pMIB/V5-His A, B, and C Vector Kit
Contents
1. Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan K K Invitrogen Ltd 5791 Van Allen Way Nihonbashi Hama Cho Park Bldg 4F Inchinnan Business Park Carlsbad CA 92008 USA 2 35 4 Hama Cho Nihonbashi 3 Fountain Drive Tel 1 760 603 7200 Tel 81 3 3663 7972 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Fax 81 3 3663 8242 Tel 44 0 141 814 6100 Fax 1 760 602 6500 E mail jpinfo invitrogen com Tech Fax 44 0 141 814 6117 E mail E mail tech_service invitrogen com eurotech invitrogen com MSDS Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product CofAs are available on our website at www invitrogen com support and are searchable by product lot number which is printed on each box continued on next page 30 Technical Service continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service please contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to the specifications stated on the certificate of2. Hind Ill Asp718 von E mn BspH 1 CAT ORF bases 691 1347 V5 epitope bases 1414 1455 Polyhistidine 6xHis region bases 1465 1482 OplE2 Reverse priming site bases 1492 1517 OpIE2 polyadenylation sequence bases 1500 1629 pUC origin bases 1698 2371 complementary strand OplE1 promoter bases 2447 2735 EM7 promoter bases 2736 2802 Blasticidin resistance gene bsd bases 2803 3201 Ampicillin resistance gene bla bases 3321 4181 26 OpIE2 Promoter Description 61 121 181 241 301 361 421 481 541 The OpIE2 promoter has been analyzed by deletion analysis using a CAT reporter in both Lymantria dispar LD652Y and Spodoptera frugiperda Sf9 cells Expression in Sf9 cells was much higher than in LD652Y cells Deletion analysis revealed that sequence up to 275 base pairs from the start of transcription is necessary for maximal expression Theilmann and Stewart 1992 Additional sequence beyond 275 may broaden the host range expression of this plasmid to other insect cell lines Tom Pfeifer personal communication In addition an 18 bp element appears to be required for expression This 18 bp element is repeated almost completely in three different locations and partially at six other locations These are marked in the figure below Elimination of the three major 18 bp elements reduces expression to basal levels Theilmann and Stewart 1992 The function of these elements is not kn
3. protein fusion migrates around 34 kDa on an SDS PAGE gel continued on next page 14 Transient Expression in Insect Cells continued Troubleshooting Cells Growing Too Slowly Or Not At All For troubleshooting guidelines regarding cell culture refer to the Insect Cell Lines manual This manual may be downloaded from our Web site www invitrogen com Low Transfection Efficiency If the transfection efficiencies are too low check the following Impure DNA Transfected cells will appear unhealthy when compared to the negative control DNA only no lipids Use clean pure DNA isolated by resin based DNA isolation kits e g S N A P MidiPrep Kit Poor Cell Viability Be sure to test cells for viability and make sure you use log phase cells Refer to the Insect Cell Lines manual to troubleshoot cell culture Method of Transfection Optimize transfection Low or No Secreted Protein Expression Gene not cloned in frame with the N terminal HBM secretion signal If it is not in frame with the N terminal secretion signal the recombinant protein may be poorly expressed or not expressed at all Re design your cloning strategy to make sure that you clone your gene in frame with the HBM secretion signal Optimize expression If you ve tried a time course to optimize expression try switching cell lines Proteins may express better in a different cell line Proteins are degraded Include protease inhibitors in the medium
4. Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Tessier D C Thomas D Y Khouri H E Laliberte F and Vernet T 1991 Enhanced Secretion from Insect Cells of a Foreign Protein Fused to the Honeybee Melittin Signal Peptide Gene 98 177 183 Theilmann D A and Stewart S 1991 Identification and Characterization of the IE 1 Gene of Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 180 492 508 Theilmann D A and Stewart S 1992 Molecular Analysis of the trans Activating IE 2 Gene of Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 187 84 96 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Yamaguchi I Shibata H Seto H and Misato T 1975 Isolation and Purification of Blasticidin S Deaminase from Aspergillus terreus J Antibiotics 28 7 14 2000 2008 2010 Invitrogen Corporation All rights reserved 35 invitrogen Corporate Headquarters Invitrogen Corporation 5791
5. Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the Expression Kit or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the Expression Kit to a third party without written notification to and written approval from Invitrogen You may not assign sub license rent lease or otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Invitrogen and RCT Inquiries for commercial use should be directed to Research Corporation Technologies 101 North Wilmot Road Suite 600 Tucson AZ 85711 3335 Tel 1 520 748 4400 Fax 1 520 748 0025 33 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Blissard G W and Rohrmann G F 1989 Location Sequence Transcriptional Mapping and Temporal Expression of the gp64 Envelope Glycoprotein Gene of the Orgyia pseudotsugata Multicapsid Nuclear Polyhedrosis Virus Virology 170 537 555 Coligan J E Dunn B M Ploegh H L Speicher D W and Wingfield P T 1998 Current Protocols in Protein Science New York John Wiley Deutscher M P 1990 Guide to Protein Purification In Methods in Enz
6. Tris HCI pH 6 8 2 5 ml Glycerol 100 2 ml P mercaptoethanol 0 4 ml Bromophenol Blue 0 02 g SDS 0 4 g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed 23 pMIB V5 His Map and Features Map of The figure below summarizes the features of the pMIB V5 His A B and C pMIB V5 His vectors For a more detailed explanation of each feature see the next page The 24 complete sequences of pMIB V5 His A B and C are available for downloading from our Web site www invitrogen com or from Technical Service see page 30 ane 55 ES f sxs Sph Hind III Asp718 Kpn Sac BamH Spe EcoR I EcoR V Xho BstE II BspH 1 Comments for pMIB V5 His A 3596 nucleotides OplE2 promoter bases 1 549 OpIE2 Forward priming site bases 511 530 Frame dependent variations Honeybee melittin secretion signal bases 565 627 Multiple cloning site bases 629 721 V5 epitope bases 734 775 Polyhistidine 6xHis region bases 785 802 OplE2 Reverse priming site bases 812 837 OplE2 polyadenylation sequence bases 820 949 pUC origin bases 1018 1691 complementary strand OplE1 promoter bases 1765 2056 EM7 promoter bases 2056 2122 Blasticidin resistance gene bsd bases 2123 2521 Ampicillin resistance gene bla bases 2641 3501 continued on next page pMIB V5 His Map and Features continued Features of pMIB V5 His The features of pMIB V5 His A B and C
7. analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 31 Purchaser Notification Limited Use Label License No 22 Vectors and Clones Containing Sequences Coding for Histidine Hexamer Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker L
8. are described below All features have been functionally tested The multiple cloning site has been tested by restriction analysis Features Function OpIE2 promoter Provides constitutive expression of the gene of interest in lepidopteran insect cells Theilmann and Stewart 1992 OpIE2 Forward priming site Allows sequencing of the insert from the 5 end Honeybee melittin secretion signal HBM Directs secreted expression of the gene of interest Tessier et al 1991 Multiple cloning site Allows insertion of the gene of interest for secreted expression V5 epitope Allows detection of your recombinant protein Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr with the Anti V5 Antibody Catalog no R960 25 or Anti V5 HRP Antibody Catalog no R961 25 Southern et al 1991 Polyhistidine 6xHis tag Allows purification of your recombinant protein on metal chelating resin such as ProBond In addition the C terminal 6xHis tag is the epitope for the Anti His C term Antibody Catalog no R930 25 and the Anti His C term HRP Antibody Catalog no R931 25 Lindner et al 1997 OpIE2 Reverse priming site Allows sequencing of the insert from the 3 end OpIE2 polyadenylation sequence Allows efficient transcription termination and polyadenylation of mRNA Theilmann and Stewart 1992 pUC pMB1 derived origin Allows high copy replication and maint
