Home

Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual

1. Retest Adet Hist Mel1 LacZ phenotype Isolate plasmids from yeast Gace Eliminate colonies bearing the same AD library plasmid by a PCR or b Colony Hybridization Transform plasmids into E coli and purify DNA U Confirm Interaction in Yeast Cotransform DNA BD bait and AD library plasmids into AH109 or Perform yeast matings iti In vitro coimmunoprecipitation i ang Additional Two Hybrid Tests using Matchmaker Co IP Kit Confirm protein interactions Sequence cDNA inserts Switch Vectors Cat No 630449 in mammalian cells Frameshift Mutations Site specific mutations deletions In vivo Co IP using Mammalian Two Hybrid pCMV Myc amp pCMV HA Assay Kit Cat No 631604 Cat No 630301 Figure 6 Strategies for analyzing and verifying putative positive clones If the library screen was performed using strain CG 1945 see the YPH Section IX for details on how to segregate the DNA BD bait and AD library plasmids Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual X Analysis amp Verification of Putative Positive Clones continued Transform AH109 with Master plate with candidate clones AH109 AD vector a AD library gt 3 Mate to Y187 transformed with 1 DNA BD 2 DNA BD bait 3 DNA BD laminC 4 DNA BD 5 DNA BD bait Figure 7
2. 1995 Notes e Two hybrid libraries are usually constructed in the AD vector rather than the DNA BD vector Fusing random proteins to a DNA BDwill produce a much larger percentage of fusions that function as autonomous transcriptional activators Ma amp Ptashne 1987 e Other GAL4 AD vectors are compatible with Matchmaker Two Hybrid System 3 provided they carry the LEU2 nutritional marker 1 Amplification of premade libraries Obtain premade libraries as E colitransformants notas purified DNA Amplify the library to produceenoughplasmid DNAtoscreenthelibraryinyeast Ifyouhaveobtaineda Matchmaker cDNA Library follow the amplification protocol provided in Appendix C If you have obtained a library from another commercial source follow the manufacturer s instructions 2 Construction of cDNA libraries Use any standard method for generating cDNA Sambrook et al 1989 Ausubel et al 1995 For detailed information regarding construction of two hybrid cDNA libraries see Vojtek et al 1993 Durfee et al 1993 Dalton amp Triesman 1992 and Luban et al 1992 Be sure to reserve a 1 0 ml aliquot of your library frozen in 25 glycerol so that you can go back and amplify it later You can also construct genomic DNA libraries from an organism whose genome contains few or no introns such as bacteria or yeast pGADT7 contains a unique Bam HI site for constructing a Sau 3Al digested genomic DNA library and a unique Cla I si
3. Titer the optimal concentration of 3 AT needed to eliminate background growth on His selection plates For the highest transformation efficiency use competent cells within 1 hr preparing them If necessary you can store competent cells after Step 11 at room temperature for several hours with only a minor reduction in competency When performing simultaneous cotransformations the bait plasmid must be used in excess and the AD plasmid or library must be limiting To obtain an even growth of colonies spread the transformation mixture over the agar surface until all liguid has been absorbed Alternatively use 5 mm sterile glass beads 5 7 beads per 100 mm plate 7 9 beads per 150 mm diameter plate to promote even spreading To spread the colonies shake the plate back and forth not round and round 10 11 12 Below are procedures for preparing competent cells and transforming yeast Set up the control and experimental transformations listed in Table V Transformation Scale SMALL LARGE LIBRARY Inoculate 1 ml of YPDA or SD with several 2 3 mm colonies Vortex vigorously to disperse any clumps Transfer cells to a flask containing this volume of YPDA or SD8 Incubate at 30 C for 16 18 hr with shaking 250 rpm to stationary phase ODgg9 gt 1 5 Transfer overnight culture enough to produce an ODoggo 0 2 0 3 into this volume of YPDA Incubate at 30 C for 3 hr with shaking 230 270 rpm The OD
4. User Manual Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual O Clontech United States Canada 800 662 2566 Asia Pacific 1 650 919 7300 Europe 33 0 1 3904 6880 Japan PT3247 1 PR742219 81 0 77 543 6116 Published 3 April 2007 Clontech Laboratories Inc ATakara Bio Company 1290 Terra Bella Ave Mountain View CA 94043 Technical Support US E mail tech clontech com www clontech com Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Table of Contents Hl IV V VI VII VIII xI XII XIII Introduction Overview A Yeast Two Hybrid Screen Lists of Components Additional Materials Reguired Yeast Strains amp Phenotypes A Yeast Host Strains B Phenotypes Control Vectors A Positive Controls B Negative Control Matchmaker GAL4 cDNA amp Genomic Libraries A Library Construction B Library Ouality Control Information Preparing for a Two Hybrid Screen A Construct Fusion Genes B Obtain or Construct and AD Fusion Library C Verify that Constructs Do Not Activate Reporter Genes D Verify Protein Expression Library Transformation amp Screening Protocols A Transformation Scales B YeastTransformation Protocols C Plating and Screening Transformation Mixtures D Calculations Analysis amp Verification of Putative Positive Clones Retest Phenotypes Isolate Plasmid DNA from Yeast Sort Colonies to Eliminate Duplicates Rescue AD l
5. Vojtek A Hollenberg S amp Cooper J 1993 Mammalian Ras interacts directly with the serine threonine kinase Raf Cell 74 205 214 Ye O amp Worman H J 1995 Protein protein interactions between human nuclear lamins expressed in yeast Experi mental Cell Res 219 292 298 Yang M Wu Z amp Fields S 1995 Protein peptide interactions analyzed with the yeast two hybrid system Nucleic Acid Res 23 7 1152 1156 Zhang X Settleman J Kyriakis J M Takeuchi Suzuki E Elledge S J Marshall M S Bruder J T Rapp U R amp Avruch J 1993 Normal and oncogenic p21 s proteins bind to the amino terminal regulatory domain of c Raf 1 Nature 364 308 313 Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual XIII Related Products For the latest and most complete listing of all Clontech products please visit www clontech com GAL4 based One and Two Hybrid Systems and Related Products pGADT7 AD Vector 630442 e pGBKT7 DNA BD Vector 630443 e Mammalian Matchmaker Two Hybrid Assay Kit 630301 e Matchmaker Pretransformed cDNA Libraries many e Matchmaker cDNA and Genomic Libraries many e Matchmaker Random Peptide Library 638853 e pBridge Vector 630404 e pCMV Myc amp pCMV HA Vector Set 631604 e Matchmaker Co IP Kit 630449 e Matchmaker AD LD Insert Screening Amplimer Set 630433 Antibodie
6. use in drugs in vitro diagnostic purposes therapeutics or in humans Clontech products may not be transferred to third parties resold modified for resale or used to manufacture commercial products or to provide a service to third parties without written approval of Clontech Laboratories Inc NucleoSpin and NucleoBond are a registered trademarks of Macherey Nagel GmbH amp Co Parafilm is a registered trademark of the American Can Co Clontech the Clontech logo and all other trademarks are the property of Clontech Laboratories Inc unless noted otherwise Clontech is aTakara Bio Company 2007 Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 3 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual l Introduction MatchmakerTwo Hybrid System 3 is an advanced GAL4 based two hybrid system that provides a transcriptional assay for detecting protein interactions in vivo in yeast You can use this system to screen a library for novel proteins that interact with a known bait protein or to test two previously cloned proteins for an interaction Matchmaker Two Hybrid System 3 incorporates many features that reduce the incidence of false positive results and allow you to guickly identify and confirm protein interactions Key features of System 3 are detailed in Figure 1 Strain AH109 e Virtually eliminates false positives Allows stringency of Ades His selection to be varied
7. 286 292 Finley Jr R L amp Brent R 1994 Interaction mating reveals binary and ternary connections between Drosophila cell cycle regulators Proc Natl Acad Sci USA 91 12980 12984 Gietz D St Jean A Woods R A amp Schiestl R H 1992 Improved method for high efficiency transformation of intact yeast cells Nucleic Acids Res 20 1425 Golemis E A Gyuris J amp Brent R 1996 Analysis of protein interactions and Interaction trap two hybrid systems to iden tify interacting proteins In Current Protocols in Molecular Biology John Wiley amp Sons Inc Sections 20 0 and 20 1 Guarente L 1993 Strategies for the identification of interacting proteins Proc Natl Acad Sci USA 90 1639 1641 Gubler U amp Hoffman B J 1983 A simple and very efficient method for generating cDNA libraries Gene 25 263 269 Guthrie C amp Fink G R 1991 Guide to yeast genetics and molecular biology In Methods in Enzymology Academic Press San Diego 194 1 932 Gyuris J Golemis E Chertkov H amp Brent R 1993 Cdi1 a human G1 and S phase protein phosphatase that associates with Cdk2 Cell 75 791 803 Hagen F S Gray C L amp Kuijper J L 1988 Assaying the quality of cDNA libraries Bio Techniques 6 4 340 345 Harper J W Adami G R Wei N Keyomarsi K amp Elledge S J 1993 The p21 Cdk interacting protein Cip1 is a potent inhibitor of G1 cyclin dependent kinases Cell 75 805
8. GAL4 domains occlude the site of interaction 3 the hybrid protein folds improperly or 4 the hybrid protein cannot be localized to the yeast nucleus See van Aelst et al 1993 for one example Some types of protein interactions may notbedetectablein a GAL4 based system Some protein interactions are not detectable using any type of two hybrid assay A rare category of false positives in which an AD library hybrid activates transcription inappropriately www clontech com Solution Compare growth curves of host strain with DNA BD vector and DNA BD bait If bait is toxic use sequential transformations or switch to a low expressing DNA BD vector Truncation ofone ofthe hybrid proteins may alleviate the toxicity and still allow the interaction to occur Try using vectors that express lower levels of the fusion proteins such as pGBT9 a DNA BD vector and pGAD424 pGAD GL or pGAD10 AD vectors Holtz amp Zhu 1995 See previous tip on improving transformation efficiency Construct hybrids containing different domains of the bait protein For example to study proteins that normally do not localize to the nucleus it may be necessary to generate mutant forms of the protein that can be transported across the nuclear membrane Use the Matchmaker LexATwo Hybrid System Cat No K1609 1 Refer to Section X for methods to verify protein interactions see Bartel et al 1993a for further discussion of
