O ring seal 349 Refit the NDE shield and pass the bundle of wires between the top bars of the shield Refit the fixing clamps on the cables the R 791 module and the exciter connector Refit the air intake grille 51 Replace the terminal box lid 48 LEROY 14 SOMER 236 290 LSA 43 2 44 2 4 POLES ALTERNATORS NDE shield Rotor Screw rod WARNING When dismantling the shields you will need to change the antifriction bearings the O ring seal the preloading wavy washer and adhesive paste 4 6 6 Replacing the DE bearing 4 6 6 1 Dismantling Uncouple the alternator from the prime mover Remove the 8 assembly screws Remove the DE shield 30 Remove the NDE shield see section 4 6 5 1 Remove both ball bearings 60 and 70 using a puller with a central screw 4 6 6 2 Reassembly Heat the new bearings by induction or in a drying oven at 80 C do not use an oil bath and fitthem to the machine Check that both the preloading
225. ood condition Replace missing or damaged safety signs Be sure new equipment components and repair parts include the current safety signs Replacement safety signs are available from your John Deere dealer There can be additional safety information contained on parts and components sourced from suppliers that is not reproduced in this operator s manual TS201 UN 23AUG88 Learn how to operate the machine and how to use controls properly Do not let anyone operate without instruction Keep your machine in proper working condition Unauthorized modifications to the machine may impair the function and or safety and affect machine life If you do not understand any part of this manual and need assistance contact your John Deere dealer DX READ 19 16JUNO9 1 1 072209 05 2 PN 27 125 290 Safety Prevent Machine Runaway Avoid possible injury or death from machinery runaway Do not start engine by shorting across starter terminals Machine will start in gear if normal circuitry is bypassed NEVER start engine while standing on ground Start engine only from operator s seat with transmission in neutral or park 15177 UN 11JAN89 DX BYPAS1 19 29SEP98 1 1 Handle Fuel Safely Avoid Fires Handle fuel with care it is highly flammable Do not refuel the machine while smoking or when near open flame or sparks Always stop engine before refueling machine Fill fuel tank outdoors Prevent fires by keeping
226. op up tank outlet Fill up the oil top up tank with oil Fill up the crankcase with oil Fill up the on board tank with fuel or ON E Check that the batteries are fitted and filled with electrolyte 3 3 Road transport 3 3 1 Generating sets with and without an enclosure Generating sets must be transported by road in accordance with the regulations of the countries concerned When transporting generating sets in containers by road the following steps must be observed 1 Puta plastic cover over non enclosed generating sets during transportation 2 Select transport equipment trailer semi trailer etc suitable for this usage and having all the safety guarantees in terms of load bearing capacity and of the securing devices Chock and fix the generating sets to the floor of the transport equipment Strap the generating sets to the transport equipment Select a transport route which makes it possible to travel on roads suitable for vehicles and whose quality will not damage the on board generating sets 27 290 3 3 2 Generating sets on trailers 3 3 2 1 Hitching and unhitching the trailer Jockey wheel for M3128 and M3129 type trailers Jockey wheel for M3126 and M3127 type trailers Before hitching the trailer check the hitching system on the towing vehicle this must be perfectly compatible with the trailer Towing a trailer with a non compliant device bar cables lashing etc runs the ri
227. ormed ata cleaning station equipped with a vacuum system that collects and flushes outthe products used The insulating components and the impregnation system are not at risk of damage from solvents Avoid letting the cleaning product run into the slots Apply the product with a brush sponging frequently to avoid accumulation in the housing Dry the winding with a dry cloth Let any traces evaporate before reassembling the machine 4 2 4 Mechanical servicing WARNING Cleaning the machine using water or a highpressure washer is strictly prohi bited Any problems arising from such treatment are not covered by our warranty Degreasing Use a brush and detergent suitable for paintwork Dusting Use an air gun Ifthe machine is fitted with air inlet and outlet filters the maintenance personnel should clean them routinely at regular intervals In the case of dry dust the filter can be cleaned using compressed air and or replaced if it is clogged After cleaning the alternator itis essential to check the winding insulation see sections 3 2 and 4 8 4 3 Fault detection If when commissioned the alternator does not work normally the source of the malfunction must be identified See sections 4 4 and 4 5 LEROY SOMER 11 233 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 4 4 Mechanical defects Bearing Excessive temperature rise in one or both bearings bearing temperature more than 8
228. ot getting fuel or air in fuel system Faulty injection pump or nozzles Engine starting under load Improper starting procedure No fuel Air in fuel line Cold weather Slow starter speed Crankcase oil too heavy Improper type of fuel Water dirt or air in fuel system Clogged fuel filter Dirty or faulty injection nozzles Injection pump shut off not reset Low engine oil level Injection pump out of time Low coolant temperature Engine overheating Continued on next page 55 4 196 290 Solution Verify correct starting procedure Check fuel in tank and manual shut off valve Check and correct exhaust restriction Replace fuel filter or drain water from filter Check fuel flow at supply pump or bleed fuel system Consult authorized diesel repair station for repair or replacement Remove load Review starting procedure Check fuel tank Bleed fuel line Use cold weather starting aids See Starter Cranks Slowly Use oil of proper viscosity Consult fuel supplier use proper type fuel for operating conditions Drain flush fill and bleed system Replace filter element Have authorized servicing dealer or engine distributor check injectors Turn key switch to OFF then to ON Add oil to engine crankcase See your authorized servicing dealer or engine distributor Remove and check thermostat See Engine Overheats DPSG CD03523 49 19 22JANO7 1 4
229. ote voltage setting potentiometer in the midale Operate the alternator at its rated speed if the voltage does not rise it is necessary to re magnatise the magnetic circuit slowly adjust the voltage potentiometer of theA V R P1 untilthe output voltage reaches its rated value Stability setting with P2 3 2 2 Special type of use WARNING Excitation circuit E E must not be left open when the machine is running A V R damage will occur 3 2 2 1 R250 field weakening SHUNT BAHA The exciter is switched off by disconnecting the A V R power supply 1 wire O or 110V Contact rating 16A 250V AC Do notreclose the power supply until the voltage has reached a value lt 15 of the rated voltage approximately 5 seconds after opening 3 2 2 2 R250 field forcing 400V 10m Diode Excitation Inducer The battery must be isolated from the mass Exciter field may be at line potential LEROY 8 SOMER 254 290 LEROY SOMER Installation and maintenance R250 A V R 3 3 Electrical faults Effect Check cause No voltage at no load on start up Connect a new battery of 4 to 12 volts to terminals E and E respecting the polarity for 2 to 3 seconds The alternator starts up and its voltage is still correct when the battery is removed Lack of residual magnetism The alternator starts up but its voltage does not reach the rated value when th
230. ous reasons this cannot always be accomplished These SPNs allow the manufacturer some flexibility to communicate non specific component diagnostic information Since SPNs 611 615 use the standard SPN FMI format it allows the use of standard diagnostic tools electronic dashboards satellite systems and other advanced devices that scan Parameter Groups containing the SPN FMI formats Because manufacturer defined codes are not desirable in terms of standardization the use of these codes should only occur when diagnostic information cannot be communicated as a specific component and failure mode Possible reasons for using a System Diagnostic Code include 1 Cost of specific component fault isolation is not justified or 2 New concepts in Total Vehicle Diagnostics are being developed or 3 New diagnostic strategies that are not component specific are being developed Due to the fact that SPNs 611 615 are manufacturer defined and are not component specific FMIs 0 13 and 15 31 have little meaning Therefore FMI 14 Special Instructions is usually used The goal is to refer the service personnel to the manufacturer s troubleshooting manual for more information on the particular diagnostic code This failure mode does not relate to the signal range definition as do many of the FMls This type of fault may or may be directly associated with the value of general broadcast information FMI 15 DATA VALID BUT ABOVE NORMAL OPERATING RANGE LEAST S