9. labeled cryovial 4 Freeze the tube in liquid nitrogen or dry ice ethanol bath and store at 80 C Transient Expression in Insect Cells Introduction Plasmid Preparation Method of Transfection Control of Plasmid Quality Before Starting 10 Once you have cloned your gene of interest into pMIB V5 His you are ready to transfect your construct into Sf9 Sf21 or High Five cells using lipid mediated transfection and test for expression of your protein Plasmid DNA for transfection into insect cells must be very pure and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or other resin based DNA purification systems The PureLink HQ Mini Plasmid Purification Kit is a small scale plasmid isolation kit that isolates 10 15 ug of plasmid DNA from 10 15 ml of bacterial culture Plasmid can be used directly for transfection of insect cells We recommend lipid mediated transfection with Cellfectin Reagent Note that other lipids may be substituted although transfection conditions may have to be optimized Expected Transfection Efficiency using Cellfectin Reagent e 40 60 for Sf9 or Sf21 cells e 40 60 for High Five cells Note Other transfection methods e g calcium phosphate and electropora
10. pages 24 25 Start of transcription gt TATA Box OpIE2 Forward priming site l l l TCGCGCCTAT AAATACAGCC CGCAACGATC TGGTAAACAC AGTTGAACAG CATCTGTTCG AATTTAAAGC Honeybee melittin secretion signal r TACC ATG AAA TTC TTA GTC AAC GTT GCC CTT GTT TTT ATG GTC GTA TAC ATT TCT Met Lys Phe Leu Val Asn Val Ala Leu Val Phe Met Val Val Tyr Ile Ser Sph Hind I Asp718 Kpn Sac Bam Spe EcoR TAC ATC TAT GCC GGC ATGCTAAGCT TGGTACCGAG CTCGGATCCA CTAGTCCAGT GTGGTGGAAT A m Tyr Ile Tyr Alai Melittin Cleavage Site EcoR V Not Xho l Xba Sac ll fi fi me TCTGCAGATA TCCAGCACAG TGGCGGCCGC TCGAGTCTAG AGGGCCCGCG GTTCGAA GGT AAG CCT Gly Lys Pro V5 epitope Polyhistidine 6xHis region l ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His His OpIE2 Reverse priming site CAC CAT TGA G TTTATCTGAC TAAATCTTAG TITGTATTGT CATGTTTTAA TACAATATGT His His OpIE2 polyadenylation signal AR TATGTTTAAA TATGTTTTTA ATAAATTTTA TAAAATAATT TCAACTTTTA TTGTAACAAC ATTGTCCATT 3 untranslated region of OplE2 TACACACTCC TTTCAAGCGC GTGGGATCGA TGCTCACTCA continued on next page Cloning into pMIB V5 His A B and C continued Multiple Cloning Below is the multiple cloning site for pMIB V5 His C The TATA box start of Site of pMIB V5 transcription and the polyadenyla
11. the protocol for your use You may have to empirically determine the optimal conditions for transfection e Do not linearize the plasmid prior to transfection Linearizing the plasmid appears to decrease protein expression The reason for this is not known continued on next page 11 Transient Expression in Insect Cells continued Transfection Plasmid DNA and Cellfectin Reagent are mixed together in the appropriate Procedure medium see below and incubated with freshly seeded insect cells The amount of cells liposomes and plasmid DNA has been optimized for 60 mm culture plates It is important that you optimize transfection conditions if you use plates or flasks other than 60 mm plates Note If you are using serum free medium we recommend using Sf 900 II SFM to transfect Sf9 cells and Express Five SFM to transfect High Five cells If you are using Grace s Medium be sure to use Grace s Medium without supplements The proteins in the FBS and supplements will interfere with the liposomes causing the transfection efficiency to decrease 1 To prepare each transfection mixture use a 1 5 ml microcentrifuge tube Add the following reagents Grace s Insect Media Sf9 OR Appropriate serum free medium 1 ml pMIB V5 His plasmid or construct 1 ug ulin TE pH 8 1 10 ul Cellfectin Reagent mix well before use and always add last 20 ul Gently mix the transfection mixture for 10 seconds Incubate the transfect
12. when harvesting to prevent degradation of recombinant protein Poor secretion If the protein is normally localized to the nucleus addition of the secretion signal to force the protein into the secretory pathway may result in incorrect folding and retention in the cell You may detect expression of your protein in the cellular fraction using the Anti V5 antibodies or the Anti His C term antibodies see page vi for ordering information 15 Selecting Stable Cell Lines Introduction Nature of Stable Cell Lines Before Starting Effect of Blasticidin on Sensitive and Resistant Cells Suggested Blasticidin Concentrations Determining Blasticidin Sensitivity 16 Once you have demonstrated that your protein is expressed in Sf9 Sf21 or High Five cells you may wish to create stable expression cell lines for long term storage and large scale production of the desired protein Note that stable cell lines are created by multiple copy integration of the vector Amplification as is the case with calcium phosphate transfection and hygromycin resistance in Drosophila is generally not observed Review the information on blasticidin S on page 29 Prepare a stock solution of blasticidin S as described Cytopathic effects should be visible within 3 5 days depending on the concentration of blasticidin in the medium Sensitive cells will enlarge and become filled with vesicles The outer membrane will show signs of b
13. 100 pg ml ampicillin or Low Salt LB agar plates containing 100 pg ml blasticidin see below Once you have obtained ampicillin or blasticidin resistant colonies pick 10 transformants and screen for the presence and orientation of your insert To facilitate selection of blasticidin resistant E coli the salt concentration of the medium must remain low lt 90 mM and the pH must be 7 0 Prepare Low Salt LB broth and plates using the recipe in the Appendix page 22 Failure to lower the salt content of your LB medium will result in non selection due to inhibition of the drug We recommend that you sequence your construct to confirm that your gene is fused in frame with the N terminal HBM secretion signal and the C terminal V5 epitope and the polyhistidine tag Use the OpIE2 Forward and Reverse sequencing primers included in your kit or a primer to your gene of interest to sequence your insert Note Resuspend each primer in 20 ul sterile water to prepare a 0 1 ug ul stock solution continued on next page Transforming E coli continued Long Term Storage Once you have confirmed that you have the correct clone prepare a glycerol stock for long term storage It is also a good idea to keep a stock of plasmid DNA at 20 C To prepare a glycerol stock 1 Grow the E coli strain containing the plasmid overnight 2 Combine 0 85 ml of the overnight culture with 0 15 ml of sterile glycerol 3 Vortex and transfer to a
14. 34 111 Important Information Shipping Storage Kit Contents Product Qualification Primer Sequences Reagents Supplied by the User iv The pMIB V5 His Vector Kit is shipped on wet ice Upon receipt store the kit 20 C The following items are supplied with each pMIB V5 His Vector Kit Store at 20 C Item Composition Volume pMIB V5 His A B and C 20 ug each at 0 5 pg pl in TE 40 ul buffer pH 8 0 10 mM Tris HCl 1mM EDTA pH 8 0 pMIB V5 His CAT 20 ug at 0 5 ug ul in TE buffer 40 pl pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 OpIE2 Forward Sequencing Primer Lyophilized in TE pH 8 0 2 ug OpIE2 Reverse Sequencing Primer Lyophilized in TE pH 8 0 2 ug The Certificate of Analysis provides detailed quality control information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box The sequence of each primer is provided below Primer Sequence pMoles Supplied OpIE2 Forward 5 CGCAACGATCTGGTAAACAC 3 329 OpIE2 Reverse 5 GACAATACAAACTAAGATITAGTCAG 3 250 Be sure to have the following reagents and equipment on hand before starting experiments e Express Five Serum Free Medium recommended e Grace s medium optional e Fetal Bovine Serum FBS optional e 1 5 10 and 25 ml sterile p