9. Library scale 100 500 ug 8ml 103 104 1 x 109 50 x 150 mm Large scale Simultaneous 10 50 ug 1 5 ml 103 104 1x 10 5 x 150 mm Sequential 10 50 ug 1 5 ml 104 105 1 x 108 50 x 150 mm Small scale 0 1 ug 1 5 ml 10 na 1 x 100 mm na not applicable a cfu per ug of the AD library gt Total approximate number of transformants expected on SD Leu Trp selection plates assuming that 1 the minimal amount of plasmid was used 2 the transformed cells were resuspended in the volumes recommended in the protocol 3 200 ul of transformed cells were spread on each plate and 4 the transformation efficiencies were optimal Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols continued B Yeast Transformation Protocols Tips for a successful transformation Use a 1 3 week old colony 2 3 mm to inoculate each liquid culture If colonies on the stock plate are lt 2 mm use several colonies Note To aid in resuspending the cells place the colony in a 1 5 ml tube containing 0 5 ml of medium and vortex vigorously Then transfer the cell suspension to the complete volume of culture medium If the overnight or 3 hr cultures are visibly clumped disperse the clumps by vortexing When you are collecting cells by centrifugation a swinging bucket rotor results in better recovery of the cell pellet
10. Library screening e Use simple a gal or B gal assay a gal or B gal assay Improved vectors Increased transformation efficiency High level protein expression Verification of true positives E c Myc and HA tags facilitate detection of fusion proteins Distinct bacterial selection y N markers ias A Ul Epitope Tagged DNA BD Kan Matchmaker Expression Vectors e High copy vectors Co IP Kit or Mammalian Matchmaker Kit T7 promoter allows in vitro transcription and translation Figure 1 Overview of Matchmaker System 3 advances and screening process Principle of the two hybrid assay In Matchmaker System 3 a bait gene is expressed as a fusion to the GAL4 DNA binding domain DNA BD while another gene or cDNA is expressed as a fusion to the GAL4 activation domain AD Fields amp Song 1989 Chien et al 1991 When bait and library fusion proteins interact the DNA BD and AD are brought into proximity thus activating transcription of four reporter genes Figure 2 This technology can be used to identify novel protein interactions confirm suspected interactions and define interacting domains Moreover two hybrid technology provides immediate access to the genes encoding the interacting proteins Sensitive in vivo assay Yeast two hybrid systems provide a sensitive method for detecting relatively weak and transient protein interactions Such interactions may not be biochemically detectable but may be critic
11. New yeast strain reduces false positives System 3 features the yeast strain AH109 which virtually eliminates false positives by using three reporters ADE2 HIS3 and MEL1 or lacZ under the control of distinct GAL4 upstream activating sequences UASs andTATA boxes Figure 3 These promoters yield strong and specific responses to GAL4 As a result two major classes of false positives are eliminated those that interact directly with the sequences flanking the GAL4 binding site and those that interact with transcription factors bound to specific TATA boxes The ADE2 reporter alone provides strong nutritional selection the option of using H S3 selection reduces the incidence of false positives and allows you to control the stringency of selection James et al 1996 Furthermore you have the option of using either WEL7 or lacZ which encode a galactosidase and f galactosidase respectively MEL1 is an endogenous gene found in several yeast strains Because a galactosidase is a secreted enzyme it can be assayed directly on X a Gal Cat No 630407 indicator plates which employ blue white screening AH109 Constructs GAL1 TATA HIS3 GAL2 TATA ADE2 MEL1 TATA ELZA MEL1 TATA MEL1 Y187 Constructs GAL1 TATA lacZ Figure 3 Reporter constructs in yeast strains AH109 and Y187 Strain AH109 is a derivative of strain PJ69 2A and includes the ADE2 and HIS3 markers James et al 1996 MEL1 is an endogenous GAL4 responsive gene The
12. Note Using polyclonal antibodies may result in multiple cross reacting bands Alternatively use the T7 promoter to transcribe and translate the epitope tagged fusion proteins in vitro Confirm protein transcription andtranslation by coimmunoprecipitation using the Matchmaker Co IP Kit Cat No 630449 Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols In this section we provide detailed protocols for polyethylene glycol lithium acetate PEG LiAc mediated transformation of yeast Ito etal 1983 Schiestl amp Gietz 1989 Hill etal 1991 Gietz etal 1992 The procedures described here are for library screens using strain AH109 only If you choose to use strain CG 1945 follow the same general procedures and plate on SD His Leu Trp DO NOT PLATE STRAIN CG 1945 ON MEDIA LACKING ADENINE IT WILL NOT GROW A Transformation Scales We provide protocols for small large and library scale transformations Table V compares the transformation methods e Use small scale transformations to Verify that the DNA BD bait does not autonomously activate reporter genes Look for toxicity effects of DNA BD bait on host Perform control experiments Transform the DNA BD bait for sequential transformations e Use large scale transformations when you are learning two hybrid
13. Notes e Prepare the selection media and pour the required number of agar plates in advance e Allow SD agar plates to dry at room temperature for 2 3 days or at 30 C for 3 hr prior to plating any trans formation mixtures Moisture droplets on the agar surface can cause uneven spreading e Yeastmaker Yeast Transformation System Cat No 630439 provides all the necessary reagents for yeast transformations Note e Boil the carrier DNA for 20 min and quickly cool it on ice just prior to use e Sterile PEG LiAc solution Prepare immediately prior to use from 10X stocks e 100 DMSO Dimethyl sulfoxide Sigma Cat No D 8779 e 1XTE buffer e Sterile glass rod bent pasteur pipette or 5 mm glass beads for spreading cells on plates 65 Glycerol MgSO solution for the low stringency procedure eX a Gal Cat No 630407 Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual V Yeast Strains amp Phenotypes This section provides detailed phenotypes of the yeast strains included with Matchmaker System 3 and Matchmaker GAL4 cDNA and Genomic Libraries For additional information on the growth and maintenance of yeast see the YPH Chapter III We also recommend Guthrie amp Fink s Guide to Yeast Genetics and Molecular Biology 1991 and Heslot amp Gailardin s Molecular Biology and Genetic Engineering of Yeasts 1992 A Yeast Ho
14. Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual I Introduction continued Compatible Matchmaker products e Pretransformed Matchmaker cDNA Libraries provide a high quality library previously transformed into Y187 Simply mate to AH109 that has been transformed with your bait e Matchmaker GAL4 cDNA Libraries provide a convenient means to quickly screen a high quality premade cDNA library e pBridge Three Hybrid Vector Cat No 630404 allows you to investigate ternary protein complexes Tirode et al 1997 pBridge allows expression of the DNA BD bait and a third protein The third protein is only expressed in the absence of methionine e TheMatchmaker Co IP Kit Cat No 630449 provides reagents for quickly and independently confirming protein interactions through an in vitro coimmunoprecipitation e Matchmaker Antibodies allow you to easily detect fusion proteins See Related Products for details e The pCMV Myc amp pCMV HAVector Set Cat No 631604 allows in vivocoimmunoprecipitations in mammalian cells e The Mammalian Matchmaker Two Hybrid Assay Kit Cat No 630301 is ideal for confirming protein interactions in mammalian cells e X a Gal Cat No 630407 allows you to detect a galactosidase activity TABLE I LIST OF ABBREVIATIONS Two Hybrid Terminology AD library A fusion of the GAL4 AD with a library cDNA protein DNA BD bait A fusion of the GAL4 DN
15. Yeast mating to verify protein interactions Plate on SD Leu N Inoculate 0 5 ml YPD cultures 5 Replica plate or streak onto SD Ade His Leu Trp X o Gal 2 Yeast Mating Yeast mating is a convenient method of introducing two plasmids into the same host cells Finley amp Brent 1994 Harper et al 1993 If you have many Ade His Mel1 LacZ positive clones to analyze it will be more convenient to handle the clones in batches of 10 or so each a Transform AH109 with the AD library and AD plasmid and select on SD Leu b Transform Y187 or a suitable Mata strain with the following three plasmids and select on SD Trp plates i DNA BD ii DNA BD bait iii pGBKT7 Lam c For each candidate AD library plasmid to be tested set up the yeast matings indicated in Figure 7 using the Trp and Leu transformants obtained in Steps a amp b above d Refer to the YPH Chapter IX for mating procedures To select for diploids spread mating mixtures on SD Leu Trp plates as directed e Streakorreplica plateto SD Ade His Leu Trp X a gal True positives areAD library clones exhibiting reporter gene expression only when the AD library plasmid is introduced by mating with the plasmid encoding the DNA BD bait protein Discard any B galactosidase positive colonies containing the AD library plasmid alone F In vitro Analysis The Matchmaker Co IP Kit Cat No 630449 allows you to confirm protein interactio
16. fragment located at the 5 end of the gene A sample of the library may also be used as a template for PCR amplification of G3PDH and transferrin receptor cDNA fragments e Nonhuman mammalian cDNA libraries A representative sample up to 107 cfu or gt 107 pfu of the total library is used as a template in a PCR reaction with B actin PCR primers Species specific PCR primers are used for Mouse and Rat Matchmaker cDNA Libraries human primers are used for other nonhuman mammalian libraries Mouse and rat libraries may also be used as templates in PCR reactions using species specific G3PDH primers e Nonmammalian cDNA libraries A representative sample of the total library containing up to 10 cfu or gt 10 pfu is used as a template in a PCR reaction using the appropriate species specific primers for a ubiquitously expressed gene Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual VIII Preparing for a Yeast Two Hybrid Screen A Construct Fusion Genes The following is a brief protocol on constructing gene fusions For more detailed information see Sambrook et al 1989 The orientation and reading frame of each fusion must be maintained in order to express fusion proteins e You can generate a fusion gene if compatible restriction sites are present in the test genes and the corresponding vector If not generate the gene frag