231. ow engines to cool then carefully remove radiator cap 2 Fill radiator with coolant to the normal operating level IMPORTANT DO NOT apply excessive pressure to cooling system doing so may damage radiator and hoses 3 Connect gauge and adapter to radiator filler neck Pressurize cooling system to specification listed for radiator cap With pressure applied check all cooling system hose connections radiator and overall engine for leaks If leakage is detected correct as necessary and pressure test system again If no leakage is detected but the gauge indicated a drop in pressure coolant may be leaking internally within the system or at the block to head gasket Have your engine distributor or servicing dealer correct this problem immediately CD03523 00000EC 19 22JANO7 1 1 072209 PN 81 179 290 Maintenance 2000 hours 2 years Check and adjust engine valve clearance 4045 and 6068 Engines Adjust engine valve clearance as follows or have your authorized servicing dealer or engine distributor adjust the engine valve clearance 1 Remove rocker arm cover and crankcase vent tube 2 Using JDE83 or JDG820 Flywheel Turning Tool A rotate engine flywheel in running direction clockwise viewed from water pump until No 1 piston front has reached top dead center TDC on compression stroke Insert timing pin JDE81 4 B into flywheel bore o lt x gt Z gt lt lt LO Oo Mm Q
232. ower supply 1 wire X1 or X2 Contact rating 16 A 250V A C 3 2 3 2 R438 field weakening AREP PMG The exciter is switched off by disconnecting the AVR power supply 1 wire on each auxi liary winding contact rating 16 A 250V A C Connection is identical for resetting the AVR internal protection In case of using the de excitation pro vide a forced excitation 3 2 3 3 R438 field forcing 400V 10A pg Diode Exciter field Forced excitation Time Guaranteed voltage build up Parallel operation de energized Parallel operation at standstill Frequency starting Sustained voltage on overload LEROY SOMER 11 269 290 LEROY SOMER R438 3 3 Electrical faults Action A V R Effect Check Cause No voltage at no load on start up Connect a new battery of 4 to 12 volts to terminals E and E respecting the polarity for 2 to 3 seconds The alternator builds up and its voltage is still correct when the battery is removed Lack of residual magnetism The alternator builds up but its voltage does not reach the rated value when the battery is removed Check the connection of the voltage reference to the AVR Faulty diodes Armature short circuit The alternator builds up but its voltage disappears when the battery is removed Faulty AVR Field windings disconnected Main field winding open circuit check the
233. parts sdmo com To find your nearest center service please consult our website www sdmo com 85 290 EN 7 7 Fault finding Refer to the user manual and engine and alternator maintenance manuals appended Additionally in the event of an abnormal rise in engine temperature check that the radiator is clean 7 8 No load and under load tests Notes on operation at no load and under load When operating at no load or low load lt 30 of nominal power the operating conditions do not allow optimum running of the engine The main causes are as follows v The low volume of fuel burned in the combustion chamber leads to incomplete combustion the resulting thermal energy means that the optimum engine operating temperature cannot be reached v Overheated engines have lower compression ratios low compression ratio without turbocharging which are defined for full load and not suitable for good combustion at low load All of these factors lead to choking of the engine in particular the piston rings and valves which leads to Y Accelerated wear and glazing of the cylinder liners v Loss of sealing of seats and sometimes sticking of valve stems Consequently operating any turbocharged engine at low load lt 30 can only have adverse repercussions on an engine s operation and its service life Maintenance intervals will have to be shortened to accompany harsh operating conditions Shortening draining intervals among other things
234. pond to the rated operating The threshhold position and LAM fonction settings are done with the jumper Operating at 50 Hz U F gradient 0 threshold at 48 Hz without LAM for impacts between 30 and 40 of the rated load 1 threshold at 48 Hz with LAM 13 for impacts between 40 and 70 of the rated load 2 threshold at 48 Hz with LAM 25 for impacts gt 70 of the rated load Operating at 60 Hz U F gradient 3 threshold at 58 Hz without LAM for impacts between 30 and 40 of the rated load 4 threshold at 58Hz with LAM 13 for impacts 40 and 70 of the rated load 5 threshold at 58Hz with LAM 25 for impacts gt 70 of the rated load Specific operating 6 threshold at 57Hz without LAM for speed variations at a steady state gt 2 Hz 7 threshold at 65Hz without LAM for variable speed and tractelec gearlec U F gradient 8 special the factory setting 48Hz 2U F gradient a special programme is possible on request This programme must be specified before ordering during the project study 9 threshold at 47 5 Hz without LAM for speed variations at a steady state gt 2 Hz For hydraulic applications it is advisable to select frequency see the nameplate on the position 0 for 50 Hz alternator position 3 for 60 Hz Risk of destruction for the alternator LEROY SOMER 5 251 290 LEROY SOMER R250 A V R 2 3 R250 A V R option Potentiometer for voltage setting 1000 W 0
235. prime mover do not use the fan to turn the alternator or rotor The holes of the coupling discs should be aligned with the flywheel holes by cranking the engine Make sure the alternator is securely bedded in position during coupling Check that there is lateral play on the crankshaft 3 1 2 2 Double bearing alternator Semi flexible coupling Careful alignment of the machines is recommended checking that the lack of concentricity and parallelism of both parts of the coupling do not exceed 0 1 mm This alternator has been balanced with a 1 2 key 3 1 3 Location The room where the alternator is placed must be ventilated to ensure that the ambient temperature cannot exceed the data on the nameplate 3 2 Checks prior to first use 3 2 1 Electrical checks Under no circumstances should an alternator new or otherwise be operated if the insulation is less than 1 megohm for the stator and 100 000 ohms for the other windings LEROY 6 SOMER 228 290 LSA 43 2 44 2 4 POLES ALTERNATORS There are 2 possible methods for restoring the above minimum values a Dry out the machine for 24 hours in a drying oven at a temperature of 110 C without the regulator b Blow hot air into the air intake having made sure that the machine is rotating with the exciter field disconnected Note Prolonged standstill In order to avoid these problems we recommend the use of space heaters as well as turning over
236. r 2 with its lever Place the stabiliser in contact with the ground Tighten the jaw of the stabiliser 2 with its lever 31 290 3 3 2 2 Check before towing Before first use it is essential to check the tightness of the wheel bolts IMPORTANT Before towing check the following Wheel tightness Hitching hook locked Tyre pressure Signalling lights working Enclosure doors closed Parking brake released Guide wheels jockey wheels and stands lifted and locked Safety cable fitted INFLATION PRESSURE BAR 185R14C 5 145R13 185 70R13 175R14C 215R14C 215 75R14C TIGHTENING TORQUE WHEELS Axis of 10 60 Nm Axis of 14 and 16 120 Nm 155 70R13 3 3 2 3 Operation The driving speed must be suited to the condition of the road and the handling of the trailer Maximal speed on road 140km h Driving at high speed causes the tyres to heat it is therefore important to stop from time to time and check them Excessive heating may cause a puncture and therefore a serious accident For reversing manoeuvres remember to lock the inertia brake Particular attention must be paid to the tightness of the wheels on new vehicles In the first few miles driving heating of the brake hubs and drums will actually reduce the wheel tightness It is therefore essential to check the tightness every 6 miles 10 kilometres until no further loosening is noted IMPORT
237. r Sets Saran Built OMCD16564 ISSUE G9 ANGLAIS CALIFORNIA Proposition 65 Warning Diesel engine exhaust and some of its constituents are known to the State of California to cause cancer birth defects and other reproductive harm If this product contains a gasoline engine A WARNING The engine exhaust from this product contains chemicals known to the State of California to cause cancer birth defects or other reproductive harm The State of California requires the above two warnings John Deere Usine De Saran This manual replaces OMCD16564 F8 European Version PRINTED IN GERMANY 99 290 Foreword THIS MANUAL COVERS the following engines for generator sets Non Emission Certified Engines Mechanical Fuel System CD3029DF120 CD3029DF128 CD3029TF120 CD3029TF158 CD4039DF008 CD4039TF008 CD4045DF158 CD4045HF120 CD4045HF158 CD4045TF120 CD4045TF158 CD4045TF220 CD4045TF258 CD6068HF 120 CD6068HF 158 CD6068HF 258 CD6068TF158 CD6068TF220 CD6068TF258 Emission Certified Engines Stage Il according to Directive 97 68 EC CD3029HFS70 Mechanical Fuel System CD3029HFU70 Mechanical Fuel System CD3029TFS70 Mechanical Fuel System CD3029TFU70 Mechanical Fuel System CD4045HFS72 DE10 Fuel System CD4045HFS73 HPCR System 2 Valve Head CD4045HFU72 DE10 Fuel System CD4045HFU79 HPCR System 2 Valve Head CD4045TFS70 Mechanical Fuel System CD4045TFU70 Mechanical Fuel System