15. 5 C before adding the blasticidin to 100 g ml final concentration 4 Store plates at 4 C in the dark Plates containing blasticidin are stable for up to 2 weeks 1 Prepare a 0 4 stock solution of trypan blue in phosphate buffered saline pH 74 2 Mix 0 1 ml of trypan blue solution with 1 ml of cells and examine under a microscope at low magnification 3 Dead cells will take up trypan blue while live cells will exclude it Count live cells versus dead cells Cell viability should be at least 95 99 for healthy log phase cultures continued on next page Recipes continued Cell Lysis Buffer 1X PBS 2X SDS PAGE Sample Buffer 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 This solution can be prepared from the following common stock solutions For 100 ml combine 1M Tris base 5 ml 5 M NaCl 3 ml Nonidet P 40 1ml 2 Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl 3 Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 M leupeptin and 0 1 uM aprotinin before use 137 mM NaCl 2 7 mM KCl 10 mM Na HPO 1 8 mM KH PO 1 Dissolve 8 g NaCl 0 2 g KCI 1 44 g Na HPO 0 24 g KH PO in 800 ml deionized water 2 Adjust pH to 7 4 with concentrated HCl Bring the volume to 1 liter You may wish to filter sterilize or autoclave the solution to increase shelf life 2 1 Combine the following reagents 0 5 M
16. McKnight 1989 and an element R4 that is homologous to the proposed binding site of the Drosophila transcription factor Adf 1 England et al 1990 Three other Adf 1 like elements are found at three other distal locations These elements are referred to as R1 R2 R3 and R4 R3 and R4 are marked in the figure below R1 and R2 are not present in pIB V5 His but do not appear to be important for expression in Sf9 cells The function of these elements has not been determined Primer extension experiments revealed that transcription initiates from the A in the CAGT sequence This CAGT sequence motif has been shown to be conserved in a number of early genes Blissard and Rohrmann 1989 R3 TTGGTCATGC GAAACACGCA CGGCGCGCGC ACGCAGCTTA GCACAAACGC GTCGTTGCAC m GCGCCCACCG CTAACCGCAG GCCAATCGGT CGGCCGGCCT CATATCCGCT CACCAGCCGC R4 GTCCTATCGG GCGCGGCTTC CGCGCCCATT TTGAATAAAT AAACGATAAC GCCGTTGGTG TATA HA GCGTGAGGCA TGTAAAAGGT TACATCATTA TCTTGTTCGC CATCCGGTTG GTATAAATAG Start of transcription ACGTTCATGT CGGGATCTGC TGGTTTTTGT TTCAGTTGCA AGTTGGCTGC GGCGCGCGCA GCACCTTTGC CGGGCTGCAG CACGTGTTGA CAATTAATCA TCGGCATAGT Blasticidin S Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions Merck Index 12 1350 NH2 MW 458 9 Soy Formula Ci7H26NgOs Hcl 1 O N HOOC O de dl NH NH2 O Always wear gloves mask goggles and protective clo
17. Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
18. aminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys Acta 1219 653 659 Kimura M and Yamaguchi I 1996 Recent Development in the Use of Blasticidin S a Microbial Fungicide as a Useful Reagent in Molecular Biology Pesticide Biochem Physiol 56 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Mann S G and King L A 1989 Efficient Transfection of Insect Cells with Baculovirus DNA Using Electroporation J Gen Virol 70 3501 3505 continued on next page 34 References continued Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression BioTechniques 5 444 447 Pfeifer T A Hegedus D D Grigliatti T A and Theilmann D A 1997 Baculovirus Immediate Early Promoter Mediated Expression of the Zeocin Resistance Gene for Use as a Dominant Selectable Marker in Dipteran and Lepidopteran Insect Cell Lines Gene 188 183 190 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Southern J A Young D F Heaney F
19. as an exclusive license to sell the Expression Kit to scientists for academic research or one year commercial evaluation only under the terms described below Use of the Expression Kit for any Commercial Purpose as defined below other than evaluation requires the user to obtain a commercial license as detailed below Before using the Expression Kit please read the terms and conditions set forth below Your use of the Expression Kit shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the Expression Kit pursuant to these terms and conditions please contact Invitrogen s Technical Services to return the unused and unopened Expression Kit for a full credit Otherwise please complete the Product User Registration Card and return it to Invitrogen Invitrogen grants you a non exclusive license to use the enclosed Expression Kit for academic research or for commercial evaluation purposes only The Expression Kit is being transferred to you in furtherance of and reliance on such license You may not use the Expression Kit or the materials contained therein for any Commercial Purpose without a license for such purpose from Research Corporation Technologies RCT If you are a commercial entity your right to use the Expression Kit expires after one year Any commercial entity that wishes to use the Expression Kit beyond this one year period must obtain a commercial license from RCT Commercial entities w
20. e C terminal tag containing the V5 epitope and 6xHis tag will increase the Note size of your protein by 3 kDa Note that any additional amino acids between your protein and the tags are not included in this molecular weight calculation Preparing Cell Before starting prepare Cell Lysis Buffer A recipe is provided on page 23 for your Lysates convenience but other recipes are suitable 1 Prepare an SDS PAGE gel that will resolve your expected recombinant protein 2 Remove the medium from each plate and prepare samples as detailed above 3 Wash the cells once with 1X PBS see page 23 for a recipe Add 100 ul Cell Lysis Buffer and slough or scrape the cells into a microcentrifuge tube Vortex the cells to ensure they are completely lysed 4 Centrifuge at maximum speed for 1 2 minutes to pellet nuclei and cell membranes Transfer the supernatant to a new tube 5 Assay the lysate for protein concentration You may use the Bradford Lowry or BCA assays Pierce 6 Mix 30 ul of lysate with 30 ul of 2X SDS PAGE sample buffer Proceed with Steps 5 and 6 as detailed above Polyacrylamide To facilitate separation and visualization of your recombinant protein by Gel polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Tris Electrophoresis Glycine polyacrylamide gels are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more informat
21. e R960 25 Anti V5 HRP Antibody derived from the P and V R961 25 i r proteins of the paramyxovirus Anti V5 AP Antibody SV5 Southern et al 1991 R962 25 GKPIPNPLLGLDST Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP polyhistidine 6xHis tag R931 25 Antibody requires the free carboxyl group for detection Lindner et al 1997 Anti His C term AP R932 25 Antibody HHHHHH COOH The metal binding domain encoded by the polyhistidine tag allows simple easy purification of your recombinant protein by Immobilized Metal Affinity TM Chromatography IMAC using Invitrogen s ProBond Resin see below To purify proteins expressed using the InsectSelect TM System the ProBond Purification System or the ProBond resin in bulk are available separately See the table below for ordering information 10 ml polypropylene columns Product Quantity Catalog no ProBond Metal Binding Resin 50 ml R801 01 precharged resin provided as a 50 slurry in 150 ml R801 15 20 ethanol ProBond Purification System 6 purifications K850 01 Purification Columns 50 R640 50 Overview Introduction Description of System Description of Promoters Introduction The InsectSelect technology facilitates constitutive stable or transient expression of recombinant proteins in insect cell lines pMIB V5 His A B and C are 3 6 kb vectors that use the InsectS
22. e to the binding buffer prior to addition of the protein mixture to the column Addition of imidazole may help to reduce background contamination by preventing proteins with low specificity from binding to the metal chelating resin To scale up insect cell culture refer to the Insect Cell Lines manual 21 Recipes LB Luria Bertani Medium and Plates Low Salt LB Medium with Blasticidin Trypan Blue Exclusion Assay 22 Appendix Composition 10 g Tryptone 5 g Yeast Extract 10 g NaCl pH 7 0 1 Combine the dry reagents above and add deionized distilled water to 950 ml 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 10 g Tryptone 5 g NaCl 5 g Yeast Extract 1 Combine the dry reagents above and add deionized distilled water to 950 ml 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter For plates add 15 g L agar before autoclaving 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 5