17. of lt 5 x 104 cfu ug or the bait plasmid gave a transformation efficiency of lt 10 for the bait plasmid www clontech com Solution If two test proteins are being assayed switch from the DNA BD to the AD vector and vice versa Remove the activating domain by creating specific deletions within the gene Retest the deletion constructs for activation At the amino acid level a net negative charge per 10 amino acids is a minimal AD Note that such deletions may also eliminate a potentially interacting domain Remake SD Ade His Leu Trp X a Gal medium Add the appropriate amount of 3 AT Section V B 5 Use water or TE Remake media test with control transformations Switch to seguential transformation Repeat the experiment using more of the plasmid that had the low transformation efficiency Check the purity of the DNA and if necessary repurify it by ethanol precipitation If you are not already doing so we strongly recommend using the pretested and optimized Yeastmaker Carrier DNA which is available separately Cat No 630440 or as part of theYeastmakerYeastTransformation System Cat No 630439 Repeat the transformation this time including a recovery period after the heat shock To provide a recovery period perform the simultaneous cotransformation as described Section IX B but add the following steps after Step B 21 22 Resuspend cells in 1 0 LofYPDA medium for a library
18. onto 100 mm SD Leu Trp plates e Plate at least 1 5 3 times the number of independent colonies f In a low stringency library screen use three His selection plates one with the optimal concentration of 3 AT one with a 10 15 mM higher 3 AT concentration to control for background growth due and one with a 5 mM lower 3 AT concentration for improved growth of weak positives Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols continued AD fusion library Marker LEU2 DNA BD bait Marker TRP1 Cotransform AH109 Low stringency Plate culture on SD Leu Trp to select all cotransformants Ses s S Ee Nearly confluent growth Scrape colonies and make 7 or a glycerol stock Medium stringency Plate culture on SD His Leu Trp Plate culture on SD Ade His Leu Trp X a gal Replica plate to SD Ade His Leu Trp X a gal High stringency Plate culture on SD Ade His Leu Trp X o gal ae Colony growth and blue color indicates an interaction between the two hybrid proteins Figure 5 Screening an AD fusion library using strain AH109 Use the stringency of your choice to screen for interacting proteins Note high stringency selections result in fewer colonies and reduce the number of false
19. positives However weak interactions may be missed 1 Plate transformation mixtures as indicated in Table V Plate small scale transformations on 100 mm plates and large and library scale transformations on 150 mm plates With a new bait and library combination predicting the optimal method is difficult Therefore plate a third of the transformation on low medium and high stringency plates 2 Incubate plates upside down at 30 C until colonies appear 3 If screening an AD library calculate the transformation efficiency and estimate the num ber of clones screened as described in Section IX D Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols continued 4 LOW STRINGENCY PROTOCOL ONLY Harvest the library transformants as follows a Chill plates at 49C for 3 4 hr b Add 1 5 ml of TE buffer pH 7 0 to each plate Carefully scrape the colonies into the liquid using a heat bent sterile Pasteur pipette Combine all liquids in a sterile 50 ml tube and vortex to resuspend the cells Note If the combined volume is too large reduce it as follows centrifuge for 5 min at 1 000 x g remove all but 25 50 ml of the supernatant and vortex to resuspend the cells c Createaglycerolstockby adding an equal volume ofsterile65 glycerol MgSO solution Divide into 1 ml aliq
20. sure to perform it at 30 C Lysis is more likely to occur in liquid cultures and you risk lysing the entire culture at temperatures over 31 0 C Growth at 30 31 C is not necessary once the pACT or pACT2 library DNA has been transferred to a new E coli host A Reagents and Materials Required e LB amp agar plates Appendix A Notes e The exact number of plates required depends onthe size of the library Use the following calculation to determine how many plates to use Normally use 3 times the size of the originally library and plate at 20 000 cfu plate No of independent clones x 3 No clones to screen 2 x 108 x 3 6 x 10 clones to screen No of clones to screen colonies per plate No of plates 6 x 106 20 000 300 plates e Ifthe titer is 6 x 108 determine the amount of the library stock to spread on each plate No clones to screen library titer uls of library to plate 6 x 10 6 x 108 titer 10 pl e Calculate the volume of media needed to plate 150 ul on each plate 300 plates x 150 ul 52 5 ml e Add 10 ul of the library to 52 5 ml of LB amp and spread 150 ul onto each of the 300 LB amp plates e Allow the agar plates to dry at room temperature for 2 3 days or at 30 C for 3 hr prior to plating cells Moisture droplets on the agar surface can lead to uneven spreading of cells e LB glycerol 1 L LB broth containing 25 glycerol e Sterile glass spreading rod bent Pasteur pipette or 5 mm diameter sterile glass be
21. 816 Heslot H amp Gaillardin C eds 1992 Molecular Biology and Genetic Engineering of Yeasts CRC Press Inc Hill J Donald K A amp Griffiths D E 1991 DMSO enhanced whole cell yeast transformation Nucleic Acids Res 19 5791 Holm C 1993 A functional approach to identifying yeast homologs of genes from other species In Methods A Com panion to Methods in Enzymology 5 102 109 Holtz A E amp Zhu L July 1995 Clontechniques X 3 20 Hopkin K 1996 Yeast two hybrid systems more than bait and fish J NIH Res 8 27 29 Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual XII References continued Ito H Fukada Y Murata K amp Kimura A 1983 Transformation of intact yeast cells treated with alkali cations J Bacte riol 153 163 168 Iwabuchi K Li B Bartel P amp Fields S 1993 Use of the two hybrid system to identify the domain of p53 involved in oligomerization Oncogene 8 1693 1696 James P Haliaday J amp Craig E A 1996 Genomic libraries and a host strain designed for highly efficient two hybrid selection in yeast Genetics 144 1425 1436 Kuo H J Maslen C L Keene D R amp Glanville R W 1997 Type VI collagen anchors endothelial basement membranes by interacting with type IV collagen J Biol Chem 272 26522 26529 Li B amp Fields S 1993 Ide
22. A BD with a bait cDNA protein Yeast Phenotypes Ade His Leu or Trp Requires adenine Ade histidine His leucine Leu or tryptophan Trp in the medium to grow is auxotrophic for at least one of these specific nutrients Adet Expresses the ADE2 reporter gene i e does not require Ade in the medium to grow Hist Expresses the H S3 reporter gene i e does not require His in the medium to grow LacZ Expresses the lacZ reporter gene i e is positive for B galactosidase activity Mel1 Expresses the MEL1 reporter gene i e is positive for a galactosi dase activity Miscellaneous Ade2p Protein encoded by the yeast ADE2 gene 3 AT 3 amino 1 2 4 triazole a competitive inhibitor of the His3 protein CHX Cycloheximide DO Dropout supplement or solution a mixture of specific amino acids and nucleosides used to supplement SD base to make SD medium DO solutions are missing one or more of the nutrients required by untransformed yeast to grow on SD medium His3p Protein encoded by the yeast H S3 gene SD medium Minimal Synthetic Dropout medium comprised of a nitrogen base a carbon source glucose or galactose and a DO supplement YPH Yeast Protocols Handbook PT3024 1 Protocol No PT3247 1 Version No PR742219 www clontech com Clontech Laboratories Inc Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual ll Overview A Yeast Two Hybrid Screen Construct AD target Construct or Obtai
23. GC 3 21 mer 3 DNA BD Sequencing Primer 0 1 yg ul 5 ATCATAAATCATAAGAAATTCGCC 3 24 mer 3 AD Sequencing Primer 0 1 yg ul 5 AGATGGTGCACGATGCACAG 3 20 mer Leu Trp Dropout Supplement Ade His Leu Trp Dropout Supplement Herring Testes Carrier DNA denatured Vector Information Packets PT3248 5 amp PT3249 5 B Matchmaker GAL4 cDNA amp Genomic Libraries Store all components at 70 C Divide the library cultures into 100 ul aliquots and store at 709C Avoid multiple freeze thaw cycles Retiter and amplify the library before use Appendices B and C The appropriate vector information is provided inthe accompanying vector information packet 2x1 0 ml Plasmid Library Culture in LB broth 25 glycerol 0 5 ml AH109 Saccharomyces cerevisiae in YPDA medium 25 glycerol e 0 5 ml CG 1945 Saccharomyces cerevisiae inYPD medium 25 glycerol Protocol No PT3247 1 Version No PR742219 www clontech com Clontech Laboratories Inc Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IV Additional Materials Required The following reagents and materials are not supplied but are required Recipes for these materi als are provided in Appendix A and the YPH eYPDA or the appropriate SD liquid medium eSterile 1X TE LiAc Prepare immediately prior to use from 10X stocks TE buffer or sterile distilled H O e Appropriate sterile tubes or flasks for transformations eAppropriate SD agar plates
24. PH Appendix C e YPDA medium To 1L of YPD Medium Cat No 630409 add 15 ml of filter sterilized 0 2 adenine hemis ulfate Sigma Cat No A 9126 to a final concentration of 0 003 Reagent for low stringency screens 65 glycerol MgSO solution sterile Final Conc Glycerol 65 viv MgSO 100 mM Tris HCI pH 8 0 25 mM Media for Titering and Amplifying Plasmid Libraries in E coli e LB broth 10 g L Bacto tryptone 5 g L Bacto yeast extract 5 g L NaCl Adjust pH to 7 0 with 5 N NaOH Autoclave Store at room temperature e LB amp broth Prepare LB broth then autoclave and cool to 50 C Add ampicillin to 100 ug ml Store at 4 C e LB amp plates Prepare LB broth then add agar 18 g L autoclave and cool to 50 C Add ampicillin to 100 ug ml Pour plates and store at 4 C e Ampicillin stock solution 50 mg ml in H20 1000X Store at 20 C X a Gal Dissolve X a Gal at 20 mg ml in dimethylformamide DMF Store X a Gal solutions in glass or polypropylene bottles at 209C in the dark 1 Pouring X c Gal indicator plates a Prepare and autoclave 1 0 L of the appropriate dropout agar medium Cool to 55 C b Add 1 ml of X a Gal 20 mg ml c Pour plates and allow medium to harden at room temperature d Plate cells and incubate at the appropriate temperature until blue colonies form 2 Spreading X ca Gal onto premade plates a Dilute X a Gal to 4 mg ml in DMF b Pour appropriate dropout plates and allow medium to
25. account the much higher than normal cellular concentration and be magnified accordingly If 30 ml of culture when diluted to 10 has an ODgoq 1 treat the stock as though it were 3 L of culture and prepare plasmid DNA using a NucleoBond Mega or Giga Plasmid Kit Cat Nos 635938 amp 635939 7 Expected yields of plasmid DNA per 1 x 108 cfu e pACT amp pACT2 Libraries 0 25 mg e all other Matchmaker GAL4 Libraries 1 mg 8 Optional To obtain higher yields scrape the colonies into LB amp no glycerol and pool the colonies in one flask Incubate at 31 30 C for 2 4 hr with at 200 rpm Add sterile glycerol to 25 then proceed with Step 5 above Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219