238. r any accidents caused by these phenomena However it is possible to install surge protectors considering that this assembly does not provide complete protection 5 Installation 5 1 Warnings concerning commissioning The inspections referred to in this section enable the electrical generator set to operate Specific skills are required to carry out these operations They must only be entrusted to personnel with the necessary skills IMPORTANT Failure to follow these instructions in any way could result in malfunction or very serious accidents 5 2 Checking the generating set installation Check the position of the generating set stability mounting available space ventilation exhaust etc Check the electrical connections gt earthing gt electrical control connections gt electrical power connections gt starter battery charging system rating and voltage if fitted to the generating set 48 290 EN 5 3 Preparing for operation of the generating set Become familiar with the controls useful to operate the generating set Read and understand the user menus of the control unit Become familiar with the maintenance plans for the generating set Become familiar with the operation of the generating set at no load or under load Become familiar with the fluid specifications fuel lubricant and coolant 5 4 Checking the generating set before startup Check that the plugs blanking covers an
239. r lifting the engine is with JDG23 Engine Lifting Sling A and safety approved lifting straps B that come with engine Use extreme caution when lifting and NEVER permit any part of the body to be positioned under an engine being lifted or suspended Lift engine with longitudinal loading on lifting sling and lifting straps only Angular loading greatly reduces lifting capacity of sling and straps RG7784 UN 11NOV97 NOTE If engine does not have lifting straps universal straps can be procured through service parts under larger components such as power take off part numbers JD 244 1 and JD 244 2 transmission generator air compressor etc are attached to engine the lifting straps If not equipped install lifting straps and torque to 200 provided with engine or through parts channel N m 145 lb ft are not intended for this purpose Technician is responsible for providing adequate lifting Attach JDG23 Engine Lifting Sling A to engine lifting devices under these situations See machine straps B and overhead hoist manuals for additional information on IMPORTANT Lifting straps are designed to lift the romoving eng ne tromimacnine SngIne and accessories such as radiator 3 Carefully move engine to desired location air filter and other small components If DPSG CD03523 95 19 22JANO7 1 1 Follow Safety Instructions Carefully read all safety messages in this manual and on your machine safety signs Keep safety signs in g
240. r more faults have appeared after the first fault they can only be displayed after the first fault has been reset press Reset as many times as the number of faults present Note an alarm can appear at the same time as a fault 6 2 5 Faults and alarms Details List of faults which will cause the generating set to stop and generate a pictogram Associated pictogram Oil pressure fault Indicates that the oil pressure is incorrect Associated pictogram l gt o de aa Engine temperature fault Indicates that the engine temperature is too high Associated pictogram Non starting fault Indicates that there have been three consecutive unsuccessful starting attempts Associated pictogram Overspeed fault Indicates an excessive generating set running speed Associated pictogram Low fuel level fault Indicates the need to top up the fuel 56 290 EN List of faults which will cause the generating set to stop and generate a fault code Low coolant level fault indicates that the level of coolant is low in the radiator linked to a two second time delay Or Overload or short circuit fault optional with the circuit breaker SD contact closing overload or short circuit the generating set switches off immediately also causing the main circuit breaker to be triggered Additional fault linked to message opposite is displayed in the following two cases gt Differential fault 1
241. r spring tension using a torque wrench and procedure outlined below Release tension on belt using a breaker bar and socket on tension arm Remove belt from pulleys Release tension on tension arm and remove breaker bar Put a mark A on swing arm of tensioner as shown Measure 21 mm 0 83 in from A and put a mark B on tensioner mounting base NOTE Earlier engines have a LEFT HAND thread roller cap screw while later engines have a 12 7 mm 1 2 in square hole in tensioner Install torque wrench on roller cap screw or in square hole so that it is aligned with center of roller and tensioner as shown Rotate the swing arm using a torque wrench until marks A and B are aligned Record torque wrench measurement and compare with specification below Replace tensioner assembly as required Specification Spring Force 18 22 N m 13 16 lb ft Align marks A Mark on swing arm B Mark on tensioner mounting base Check and adjust engine valve clearance 3029 and 4039 Engines NOTE Valve clearance must be adjusted after the first 500 hours of operation then every 1000 hours thereafter Adjust engine valve clearance as follows or have your authorized servicing dealer or engine distributor adjust the engine valve clearance 1 Remove rocker arm cover and crankcase vent tube 2 Using JDE83 or JDG820 Flywheel Turning Tool A rotate engine flywheel in running direction clockwise viewed from water pump
242. rating set in the event of a fault which could endanger personnel or damage equipment Key switch for starting up shutting down the module and RESET function Electronic card protection fuse Screen scroll button press successively to access the various screens which are available STOP button press to switch off the generating set START button press to switch on the generating set Normal operation LEDs and alarm and fault warning LEDs Slot reserved for panel fascia options Mounting bolt LCD for displaying alarms and faults operating states electrical and mechanical quantities 53 290 Figure 17 Description of the LEDs A lit LED indicates Module being supplied green lights up and remains lit Emergency stop activated control panel or external emergency stop red lights up and remains lit Visualisation of starting phase and speed voltage stabilisation flashing and generating set operating OK or set ready to generate green lights up and remains lit General alarm orange flashing OS WHO General fault red flashing 6 2 1 1 Introduction to pictograms The pictograms are as follows Operating temperature Fuel Symbols for electric and mechanical sizes Overspeed Non starting fault gt BORCE i Starting on external command N 11 1 fh AUT PE EA es Preheating ___ gt gt To To Tm Air intake 00 AN OO SIBAR R A Delay Oil pressure Figure 18 View
243. rator e lf you use solvent or paint stripper remove stripper with soap and water before welding Remove solvent or paint stripper containers and other flammable material from area Allow fumes to disperse at least 15 minutes before welding or heating Do not use a chlorinated solvent in areas where welding will take place X9811 UN 23AUG88 DX FLUID 19 O3MAR93 1 1 o gt lt x LO Z D ioe LO O 0 E DX TORCH 19 10DEC04 1 1 TS220 UN 23AUG88 Do all work in an area that is well ventilated to carry toxic fumes and dust away Dispose of paint and solvent properly 05 7 130 290 DX PAINT 19 24JULO2 1 1 072209 PN 32 Service Cooling System Safely Explosive release of fluids from pressurized cooling system can cause serious burns Shut off engine Only remove filler cap when cool enough to touch with bare hands Slowly loosen cap to first stop to relieve pressure before removing completely Avoid Harmful Asbestos Dust Avoid breathing dust that may be generated when handling components containing asbestos fibers Inhaled asbestos fibers may cause lung cancer Components in products that may contain asbestos fibers are brake pads brake band and lining assemblies clutch plates and some gaskets The asbestos used in these components is usually found in a resin or sealed in some way Normal handling is not hazardous as long as airborne dust containing asbestos is not generated
244. re the engine is loaded immediately upon reaching rated speed Normal engine operation Compare engine coolant temperature and engine oil pressure with specifications below Specification Minimum oil pressure at full load rated speed PTOSSUl O pianino aaa 275 kPa 2 75 bar 40 psi Coolant temperature range Temperature 82 94 C 180 202 F Stop engine immediately if coolant temperature is above or oil pressure below specifications or if there are any signs of part failure Symptoms that may be early signs of engine problems could be e Sudden loss of power Oil at normal operating temperature of 115 C 240 F Standby power units To assure that your engine will deliver efficient standby operation when needed start engine and run at rated speed with 50 0 load for 30 minutes every 2 Stopping the engine 1 Before stopping run engine for at least 2 minutes at fast idle and no load Changing Generator Frequency Generator sets powered by 6068HFU 4 engine are dual frequency 50 Hz 1500 rpm or 60 Hz 1800 rpm 15 29 164 290 e Unusual noise or vibration e Excessive black exhaust e Excessive fuel consumption e Excessive oil consumption e Fluid leaks Recommendation for turbocharger engines Should the engine stall when operating under load IMMEDIATELY restart it to prevent overheating of turbocharger components Idling engine Avoid excessive engine idling Prolonged idling may cause