23. elect technology to allow expression and secretion of your protein of interest in insect cell lines The pMIB V5 His vector contains the following features e OplIE2 promoter for high level constitutive expression of the gene of interest Theilmann and Stewart 1992 e Honeybee melittin secretion signal HBM for directing secreted expression of the gene of interest Tessier et al 1991 e OpIE1 promoter for expression of the blasticidin resistance gene see next bullet Theilmann and Stewart 1991 e Blasticidin resistance gene for selection of stable cell lines Takeuchi et al 1958 Yamaguchi et al 1965 e EM7 promoter for expression of ampicillin and blasticidin resistance in E coli e Ampicillin resistance gene for selection of transformants in E coli e C terminal peptide containing the V5 epitope and 6xHis tag for detection and purification of your protein of interest if desired e Three reading frames to facilitate in frame cloning with the C terminal peptide The control plasmid pMIB V5 His CAT is included for use as a positive control for expression and secretion The gene of interest is cloned into pMIB V5 His and transfected into Sf9 or High Five cells using lipid mediated transfection After transfection cells can be assayed for secreted expression of the gene of interest Once you have confirmed that your gene expresses you can select for a stable polyclonal population or stable clonal cell lines using bla
24. enance in E coli OpIE1 promoter Provides constitutive expression of the blasticidin resistance gene in lepidopteran insect cells Theilmann and Stewart 1991 EM7 promoter Allows efficient expression of the blasticidin and ampicillin resistance genes in E coli Blasticidin resistance gene bsd Allows generation of stable insect cell lines Kimura et al 1994 Ampicillin resistance gene bla Allows selection of transformants in E coli Note The native promoter has been removed Transcription is assumed to start from the EM7 promoter 25 pMIB V5 His CAT Map Description Map Comments for pMIB V5 His CAT 4276 nucleotides OplE2 promoter bases 1 549 OplE2 Forward priming site bases 511 530 Honeybee melittin secretion signal bases 565 627 pMIB V5 His CAT is a 4276 bp control vector expressing chloramphenicol acetyltrans ferase CAT The plasmid was constructed by cloning a Hind III Xho I fragment containing the CAT gene into pMIB V5 His B In pMIB V5 His CAT CAT is expressed as a fusion to the V5 epitope and 6xHis tag The molecular weight of the protein is 34 kDa The figure below summarizes the features of the pMIB V5 His CAT vector The complete nucleotide sequence for pMIB V5 His CAT is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 30 gt coco On OBO 7 023 V5 epitope ots BI o ER on Eo kon
25. from Invitrogen These TM kits include InsectSelect vectors with different antibiotic resistance genes In addition the pIZT V5 His Vector Kit enables expression of a gene of interest and a cycle 3 GFP Zeocin fusion gene This allows both visual monitoring of transfection efficiency and generation of a stable cell line For more information about the various InsectSelect vector kits available from Invitrogen visit our World Wide Web site www invitrogen com or call Technical Service see page 30 See the table below for ordering information Product Catalog no pIB V5 His TOPO TA Expression Kit K890 01 pIB V5 His Vector Kit V8020 01 pIZ V5 His Vector Kit V8000 01 pIZT V5 His Vector Kit V8010 01 continued on next page Accessory Products continued Detection of Recombinant Proteins Purification of Recombinant Protein vi Expression of your recombinant fusion protein can be detected using an antibody to the appropriate epitope The table below describes the antibodies available for detection of C terminal fusion proteins expressed using pMIB V5 His Horseradish peroxidase HRP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods Fifty microliters of each antibody is supplied which is sufficient for 25 Westerns Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitop
26. iently in the InsectSelect System than in baculovirus systems Jarvis et al 1996 To date reported expression levels range from 1 2 g ml human IL 6 Invitrogen to 8 10 g ml human melanotransferrin Hegedus et al 1999 Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes BSD from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a non toxic deaminohydroxy Kimura and Yamaguchi 1996 Yamaguchi et al 1975 The table below describes the general steps needed to clone and express your gene of interest For more details refer to the pages indicated Information on how to culture insect cell lines may be found in our Insect Cell Lines manual This manual may be downloaded from our Web site www invitrogen com Ste Action Page p 1 Establish culture of Sf9 Sf21 or High Five cells 3 2 Develop a cloning strategy to ligate your gene of interest into 4 7 pMIB V5 His A B or C in frame with the honeybee melittin secretion signal and the C terminal peptide encoding the V5 epitope and the polyhistidine 6xHis tag if desired 3 Transform your ligation reactions into a recA endA E c
27. ify purification As you expand your stable cell line you can maintain the concentration of blasticidin at 10 pg ml Cells can be switched from complete TNM FH to serum free medium during passage Refer to the Insect Cell Lines manual for more information on how to adapt cells to different medium If you plan to use a metal chelating resin such as ProBond to purify your secreted protein from serum free medium note that adding serum free medium directly to the column will strip the nickel ions from the resin See the information below in Purification of 6xHis tagged Proteins from Medium for a general recommendation to address this issue Many protocols are suitable for purifying proteins from the medium The choice of protocol depends on the nature of the protein being purified Note that the culture volume needed to purify sufficient quantities of protein is dependent on the expression level of your protein and the method of detection To purify 6xHis tagged proteins from the medium see below To purify 6xHis tagged recombinant proteins from the culture medium we recommend that you perform dialysis or ion exchange chromatography prior to affinity chromatography on metal chelating resins Dialysis allows e Removal of media components that strip Ni from metal chelating resins Ion exchange chromatography allows e Removal of media components that strip Ni from metal chelating resins e Concentration of your sam
28. ill be contacted by RCT during this one year period regarding their desire to obtain a commercial license You may terminate your use of the Expression Kit at any time by destroying all InsectSelect expression products in your control Your right to use the Expression Kit will also terminate automatically if you fail to comply with the terms and conditions set forth herein You shall upon such termination of your rights destroy all Expression Kits in your control and notify Invitrogen of such in writing Commercial Purpose include Any use of Expression Products in a Commercial Product Any use of Expression Products in the manufacture of a Commercial Product Any sale of Expression Products Any use other than evaluation of Expression products or the Expression Kit to facilitate or advance research or development of a Commercial Product and Any use other than evaluation of Expression Products or the Expression Kit to facilitate or advance any research or development program the results of which will be applied to the development of Commercial Products Expression Products means products expressed with the Expression Kit or with the use of any vectors or host strains in the Expression Kit Commercial Product means any product intended for commercial use Access to the Expression Kit must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research or evaluation
29. imited Use Label License No 68 InsectSelect Technology 32 This product is licensed under U S and foreign patents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzer land and is provided only for use in research Information about licenses for commercial use is available from OIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Blasticidin and the blasticidin resistance gene bsd are sold under patent license and may be used for research purposes only Inquiries for commercial use should be directed to Kaken Pharmaceutical Company Ltd Bunkyo Green Court Center Office Building 19 20 Fl 28 8 Honkomagome 2 chome Bunkyo ku Tokyo 113 8650 Japan Tel 81 3 5977 5008 Fax 81 3 5977 5008 The InsectSelect System the Expression Kit was developed into an expression system by scientists at the University of British Columbia UBC for high level expression of recombinant proteins The Expression Kit also incorporates use of the Zeocin selection marker that is licensed to Invitrogen Components of the InsectSelect System are covered by one or more U S patents or patent applications and corresponding foreign patents or patent applications owned and or licensed by UBC and others continued on next page Purchaser Notification continued Limited Use Label License No 68 InsectSelect Technology continued Invitrogen Corporation Invitrogen h