26. ads 10 plate e Optional for Step 8 LB amp broth 2 L Appendix A and sterile 50 80 glycerol B Plasmid Library Amplification Protocol 1 If you have not done so already titer the plasmid library Appendix B 2 Plate the library directly on LB amp plates at a high enough density so that the resulting colonies will be nearly confluent 20 000 40 000 cfu per 150 mm plate Plate enough cfu to obtain at least 2 3X the number of independent clones in the library Notes e The number of independent clones is the number of independent colonies present in the library before amplification If you have purchased a library from Clontech the size of the library is stated on the PAC e To promote even growth of the colonies continue spreading the inoculum over the agar surface until all visible liquid has been absorbed and then allow plates to sit at room temperature for 15 20 min If using glass beads to spread the colonies shake the plate back and forth not round and round 3 Invert the plates and incubate at 37 C for 18 20 hr Notes e For pACT or pACT2 libraries incubate plates at 30 31 C for 36 48 hr or until confluent e Growing the transformants on solid medium instead of in liquid culture minimizes uneven amplification of the individual clones 4 Add 5 ml of LB glycerol to each plate and scrape colonies into liquid Pool all the resuspended colonies in one flask and mix thoroughly Note To obtain higher yields s
27. aincoloniesthathave lost the DNA BD and retained the AD Refer to the YPH Chapter IX for this procedure e Ifyoutransformed strain AH109 and did notuse DNA BD andAD vectors with different antibiotic markers transform KC8 E coli cells and plate on M9 medium lacking leucine KC8 cells have a defect in euB that can be complemented by yeast LEUZ2 System 3 Users or Libraries User with a pGBKT7 bait Transform the yeast purified plasmid DNA into E coli To select for transformants containing only the AD library plasmid plate on LB medium containing ampicillin 2 To verify that you have obtained the same AD library plasmid amplify inserts by PCR Then digest the fragment with A u I or Hae lll and run a small sample on an 3 4 agarose EtBr gel Compare the PCR product gel profiles from E coli and yeast Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual X Analysis amp Verification of Putative Positive Clones continued E Retest Protein Interactions in Yeast You can retest protein interactions in yeast by either cotransformation or yeast mating A real interaction will behave like the controls in Table VI 1 Cotransformation a Using the small scale transformation procedure transform the DNA BD bait and AD library plasmids into AH109 Plate on SD Ade His Leu Trp X a gal c Incubate plates at 30 C until colonies appear
28. al for proper functioning of complex biological systems Guarente 1993 Estojak et al 1995 The sensitivity of Matchmaker GAL4 Two Hybrid System 3 is primarily attributable to high fold amplification of positive signals in vivo i e transcriptional translational and enzymatic In addition because the two hybrid assay is performed in vivo the proteins are more likely to be in their native conformations which may lead to increased sensitivity and accuracy of detection Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Introduction continued Library protein Bait protein DNA BD transcription minimal promoter Reporter gene Figure 2 The two hybrid principle The DNA BD is amino acids 1 147 of the yeast GAL4 protein which binds to the GAL UAS upstream of the reporter genes The AD is amino acids 768 881 of the GAL4 protein and functions as a transcriptional activator The sensitivity of the two hybrid assay means that it can be used to pinpoint specific residues critical for protein interactions and to evaluate protein variants for the relative strength of their interactions Yang et al 1995 The binding data reported by Yang et al ibid lead them to suggest that protein interactions with dissociation constants Ky above 70 uM can be detected using a GAL4 based two hybrid assay
29. broth Appendix A LB amp plates 100 mm plates Appendix A Note Allow the agar plates to dry unsleeved at room temperature for 2 3 days or at 30 C for 3 hr prior to plating cells Moisture droplets on the agar surface can lead to uneven spreading of cells Sterile glass spreading rod bent Pasteur pipette or 5 mm glass beads for spreading culture on plates o Thaw an aliguot of the library and place on ice Mix by gentle vortexing Transfer 1 ul to 1 ml of LB broth in a 1 5 ml microcentrifuge tube Mix by gentle vortexing This is Dilution A 1 10 Note pACT and pACT2 libraries may be viscous and repeated freeze thaw cycles may increase viscosity To facilitate accurate pipetting of the library first dilute a 10 ul sample with 10 ul of LB broth Then prepare further dilutions from this 1 1 dilution Be sure to account for this extra dilution when calculating the titer Remove 1 ul from Dilution A and add it to 1 ml of LB broth in a 1 5 ml microcentrifuge tube Mix by gentle vortexing This is Dilution B 1 105 Add 1 ul from Dilution A to 50 ul of LB broth in a 1 5 ml microcentrifuge tube Mix by gentle vortexing Spread the entire mixture onto a prewarmed LB amp plate Note Continue spreading the inoculum over the agar surface until all visible liquid has been absorbed This procedure is essential for even growth of the colonies Plate 50 ul and 100 ul aliquots of Dilution B on LB amp plates Leave pla
30. comm LYS2 GAL Tyas GAL Trara HIS3 URA3 GALA guna CYC Trata lacZ B Phenotypes 1 Nutritional Requirements To verify phenotypes and to become familiar with the yeast strains test them for the phenotypes shown in Table III a Streak each strain onto adenine supplemented YPD YPDA plates Incubate at 30 C for 3 5 days Propagate additional cultures only from isolated colonies Note The stock may be refrozen several times without significantly decreasing viability b Using a sterile loop or toothpick streak 3 4 colonies onto the indicated SD selection plates c Incubate plates at 30 C for 4 6 days yeast strains grow more slowly on SD selection media than on YPDA d Seal stock plate with Parafilm and store at 4 C TABLE Ill MATCHMAKER YEAST STRAIN PHENOTYPES Strain SD Ade SD Met SD Trp SD Leu SD His SD Ura YPDA YPD CHX AH109 Y187 2 a CG 1945 Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual V Yeast Strains amp Phenotypes continued 2 Colony Color and Size a Y187 and CG 1945 carry the ade2 101 mutation On medium with low amounts of adenine the colonies will turn pink after a few days and may turn darker asthe colony ages These colonies grow to gt 2 mm in diameter However small lt 1 mm white colonies will form at a rate
31. crape the colonies into LB amp no glycerol and pool the colonies in one flask Incubate at 30 31 C for 2 4 hr with vigorous shaking 200 rpm Add sterile glycerol to 25 and proceed to Step 5 Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Appendix C Plasmid Library Amplification continued 5 Set aside one third of the library culture roughly equivalent to 3 L of overnight culture for the plasmid preparation this portion can be stored at 4 C if you plan to use it within 2 weeks For storage gt 2 weeks divide the culture into 50 ml aliquots and store at 70 C e Set aside five 1 ml aliquots of the library culture in case you wish to re amplify the library at a later time Store the aliquots at 70 C e Divide the remainder of the library culture into 50 ml aliquots and store at 709C 6 Prepare plasmid DNA using any standard method that yields a large guantity of highly purified plasmid See Sambrook et al 1989 for CsCl gradient purification if necessary Note The cell culture from Step 4 will be very dense ODgpp gt gt 1 so adjust the plasmid preparation protocol accordingly i e follow the procedure as if you were processing 3 L of overnight liguid culture or prepare a sterile dilution from 10 to 103 Plasmid preparation procedures are based on a culture of ODgog 71 2 Your plasmid preparation must take into
32. d pGADT7 T encode fusions between the GAL4 DNA BD and AD and murine p53 and SV40 large T antigen respectively p53 and large T antigen interact in a yeast two hybrid assay Li amp Fields 1993 Iwabuchi et al 1993 B Negative Control pGBKT7 Lam encodes a fusion of the DNA BD with human lamin C and provides a control for a fortuitous interaction between an unrelated protein and either the pGADT7 T control or your AD library plasmid Lamin C neither forms complexes nor interacts with most other proteins Bartel et al 1993b S Fields pers comm Ye amp Worman 1995 TABLE IV MATCHMAKER TWO HYBRID SYSTEM 3 VECTORS Fusion Epitope Yeast selection Bacterial selection Cloning vectors pGBKT7 DNA bait c Myc TRP1 kanamycin pGADT7 AD library HA LEU2 ampicillin Control vectors pCL1 GAL4 LEU2 ampicillin pGADT7 T AD T antigen HA LEU2 ampicillin pGBKT7 53 DNA BD p53 c Myc TRP1 kanamycin pGBKT7 Lam DNA BD lamin C c Myc TRP1 kanamycin a HA hemagglutinin ProtocolNo PT3247 1 wwwelontechcom Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Vil Matchmaker GAL4 cDNA amp Genomic Libraries You can use premade Matchmaker GAL4 cDNA and Genomic Libraries with all Matchmaker GAL4 based systems A Library Construction cDNA libraries are prepared using a modified Gubler amp Hoffman procedure 1983 cDNA Priming Methods e Oligo dT priming elimi
33. election markers kanamycin and ampicillin respectively to simplify their independent isolationin E coli Purifying the plasmids from E coliallows the isolation of AD vectors after a library screening Each vector also contains thehigh copy pUC origin of replication to ensure high yields from plasmid preparations These features provide the high quality and quantity of DNA necessary for sequencing and characterizing inserts by PCR or restriction digests Increased transformation efficiency Another benefit of System 3 is that yeast strains carrying pGBKT7 are transformed more efficiently than strains containing other DNA BD vectors Louret et al 1997 Clontechniques January 1999 This higher transformation efficiency facilitates the introduction of AD fusion libraries into yeast which maintains the complexity of the library and increases the probability of detecting novel two hybrid protein interactions Considerations The Matchmaker Systems have been used to identify many different types of protein interactions including those from prokaryotes yeast plants Drosophila and mammals However all yeast two hybrid systems have potential limitations e Somebaitproteins may have intrinsic DNA binding and ortranscriptional activating properties hence deletion of certain portions of bait proteins may be required to eliminate unwanted activity before the proteins can be used in a two hybrid screen Bartel et a 1993b e Some hybrid