245. red by the system This type of fault may or may be directly associated with the value of general broadcast information 288 290 EN FMI 10 ABNORMAL RATE OF CHANGE Any data exclusive of the abnormalities covered by FMI 2 that is considered valid but whose data is changing at a rate that is outside the predefined limits that bound the rate of change for a properly functioning system outside Region c of the signal range definition Broadcast of data values is continued as normal FMI 11 ROOT CAUSE NOT KNOWN It has been detected that a failure has occurred in a particular subsystem but the exact nature of the fault is not known Broadcast of data value is substituted with the error indicator value FMI 12 BAD INTELLIGENT DEVICE OR COMPONENT Internal diagnostic procedures have determined that the failure is one which requires the replacement of the ECU used here to mean the packaged unit that includes some microprocessor and its associated components and circuits lt can be assumed that the communications subsystem is not the part that has failed and the manufacturer has determined that there is no serviceable component smaller than the ECU involved in the failure Broadcast of data value is substituted with the error indicator value if appropriate as there may or may not be any broadcast involved This error is to include all internal controller trouble codes that can not be caused by connections or systems external to the con
246. red normal as determined by the predefined moderately severe level limits for that particular measure of the real world condition Region j of the signal range definition Broadcast of data values is continued as normal 289 290 EN FMI 19 RECEIVED NETWORK DATA IN ERROR Any failure that is detected when the data received via the network is found substituted with the error indicator value i e FE16 see J1939 71 This type of failure is associated with received network data The component used to measure the real world signal is wired directly to the module sourcing the data to the network and not to the module receiving the data via the network The FMI is applicable to Region fand g of the signal range definition This type of fault may or may be directly associated with the value of general broadcast information FMI 20 30 RESERVED FOR SAE ASSIGNMENT FMI 31 CONDITION EXISTS Used to indicate that the condition that is identified by the SPN exists when no more applicable FMI exists or in cases when the reported SPN name spells out the component and a non standard failure mode This type of fault may or may be directly associated with the value of general broadcast information This FMI will mean not available when the associated SPN is also not available as when the remainder of the packet is filled with binary ones after all data has been transmitted 290 290
247. rent generators for generating sets Low Voltage Directive Nr 2006 95 CE dated 12 December 2006 Furthermore these generators designed in compliance with the Machine Directive Nr 2006 42 are therefore able to be incorporated into Electrical Gen Sets complying with the following International Directives Machinery Directive Nr 2006 42 CE dated 17 May 2006 EMC Directive Nr 2004 108 CE dated 15 December 2004 as intrinsic levels of emissions and immunity are concerned WARNING The here above mentioned generators should not be commissioned until the corresponding Gen Sets have been declared in compliance with the Directives Nr 2006 42 CE et 2004 108 CE as well as with the other relevant Directives Leroy Somer undertakes to transmit in response to a reasoned request by the national authorities relevant information on the generator Technical Managers P Betge J Begu 4152 en 2010 11 d LEROY 22 SOMER 244 290 LSA 43 2 44 2 4 POLES ALTERNATORS LEROY SOMER 23 245 290 LEROY SOMER LEROY SOMER 4067 en 2009 05 b IRON R 250 E F1 Slow fuse 250V 8A Voltage Eo W V 1 8 0344 Stabilit IO i ST4 Option External potentiometrer for voltage adjusting Y R250 A V R Installation and maintenance 247 290 LEROY SOMER R250 A V R This manual concerns the alternator A V R which you have
248. resistance Voltage too low Check the drive speed Correct speed Check the AVR connections AVR may be faulty Field windings short circuited Rotating diodes burnt out Main field winding short circuited Check the resistance Speed too low Increase the drive speed Do not touch the AVR voltage pot P2 before running at the correct speed Voltage too high Adjust AVR voltage potentiometer Adjustment ineffective Faulty AVR Voltage oscillations Adjust AVR stability potentiometer If no effect try normal fast recovery modes ST2 Check the speed possibility of cyclic irregularity Loose connections Faulty AVR Speed too low when on load or U F bend set too high Voltage correct at no load and too low when on load Run at no load and check the voltage between E and E on the AVR Voltage between E and E SHUNT lt 20 V AREP PMG lt 10V Check the speed or U F bend set too high Voltage between E and E SHUNT gt 30V AREP PMG gt 15V Faulty rotating diodes Short circuit in the main field Check the resistance Faulty exciter armature Caution For single phase operation check that the sensing wires coming from the AVR are correctly connected to the operating terminals Voltage disappears during operation Check the AVR the surge suppressor the rotating diodes and replace any defective co
249. rn screw B clockwise to eliminate CD30764 UN 24SEP99 B Speed droop governor adjusting screw DPSG CD03523 39 19 31JANO07 1 1 072209 40 3 PN 84 182 290 Maintenance 2000 hours 2 years Checking crankshaft vibration damper 6 CYLINDER ENGINE ONLY 1 Remove belts shown removed 2 Grasp vibration damper with both hands and attempt to turn it in both directions If rotation is felt damper is defective and should be replaced IMPORTANT The vibration damper assembly is not repairable and should be replaced every 4500 hours or 5 years whichever occurs first RG8018 UN 15JAN99 Check vibration damper radial runout by positioning a dial indicator so probe contacts damper outer circumference With engine at operating temperature rotate crankshaft using JDG820 or JDE83 Flywheel Turning Tool Note dial indicator reading If runout exceeds specifications given below replace vibration damper Specification Damper Maximum radial TNOUN iia tcvcsatsic ib 1 50 mm 0 060 in RG7508 UN 23NOV97 DPSG CD03523 40 19 22JANO7 1 1 072209 40 4 PN 85 183 290 Maintenance 2500 hours 3 years Drain and flush cooling system NOTE Drain and flush cooling system every 2500 hours 3 years when John Deere COOL GARD coolant is used Otherwise every 2000 hours 2 years moo Explosive release of fluids from pressurized cooling system can cause serious burns Shut off engine Only remove f
250. roop in centre position Apply the rated load cos y 0 8 inductive The voltage should drop by 2 to 3 If it in creases check that V and W and also S1 and S2 have not been reversed I The no load voltages should be identical for all the alternators intended to run in pa rallel Couple the machines in parallel By adjusting the speed try to obtain 0 KW power exchange By altering the voltage setting P2 on one of the machines try to cancel or minimise the current circulating between the machines From now on do not touch the voltage set tings m Apply the available load the setting is only correct if a reactive load is available By altering the speed match the kW or di vide the rated power of the units proportionally By altering the quadrature droop potentiome ter P1 match or divide the currents 3 2 2 Max excitation setting excitation ceiling Depending on Main the mains frequency 50 60 Hz supply A Max excitation 50Hz 60Hz Field 5 ohms R 438 gt ST4 Voltage Static adjustment of the current limit potentiometer P5 factory setting 7 5 A fuse rating 8 A 10 seconds The maximum factory setting corresponds to that of the excitation current required to obtain a 3 phase short circuit current of approximately 3 IN at 50 Hz for industrial power unless otherwise specified A static method can be used to reduce this value or adapt the Isc to the a
251. rouble Codes RG13242 UN 30SEP03 OURGP11 00000AD 19 03SEP03 4 7 The display will return to the single or four parameter display but the display will contain the warning icon a TOOU SENM Pressing the Enter key will redisplay the hidden 1800 RPM trouble code i SGM cool TEMP 14 2 A RG13176 UN 26SEP03 Active Trouble Code Icon OURGP11 00000AD 19 03SEP03 5 7 IMPORTANT Ignoring active trouble codes can result in severe engine damage 1 of x WARNING SPN 94 FMI 18 FAULT 6 Pressing the Enter key once again will hide the FUEL DELIVERY PRESSURE trouble code and return the screen to the single or four CORRECTIVE ACTION parameter display CHECK FUEL FILTER AND LINES RG13242 UN 30SEP03 Enter Key OURGP11 00000AD 19 03SEP03 6 7 7 The single or four parameter screen will display the warning icon until the trouble code condition is 1090 RPM ENG RPM corrected 1800 RPM DIME COOL TEMP 1 oes RG13243 UN 010CT03 Active Trouble Code Condition OURGP11 00000AD 19 03SEP03 7 7 072209 15 8 PN 45 143 290 Operating the Engine Engine Shutdown Codes 1 During normal operation the single or four parameter screen will be displayed RG13172 UN 26SEP03 Normal Operation OURGP11 00000AE 19 03SEP03 1 6 2 When the diagnostic gauge receives a severe trouble code from an engine control unit the single or four tox SHUTDOWN parameter screen will be replaced wit