30. ing 50 100 ug ml ampicillin or Low Salt LB agar plates containing 100 ug ml blasticidin see recipe page 22 3 Prepare a glycerol stock from each transformant containing plasmid for long term storage see page 9 pMIB V5 His is a terminal fusion vector To express your gene as a recombinant fusion protein you must clone your gene in frame with the N terminal HBM secretion signal If you wish to include the C terminal peptide for detection with either the V5 or His C term antibodies or purification using the polyhistidine 6xHis tag you must also clone your gene in frame with the C terminal peptide The vector is supplied in three reading frames to facilitate cloning Refer to the diagrams on pages 5 7 to develop a cloning strategy Be sure that your gene does not contain a stop codon upstream of the C terminal peptide If you do not wish to include the C terminal peptide include the native stop codon for your gene of interest The HBM secretion signal is processed from your recombinant protein by a signal peptidase directed cleavage after alanine21 in the signal sequence Tessier et al 1991 For the location of the melittin cleavage site refer to the diagrams on pages 5 7 Note that you will not obtain native protein following cleavage of the signal sequence because of the intervening sequences between the melittin cleavage site and the restriction site of interest in the multiple cloning site see diagrams on pages 5 7 For exam
31. invitrogen pMIB V5 His A B and C Vector Kit For the Selection of Transfected Cells and Stable Expression of Secreted Heterologous Proteins in Lepidopteran Insect Cell Lines Catalog no V8030 01 Version E 29 December 2010 25 0356 11 Table of Contents Important Information A a daba iv Accessory PLOGUCIS cities eaha saiia aaa E E RE E EE A T E EA TEE ladees ss Ea E ERA ORATE Eia REOR AENA v Introduction anal 1 OVNI Wisconsin ria 1 MeihodS 2 0 0 0 0 nn a 3 Cu lturing Insect Cells vsere sann Reale Ria lH cl lee 3 Cloning into pMIB V5 His A B and C uesunsssessnersnensensnnnnonnnnnnnnnnnsnonnnnnnnnnnnennnesnnesnnesnansnonsnonsnensnnnsennnnnnnnnn 4 Transforming Encolado 8 Tr nsient Expression in Insect Cells is sicvecsdssesessicissestystesceapsichdsbuckcsesvesseddsdyesshesbidepspascussouseacess cpehstenteaesesdanteasnbbens 10 Selecting Stable Cell LME i 4s locas us eee see i 16 Scale Up and Puritic ation oss set u antreten halen Geert ede ae heed ade deh ede 20 ADD ONGIX a a 22 RECIPES fen dazeh cet cee ctusbtu venue A E ban deen la la 22 PMIB V 5 His Map nd Fe tures seinen ah esah seen 24 PMIB V5 His CAT Mapa ater neues BE BER aan Ata 26 INIA aaa ann San REINER SSR Ang enkbanteine 27 OplEL Promoter u sa ee eel ee So Ae piel oe ee hides ae es 28 Blasticidin Sa BE Sie Ae SA a i i a 29 Technical Service a 22535 ss25 oc55ss teh ass RL ii 30 Purchaser Notification diles 32 Referenciales
32. ion about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or call Technical Service see page 30 continued on next page 13 Transient Expression in Insect Cells continued Western Analysis To detect expression of your recombinant fusion protein by Western blot analysis you may use the Anti V5 antibodies or the Anti His C term antibodies available from Invitrogen see page vi for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope or a polyhistidine 6xHis tag WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our Web site www invitrogen com or call Technical Service see page 30 Assay for CAT If you use pMIB V5 His CAT as a positive control vector you may assay for CAT expression using your method of choice Commercial kits to assay for CAT protein are available There is also a novel rapid radioactive assay Neumann et al 1987 CAT can be detected by Western blot using antibodies against the C terminal fusion tag or an antibody against CAT Catalog no R902 25 The CAT V5 His
33. ion mixture at room temperature for 15 minutes While the transfection mixture is incubating proceed to Step 4 4 Carefully remove the medium from the cells without disrupting the monolayer Note If you are using medium containing serum wash the cells by carefully adding 2 ml of fresh Grace s Insect Media without supplements or FBS This will remove trace amounts of serum that will decrease the efficiency of liposome transfection Remove all of the medium from the monolayer 5 Add the entire transfection mix dropwise into the 60 mm dish Repeat for all transfections Distribute the drops evenly over the monolayer This method reduces the chances of disturbing the monolayer 6 Incubate the dishes at room temperature for 4 hours on a side to side rocking platform Adjust speed to 2 side to side motions per minute Note If you do not have a rocker manually rock the dishes periodically 7 Following the 4 hour incubation period add 1 2 ml of complete TNM FH medium Sf9 cells or the appropriate serum free medium to each 60 mm dish place the dishes in a sealed plastic bag with moist paper towels to prevent evaporation and incubate at 27 C Note It is not necessary to remove the transfection solution as Cellfectin Reagent is not toxic to the cells If you are using a different lipid and observe loss of viability then remove the transfection solution after 4 hours rinse two times with medium and replace with 1 2 ml of fresh med
34. ipettes e Cryovials e Hemacytometer and Trypan Blue see recipe on page 22 e Table top centrifuge e 60mm tissue culture plates other flasks and plates may be used e Sterile microcentrifuge tubes 1 5 ml e Cell Lysis Buffer see recipe on page 23 e PBS see recipe on page 23 e Cloning cylinders optional e 96 well plates optional Accessory Products Introduction Products Available Separately Other InsectSelect Kits The products listed in this section are intended for use with the pMIB V5 His Vector kit For more information refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 The products listed below may be used with the pMIB V5 His Vector Kit and are available separately from Invitrogen Product Amount Catalog no Sf9 Cells frozen 1 ml vial 1 x 107 B825 01 cells ml Sf21 Cells frozen 1 ml vial 1 x 107 B821 01 cells ml High Five Cells frozen 1 ml vial 3 x 10 B855 02 cells ml Grace s Insect Cell Culture Medium 500 ml 11595 030 Unsupplemented Sf 900 II SFM 1 liter 10902 088 Express Five SFM 1 liter 10486 025 PureLink HQ Mini Plasmid 100 preps K2100 01 Purification Kit Cellfectin Reagent 1ml 10362 010 Blasticidin S 50 mg R210 01 Several other kits that allow you to clone and stably express your gene of interest using the InsectSelect technology are available
35. is OplE2 Reverse priming site 7 TGA GTTTATCTG ACTAAATCTT AGTTTGTATT GTCATGTTTT AATACAATAT GTTATGTTTA Xxx OplE2 polyadenylation signal rT AATATGTTTT TAATAAATTT TATAAAATAA TTTCAACTTT TATTGTAACA ACATTGTCCA TTTACACACT 3 untranslated region of OplE2 CCTTTCAAGC GCGTGGGATC GATGCTCACT Transforming E coli Introduction E coli Host Transformation Method Important EC Nous Once you have completed your ligation reactions you are ready to transform into E coli Many strains and transformation protocols are suitable General recommendations are provided below Many E coli strains are suitable for transformation of pMIB V5 His including TOP10 Catalog no C610 00 or DH5 We recommend that you propagate vectors containing inserts in E coli strains that are recombination deficient recA and endonuclease A deficient endA For your convenience TOP10 is available as electrocompetent or chemically competent cells from Invitrogen Item Quantity Catalog no Electrocomp TOP10 5 x 80 ul C664 55 10 x 80 ul C664 11 30 x 80 pl C664 24 One Shot TOP10 chemically competent cells 21 x 50 ul C4040 03 You may use any method of choice to transform E coli Chemical transformation is the most convenient for many researchers Electroporation is the most efficient and the method of choice for large plasmids To select transformants use LB agar plates containing 50