34. es on SD Leu Trp X a Gal plates 2 3 times to allow loss of some of the AD library plasmids while maintaining selective pressure on both the DNA BD and AD vectors Incubate plates at 30 C for 4 6 days A mixture of white and blue colonies indicates segregation Replica plate or transfer well isolated colonies to SD Ade His Leu Trp X a Gal plates to verify that they maintain the correct phenotype Collect the restreaked and retested Ade His Mel1 colonies on SD Ade His Leu Trp master plates in a grid fashion Incubate plates at 30 C for 4 6 days After colonies have grown seal plates with Parafilm and store at 4 C for up to 4 weeks Isolate Plasmid DNA from Yeast The Yeastmaker Yeast Plasmid Isolation Kit Cat No 630441 provides the reagents and a protocol for isolating plasmid DNA from yeast These procedures provide plasmid DNA suitable for PCR and E coli transformations A similar protocol is provided in the YPH Note the plasmid DNA isolated from each positive yeast colony will be a mixture of the DNA BD bait plasmid and at least one type of AD library plasmid Alternatively you may wish to try the direct transfer of plasmid DNA from yeast to E coli by electroporation Marcil amp Higgins 1992 Note For this method the transformation efficiency of competent E coli cells must be gt 10 cfu mg C Sort Colonies to Eliminate Duplicates 1 Amplify AD library inserts by PCR and characterize PCR prod
35. false positives Clontech Laboratories Inc Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual XII References General References are indicated with a bullet Allen J B Wallberg M W Edwards M C amp Elledge S J 1995 Finding prospective partners in the library the yeast two hybrid system and phage display find a match TIBS 20 511 516 Aho S Arffman A Pummi T amp Uitto J 1997 A novel reporter gene MEL7 for the yeast two hybrid system Anal Biochem 253 270 272 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A amp Struhl K 1995 Current Protocols in Molecular Biology John Wiley amp Sons Bartel P L Chien C T Sternglanz R amp Fields S 1993a Using the two hybrid system to detect protein protein interac tions In Cellular Interactions in Development A Practical Approach ed Hartley D A Oxford University Press Oxford pp 153 179 Bartel P L Chien C T Sternglanz R amp Fields S 1993b Elimination of false positives that arise in using the two hybrid system BioTechnigues 14 920 924 Bendixen C Gangloff S amp Rothstein R 1994 A yeast mating selection scheme for detection of protein protein interac tions Nucleic Acids Res 22 1778 1779 Borson N D Sato W L amp Drewes L R 1992 A lock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods Appl 2 144 148 Chenchik A Dia
36. goo will be 0 5 0 1 Place cells in 50 ml tubes and centrifuge at 1 000 x g for 5 min at room temperature Discard the supernatant and resuspend cell pellets by vortexing in this volume of sterile TE or H O Pool cells centrifuge at 1 000 x g for 5 min at room temperature Decant the supernatant Resuspend the cell pellet in this volume of freshly prepared sterile 1XTE LiAc Prepare PEG LiAc solution 50 ml 50 ml 300 ml 300 ml 25 50 ml 25 50 ml 1 5 ml 1 5 ml 10 ml 10 ml 150 ml 1L 500 ml 8 mlb 100 ml a Use SD Trp when performing the second transformation in a sequential transformation protocol b For library cotransformations only remove two 100 ul aliquots of competent cells to perform control transformations with pCL1 and pGBKT7 53 pGADT7 T Protocol No PT3247 1 Version No PR742219 www clontech com Clontech Laboratories Inc Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols continued 13 14 15 16 17 18 19 20 21 22 23 In the indicated tube add and mix the following e DNA BD bait e AD library e Herring testes carrier DNA Add this volume of yeast competent cells and mix well by vortexing Add this volume of sterile PEG LiAc solution and vortex at high speed to mix Incubate at 30 C for 30 min with shaking 200 rpm Add this volume of DMSO Mix well b
37. h the epitope tag See Section X G 2 5 for further recommendations G Sequence AD Library Inserts Use only DNA isolated from E coli 1 Sequence inserts in the positive AD library plasmids using the 3 AD Sequencing Primer andT7 Sequencing Primer provided with System 3 Verify the presence of an open reading frame ORF fused to the GAL4 AD sequence and compare the sequence to those in GenBank EMBL or other databases 2 If your sequencing results reveal a peptide lt 10 amino acids fused to the AD or no fusion peptide at all keep sequencing beyond the stop codon You may find another ORF Nontranslated gaps upstream of ORF inserts are most commonly found in yeast genomic libraries where intercistronic regions are very short Such gaps can also occur in cDNA libraries due to the cloning of a portion of the 5 untranslated region of the mRNA along with the coding region in the cDNA If the library was built in a high level expression vector such as pGADT7 pGAD GH or pACT2 a Western blot will reveal the presence and size of an AD fusion protein 3 Due to occasional translational read through two different ORFs may occasionally be expressed as a fusion with the AD even though a nontranslated gap comes between them 4 If your sequencing results fail to reveal any ORF in frame with the AD coding region the positive library clone could be transcribed in the reverse orientation from a cryptic promoter within the ADH7 terminator Chie
38. harden at room temperature c Spread 200 ul of X a Gal 4 mg ml onto a 15 cm plate or 100 ul onto a 10 cm plate using glass beads Note To quickly 1 24 hr determine if a yeast strain contains MEL1 spread X o Gal at 20 mg mlas described d Allow plates to dry for 15 min at room temperature e Plate cells and incubate at the appropriate temperature until blue colonies form Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Appendix B Library Titering A Important Diluted libraries are always less stable than undiluted libraries Therefore once the library dilutions are made use them within the next hour before drastic reductions in titer occur Use proper sterile technique when aliquoting and handling libraries Design and use appropriate controls to test for cross contamination Always use the recommended concentration of antibiotic in the medium to ensure plasmid stability pACT and pACT2libraries are released from AACT andAACT 2 libraries respectively Incubating cultures of pACT and pACT2 libraries at 37 C can result in plaques on the high density plates due to the presence of residual phage in the library These plaques should not interfere with library titering However if they are numerous retiter the library at 30 31 C and incubate 36 48 hr B Plasmid Library Titering Reagents and Materials Required LB
39. ibrary Plasmids via transformation of E coli Retest Protein Interactions in Yeast In vitro Analysis Sequencing AD Library Inserts In vivo Analysis Additional Two Hybrid Tests Troubleshooting Guide Pro mmooue References Related Products Appendix A Media amp Solution Recipes Appendix B LibraryTitering Appendix C Plasmid Library Amplification Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual List of Tables Table I List of Abbreviations 7 Table Il Matchmaker Yeast Strain Genotypes 11 Table Ill Matchmaker Yeast Strain Phenotypes 11 Table IV Matchmaker Two Hybrid System 3 Vectors 13 Table V Comparison of Two Hybrid Transformation Methods 18 Table VI Set up for a Two Hybrid Library Screen 21 List of Figures Figure 1 Overview of Matchmaker Two Hybrid System 3 advances and screening process 4 Figure 2 The two hybrid principle 5 Figure 3 Reporter constructs in yeast strains AH109 and Y187 5 Figure 4 Overview of performing a yeast two hybrid screen 8 Figure 5 Screening an AD fusion library using strain AH109 22 Figure 6 Strategies for analyzing and verifying putative positive clones 25 Figure 7 Yeast mating to verify protein interactions 26 Notice to Purchaser Clontech products are to be used for research purposes only They may not be used for any other purpose including but not limited to
40. lacZ reporter gene was introduced into PJ69 2A to create AH109 A Holtz unpublished The HIS3 ADE2 and MEL 1 lacZ reporter genes are under the control of three completely heterologous GAL4 responsive UAS and promoter elements GAL1 GAL2 and MEL1 respectively Strain Y187 contains the lacZ reporter gene under control of the GAL1 UAS Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 5 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual l Introduction continued Optimized vectors facilitate downstream confirmation The Matchmaker System 3 DNA BD and AD fusion vectors pGBKT7 and pGADT were designed for high level protein expression and to facilitate confirmation of protein interactions Bait and library inserts are expressed as GAL4 fusions with c Myc and hemagglutinin HA epitope tags respectively The epitope tags eliminate the need to generate specific antibodies to each new protein and allow convenient identification of the fusion proteins System 3 vectors also include T7 promoters downstream of the GAL4 coding sequences These promoters allow you totranscribe and translate the epitope tagged fusion proteins in vitro The Matchmaker Co IP Kit Cat No 630449 allows you to confirm protein interactions through an in vitro coimmunoprecipitation The T7 promoter is also a priming site for DNA sequencing Finally pGBKT7 and pGADT7 were designed to express different bacterial s
41. lating and Screening Transformation Mixtures You can select AH109 transformants using high medium or low stringency media Figure 5 Less stringent screens increase the number of false positives while more stringent screens may result in false negatives e High stringency Plate transformations on SD Ade His Leu Trp X a Gal medium to screen for ADE2 HIS3 and MEL 1 expression This screen virtually eliminates false positive interactions however low affinity protein interactions may be missed e Medium stringency Plate library transformations on SD His Leu Trp medium to screen for expression of H S3 Plan to screen at least 1 5 3 times the number of independentclones in the library Subsequently replica plate Hist colonies onto SD Ade His Leu Trp X a Gal medium to screen for ADE2 and MEL1 expression e Low stringency Perform this screen if you are having trouble picking up positive clones or if you suspect that your bait protein interacts very weakly or transiently with other proteins Plate out library transformations on SD Leu Trp medium to select the DNA BD and AD vectors This selection step provides an initial phase of growth that maximizes plasmid copy number which results in higher levels of fusion protein This in turn improves the chances of detecting AD fusion proteins that interact weakly or transiently with the bait This screen typically results in up to 1 000 candidate colonies Therefore you must op
42. ment by PCR with useful restriction sites incorporated into the primers Scharf 1990 A restriction site at the end of a gene can often be changed into a different site or put into a different reading frame using a PCR primer that incorporates the desired mutation e Ifyou are investigating two known genes use either vector unless one has an activation or DNA binding activity that would interfere withthe proper functioning ofthetwo hybrid system 1 Purify the gene fragment whether generated by PCR or cut out of a plasmid Note We recommend the NucleoSpin Extraction Kit Cat No 635961 for rapid isolation of DNA fragments 2 Digest the DNA BD or AD vector with the appropriate restriction enzyme s treat with phosphatase and purify 3 Ligate the appropriate vector and insert Transform ligation mixtures into E coli 4 Identify insert containing plasmids by restriction analysis or PCR using the Matchmaker Insert Screening Amplimer Set Cat No 630433 5 Use the Sequencing Primers included with Matchmaker System 3 to check the orientation and reading frame of the junctions Obtain or Construct an AD Fusion Library Premade Matchmaker cDNA Libraries and Pretransformed cDNA Libraries from a variety of tissues and species are available from Clontech Alternatively construct an AD fusion library in pGADT7 using either intronless genomic DNA or cDNA such that at least 10 different hybrid proteins will be expressed Ausubel et al