252. s no combustible material near the engine or battery Also check to make sure that the engine and battery are clean lf combustible materials or dust are found near the engine or battery remove them gt Check the electrical wiring for such components as the starter and alternator for looseness gt Check the entire engine for fuel leakage engine oil or coolant If leakages are found repair gt Make sure the following valves plugs and cocks are open or closed tightened properly v Fuel feed valve Open Y Coolant drain cock plug Closed Tightened v Oil drain valve Closed Checking the engine oil level A Do not top up the oil if the oil level is not below the low level marker Important Pull out the oil level gauge A and wipe it clean using a waste cloth Insert the oil level gauge fully into the oil level gauge guide then pull out the gauge again The proper oil level is between the high and low marks on the oil level gauge lf the oil level is low add engine oil Install the oil filler cap B after refilling 00000 Check the oil pan and other area for oil leakage 50 290 Checking the coolant level over the cap and loosen the cap about a half turn or stand the lever to the upright position to release internal pressure Never open the radiator filler cap while the engine is hot otherwise the steam or hot coolant spurts out and you may be scald with it A Remove the radiator filler cap only af
253. sidual current device must be added to each of the circuit outlets in use e f the generating set s residual current device is adjustable located upstream this must be above those devices located downstream terminal circuits this means that continuity on clean circuits will be maintained in the event of a fault on one of the terminal circuits see the following point on setting the residual current device Example Generating set 0 3A Generating set s residual 300mA current device 0 03A Terminal circuit 1 0 03A Terminal circuit 2 0 03A Terminal circuit 3 Residual current device Residual current device Residual current device 30mA 30mA 30mA Risk of electric shock The generating set s differential relay is factory set with a current threshold of 0 03 A 80 mA and with an automatic time delay 0 s Any change to the setting on the residual current device could pose a risk to personal safety The user will be held liable any changes must only be made by trained qualified engineers If the setting is modified it is essential to restore the original settings after use 40 290 N 4 2 2 4 Setting the generating set differential protection The setting of the generating set s residual current device is guaranteed by a differential relay fitted near the control unit type A AC or B depending on the generating sets As a result two parameters relating to the dow
254. sk of serious accidents Also check v That there are no incipient ruptures or significant wear on the hitching system IMPORTANT v That the locking system is working properly 28 290 EN Hitching a trailer fitted with a hitching ring 1 Drive the towing vehicle or bring the trailer up to the hitching point then With the jockey wheel touching the ground place the stabiliser 1 in the top position gt Loosen the jaw of the stabiliser 2 with its lever gt Raise the stabiliser fully gt Tighten the jaw of the stabiliser 2 with its lever Remove the wheel chocks if necessary and store them 2 Position the trailer parallel to the ground using the guide wheel handle jockey wheel 3 Place the hitching ring above the towing vehicle s hitching system After this adjustment the trailer must remain parallel to the ground Make any necessary height adjustments to the towbar using the jockey wheel to enable hitching IMPORTANT Remove the safety pin from the towbar 3 Undo the nut with the lever 4 Use the adjustable towbar handle to place the ring above the hitching system Tighten the nut to lock the towbar Fit the towbar safety pin 4 Attach the ring to the hitching system Lower the trailer by moving the jockey wheel away from the ground using its handle 5 5 Lock the jockey wheel in the towing position When in the towing position the jockey wheel must not obstruct the
255. st code line Last code line Display if no codes available 62 290 EN F Fault finding module internal errors Like any equipment using internal memory and a program the fault finding module generates fault codes Two types of code can be recognised Address Claim Procedure Errors Run Time Bus Errors Address Claim Procedure Errors ACP Err The following fault codes relate to the switching on of the fault finding module Error Code 1 When switched on the fault finding module must issue a request to the ECU for the network addresses used in order to exploit them this screen appears when an address cannot be used the fault finding module cannot find the default addresses an address cannot be found in the correct register Error Code 2 Passive Bus Error this code appears when the fault finding module cannot detect the ECU in this case the CAN Bus is open the CAN_hi and CAN _lo run time bus connection is reversed between the source ECU and the fault finding module Error Code 3 This code is the result of the following problems the CAN_Hi or CAN_lo bus or both are connected to an electrical ground or an external source of current data is being not transmitted at a standard baud rate This type of fault generally requires repairs to be carried out on the CAN BUS connection and therefore involves work on the engine wiring harness i e on the fault finding module ex
256. stributor See your authorized servicing dealer or engine distributor See your authorized servicing dealer or engine distributor Clean or replace fuel hose See your authorized servicing dealer or engine distributor Add oil DPSG CD03523 49 19 22JANO7 2 4 072209 PN 99 Troubleshooting Symptom High oil consumption Engine emits white smoke Engine emits black or gray exhaust smoke Engine overheats Problem Improper type of oil Crankcase oil too light Oil leaks Restricted crankcase vent tube Defective turbocharger Improper type of fuel Low engine temperature Defective thermostat Defective injection nozzles Engine out of time Improper type of fuel Clogged or dirty air cleaner Engine overloaded Injection nozzles dirty Engine out of time Turbocharger not functioning Engine overloaded Low coolant level Faulty radiator cap Stretched poly V belt or defective belt tensioner Continued on next page 95 6 198 290 Solution Drain fill crankcase with oil of proper viscosity and quality Use proper viscosity oil Check for leaks in lines gaskets and drain plug Clean vent tube see your authorized servicing dealer or engine distributor Use proper fuel Warm up engine to normal operating temperature Remove and check thermostat see your authorized servicing dealer or engine distributor See your authorized servicing deal
257. t shows evidence of bad condition punched dented replace both the primary and the secondary elements Proceed as follows 4 Clean primary element with compressed air working from clean to dirty side 1 Thoroughly clean all dirt around air filter area NOTE Compressed air pressure must not exceed 2 Remove wing nut D and remove primary element 600 kPa 6 bar 88 psi A from canister IMPORTANT Do not attempt to clean the secondary 5 Mark air filter to keep track of each cleaning operation safety element B It must be only 6 Fully depress air restriction indicator reset button and replaced as recommended release to reset indicator 3 Thoroughly clean all dirt from inside canister 7 Check air system entirely for proper condition see CHECKING AIR INTAKE SYSTEM DPSG CD03523 58 19 22JANO7 1 1 072209 00 4 PN 91 189 290 Maintenance As required Replacing fan and alternator belt 4045 and 6068 Engines NOTE Refer to CHECKING BELT TENSIONER SPRING TENSION AND BELT WEAR for additional information on the belt tensioner Inspect belts for cracks fraying or stretched out areas Replace if necessary On engines with automatic belt tensioner release tension on belt using a breaker bar and socket on tension arm On engines with manual tensioner loosen cap screws holding the alternator CD30769 UN 01SEP99 Remove poly V belt from pulleys and discard belt Installation on 4045 e
258. ta 17 Sa SPARE PARES ocina tii oi aeiia 18 5 1 First maintenance PAINS viinnnni ri iris 18 5 2 Technical support service acci n 18 o nn A 18 5 4 Exploded views parts list and tightening torque ccoccccoccccccnccccncnncncnocnnoncncnaconononons 19 EC declaration of incorporation invicta iia 22 LEROY SOMER 3 225 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 1 RECEIPT 1 1 Standards and safety measures Our alternators comply with most international standards See the EC Declaration of Incorporation on the last page 1 2 Inspection On receipt of your alternator check that it has not suffered any damage in transit If there are obvious signs of knocks contact the transporter you may be able to claim on their insurance and after a visual check turn the machine by hand to detect any malfunction 1 3 Identification The alternator is identified by means of a nameplate fixed on the machine see drawing Make sure that the nameplate on the machine conforms to your order The machine name is defined according to various Criteria for example LSA 43 2 M45 J6 4 e LSA name used in the PARTNER range M Marine C Cogeneration T Telecommunications e 43 2 machine type e M45 model LSA Date N Hz Min 1 R P M Protection Cos P F Cl ther Th class R gulateur A V R Altit _ m Masse Weight RItAV D E bearing RItAR N D E bearing
259. tem check o Vibration damper check Number of hours Job done by Observation Dealer or distributor stamp DPSG CD03523 67 19 22JANO7 1 1 02 7 114 290 072209 PN 16 Maintenance Records 6500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace manual tensioner o Valve clearance adjust 300 Series o Belt check tension and wear 300 Series and POWERTech with Number of hours Job done by Observation Dealer or distributor stamp 7000 Hours of operation DPSG CD03523 68 19 22JANO7 1 1 o Engine oil drain o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean o Air intake system check Number of hours Job done by Observation Dealer or distributor stamp 02 8 115 290 DPSG CD03523 69 19 22JANO7 1 1 072209 PN 17 Maintenance Records 7500 Hours of operation o Engine oil drain o Cooling system drain and flush if COOL GARD is used o Engine oil filter replace o Fuel filter replace o Belt check tension and wear 300 Series and POWERTech with manual tensioner o Valve clearance adjust 300 Series Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 70 19 22JANO7 1 1 8000 Hours of operation o Engine oil drain o Co