36. ium 8 Harvest the cells 2 3 and 4 days posttransfection and assay for expression of your gene see next page There s no need to add fresh medium if the cells are sealed in an airtight plastic bag with moist paper towels continued on next page 12 Transient Expression in Insect Cells continued Testing for Use the medium from one 60 mm plate for each expression experiment If you are Secreted Protein also harvesting cells see Preparing Cell Lysates below Before starting prepare 2X Expression SDS PAGE sample buffer A recipe is provided on page 23 for your convenience but other recipes are suitable If you are using pre cast polyacrylamide gels see below refer to the manufacturer s instructions to prepare the appropriate sample buffer 1 Prepare an SDS PAGE gel that will resolve your expected recombinant protein 2 Harvest the medium from the cells Note Depending on the sensitivity of your antibody media samples can be concentrated to approximately 10 fold prior to Western blot analysis You may use any method to concentrate the media samples We suggest using commercially available ultrafiltration devices e g Centricon or a Speed Vac 3 Mix 20 ul of the media samples with 20 ul of 2X SDS PAGE sample buffer Boil the samples for 5 minutes Centrifuge briefly Load samples electrophorese blot and probe with a suitable antibody see the next page 6 Visualize proteins using your desired method Th
37. ium without blasticidin when splitting cells Let the cells attach before adding selective medium 7 Expand resistant cells into flasks to prepare frozen stocks Always use medium containing blasticidin when maintaining stable lepidopteran cell lines You may lower the concentration of blasticidin to 10 ug ml for maintenance continued on next page 17 Selecting Stable Cell Lines continued Isolation of Clonal Cell Lines Using Cloning Cylinders 18 If you elect to select clonal cell lines try to isolate as many foci colonies as possible for expression testing As in mammalian cell culture the location of integration may affect expression of your gene Tip Perform selections in small plates or wells When you remove the medium you must work quickly to prevent the cells from drying out Using smaller plates or wells limits the number of colonies you can choose at a time To select more colonies increase the number of plates or wells not the size Before beginning have sterile cloning cylinders on hand To select colonies 1 Examine the closed plate under a microscope and mark the location of each colony on the top of the plate Transfer the markings to the bottom of the plate Be sure to include orientation marks Note Each colony will contain TM 50 to 200 cells Sf9 cells tend to spread more than High Five cells Move the culture dish to the sterile cabinet and remove the lid Apply a thin layer of ste
38. ium every 3 4 days and observe the percentage of surviving cells 4 Note the percentage of surviving cells at regular intervals to determine the appropriate concentration of blasticidin that kills the cells within 1 week after addition of blasticidin continued on next page Selecting Stable Cell Lines continued Reminder Do not linearize the plasmid prior to transfection Linearizing the Note plasmid appears to decrease protein expression The reason for this is not known Stable For stable transfections follow the steps below Include a mock transfection and Transfection a positive control pMIB V5 His CAT 1 Follow the transfection procedure on page 12 Steps 1 to 6 2 Forty eight hours posttransfection remove the transfection solution and add fresh medium no blasticidin 3 Split cells 1 5 20 confluent and let cells attach overnight before adding selective medium 4 Remove medium and replace with medium containing blasticidin at the appropriate concentration Incubate cells at 27 C 5 Replace selective medium every 3 to 4 days until you observe foci forming At this point you may use cloning cylinders or dilution to isolate clonal cell lines next page or you can let resistant cells grow out to confluence for a polyclonal cell line 2 to 3 weeks 6 To isolate a polyclonal cell line let the resistant cells grow to confluence and split the cells 1 5 and test for expression Important Always use med
39. lebbing and cells will eventually detach from the plate Blasticidin resistant cells should continue to divide at regular intervals to form distinct colonies There should be no distinct morphological changes between blasticidin resistant cells and cells not under selection with blasticidin In general concentrations around 10 pg ml will kill Sf9 cells in complete TNM FH medium and concentrations around 20 ug ml will kill High Five cells in Express Five SFM within one week although a few cells will remain that exclude trypan blue To obtain faster and more thorough killing in 3 4 days we recommend using 50 80 pg ml blasticidin Using higher concentrations of blasticidin may result in enrichment of clones containing multiple integrations of your gene of interest Once you have obtained your stable cell line s the concentration of blasticidin can be lowered and cells maintained at 10 ug ml blasticidin If you use other media or have trouble selecting cells using the concentrations above we recommend that you perform a kill curve see below If you wish to test your cell line for sensitivity to blasticidin perform a kill curve as described below Assays can be performed in 24 well tissue culture plates 1 Seed insect cells in TNM FH or serum free medium of choice 2 The next day substitute culture medium with medium containing varying concentrations of blasticidin 0 100 ug ml blasticidin 3 Replenish the selective med
40. necessary to change the medium or place in a humid environment 7 Check the plate after a week and mark the wells that have only one colony Continue to incubate the plate until the colony fills most of the well Harvest the cells and transfer to a 24 well plate with 0 5 ml of fresh medium containing blasticidin 10 Continue to expand the clone to 12 and 6 well plates and finally to a T 25 flask Assay for Assay each of your cell lines for yield of the desired protein and select the one Expression with the highest yield for scale up and purification of recombinant protein Remember to prepare master stocks and working stocks of your stable cell lines Important prior to scale up and purification Refer to the Insect Cell Lines manual for information on freezing your cells and scaling up for purification 19 Scale Up and Purification Introduction Important Adapting Cells to Different Medium Purifying Proteins from Medium Purification of 6xHis tagged Proteins from Medium 20 Once you have obtained stable cell lines expressing the protein of interest and prepared frozen stocks of your cell lines you are ready to purify your protein General information for protein purification is provided below Eventually you may expand your stable cell line into larger flasks spinners shake flasks or bioreactors to obtain the desired yield of protein We recommend that you culture cells in serum free medium to simpl
41. nsfection and selection Note that if you wish to transfect Sf9 or Sf21 cells in serum free medium you will need to adapt the cells to serum free medium before transfection see Insect Cell Lines manual for a protocol Prepare Cells For each transfection use log phase cells with greater than 95 viability We recommend that you set up enough plates to perform a time course for expression of your gene of interest Test for expression 2 3 and 4 days posttransfection You will need at least one 60 mm plate for each time point 1 For Sf9 Sf21 cells or High Five cells seed 2 x 10 cells in appropriate serum free medium in a 60 mm dish Rock gently from side to side for 2 to 3 minutes to evenly distribute the cells Do not swirl the plates in a circular motion Cells should be 50 to 60 confluent 2 Incubate the cells for at least 15 minutes without rocking to allow the cells to fully attach to the bottom of the dish to form a monolayer of cells 3 Verify that the cells have attached by inspecting them under an inverted microscope Positive and We recommend that you include the following controls Negative Controls pMIB V5 His CAT vector as a positive control for transfection and expression e Lipid only as a negative control e DNA only to check for DNA contamination e If you use another lipid besides Cellfectin Reagent review the protocol on Note the next page and consult the manufacturer s instructions to adapt