43. n AD Library Construct DNA bait Section VIII A Section VIII A Section VIII B NN 1 week TF 1 3 weeks Test for Autonomous Activation Titer and Amplify Library 3 days 1 week Sy 6 days 1 week Transform AH109 Use sequential or simultaneous methods Section IX B 3 hr Select Transformants High Stringency SD Ade His Leu Trp X a Gal Medium Stringency SD His Leu Trp Low Stringency SD Leu Trp Section IX C 5 days 2 week Verify Protein Interactions Figure 4 Overview of performing a yeast two hybrid screen The appropriate User Manual sections are indicated Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual lll Lists of Components A Matchmaker Two Hybrid System 3 Store all yeast strains at 709C Store sequencing primers and plasmid DNA at 20 C e 50 e 50 e 50 e 50 e 50 e 50 0 5 0 5 40 ul ul ul ul ul ul ml ml ul ul ul ml pGBKT7 Cloning Vector 0 1 ug ul pGADT7 Cloning Vector 0 1 pg ul pGBKT7 53 Control Vector 0 1 yg pl pGBKT7 Lam Control Vector 0 1 Ug ul pGADT7 T Control Vector 0 1 yg pl pCL1 Control Vector 0 1 ug l AH109 Saccharomyces cerevisiae inYPDA medium 25 glycerol Y187 Saccharomyces cerevisiae in YPD medium 25 glycerol T7 Sequencing Primer 0 1 yg ul 5 TAATACGACTCACTATAGG
44. n et al 1991 Such proteins apparently function as transcriptional activators as well as interacting with the bait protein 5 Yeast also allow translational frameshifts A large ORF in the wrong reading frame may actually correspond to the expressed protein H In vivo Analysis Ifthe fusion proteins coimmunoprecipitate confirm functional analysis in vivothrough either a coimmunoprecipitation or a Mammalian Two Hybrid Assay Cat No 630301 1 We recommend the pCMV Myc amp pCMV HA Vector Set Cat No 631604 for in vivo coimmunoprecipitation in mammalian cells The CMV promoter in these vectors allows constitutive expression of the bait and library cDNA in a wide variety of mammalian cell types All Matchmaker GAL4 based vectors are compatible therefore you can easily transfer your bait and library inserts into pCMV Myc and pCMV HA 2 The Mammalian Two Hybrid Assay Kit is ideal for confirming protein interactions via two hybrid interactions in mammalian cells Proteins are more likely to be in their native conformations and to have the appropriate posttranslational modifications therefore results are more likely to represent biologically significant interactions I Additional Two Hybrid Tests 1 Transfer the library insert from the AD to the DNA BD vector and vice versa and then repeat the two hybrid assay Chien et al 1991 van Aelst et al 1993 You should still be able to detect the interaction 2 Create a frameshift m
45. nates the synthesis of lengthy poly dT regions and ensures that full length clones and 3 ends will be well represented in the library Chenchik et al 1994 Borson et al 1992 Moqadam amp Siebert 1994 e Oligo dT random priming may lead to a greater representation of all portions of the gene including amino terminal and internal domains regardless of mRNA secondary structure random priming also generates a wider size range of cDNA e Unidirectional libraries are made with oligo dT primers that have one vector compatible restriction enzyme site The other site is added with sticky ends by the adaptor that is ligated to the cDNA Thus digestion with one restriction enzyme ensures the cDNA s proper orientation when ligated to a vector that has been digested with the appropriate two enzymes Adaptors and Linkers Please refer to the Product Analysis Certificate PAC for information on the specific adaptor or linker used in the construction of your Matchmaker Library Notes e The open reading frame of the insert starts at the codon immediately following the C terminal codon a a 881 of the GAL4 AD not within the adaptor e If an EcoR linker is used the cDNA is methylated to protect any internal EcoR sites e Ifan adaptor is used in the construction of nondirectionally cloned libraries no methylation or restriction enzyme digestion of the cDNA is required therefore any internal EcoR sites present in the cDNA will n
46. ns quickly and independently via an in vitro coimmunoprecipitation The Co IP Kit works with all GAL4 based Matchmaker System and Library vectors Because System 3 vectors already contain T7 promoters and epitope tags you can use them directly in in vitrotranscription translation reactions For all other GAL4 based vectors you must first use the Co IP Primers to amplify inserts in order to incorporate theT7 promoters and epitope tags The Co IP Kit also provides c Myc and HA antibodies for precipitating interacting proteins 1 Transcribe and translate the epitope tagged fusion proteins in vitrousing theT7 promoters in theAD and DNA BD vectors Note theT7 promoter is located downstream of the GAL4 coding seguence hence the GAL4 domains are not transcribed Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual X Analysis amp Verification of Putative Positive Clones continued 2 Coimmunoprecipitate the epitope tagged fusion proteins using c Myc and HA antibodies Durfee et al 1993 Zhang et al 1993 If the fusion proteins do not coimmunoprecipitate use other means to confirm the interaction Note protein interactions with weak affinities may escape detection by coimmunoprecipitation See Phizichy amp Fields 1995 for details on more sensitive detection methods Furthermore the AD fusion proteins may potentially not be in frame wit
47. nt colonies cfu growing onthe SD Leu Trp dilution plate that has between 30 300 cfu cfu x total suspension vol ul cfu ug DNA Vol plated ul x dilution factor x ug DNA used In a cotransformation this is the amount of imiting plasmid not the total amount of DNA 2 Number of Clones Screened cfu ug x Mg of library plasmid used No of clones screened Example calculation e 100 colonies grew on the 1 100 dilution transformation efficiency control plate dilution factor 0 01 e resuspension volume 10 ml e amount of library plasmid used 100 ug 100 cfu x 10 ml x 10 ul ml 1x10 cfu ug 100 ul x 0 01 x 100 ug e 1x 104 cfu x 100 ug 1x 10 clones screened 3 Amount of DNA to Use If you screened lt 109 clones repeat the transformation using more DNA Calculate the amount of DNA to use in the repeat transformation as follows 108 clones ug DNA needed No of clones screened ug DNA used Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual X Analysis amp Verification of Putative Positive Clones This section provides protocols for verifying protein interactions Figure 6 provides a detailed overview A Retest Phenotypes The initial library cotransformants may contain more than one AD library plasmid which can complicate the analysis of putative positive clones 1 Restreak positive coloni
48. ntification of mutations in p53 that affect its binding to SV40T antigen by using the yeast two hybrid system FASEB J 7 957 963 Louret O F Doignon F amp Crouzet M 1997 Stable DNA binding yeast vector allowing high bait expression for use in the two hybrid system Bio Techniques 23 816 819 Luban J Alin K B Bossolt K L Humaran T amp Goff S P 1992 Genetic assay for multimerization of retroviral gag polyproteins J Virol 66 5157 5160 Luban J amp Goff S P 1995 The yeast two hybrid system for studying protein interactions Curr Opinion Biotechnol 6 1 59 64 Ma J amp Ptashne M 1987 A new class of yeast transcriptional activators Ce 51 113 119 Marcil R amp Higgins D R 1992 Direct transfer of plasmid DNA from yeast to E coli by electroporation Nucleic Acids Res 20 917 Matchmaker Two Hybrid System 3 January 1999 Clontechniques XIV 1 12 14 McNabb D S amp Guarente L 1996 Genetic and biochemical probes for protein protein interactions Curr Opin Bio technol 7 5 554 559 Mendelsohn A R amp Brent R 1994 Biotechnology applications of interaction traps two hybrid systems Curr Opinion Biotechnol 5 482 486 Mogadam F amp Siebert P 1994 Rapid Amplification of the 3 end of cDNAs with the 3 AmpliFINDER RACE Kit Clon techniques X 3 6 9 Ozenberger B A amp Young K H 1995 Functional interaction of ligands and receptors of the hemato
49. of 1 2 due to spontaneous mutations that eliminate mitochondrial function Holm 1993 Avoid these white colonies when inoculating cultures In the absence of GAL4 AH109 also exhibits the ade2 101 phenotype However in the presence of protein interactions the ADE2marker complements in cisthe AH109 ade2 101 phenotype b When transformed with pAS2 1 or any pAS2 derived plasmid CG 1945 grows more slowly and forms noticeably smaller colonies than untransformed CG 1945 3 Antibiotic Resistance CG 1945 is cycloheximide resistant When making competent CG 1945 cells use liguid YPD medium without cycloheximide 4 MEL1 and lacZ Reporter Gene Expression Levels a In response to GAL4 activation AH109 andY187 secrete a galactosidase which can be detected on medium containing X a Gal Aho et al 1997 b In response to GAL4 activation Y187 exhibits a higher level of induced B galactosidase activity than both AH109 and CG 1945 This is because of differences in the strengths of the lacZ promoter constructs InY187 lacZ is under control of the intact GAL7 UAS in AH109 and CG 1945 lacZ is under control of the weaker MEL1 UAS and UAS 17 mer consensus sequence respectively Therefore use liquid cultures ofY 187 for quantitative B galactosidase assays For further information on B galactosidase assays see the YPH 5 Leaky HIS3 Expression a 3 AT is a competitive inhibitor of the yeast H S3 protein His3p 3 AT is used to inhibit low le
50. ot be cut e f an adaptor is used in the construction of unidirectionally cloned libraries the cDNA is methylated to protect the alternative site e Ifthe library is synthesized using EcoR Not Sal adaptors you may excise the inserts from the vector using sites within the adaptor cDNA Size Fractionation The adaptorligated double stranded cDNA is size fractionated to remove unincorporated primers unligated adaptors and adaptor dimers this process also removes low molecular weight lt 400 bp incomplete cDNAs Insert Size Range and Average Insert Size Sizes are determined by running the cDNA on a gel prior to cloning and comparing the profile to MW size markers Library Amplification Unless otherwise stated on the PAC all libraries are amplified once Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual VII Matchmaker GAL4 cDNA amp Genomic Libraries continued B Library Quality Control Information The following information is provided on the PAC These data were obtained at the time of library construction Number of Independent Clones The number of independent clones is estimated before amplification Most libraries are guaranteed to have at least 1 x 108 independent clones Library Titer Library titer is determined after amplification and must be gt 108 cfu ml for plasmid libraries Insert Size Anal