260. tension Run Time Bus Errors Fault codes can only be active if the fault finding module has been able to obtain the network addresses when it was switched on see Address Claim Procedure Errors ACP err Error Code 1 EP Passive Error this screen appears when the fault finding module loses contact with the ECU there may be two causes of this one connector on the bus connection is disconnected the CAN Bus is open Error Code 2 BO Bus Off in this case the case is identical to Error code 3 of the ACP Error Code 3 BR Bus Reset this error code is similar to Error code 3 of the ACP as are its causes In this case the fault finding module has encountered problems on the CAN Bus and it tries to automatically re establish the network connection 63 290 6 3 Generator set with TELYS control panel 6 3 1 Control panel presentation 6 3 1 1 View of the front panel e l m T ee r 2 Q A 6 e e Cy eo anno Figure 19 View of the front panel mua Emergency stop button AU for switching off the generating set in the event of a fault which could endanger personnel or damage equipment Key switch for switching the module on off Electronic board protection fuse Scrolling and selection wheel for scrolling through the menus and screens and selecting items simply by pressing the wheel STOP button press to switch off the generating set START button press to switch on the ge
261. ter the engine has cooled to room temperature Place a waste cloth O Open the radiator filler cap A Check coolant level which should be at bottom of filler neck add coolant to the speci fied level Check for leaks in the cooling circuit Checking the air filter A clogged filter element limits the engine s air intake and a reduced air supply to the engine Important If the air filter is fitted with a dust control valve A press the tip of the valve to evacuate any accumulated dust particles Check the air filter clogging indicator B If the indicator is red clean the air filter 51 290 Checking the fuel filters A When handling fuel make sure there are no open flames or other fire hazards near the engine Wipe off any spilled fuel completely Spilled fuel can ignite and cause a fire The fuel prefilter draining should not be performed when the engine is cold and stopped O Loosen drain plugs A at bottom of fuel filters two or three turns Loosen air bleed plugs B two full turns and drain water into a suitable container When fuel starts to drain out tighten drain plugs securely Bleed fuel system A Drain plug B Air bleed plug C Primary fuel filter D Final fuel filter CO30929 52 290 6 2 Generator set with NEXYS control panel 6 2 1 Control panel presentation SO OVOOHOHOD a Figure 16 View of the front side Emergency stop button for switching off the gene
262. ternator builds up and its voltage is still correct when the battery is removed Lack of residual magnetism The alternator builds up but its voltage does not reach the rated value when the battery is removed Check the connection of the voltage reference to the AVR Faulty diodes Armature short circuit The alternator builds up but its voltage disappears when the battery is removed Faulty AVR Field windings open circuit check winding Revolving field coil open circuit check the resistance Voltage too low Check the drive speed Check the AVR connections AVR may be faulty Field windings short circuited Rotating diodes burnt out Revolving field coil short circuited Check the resistance Correct speed Increase the drive speed do not touch the AVR voltage pot P2 Speed too low before running at the correct speed Voltage too high Adjust AVR voltage potentiometer Adjustment ineffective Faulty AVR Voltage oscillations Adjust the AVR stability potentiometer Check the speed possibility of cyclic irregularity Loose connections Faulty AVR Speed too low when on load or AVR LAM set too high If no effect try normal or fast stability modes ST2 Voltage correct at no load and too low when on load Run at no load and check the voltage between E and E on the AVR Voltage between E and E DC SHUNT lt 20V AREP PMG lt 10V Che
263. tes correctly V VV Y Y Y V Y Engage the parking brake when the equipment is installed on the operating site on its trailer When chocking the trailer on a slope ensure that there is nobody in the path of the trailer 8 290 EN Maintaining the equipment Personnel skills gt Ensure that the maintenance operations are performed on the equipment by appropriately trained personnel Personnel protection VV VV VV WV Wear suitable clothing and protective goggles Remove any personal belongings that may hinder the operation watch bracelet etc Fit a panel over the controls of the equipment to prevent any attempt to start Disconnect the battery and pneumatic starter if fitted before beginning any maintenance operation Handle the equipment according to best practices using techniques which do not endanger the personnel It is essential to wear gloves when detecting leaks Regularly check that the safety devices are operating correctly Equipment protection gt gt Use tools in good condition and suited to the work to be done Ensure you have understood the instructions before beginning any operation Respect the maintenance table and its recommendations In dusty or unfavourable conditions certain maintenance intervals will need to be reduced Check that the spare parts fitted on the equipment are supplied only by the dealer Handle the equipment according to best practices using techniques which do not r
264. the machine from time to time Space heaters are only really effective if they are working continuously while the machine is stopped WARNING Ensure that the alternator has the degree of protection matching the defined environmental conditions 3 2 2 Mechanical checks Before starting the machine for the first time check that all fixing bolts and screws are tight the cooling air is drawn in freely the protective grilles and housing are cor rectly in place Connection codes L L voltage the standard direction of rotation is clock wise as seen from the shaft end phase rotation in order 1 2 3 For anti clockwise rotation swap 2 and 3 the winding connection corresponds to the site operating voltage see section 3 3 3 3 Terminal connection diagrams To modify the connection change the position ofthe stator cables on the terminals The winding code is specified on the nameplate 3 3 1 Terminal connection 12 wire The connection accessories are detailed in section 5 3 3 Any intervention on the alternator terminals during reconnection or checks should be performed with the machine stopped Factory connection Winding 6 7 3 phases 50 Hz R 250 voltage sensing 0 gt T8 110 V gt T11 R 438 voltage sensing 0 gt T3 110 V gt T2 Winding 3 phases 60 Hz 190 208 190 240 380 415 380 480 R 250 voltage sensing 0 gt T8
265. tion STATOR 12 wire marking T1 to T 12 T1 1 T2 T8 T3 T9 T4 T10 TS T11 T6 T12 Voltage reference STATOR 12 wire marking T1 to T12 T1 T7 T2 T8 T3 TO T4 T10 T5 T11 T6 T12 Voltage reference LEROY SOMER 5 227 290 LEROY SOMER LSA 43 2 44 2 4 POLES ALTERNATORS 3 INSTALLATION Personnel undertaking the various operations indicated in this section must wear personal protective equipment appropriate for mechanical and electri cal hazards 3 1 Assembly All mechanical handling operations must be undertaken using suitable equipment and the machine must be horizontal Check how much the machine weighs see 4 8 3 before choosing the lifting tool 3 1 1 Handling The generously sized lifting rings are for handling the alternator alone They must not be used to lift the genset The choice of lIiftinghooksorhandlesshould be determined by the shape of these rings Choose a lifting system which respects the integrity and the environment of the alternators During this operation do not allow anyone to stand under the load 3 1 2 Coupling 3 1 2 1 Single bearing alternator Before coupling the machines check that they are compatible by undertaking a torsional analysis of the transmission checking the dimensions of the flywheel and its housing the flange coupling discs and offset WARNING When coupling the alternator to the
266. tiple Glow Plugs HPCR S 6068 non HPCR 4 valve 4 valve head engines head engines CD30925 B Single Glow Plug 3029 and 4039 engines lt e z Glow Plugs on HPCR 4 valve head engine CD30925 UN 23JAN07 Continued on next page DPSG CD03523 19 19 06FEB07 1 3 15 26 PN 63 161 290 Operating the Engine Coolant heater Connect plug of coolant heater A to a proper power source 110 or 220 V At an ambient temperature of 15 C 5 F the heating process takes approximatively 2 hours Extend heating period if ambient temperature is lower LX1017768 UN 240CT97 Lx1017768 Fuel preheater Fuel preheater A switches ON and OFF automatically in relation with the ambient temperature in DEERE AD POL FILTER j LX1017708 UN 090CT97 DPSG CD03523 19 19 06FEB07 3 3 15 27 PN 64 162 290 Operating the Engine Using a booster battery or charger A 12 volt booster battery can be connected in parallel with battery ies on the unit to aid in cold weather starting ALWAYS use heavy duty jumper cables ALERTS Gas given off by battery is explosive Keep sparks and flames away from battery Before connecting or disconnecting a battery charger turn charger off Make last connection and first disconnection at a point away from battery Always connect NEGATIVE cable last and disconnect this cable first TS204 UN 23AUG88 IMPORTANT Be sure polarity is correct before making