42. objective Cell Lines Using a of this method is to dilute the cells so that under selective pressure only one Dilution Method stable viable cell per well is achieved Note that the higher your transfection efficiency the more you should dilute out your cells The protocol below works well with cells transfected at 5 10 efficiency 1 Forty eight hours after transfection dilute the cells to 1 x 10 cells ml in medium without blasticidin Note Other dilutions of the culture should also be used as transfection efficiency will determine how many transformed cells there will be per well 2 Add 100 ul of the cell solution from Step 1 to 32 wells of a 96 well microtiter plate 8 rows by 4 columns 3 Dilute the remaining cells 1 1 with medium without blasticidin and add 100 l of this solution to the next group of 32 wells 8 x 4 4 Once again dilute the remaining cells 1 1 with medium without blasticidin and add 100 1 of this solution to the last group of 32 wells Note Although the cells can be diluted to low numbers cell density is critical for viability If the density drops below a certain level the cells will not grow 5 Let the cells attach overnight then remove the medium and replace with medium containing blasticidin Note Removing and replacing medium may be tedious If you slough the cells gently it is possible to dilute the cells directly into selective medium 6 Wrap the plate and incubate at 27 C for 1 week It is not
43. oli strain 8 e g TOP10 Select on LB plates containing 50 100 pg ml ampicillin or 100 ug ml blasticidin in Low Salt LB 4 Use sequencing to confirm that your protein is cloned in frame 8 with the honeybee melittin secretion signal and the C terminal peptide if desired 5 Transfect Sf9 Sf21 or High Five cells 10 12 Assay for transient expression of your protein 12 14 Create stable cell lines expressing the protein of interest by 16 19 selecting with the appropriate concentration of blasticidin 8 Scale up expression for purification 20 9 Purify your recombinant protein by chromatography on metal 20 21 chelating resin e g ProBond Methods Culturing Insect Cells Introduction Cells for Transfection Insect Cell Lines Manual Before you start your cloning experiments be sure to have cell cultures of Sf9 Sf21 or High Five cells growing and have frozen master stocks available You willneed log phase cells with gt 95 viability to perform a successful transfection Review pages 10 12 to determine how many cells you will need for transfection For additional information on insect cell culture refer to the Insect Cell Lines manual This manual contains information on e Thawing frozen cells e Maintaining and passaging cells e Freezing cells e Using serum free medium e Growing cells in suspension e Scaling up cell culture This manual is available fr
44. om our Web site www invitrogen com or by contacting Technical Service see page 30 Cloning into pMIB V5 His A B and C Introduction General Molecular Biology Techniques Propagation and Maintenance of Plasmids Cloning Considerations Signal Sequence Processing The pMIB V5 His kit supplies vectors with multiple cloning sites in three reading frames A B and C to facilitate cloning your gene of interest in frame with the C terminal peptide containing the V5 epitope and a polyhistidine 6xHis tag Use the diagrams provided on pages 5 7 to design a strategy to clone your gene of interest in frame with the HBM secretion signal and the C terminal peptide For help with E coli transformations DNA ligations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 The pMIB V5 His A B C and pMIB V5 His CAT vectors contain the ampicillin and blasticidin resistance genes to allow selection of the plasmid in E coli using ampicillin or blasticidin respectively To propagate and maintain the pMIB V5 His and pMIB V5 His CAT plasmids we recommend using the following procedure 1 Use 10 ng of each vector to transform a recA endA E coli strain like TOP10 DH5 JM109 or equivalent see page 8 for more information 2 Select transformants on LB agar plates contain
45. own Primer extension experiments revealed that transcription initiates equally from either the C or the A indicated These two transcriptional start sites are adjacent to a CAGT sequence motif that has been shown to be conserved in a number of early genes Blissard and Rohrmann 1989 GGATCATGAT GATAAACAAT GTATGGTGCT AATGTTGCTT CAACAACAAT TCTGTTGAAC TGTGTTTTCA TGTTTGCCAA CAAGCACCTT TATACTCGGT GGCCTCCCCA CCACCAACTT TTTTGCACTG CAAAAAAACA CGCTTTTGCA CGCGGGCCCA TACATAGTAC AAACTCTACG TTTCGTAGAC TATTTTACAT AAATAGTCTA CACCGTTGTA TACGCTCCAA ATACACTACC ACACATTGAA CCTTTTTGCA GTGCAAAAAA GTACGTGTCG GCAGTCACGT AGGCCGGCCT 1 r 1 1 TATCGGGTCG CGTCCTGTCA CGTACGAATC ACATTATCGG ACCGGACGAG TGTTGTCTTA AACAGGACGC GCCTCCATAT CAGCCGCGCG TTATCTCATG CGCGTGACCG GACACGAGGC j 1 TCGTGACAGG ACGCCAGCTT CCTGTGTTGC TAACCGCAGC CGGACGCAAC TCCTTATCGG Start of Transcription m gt TATA GCCCGTCCCG CTTATCGCGC CTATAAATAC AGCCCGCAAC GATCTGGTAA ACACAGTTGA ACAGCATCTG TTCGAATTTA 27 OpIE1 Promoter Description 1661 1721 1781 1841 1901 1961 28 The OpIE1 promoter has been analyzed by deletion analysis using a CAT reporter in both Lymantria dispar LD652Y and Spodoptera frugiperda Sf9 cells Deletion analysis revealed that sequence between 186 and 106 is important for maximum transcription in Sf9 cells Theilmann and Stewart 1991 This region contains a canonical CCAAT site underlined Johnson and
46. ple your recombinant protein will contain at least two extra amino acids following cleavage of the secretion signal if you clone your gene into the Sph I site continued on next page Cloning into pMIB V5 His A B and C continued Multiple Cloning Below is the multiple cloning site for pMIB V5 His A The TATA box start of Site of pMIB V5 transcription and the polyadenylation signal are marked as described in His A 491 561 616 681 746 800 861 931 Theilmann and Stewart 1992 Restriction sites are labeled to indicate the actual cleavage site The boxed nucleotides indicate the variable region The multiple cloning site has been confirmed by sequencing and functional testing The complete sequence of pMIB V5 His A is available for downloading from our World Wide Web site www invitrogen com or from Technical Service see page 30 For a map and a description of the features of pMIB V5 His A refer to pages 24 25 Start of transcription gt TATA Box OpIE2 Forward priming site IT l TCGCGCCTAT AAATACAGCC CGCAACGATC TGGTAAACAC AGTTGAACAG CATCTGTTCG AATTTAAAGC Honeybee melittin secretion signal TACC ATG AAA TTC TTA GTC AAC GTT GCC CTT GTT TTT ATG GTC GTA TAC ATT TCT Met Lys Phe Leu Val Asn Val Ala Leu Val Phe Met Val Val Tyr Ile Ser Sph Hind II Asp718 Kpn Sac Bam Spe EcoR TAC ATC TAT GCC GGC ATGCTAAGCT TGGTACCGAG CTCGGATCCA CTAGTCCAGT GTGGTGGAAT Tyr Ile T
47. ple for easier manipulation in subsequent purification steps Conditions for successful ion exchange chromatography will vary depending on the protein For more information refer to Current Protocols in Protein Science Coligan et al 1998 Current Protocols in Molecular Biology Unit 10 Ausubel et al 1994 or the Guide to Protein Purification Deutscher 1990 continued on next page Scale Up and Purification continued Metal chelating Resin Note Scale Up TM You may use the ProBond Protein Purification Kit Catalog no K850 01 or a similar product to purify your 6xHis tagged protein The ProBond Protein Purification Kit contains ProBond a metal chelating resin specifically designed to purify 6xHis tagged proteins Before starting be sure to consult the ProBond Protein Purification manual to familiarize yourself with the buffers and the binding and elution conditions If you are using another resin consult the manufacturer s instructions Many insect cell proteins are naturally rich in histidines with some containing stretches of six histidines Some of these proteins may be secreted When using the ProBond Protein Purification Kit or other similar products to purify 6xHis tagged proteins these histidine rich proteins may co purify with your protein of interest The contamination can be significant if your protein is expressed and secreted at low levels We recommend that you add 5 mM imidazol