51. poietic superfamily in yeast Mol Endocrinol 9 1321 1329 Phizichy E M amp Fields S 1995 Protein protein interactions Methods for detection and analysis Microbiol Rev 59 94 123 Ruden D M 1992 Activating regions of yeast transcription factors must have both acidic and hydrophobic amino acids Chromosoma 101 342 348 Ruden D M Ma J Li Y Wood K amp Ptashne M 1991 Generating yeast transcriptional activators containing no yeast protein sequences Nature 350 250 251 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Cold Spring Harbor NY Scharf S J 1990 Cloning with PCR In PCR Protocols A Guide to Methods and Applications eds Innis M A Gelfand D H Sninsky J J amp White T J Academic Press Inc San Diego pp 84 91 Schiestl R H amp Gietz R D 1989 High efficiency transformation of intact cells using single stranded nucleic acids as a carrier Curr Genet 16 339 346 Tirode F Malaguti C Romero F Attar R Camonis J amp Egly J M 1997 A conditionally expressed third partner stabi lizes or prevents the formation of a transcriptional activator in a three hybrid system J Biol Chem 272 22995 22999 van Aelst L Barr M Marcus S Polverino A amp Wigler M 1993 Complex formation between RAS and RAF and other protein kinases Proc Natl Acad Sci USA 90 6213 6217
52. proteins may not be stably expressed in yeast or localized to the yeast nucleus For protein interactions that normally occur on the cell surface a phage display system may be a more appropriate choice However the two hybrid system has been used to identify extracellular protein interactions Ozenberger amp Young 1995 Kuo et al 1992 e n some cases the DNA BD or AD fusion moiety may occlude the normal site of interaction or may impair the proper folding of the hybrid protein and thus interfere with the ability of the two hybrid proteins to interact van Aelst et al 1993 e Theconditions in yeast cells may not allow the proper folding or posttranslational modifications such as glycosylation required for interaction of some mammalian proteins Conversely the detection of a specific interaction between mammalian proteins in a yeast system does not necessarily indicate that there is a corresponding interaction in the proteins native environment Fields amp Sternglanz 1994 e Some protein interactions may not be detectable in a GAL4 based two hybrid system but may be detectable using a LexA based system such as the Matchmaker LexATwo Hybrid System Cat No K1609 1 Gyuris et al 1993 reviewed in Golemis et al 1996 and Mendelsohn amp Brent 1994 and vice versa We cannot predict which system will give the best results for particular protein interactions Clontech Laboratories Inc www clontech com Protocol No PT3247 1
53. s e c Myc Monoclonal Antibody 631206 e c Myc Monoclonal Antibody Agarose Beads 631208 e HA Tag Polyclonal Antibody Affinity Purified 631207 e GAL4 AD Monoclonal Antibody 630402 e GAL4 DNA BD Monoclonal Antibody 630403 General Reagents for Working With Yeast e Yeastmaker YeastTransformation System 2 630439 e Yeastmaker Carrier DNA 630440 e Yeastmaker Yeast Plasmid Isolation Kit 630441 e KC8 Electrocompetent and Chemically Competent Cells 630435 630434 e YPD Medium 630409 e YPD Agar Medium 630410 e Minimal SD Base contains glucose or galactose 630411 630420 e Minimal SD Agar Base contains glucose or galactose 630412 630421 e DO Supplements many e X a Gal 630407 General Cloning Reagents e Advantage 2 Polymerase Mix 639201 639202 e Advantage 2 PCR Kit 639206 639207 e NucleoSpin Extraction Kit 635961 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Appendix A Media amp Solution Recipes Media for Growth and Selection of Yeast Clontech carries a full line of yeast media including YPD SD with glucose or galactose with or without agar and Dropout DO Supplements ideal for use with Matchmaker Two Hybrid Systems and Libraries Please see Section XIII for ordering information If you purchased yeast media from Clontech follow the directions provided with the product Alternatively you can prepare your own media and DO Supplements using the detailed recipes provided in the Y
54. scale and 100 ml for a large scale transformation 23 Incubate cells for 1 hr at 30 C with shaking at 230 rpm 24 Pellet cells by centrifuging at 1 000 x g for 5 min at room temperature Remove supernatant Proceed to Step B 22 Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual XI Troubleshooting Guide continued Problem Failure to detect known protein interactions AD library plasmid activates all three reporters independent of the DNA BD bait Protocol No PT3247 1 Version No PR742219 Cause In sequential transformation AD transforms poorly even as empty vector Bait protein is mildly toxic or inhibiting to transformation High level expression of one or both of the hybrid proteins is toxic to the cell therefore transformants will not grow or will grow very slowly For this reason we recommend that you check for cell toxicity before performing a library screen Section VIII D The transformation efficiency of one or both plasmids is too low You may not be screening a sufficient number of library cotransformants This can be critical especially if the interacting target protein is encoded by a rare transcript in the source tissue If one of the following situations is occurring it may interfere with the ability of the two hybrid proteins to interact 1 the hybrid proteins are not stably expressed in the host cell 2 the fused
55. screening or when you do not have enough DNA for a library scale transformation Table V You can perform either seguential or simultaneous transformations e In a sequential transformation the DNA BD bait plasmid is introduced through a small scale transformation selected transformants are then grown up and transformed with the AD fusion library through a large scale transformation A sequential transformation may be preferred because it uses significantly less plasmid DNA than a simultaneous cotransformation Table V A simultaneous cotransformation is generally preferred because it is easier to perform than a sequential transformation and because of the risk that expression of the DNA BD bait protein may be toxic to the cells Ifthe DNA BD bait protein is toxic clones arising from spontaneous deletions in the DNA BD bait plasmid will have a growth advantage and will accumulate at the expense of clones containing intact plasmids e Library scale transformations are preferred when screening an AD library In the case of large and library scale simultaneous cotransformations you must determine the transformation efficiencies of both plasmids together as well as of each type of plasmid independently Example calculations are shown in Section IX D TABLE V COMPARISON OF TWO HYBRID TRANSFORMATION METHODS Amount No of Indep of Limiting Amount Transformation Clones Transformation Plasmid of Cells Efficiency Amplified No of Plates
56. st Strains The complete genotypes of AH109 Y187 and CG 1945 are provided in Table ll All strains are gal4 and gal80 this prevents interference of native regulatory proteins with the regulatory elements in the two hybrid system 1 Use AH109 as the host strain if you plan to screen an AD library using H S3 ADE2 and MEL1 2 System 3 Users Only Use Y187 as the host strain if you plan to test for an interaction between two known proteins using the acZ reporter only In addition use Y187 as a mating partner to verify protein interactions 3 Library Users Only Use CG 1945 as the host strain if you plan to separate DNA bait and AD library plasmids by cycloheximide counterselection Alternatively use pGBKT7 to construct your bait This DNA BD vector contains a kanamycin resistance marker therefore vectors can be separated in E coli without cycloheximide counterselection TABLE Il MATCHMAKER YEAST STRAIN GENOTYPES Strain Genotype References AH109 MATa trp1 901 leu2 3 112 ura3 52 his3 200 James et al 1996 gal4A gal80A LYS2 GAL 1y s GAL 1 z474 HIS3 A Holtz unpublished GAL2yas GAL2za74 ADE2 URA3 MEL 1yqg MEL1 qaqa lacZ Y187 MATa ura3 52 his3 200 ade2 101 trp 1 901 Harper et al 1993 leu2 3 112 gal4A met gal80A URA3 GAL Tyag GAL Iyara lacZ CG 1945 MATa ura3 52 his3 200 ade2 101 lys2 801 Feilotter et al 1994 trp 1 901 leu2 3 112 gal4 542 gal80 538 cyh 2 C Giroux pers
57. tchenko L Chang C amp Kuchibhatla S 1994 Great Lengths cDNA Synthesis Kit for high yields of full length cDNA Clontechniques IX 1 9 12 Chien C T Bartel P L Sternglanz R amp Fields S 1991 The two hybrid system A method to identify and clone genes for proteins that interact with a protein of interest Proc Nat Acad Sci USA 88 9578 9582 Dalton S amp Treisman R 1992 Characterization of SAP 1 a protein recruited by serum response factor to the c fos serum response element Cell 68 597 612 Durfee T Becherer K Chen P L Yeh S H Yang Y Kilbburn A E Lee W H amp Elledge S J 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit Genes Devel 7 555 569 Estojak J Brent R amp Golemis E A 1995 Correlation of two hybrid affinity data with in vitro measurements Molecular and Cellular Biology 15 5820 5829 Feilotter H E Hannon G J Ruddel C J amp Beach D 1994 Construction of an improved host strain for two hybrid screening Nucleic Acids Res 22 1502 1503 Fields S 1993 The two hybrid system to detect protein protein interactions METHODS A Companion to Meth Enzymol 5 116 124 Fields S amp Song O 1989 A novel genetic system to detect protein protein interactions Nature 340 245 247 Fields S amp Sternglanz R 1994 The two hybrid system an assay for protein protein interactions Trends Genet 10
58. te for constructing a library according to James et al 1996 Note A procedure for titering a plasmid library in E coli is in Appendix B Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual VIII Preparing for a Yeast Two Hybrid Screen continued C Verify that Constructs Do Not Activate Reporter Genes 1 Independently transform your DNA BD and AD fusion constructs into strain AH109 Assay the transformants for MEL 1 activation by selecting for transformants on SD Trp X a Gal and SD Leu X a Gal respectively Perform positive and negative controls in parallel See Section IX Table VI If a partner is known for your DNA BD bait use it to check whether an interaction is detectable before investing in a library search 2 Ifthe transformant colonies are white prepare stock plates and liquid cultures for freezing If transformant colonies are blue see Section XI for possible solutions D Verify Protein Expression 1 Independently transform the DNA BD and AD fusion constructs into strain AH109 2 Prepare Western blots from the transformants and probe the blots with antibodies to the c Myc and HA epitope tags Cat Nos 631206 631207 or the GAL4 DNA BD and AD Monoclonal Antibodies Cat Nos 630403 630402 Use untransformed yeast as a control See the YPH Section IV for protocols on preparing protein extracts from yeast