267. to the alarms and faults that appear as soon as OK is pressed 25 12 2005 15 30 7 Maintenance schedule 7 1 Reminder of use The maintenance interval frequency and the operations to be carried out are outlined in the maintenance schedule given as a guideline N B the environment in which the generating set is operating determines this schedule If the generating set is used in extreme conditions shorter intervals between maintenance procedures should be observed These maintenance intervals only apply to generating sets running on fuel oil and coolant which conform to the specifications given in this manual 7 2 Maintenance safety instructions Before each operation please observe the following maintenance safety instructions read the safety instructions carefully chapter 1 refer systematically to the maintenance instructions the battery isolating switch must be in the open position no operations must be carried out while the motor is running wear protective equipment gloves goggles safety shoes etc before operating on a pressurised circuit ensure that the circuit pressure has been reduced atmospheric pressure after the operations ensure that the equipment is clean or clean it if necessary TARNA A 81 290 EN 7 3 Table of maintenance operations 10h 1000h 2000h 20 000 h OPERATIONS 10 000 h EA AAA SMA Generator set SS Y __ Check the generalcondiion pe J o J f y Check the tight
268. tributor perform services that you may not be familiar with 1 Remove all protective coverings from engine Unseal all openings in engine and remove covering from electrical systems Remove the batteries from storage Install batteries fully charged and connect the terminals Install fan alternator belt if removed Check for filled fuel tank Perform all appropriate prestarting checks See DAILY PRESTARTING CHECKS 60 1 206 290 John Deere engines expected to be stored more than six 6 months long term storage preparation MUST BE taken See PREPARING ENGINE FOR LONG TERM STORAGE DPSG CD03523 51 19 22JANO7 1 1 with appropriate coolant See DIESEL ENGINE COOLANT Fill the fuel tank Remove fan alternator belt if desired Remove and clean batteries Store them in a cool dry place and keep them fully charged Clean the exterior of the engine with salt free water and touchup any scratched or chipped painted surfaces with a good quality paint Coat all exposed machined metal surfaces with grease or corrosion inhibitor if not feasible to paint Seal all openings on engine with plastic bags and tape Store the engine in a dry protected place If engine must be stored outside cover it with a waterproof canvas or other suitable protective material and use a strong waterproof tape DPSG CD03523 53 19 22JANO7 1 1 IMPORTANT DO NOT operate starter more than 30 seconds at a time Wait
269. troke Displacement Compression Ratio POWER 1500 rpm Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 1800 rpm Standby Width overall Length overall Height overall Weight dry Engine oil quantity Engine coolant quantity With Fan Approximate ITEM Number of Cylinders Fuel Bore Stroke UNIT OF MEASURE kW hp kW hp kW hp kW hp UNIT OF MEASURE kW hp kW hp kW hp kW hp UNIT OF MEASURE 4045TFS70 4045TFU70 4 4 Diesel Diesel 106 5 106 5 110 127 4 5 4 5 17 0 1 17 0 1 55 74 55 74 61 81 61 81 637 600 867 1230 979 1010 451 505 12 12 25 25 6068HFS72 6068HFS73 6 6 Diesel Diesel 106 5 106 5 127 127 6 8 6 8 17 0 1 19 0 1 112 150 139 186 123 165 153 205 784 784 1500 1500 1137 1137 764 764 32 32 32 32 6068HFU72 6068HFU74 6 6 Diesel Diesel 106 5 106 5 127 127 Continued on next page 65 5 211 290 6068HFS76 6 Diesel 106 5 127 6 8 17 0 1 167 224 184 247 960 1509 1381 764 32 35 6068HFU79 6 Diesel 106 5 127 6068HFS77 6 Diesel 106 5 127 6 8 17 0 1 189 253 207 277 960 1509 1381 764 32 35 CD03523 0000194 19 08JULO9 2 3 072209 PN 113 Specifications ITEM UNIT OF MEASURE 6068HFU72 Displacement L 6 8 Compression Ratio 17 0 1 POWER 1500 rpm 111 149 Prime POWER 1500 rpm Standby POWER 1800 rpm Prime POWER 01800 rpm St
270. troller FMI 13 OUT OF CALIBRATION A failure that can be identified to be the result of not being properly calibrated This may be the case for a subsystem which can identify that the calibration attempting to be used by the controller is out of date Or it may be the case that the mechanical subsystem is determined to be out of calibration This failure mode does not relate to the signal range definition as do many of the FMls FMI 14 SPECIAL INSTRUCTIONS Special Instructions is the FMI to be used when the on board system can isolate the failure to a small number of choices but not to a single point of failure When the FMI is used there is clear necessity for the service technician to take some action to complete the specific diagnosis and the manufacturer has provided instructions for the completion of that diagnosis There are two cases where this will be used 1 for emission related diagnostics where the particular failure cannot be separated between a sensor out of range and the case where the actual value is at the edge of a diagnostic region and 2 for the older SPN 611 to 615 where the problem is in determining which of two or more circuits which may interact is the one that needs repair SPNs 611 through 615 are defined as System Diagnostic Codes and are used to identify failures that cannot be tied to a specific field replaceable component Specific subsystem fault isolation is the goal of any diagnostic system but for vari
271. ttomperaturerigheastsevere SS ie PMI Coolant omperature moderatelyhigh MIN Wetertemperature veryiow ES Cootanttomperatrerigh aay mt J Coolantievetsensor TSS m engine cootantieveliow S PL Engine colantieveliow SSS a IE Cootant level sensor inputvokagehigh AMY Coovantievelsensorinput votageiow ras s crankcase pressure sensor 0 JM Ves above normal a Mad high e crankcase pressure sensor open creat wot lL bo eee IET TT iY int votage ofthe pressure sensor high Srono Tipu votage ofthe pressure sensor low Shor toV loss offuet pressure detected Fue pressure moderato high High barometric pressure Coolant temperature sensor Coolant temperature extremely high Coolant temperature sensor input voltage O gt e e 10 16 18 A es N O O 277 290 EN lel e O fase er voltage sensor A Votase above norma ECU powerdownenor SS w TTT est speed sensor O Wheel JE input noise Electrical system voltage e T Inlet air temperature atom e amtintartpertie senor es pe voltage high input voltage high an voltage low input voltage low Ambient air temperature sensor open _ circuit 45 High Inlet air temperature alarm warning High Inlet air temperature 16 alarm action alert y Fuel temperature sensor input voltage A high E mo eee A Fucltemperaturehigh EE O O 3 ee E rae Ts
272. ty The coolant concentrate shall be of a quality that provides cavitation protection to cast iron and aluminum parts in the cooling system John Deere COOL GARD meets this IMPORTANT Do not use cooling system sealing requirement additives or antifreeze that contains Freeze protection sealing additives A 50 mixture of ethylene glycol engine coolant in water IMPORTANT Do not mix ethylene glycol and provides freeze protection to 37 C 34 F propylene glycol base coolants DX COOL8 19 16NOV01 1 1 072209 10 3 PN 36 134 290 Fuels Lubricants and Coolant Operating in Warm Temperature Climates John Deere engines are designed to operate using glycol IMPORTANT Water may be used as coolant in base engine coolants emergency situations only Always use a recommended glycol base engine coolant even when operating in geographical areas where freeze protection is not required Foaming hot surface aluminum and iron corrosion scaling and cavitation will occur when water is used as the coolant even when John Deere COOL GARD II Premix is available in a coolant conditioners are added concentration of 50 ethylene glycol However there are situations in warm temperature climates where a coolant with lower glycol concentration approximately 20 ethylene glycol has been approved In these cases the low glycol formulation has been modified to provide the same level of corrosion inhibitor as John Deere COOL GARD II Premix
273. uel available in the area Examples of standards and requirements European standard CEN for vehicle fuel fuels for diesel engines diesel fuel requirements and test methods American Society for Testing and Materials basic requirement in the United States and Canada JIS KK 2204 Japanese Industrial Standards Japanese industrial standards Respecting pollutant emissions ASTM D 975 1 D and 2 D The certification measures confirming that the legal emission value limits are respected are performed with certified fuels which conform to the standards and requirements stated above Resistance to low temperatures When the external temperature is low the fluidity of diesel fuel may no longer be sufficient due to paraffin deposits Also in the winter in order to avoid malfunctions for example clogged filters use diesel fuels which are fluid enough in cold weather The requirements to respect for the various geographical regions and various seasons winter summer are specified in the standards and or national regulations Petrol companies should always supply fuels with the correct flow properties regardless of the time of year In general diesel fuel is treated with additives so that the fuel can be used at low temperatures in the region where it is marketed Treating fuel with additives must respect the engine manufacturer s recommendations and maintain a suitable lubricity for the injection systems It is recommended to favour
274. uency setting Check whether the ST4 jumper or the re mote adjustment potentiometer have been connected Optional operating modes e ST1 jumper open to connect the R 7310r R 734 3 phase sensing module e ST2 jumper open if rapid response time used e ST5 jumper open to suppress the LAM function 3 2 Settings The machine is tested and set at the fac tory When first used with no load make sure that the drive speed is correct and stable see the nameplate After opera tional testing replace all access panels or covers The only possible adjustments to the machine should be made on the AVR 3 2 1 R438 settings AREP or PMG system WARNING Before any intervention on the A V R make sure that the ST9 jumper is closed with AREP excitation and disconnected with PMG or SHUNT or separate excita tion a Initial potentiometer settings see table below Remote voltage adjustment potentiometer centre ST4 jumper removed 400V 50 Hz Input O 380 V Voltage minimum fully anti clockwise Stability Nobel centre position Voltage quadrature droop Not set operation with C T fully anti O quadrature loop fully clockwise anti clockwise Excitation ceiling Limit of excitation and 10A short circuit current maximum minimum fully anti clockwise Stability adjustments in standalone operation b Install a D C analogue voltmeter needle dial cal 50V on terminals E E an
275. until No 1 piston front has reached top dead center TDC on compression stroke Insert timing pin JDE81 4 or JDG1571 B into flywheel bore Continued on next page 35 3 177 290 RG7977 UN 14NOV97 RG12054 UN 08JANO2 DPSG CD03523 34 19 30JANO7 2 2 CD30544 UN 19MAY98 DPSG CD03523 35 19 31JANO7 1 2 072209 PN 79 Maintenance 1000 hours 1 year 3 Check and adjust valve clearance to specifications according to following procedures Specification Valve clearance engine Cold IALAK O aaa a AEN 0 35 mm 0 014 in EXE danna 0 45 mm 0 018 in 9 gt a NOTE If rocker arm is equipped with adjusting screw z and jam nut A tighten jam nut to 27 N m 20 lb ft after adjusting valve clearance QO 4 Reinstall rocker arm cover and crankcase vent tube j e 3 Cylinder Engine NOTE Firing order is 1 2 3 a Lock No 1 piston at TDC compression stroke D b Adjust valve clearance on No 1 and 2 exhaust N valves and No 1 and 3 intake valves O c Rotate flywheel 360 Lock No 1 piston at TDC S exhaust stroke E dl d Adjust valve clearance on No 3 exhaust valve and 7 No 2 intake valve S e 4 Cylinder Engine t NOTE Firing order is 1 3 4 2 a Lock No 1 piston at TDC compression stroke B b Adjust valve clearance on No 1 and 3 exhaust valves and No 1 and 2 intake valves c Rotate flywheel 360 Lock No 4 piston at TDC compression stroke C d Adjust valve clearance on No 2 and 4 e
276. urglass v If the motor is not fitted with an air preheating system or once the preheating delay has elapsed the engine starts up start of a cycle comprising 3 attempts to start up the engine v The following screen appears The number of successive and automatic starting attempts is limited to 3 Note the LED flashes as soon as the START button is pressed and continues to flash until the frequency stabilises if a measurements card has not been inserted and until the frequency and voltage stabilise if a measurements card has been inserted Following stabilisation the LED light comes on continuously 55 290 EN 6 2 3 Switching off O trigger the circuit breaker located at the base of the centre console Let the motor run under no load for 1 to 2 minutes to allow it to cool press the STOP button to stop the generating set O switch off the MICS Nexys module by switching the key to OFF without forcing it 6 2 4 Alarms and faults OM Soh The appearance of a fault or an alarm causes the following El wl T wl screen to be displayed one or more pictograms or a fault A el ya ATI code along with the SOS message are displayed ay MA AUT A o A A O O The user can access the following screens by pressing the key The fault or alarm screen will disappear once the fault or alarm has been removed Only one fault is displayed on this screen the fault which caused the generating set to stop If one o
277. ust 300 Series Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 60 19 22JANO7 1 1 3000 Hours of operation o Engine oil drain o Air intake system check o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean Number of hours Observation Dealer or distributor stamp Job done by DPSG CD03523 61 19 22JANO7 1 1 072209 02 4 PN 13 111 290 Maintenance Records 3500 Hours of operation o Engine oil drain o Engine oil filter replace o Fuel filter replace manual tensioner o Valve clearance adjust 300 Series o Belt check tension and wear 300 Series and POWERTech with Number of hours Job done by Observation Dealer or distributor stamp 4000 Hours of operation DPSG CD03523 62 19 22JANO7 1 1 o Engine oil drain o Engine oil filter replace o Fuel filter replace o Check belt and tensioning system o Crankcase vent tube clean o Cooling system drain and flush if COOL GARD is not used o Valve clearance adjust POWERTech o Air intake system check o Vibration damper check Number of hours Job done by Observation Dealer or distributor stamp DPSG CD03523 63 19 22JANO7 1 1 02 5 112 290 072209 PN 14 Maintenance Records 4500 Hours of operation o E
278. vailable and can systems when needed be selected during setup of gauge Press the menu key B to access the various engine The diagnostic gauge includes a graphical backlit Liquid functions in sequence The displays can be selected as Crystal Display LCD screen The display can show either customary English or metric units The following either a single parameter or a quadrant display showing menu of engine parameters can be displayed on the four parameters simultaneously The diagnostic gauge diagnostic gauge window uses two arrow keys C for scrolling through the engine parameter list and viewing the menu list and an enter key D for selecting highlighted items The red E and amber F lights are used to signal active trouble code received by the diagnostic gauge e Engine hours e Engine rpm e System voltage e Percent engine load at the current rpm CD03523 000018B 19 22JANO7 1 1 Main Menu Navigation 1000 RPM ENG APM NOTE The engine does not need to be running to navigate the diagnostic gauge screens If engine 14 2 57 PSI start up is desired See Starting The Engine All BAT VOLT bicis of the engine values illustrated on the diagnostic gauge indicate the engine is running RG13159 UN 26SEP03 1 Turn the key switch to the ON position Starting at the single or four engine parameter display press the Menu Key Menu key Continued on next page OURGP 11 00000A9 19 03SEP03 1 5 072209 15 1 PN 38 136 2
279. will enable you to change the oil more frequently which will tend to be choked with unburnt particles and contaminated with fuel Adding a load bench is generally used to limit low load phases and obtain the periodic full loads necessary to unchoke the engine Finally when operating under load we advise vigilance towards the oil breather circuit and more particularly towards engines which have the crankcase vent connected to the turbocharger inlet risk of oil or oil vapour absorption and accelerated engine speed On load tests It is recommended to conduct an on load test on the generating set monthly for a period of around 1 hour after stabilisation of the parameters The load must be greater than 50 of nominal power ideally 80 to ensure unchoking of the engine and to obtain a decent picture of the generating set operation Off load test no load This test is not recommended it must not exceed 10 minutes and must not be repeated without a monthly on load test This test only allows you to check for correct engine start up It does not allow you to check that the generating set is working properly 86 290 EN 8 Starter batteries A DANGER Risk of explosion or fire oxygen and hydrogen present The battery must never be exposed to any naked flames or sparks Risk of sparks forming and an explosion When fitting the battery never invert the polarities Do not short the battery terminals with a tool or other metal
280. xhaust valves and No 3 and 4 intake valves A Front of engine D No 1 Piston at TDC B Exhaust valve compression stroke C Intake valve E No 1 Piston at TDC exhaust x stroke 5 i A Front of engine E Exhaust valve 7 B No 1 Piston at TDC I Intake valve 2 compression stroke z C No 4 Piston at TDC O compression stroke S O l l DPSG CD03523 35 19 31JANO7 2 2 072209 35 4 PN 80 178 290 Maintenance 1000 hours 1 year Pressure testing cooling system Test radiador cap CAUTION Explosive release of fluids from pressurized cooling system can cause serious burns Shut off engines Only remove filler cap when cool enough to touch with bare hands Slowly loosen cap to first stop to relieve pressure before removing completely Test Radiator Cap 1 Remove radiator cap and attach to DO5104ST tester as shown Pressurize cap to specification listed Gauge should hold pressure for 10 seconds within the normal range if cap is acceptable If gauge does not hold pressure replace radiator cap Specification Radiator Cap CalibratioN PreSSure cccccccessseeeeeeeeeeeeeeeeeeeeeenenees 70 kPa 0 7 bar 10 psi for 10 seconds minimum 3 Remove the cap from gauge turn it 180 and retest cap to confirm measurement Test Cooling System NOTE Engine should be warmed up to test overall cooling system 35 5 RG6557 UN 20JAN93 RG6558 UN 20JAN93 Test cooling system 1 All

User and maintenance manual for generating sets

Contents

Download Pdf Manuals

Related Search

Related Contents