48. rile silicon grease to the bottom of a cloning cylinder Scienceware Catalog no 378747 00 or Belco Catalog no 2090 00608 using a sterile cotton tipped wooden applicator The layer should be thick enough to retard the flow of liquid from the cylinder without obscuring the opening on the inside Tip Cloning cylinders and silicon grease can be sterilized together by placing a small amount of grease in a glass petri dish and placing the cloning cylinders upright in the grease After autoclaving the grease will have spread out ina thin layer to coat the bottom of the cylinders Aspirate the culture medium and place the cylinder firmly and directly over the marked area Use a microscope if it is available to help you direct placement of the cylinder Use 20 to 100 ul of medium no blasticidin to slough the cells Try to hold the pipette tip away from the sides of the cloning cylinder to avoid the grease this will take a little practice Remove the cells and medium and transfer to a microtiter plate and let the cells attach Remove medium and replace with selective medium for culturing Expand the cell line and test for expression of your gene of interest Important Always use medium without blasticidin when splitting cells Let the cells attach before adding selective medium continued on next page Selecting Stable Cell Lines continued Isolation of Clonal You may also select clonal cell lines using a quick dilution method The
49. sticidin as a selection agent Stable cell lines can be used to express the protein of interest in either adherent culture or suspension culture Baculovirus immediate early promoters utilize the host cell transcription machinery and do not require viral factors for activation Both the OpIE2 and OpIE1 promoters are from the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus OpMNPV The virus natural host is the Douglas fir tussock moth however the promoters allow protein expression in Lymantria dispar LD652Y Spodoptera frugiperda cells Sf9 Hegedus et al 1998 Pfeifer et al 1997 Sf21 Invitrogen Trichoplusia ni High Five Invitrogen Drosophila Kc1 S2 Hegedus et al 1998 Pfeifer et al 1997 and mosquito cell lines unpublished data The OpIE2 promoter has been shown to be about 5 to 10 fold stronger than the OpIE1 promoter Pfeifer et al 1997 Both promoters have been sequenced and analyzed For more detailed information on the OpIE2 and OpIE1 promoters see page 27 and page 28 respectively continued on next page Overview continued Expression Levels The OpIE2 promoter provides relatively high levels of constitutive expression Blasticidin Resistance Experimental Outline although not all proteins will be expressed at levels equivalent to those obtained from baculovirus very late promoters e g polyhedrin or p10 However other proteins may be expressed more effic
50. thing e g a laboratory coat when handling blasticidin Weigh out blasticidin and prepare solutions in a hood To inactivate blasticidin for disposal add sodium bicarbonate e Blasticidin S is soluble in water and acetic acid Water is generally used to prepare stock solutions of 5 to 10 mg ml e Dissolve blasticidin S in sterile water and filter sterilize the solution e Blasticidin S is unstable in solutions with a pH greater than 8 Be sure the pH of the solution is below 7 e Aliquot in small volumes see below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and store at 4 C Discard after 1 2 weeks 29 Technical Service World Wide Web Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog Additional product information and special offers Contact Us For more information or technical assistance please call write fax or email Additional international offices are listed on our Web page www invitrogen com
51. tion Mann and King 1989 have also been tested with High Five cells To test the quality of a plasmid DNA preparation include a mock transfection using DNA only no lipids in all transfection experiments At about 24 to 48 hours posttransfection compare the DNA only mock transfection with cells transfected with plasmid If the plasmid preparation contains contaminants then the cells will appear unhealthy and start to lyse You will need the following for each transfection experiment e 1 10 ug of highly purified plasmid DNA 1 ug ul in TE buffer e Either log phase Sf9 or Sf21 cells 1 6 2 5 x 10 cells ml gt 95 viability or log phase High Five cells 1 8 2 3 x 10 cells ml gt 95 viability e Serum free medium see the next page e 60mm tissue culture dishes e 1 5 ml sterile microcentrifuge tubes e Rocking platform only NOT orbital e 27 C incubator e Inverted Microscope e Paper towels and air tight bags or containers e 5mMEDTA pH8 continued on next page Transient Expression in Insect Cells continued Serum Free Media Several serum free media are available from Invitrogen for use in transfection experiments with pMIB V5 His Express Five SFM Catalog no 10486 025 is recommended for use with High Five cells while Sf 900 II SFM 1X Catalog no 10902 088 is optimized for use with Sf9 and Sf21 cells Other serum free media may be used although you may have to optimize conditions for tra
52. tion signal are marked as described in His C 491 561 616 681 745 799 861 931 Theilmann and Stewart 1992 Restriction sites are labeled to indicate the actual cleavage site The boxed nucleotides indicate the variable region The multiple cloning site has been confirmed by sequencing and functional testing The complete sequence of pMIB V5 His C is available for downloading from our World Wide Web site www invitrogen com or from Technical Service see page 30 For a map and a description of the features of pMIB V5 His C refer to pages 24 25 Start of transcription TATA Box OpIE2 Forward priming site l 1 TCGCGCCTAT AAATACAGCC CGCAACGATC TGGTAAACAC AGTTGAACAG CATCTGTTCG AATTTAAAGC Honeybee melittin secretion signal TACC ATG AAA TTC TTA GTC AAC GTT GCC CTT GTT TTT ATG GTC GTA TAC ATT TCT Met Lys Phe Leu Val Asn Val Ala Leu Val Phe Met Val Val Tyr Ile Ser Sph Hind III Asp718 Kpn Sac BamH Spe EcoR TAC ATC TAT GCC GGC ATGCTAAGCT TGGTACCGAG CTCGGATCCA CTAGTCCAGT GTGGTGGAAT 7 Tyr Ile Tyr alag Melittin Cleavage Site EcoR V Not l Xho l BstE Il l TCTGCAGATA TCCAGCACAG TGGCGGCCGC TCGAGGTCAC CCATTCGAA GGT AAG CCT ATC CCT Gly Lys Pro Ile Pro V5 epitope Polyhistidine 6xHis region l AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His His His H
53. ymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA England B P Heberlien U and Tjian R 1990 Purified Drosophila Transcription Factor ADH Distal Factor 1 Adf 1 Binds to Sites in Several Drosophila Promoters and Activates Transcription J Biol Chem 265 5086 5094 Hegedus D D Pfeifer T A Hendry J Theilmann D A and Grigliatti T A 1998 A Series of Broad Host Range Shuttle Vectors for Constitutive and Inducible Expression of Heterologous Proteins in Insect Cell Lines Gene 207 241 249 Hegedus D D Pfeifer T A Theilmann D A Kennard M L Gabathuler R Jefferies W A and Grigliatti T A 1999 Differences in the Expression and Localization of Human Melanotransferrin in Lepidopteran and Dipteran Insect Cell Lines Protein Expression and Purification 15 296 307 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Jarvis D L Weinkauf C and Guarino L A 1996 Immediate Early Baculovirus Vectors for Foreign Gene Expression in Transformed or Infected Insect Cells Protein Expression and Purification 8 191 203 Johnson P F and McKnight S L 1989 Eukaryotic Transcriptional Regulatory Proteins Ann Rev Biochem 58 799 839 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S De
54. yr ai Melittin Cleavage Site EcoR V Not Xho Xba TCTGCAGATA TCCAGCACAG TGGCGGCCGC TCGAGTCTAG AGGGCCCTTC GAA GGT AAG CCT ATC Gly Lys Pro Ile V5 epitope Polyhistidine 6xHis region i CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Arg Thr Gly His His His His His OpIE2 Reverse priming site l CAT TGA GTTTA TCTGACTAAA TCTTAGTTTG TATTGTCATG TTTTAATACA ATATGTTATG His OpIE2 polyadenylation signal c TTTAAATATG TTTTTAATAA ATTTTATAAA ATAATTTCAA CTTTTATTGT AACAACATTG TCCATTTACA 3 untranslated region of OpIE2 CACTCCTTTC AAGCGCGTGG GATCGATGCT continued on next page Cloning into pMIB V5 His A B and C continued Multiple Cloning Below is the multiple cloning site for pMIB V5 His B The TATA box start of Site of pMIB V5 transcription and the polyadenylation signal are marked as described in His B 491 561 616 681 747 801 861 931 Theilmann and Stewart 1992 Restriction sites are labeled to indicate the actual cleavage site The boxed nucleotides indicate the variable region The multiple cloning site has been confirmed by sequencing and functional testing The complete sequence of pMIB V5 His B is available for downloading from our World Wide Web site www invitrogen com or from Technical Service see page 30 For a map and a description of the features of pMIB V5 His B refer to
Download Pdf Manuals
Related Search