59. tes at room temperature for 15 20 minto allowthe inoculum to soak into the agar Invert the plates and incubate at 37 C for 18 20 hr or at 30 31 C for 24 36 hr e For pACT and pACT2 libraries incubate plates at 30 31 C for 36 48 hr Countthe number of colonies to determine the titer cfu ml Calculate the titer as follows e Dilution A No colonies x 109 x 103 cfu ml e Dilution B No colonies plating volume x 10 x 103 x 103 cfu ml Note A 2 5 fold range in titer calculations is not unusual especially if more than one person is doing the titering Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual Appendix C Plasmid Library Amplification You must amplify premade Matchmaker Libraries to obtain enough plasmid for library screening in yeast You will need 100 500 ug of plasmid DNA to screen 1 x 108 independent clones see Table IV Note pACT and pACT2 library customers If you observed plaques on your high density library titering plates Appendix B you may wish to use a lower temperature i e 30 319C when incubating the library amplification plates The lower temperature will require a longer incubation time as noted below If you follow this amplification protocol exactly through Step 7 a few plaques on the amplification plates should not affect the quality or yield of plasmid If you choose to include Step 8 be
60. timize the 3 AT concentration needed to control background growth Furthermore a low stringency screen may result in a population preference for clones exhibiting stronger activation of the HIS3 reporter and extra steps may be required to sort the clones into groups before you proceed with further analysis TABLE VI SET UP FOR A TWO HYBRID LIBRARY SCREEN Vectors Scale SD Minimal Medium Amount to Phenotype Plate pl Mel1 LacZ__ His Ade Control pCL1 S leu 100 Blue pGADT7 T S Leu 100 White pGBKT7 53 S Trp 100 White S Leu Trp 200 Blue S Ade His Leu Trp X a Gal 200 Blue pGADT7 T S Leu 100 White pGBKT7 Lam S Trp 100 White S Leu Trp 200 White S Ade His Leu Trp X a Gal 200 No Growth Experimental DNA BD bait L Lib Leu 100 White AD library L Lib Trp 100 White L Lib Low Leu Trpd f 100 White L Lib Medium His Leu Trpb 200 White Blue L Lib High Ade His eu Trp X a Galb 200 White Blue a S small scale L large scale Lib library scale b f necessary see Section V B 5 for guidelines on how much 3 AT to add To test the transformation efficiency of each plasmid dilute 1 ul of the transformation with 100 ul of H O Spread 1 ul onto 100 mm SD Leu and SD Trp plates d To test the cotransformation efficiency spread 100 ul of a 1 1 000 1 100 and 1 10 dilution
61. ucts by digesting with a freguent cutter restriction enzyme such as Alu I or Hae Ill Analyze fragment sizes by agarose gel electrophoresis also run a sample of the uncut amplified insert to check for multiple AD library plasmids Prepare a new master plate with a representative clone from each group If you are satisfied with the number of unigue clones proceed to Step 3 Notes To amplify AD library inserts we recommend the Matchmaker AD LD Insert Screening Amplimer Set Cat No 630433 and the Advantage 2 PCR Kit Cat Nos 639206 639207 If a high percentage of the colonies appear to contain the same AD library insert expand your PCR analysis to another batch of 50 colonies Alternatively eliminate the abundantclones by performing yeastcolony hybridization on each master plate Use a vector free oligonucleotide probe designed from the seguence of the most abundant insert Transfer a representative of each type of insert to a new master plate CAUTION Some positive colonies may contain multiple AD library plasmids evenifthe colony has been restreaked twice Therefore if a positive colony appears to have multiple AD library plasmids do notimmediately eliminate those that contain the abundant insert 3 Prepare a glycerol stock of each unique type and store aliquots at 80 C D Rescue AD Library Plasmids via Transformation of E coli 1 Library Users e ForstrainCG 1945 usecycloheximide CHX counterselectiontoobt
62. uots and store at 49C for a week or at 809C up to 1 yr e Titer the glycerol stock on SD Leu Trp Appendix B Incubate plates at 30 C for 3 4 days or until colonies are easy to count Calculate the cfu ul of library f Plate the amplified yeast cotransformants at high density on either e High stringency plates SD Ade His Leu Trp X a gal e Medium stringency plates SD His Leu Trp To compensate for possible errors in the amplified library titer plate 0 5 x 10 cfu on some plates and 2 x 10 cfu on others Also plate appropriate controls for comparison Note If you plate on medium stringency plates you must replica plate to high stringency plates to eliminate false positives g Incubate plates upside down at 30 C until colonies appear 5 Choose Ade His Mel1 colonies for further analysis Note After 2 3 days some Ade His colonies will be visible on the high stringency plates however incubate plates for 5 10 days to allow weak positives to grow Ignore small pale colonies that appear after 2 days but never grow to gt 2 mm in diameter True His colonies are robust and can grow to gt 2 mm Ade colonies will remain white to pale pink Ade colonies will gradually turn reddish brown and stop growing Stronger ADE2 expression will be white while weaker expression will be progressively more red 6 Option Perform a B galactosidase filter assay YPH D Calculations 1 Cotransformation Efficiency Cou
63. utation just upstream of the library insert in the AD plasmid by cutting at the Mlu site filling in the overhangs and then religating Bendixen et al 1994 Repeat the two hybrid assay you should not be able to detect the interaction 3 Generatesite specificdeletion orsubstitutionmutantsandrepeatthetwo hybridassay Assay the relative strength of the interactions using a quantitative p galactosidase assay YPH Protocol No PT3247 1 www clontech com Clontech Laboratories Inc Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual XI Troubleshooting Guide Problem DNA BD bait activates reporter genes Excessive background Low transformation efficiency Clontech Laboratories Inc Cause The bait protein has a transcriptional activation domain This is especially likely if the bait protein is a transcription factor Ma amp Ptashne 1987 Ruden et al 1991 Ruden 1992 Acidic amphipathic domains are often responsible for unwanted transcriptional activation Ruden et al 1991 Ruden 1992 Improper media preparation Resuspension of transformed cells in YPDA is too rich Improper media preparation A problem with simultaneous cotrans formation even though the transformation with the AD library plasmids alone gave atransformation efficiency of gt 5 x10 cfu ug and with the bait plasmid alone gave gt 10 cfu ug The AD library vector gave a transformation efficiency
64. vels of His3p expression and thus to suppress background growth on SD medium lacking His Fields 1993 Durfee et al 1993 b CG 1945 transformants are suppressed by the addition of 5 15 mM 3 AT In general AH109 does not require 3 AT However if your DNA bait produces background growth on SD His Trp plates you will need to optimize the concentration of 3 AT To optimize the 3 AT concentration plate cells transformed with your DNA BD bait plasmid on SD His Trp plates containing 0 2 5 5 7 5 10 12 5 and 15 mM 3 AT Use the lowest concentration of 3 AT which after one week allows only small lt 1 mm colonies to grow c A high concentration of 3 AT in the medium can kill freshly transformed cells Thus if you wish to use excess 3 AT to select only very strong two hybrid interactions we recommend using the low stringency selection protocol 6 Clumping For unknown reasons strain CG 1945 often clumps in liguid culture Disperse clumps by vortexing vigorously Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual VI Control Vectors Matchmaker Two Hybrid System 3 provides positive and negative control vectors Vector information is provided in Table IV A Positive Controls pCL1 encodes the full length wild type GAL4 protein and provides a positive control for a galactosidase and f galactosidase assays pGBKT7 53 an
65. y gentle inversion or swirling Do not vortex Heat shock for 15 min in a 42 C water bath 70 ul For large and library scale swirl occasionally to mix Chill cells on ice for 1 2 min Centrifuge cells for at room temperature at Remove the supernatant Resuspend cells in this volume of 1X TE Proceed to Section IX C for plating 5 sec 14K rpm 0 5 ml 0 6 ml Transformation Scale SMALL 1 5 ml 0 1 ug 0 1 ug 0 1 mg 0 1 ml LARGE 50 ml 20 100 ug 10 50 ug 2mg 1 ml 6 ml 700 ul 5 min 1 000 xg 1 0 ml or 10 ml LIBRARY 500 ml 0 2 1 0 mg 0 1 0 5 mg 20 mg 8ml 60 ml 70ml 5 min 1 000x g 10 ml 2 For simultaneous cotransformation we recommend a molar ratio of 2 1 DNA BD vector AD vector for optimal effi ciency For seguential transformations add either the DNA BD vector construct or the AD vector construct not both gt If using the high stringency selection method resuspend cells in YPDA The media will aid the yeast in recovery from the shock of transformation but will not adversely affect screening c Use 1 0 ml for simultaneous cotransformation Use 10 ml for the second transformation in a seguential transformation protocol Clontech Laboratories Inc www clontech com Protocol No PT3247 1 Version No PR742219 Matchmaker GAL4 Two Hybrid System 3 amp Libraries User Manual IX Library Transformation amp Screening Protocols continued C P
66. ysis The insert size of 15 randomly selected clones is determined by PCR amplification using insert screening primers Sequence Representation Sequence representation is evaluated by colony hybridization using a gene specific probe All Human Matchmaker cDNA Libraries must show a minimum f actin frequency of 0 1 and all other mammalian Matchmaker cDNA Libraries must show a minimum f actin frequency of 0 05 Nonmammalian cDNA libraries are screened with a ubiquitously expressed species specific probe Note The frequency of B actin positive clones varies among libraries made with RNA from different tissues and species A frequency of gt 0 1 in a human cDNA library suggests a reasonably high probability of finding a rare transcript Hagen etal 1988 For nonhuman mammalian cDNA libraries a frequency of 0 05 suggests a reasonably high probability of finding a rare message Clontech observations unpublished Presence of Genomic DNA or rRNA Sequences in cDNA Libraries The purified poly A RNA used to construct Matchmaker cDNA libraries is not treated with DNase due to potential degradation by contaminating RNase activity Therefore the poly A preparation may have lt 1 of genomic DNA and lt 5 of rRNA PCR based Sequence Screening Human cDNA libraries A representative sample up to 107 cfu or gt 10 pfu of the total library is used as a template in a PCR reaction with human B actin PCR primers These primers amplify a 1 1 kb

Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker GAL4 Two-Hybrid System 3 &amp; Libraries User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents

Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual