Home

Molecular Manual (pdf file) - Daniel L. Nickrent

1. 44 Genes Commonly Amplified 46 SECTION 8 PURIFICATION OF PCR PRODUCTS FOR USE IN SEQUENCING REA o4 LO om 56 Column Purification using EZNA Cycle Pure 56 DEAE Nylon Membrane PEOtoGOL c cire tnde adis tef uet 58 Direct Precipitation of PCR Product using PEG eee ene 60 SECTION 9 TA CLONING AND SEQUENCING OF PCR PRODUCTS 61 i riacorsttre roi ERE RO e CL 61 Ligation and Cloning of PCR Products statue en taa 64 Transformation of Competent Cells Chemical Heat Shock Method 65 Plasmid Mini Prep EZNA Column Method eene ene 66 Plasmid Mini Preparation and Insert Confirmation Alkaline Lysis Method 68 Restriction Digest of Plasmid DINU is oae dix UH reserva Sp Se TE EE In x E vd 69 Colony PCR An Alternative to the 4 44 4 70 SECTION 10 DNA SEQUENCING REACTIONS cereis 71 How Sequencme Reactions a oed t blat RTI 71 SEqUeHe TIS o eese RI dd at en fct 73 Purifying Cycle Sequencing Products using Sephadex CENTRI SEP Columns
2. sese ene 22 PEG Purification of Genomic DNA eee te ey tuat eui es 24 Gel Spin Method of Cleaning Genomic DNA sse enhn ennt 26 Acacia DNA Extraction Miniprep Method sess enne enne 28 EZNA Plant DNA Miniprep Short Method for Dry Samples eese 29 SECTION 4 PLANT RNA EXTRACTION jccisscosssssscssovesssasssssevavevsousssessovevesvesssesoonsvesesaseossens 30 General Consideration and e de ee esee 30 RNA Extraction Using Hot Borate 31 TRIZOL RNA Isolation Method o rete eene e ee 33 Simple Plant RNA Extraction tere see EUR RAN EARN IA VERRE NON ERO e 35 NUCLEIC ACID CONCENTRATION FLUOROMET RY 0 001 4 04 4 36 SECTION 6 AGAROSE GEL ELECTROPHORESIS 440 49 44 00 37 1 amp 5 37 Preparing Samples and Running Minigels eese enne 38 Staining and Imaging to os aatem uites be Quads 39 Inactivatng Ethidium Bromide seemed oo rete aes se Ru oq du E 41 SECTION 7 POLYMERASE CHAIN REACTION 0 0 42 How roi d A EEEE AAt 42 Symmetrical
3. 91 Chemiluminescent Detection of Digoxigenin Labeled Probe Hybridization 93 SECTION 14 SOLUTION RECIPES wiscscasescecascusssstesescinsssceacecstsvecssssvasesdossnscoascssctescurdsscevessses 95 SECTION 1 LAB RULES AND SAFETY Room Organization and Equipment My laboratory is well equipped to conduct projects involving isozymes and nucleic acids RNA and DNA This lab contains a number of sensitive and expensive pieces of equipment each of which requires some knowledge for its proper operation For the high speed and ultra centrifuges you must be checked out by DLN prior to use As a general rule if you do not understand how to operate a piece of equipment ASK before proceeding If it appears that the instrument is malfunctioning unusual noises movements etc please discontinue use and report the incident The rooms that are available to researchers working in my lab are listed below with their major equipment items Rm 1046 main lab Balance analytical Ohaus GA 110 Balance top loading Ohaus GR 4100 Freezer ultralow 80 C Revco Freezer upright 20 C 22 cubic ft Lab Research Gel rigs agarose electrophoresis various sizes Owl Heat block Equatherm Temp Blok Homogenizer Brinkman Polytron Homogenizer Omni Hotplate stirring Corning PC 320 Incubator 37 C Gravity Convect Fisher 655D Microcentrifuge Sorval in dairy case Microcentrifuge Fish
4. KK K For Agarose Gels That Contain Ethidium Bromide Agarose gels contianing ethidium bromide are placed in a large mouth container that is labeled with the red and white sticker provided by the Center for Environmental Health and Safety Their campus telephone number is 453 7180 Personnel from this office will pick up and dispose of this waste after a request is made form filled out on their website at http www cehs siu edu K K K K K K K K K K K K 41 SECTION 7 POLYMERASE CHAIN REACTION How PCR Works The polymerase chain reaction PCR is an in vitro method of enzymatically amplifying increasing a small amount of target DNA as much as 108 fold This amplified DNA can then be used for cloning sequencing or other molecular applications The process is composed of three steps DNA denaturation primer annealing and chain extension see figure below These processes are facilitated through the use of a thermal cycler a programmable machine that can achieve temperatures from 0 C to 100 C can rapidly change from one temperature to the next and can hold any temperature for a specified amount of time The enzyme that can survive these extreme temperature changes without significant degradation is Taq polymerase isolated from Thermus aquaticus a thermophilic bacterium During denaturation the target DNA is melted i e the strands of the double Thermocycle Profile helix come ap
5. Equipment and supplies Squirt bottle filled with Sarcosyl rinse solution Centrifuge and rotor precooled to 4 e g Sorval Test tubes glass 2 5 X 20 cm baked with SS 34 rotor Water bath set at 37 C and another at boiling Centrifuge tubes glass 25 ml Corex one tube each per sample Reagents Centrifuge tubes polypropylene 50 ml sterile Ammonium acetate NH OAc 4 M Corning 25330 or next Lithium chloride LiCl 2 M Centrifuge tubes polyallomer 50 ml Nalgene Lithium chloride LiCl 10 M autoclaved Funnels glass baked Liquid nitrogen Potassium acetate KAc 2 M pH 5 5 Potassium chloride KC1 2 M Protease K powder stored in Miracloth or cheesecloth 9 X 9 squares 50 units 1 ml aliquots in the freezer autoclaved Sodium borate buffer 0 2 M borate 30 mM Mortars and pestles baked EDTA 5 mM dithiothreitol Pasteur pipets baked Sodium dodecyl sulfate SDS 2096 w vol Pipets plastic disposable 10 ml and bulb STE buffer salt Tris EDTA Polytron Brinkman homogenizer with the 2 0 TE buffer cm diameter generator autoclaved Organics chloroform isoamyl alcohol 24 1 Tris Spoonulas or spatulas baked buffered phenol cold 7096 and 10046 ethanol 1 Make up the appropriate volume of borate extraction buffer for the number of samples you wish to process 25 ml per sample The SDS is best added after the samples have been homogenized to minimize foaming P
6. Molecular Methods Molecular Methods in Plant Biology Fourth Edition Daniel L Nickrent Department of Plant Biology Southern Illinois University Carbondale IL 62901 6509 Revised January 2006 Copyright O 2006 by Daniel L Nickrent CONTENTS SECTION 1 LAB RULES AND SAFETY 1 2 1 4 Room Organization and Equipment pee ee a tetany 4 Specifics on Equipment Operation and Maintenance esee enne 6 orci M n 8 Chemicals ER 10 SECTION 2 INTRODUCTION Yn ta an seis 11 Molecular Methods in Plant Biology UN NOH ORE 11 Review of Metric rS e di ette nie an v aR re 11 Flow Chart of Protocols Plant Tissue to DNA Sequence eere 12 SECTION 3 PLANT GENOMIC DNA 0 0 0 0049 41 14 General Considerations and 14 Plant Genomic DNA Extraction using CTAB Mini 2 16 Plant Genomic DNA Extraction using CTAB Large Scale esee 18 Genomic DNA Extraction Mini Prep for High Carbohydrate Plants 20 Cesium Chloride Purification of Genomic DNA
7. Z SL ESBT 02 ai GUT 8027 6207 02 85 2 ST AM GYT SEST STST 2 aJ 25 2 6ET 9 T ST ai Qc ai 95 SSTT SETT ST 056 T86 296 02 A 55 2 906 688 ST AM yS 29 299 Sl AMT t 9 t59 Q7 65 2 E r BT AM 65 99 25 ST e 96 62 802 OT 892 582 292 02 a 25 282 02 ST AM Op Tr 22 94 v SIT 09 1 02 62 5 92 92 152 EM SDN 10131504 9215 1 921 v95 15v 2D 5D 0 515 21v 501 M DL 9 265 199 515 WL 21 2855092991901 2 WV LD VOD WO DV WL WLW 119 265 vov YO D5 51 0 555 IUL 2 DS v0 Wy Wb 195 99 19 20 LD 9D 21 DV WS D1 111 Wy 155 WS WL D1 VL 20V DLL VO Li 9 515 vov 101 SW 2D DW 51 999 201 1D 1D VLL 115 LLL 201 WO 901 15 1LL 201 WD 501 W 99 1 200 LD 201 51 VOL 20V W DLL 20V DLL D 900 2D 200 W 192 W1 22 DV 502 2D LL 900 919 WD 919 20V UV 2D VD 2D 229 WI JD 219 22 20 91 201 DV W VLL 201 DLL 90 202 1 DV WS 55v 5D 21 DS 90v 201 90v VOD 101 WO LLL 515 201 901 DD 9 vov VOL 152 319 SLL ILL 202 219 200 205 v9 50v 2D 21 200 Liv 201 255 Su 900 JW IW VID ILL V9 2D W DV WO DL 20 INL WL IVL D9 201 201 20 INL VOL INL DS 01 DL 19 9290 W1 1911 91 555 5D 9 D 55 SIN GLEE ST 191 LD 20v VLL VOV 515 SIS N SOEE TSEE ST WV 9D WD ND WL SXE tvtE 52 9 VOL DVD UY 90v 205 DD 1D 265
8. 1 TAE fluorometer agarose gel if clean single Strong ban if not clean single Strong band lighter than the ladder Reamplification w Prome Pri Se ion ga pGEM T Easy rinceton Separation Inc al onei one Vector System Il A1380 ed PCR Comes w chemically Ethanol precipitation check gel Dry in select transformants Speedvac 8 Colony PCR 9 Plasmid Mini Preps _ 12 Acrylamide Gel Electrophoresis EZNA Plasmid Miniprep Kit 1 V spin column 13 SECTION 3 PLANT GENOMIC DNA EXTRACTION General Considerations and Rationale Three components necessary for successful nucleic acid extraction are 1 inhibition of nucleases 2 removal of proteins and 3 physical separation of the nucleic acid from other cellular components Nuclease inhibition and removal of proteins are not mutually exclusive and often a particular step such as phenol extraction accomplishes both Inhibition of Nucleases Detergents inhibit nucleases and help separate the proteins from the nucleic acids A common detergent is sodium dodecylsulfate SDS Avoid the use of potassium salts or temperatures below 10 with SDS since this may cause precipitation of the detergent One of the most widely used detergents for plant DNA extraction buffers is CTAB cetyltrimethyl ammonium bromide CTAB is most often used in a 296 w v solution Rogers amp Bendich 1985 Doyle amp Doyle 1987 Nickrent 1994 Removal of P
9. 194 9J ju 81 91 G 77u41 uoibey 5 71 10 1sejdoJj0 u 5 54 922 919 229 IN 292 VID VJA 9 9 1VLl 55V DVL VOL v39 LW 221 1V2 9uL 215 992 1 9 192 1 9 922 1 9 199 921 922 21V 922 21 LLL ILL 292 2 9 CSZ dZ ldW MN3bu 98471 4971 02 DD YLL 122 VW 92 82 47 00vl 441 30 OTPT ZEET 6T 2 WLY DVD OW C dZ j N3bu 6921 5277 6T 1 1V 21 229 DDL C6T dZ 2T1N N3bu 6987 2987 6T 1 291 SLL 1V9 9 DAD 292 99 42 2 441 0 7021 0611 8T 221 VLY 22V 29V Cr dZ TN N3Du QSST TEST 07 919 OOY A29 991 911 291 2 97 v4 N3bu OPOT EZOT OZ OV 122 L WDD 292 6 47 vlN N3Du 78271 89741 Q2 9V DDL 511 99 UWL OL 40jTyp40439 6S2 0v4 TZ VOL 199 922 922 C8v dZ 7871 8971 02 V2 992 ODL 511 55V UWL 1 40429433404 6SZ TrZ 02 VL 122 DVD 15D DLV 09 47 STN N30u SO9T SPOT TZ 921 20V AWD LVV 129 ODA 121 2 42 24 M10u 9 565 02 91 ODL ODL LLY 112 99 043 1 YPU 6 ST 29ST 6T 2 191 229 220 1 9 VIV CEOT dZ 025 Jd1 30u 205 705 6T 2 OVW 298 V5V VOV A YZSST440Y YPU 6457 2557 Q2 19 ILD 219 92D DLV OWL VOL 40j6Sp0439 92v 8Sv TZ DVD 999 VVL LVL JLL CHOT dZ OSZT Nd1 N3Du 21 822 6T 9 Juv 949 991 V99 LVV 991 4056573 30 92v 8Sv 02 19 219 OVD VOL VOL 5 97 2 0 p2T S271 6T 9 V19 29 992 991 99 1 9 dZ 02 441 2 21 ZT 92 29 Vi VON 29 47 0221 Wd1 MN3
10. 74 Purifying Cycle Sequencing Products via Ethanol Precipitation esses 75 SECTION 11 AUTOMATED DNA SEQUENCING THE ABI 377 76 Before the Gel RUD reete en Fi oi etel e n v Oe NEQUE 76 Cleaning and Assembling the Plates and Pouring the Gel eee 76 Jobs to do While the Gel 1s PolyT e o etae e o aee resa 78 Gel TITAS and BUB erus ho sie DET eto eiu thas MR DM 80 POSE IRM M AR R EARTE AA E TEA E ARSE 81 Protocol Modifications when using Membrane Combs seen 82 Exporting Data to Other Computers caso tore e Papias 84 Editing Sequence Datso nienia teet debite uc ster Cu geodata tie 85 Interpretation of Sequence Data estu te eas ei ase tics ita ar Hae ep ed ee ive 86 SECTION 12 RESTRICTION DIGESTS AND SOUTHERN BLOTTING 87 Restriction Digestion of Plant DNA Lee eec 87 Agarose Gel Electrophoresis of Restriction 87 Southern Blotting Wet Transfer Method essen enne enne enne 88 SECTION 13 NON RADIOACTIVE HYBRIDIZATION eee ee 0 90 Probe Construction Using Digoxigenin in a PCR Amplification eee 90 Hybridization with Digoxigenin Labeled
11. A typical step up procedure e g for matK is shown below The general idea here is to first amplify relatively nonspecific templates and then increase the annealing temperature to realize higher stringency This protocol should be tried if there are mismatches at primer binding sites Denaturation 94 for 5 min 5 cycles 94 for 1 minute 46 for 1 minute 72 for 2 minutes 35 cycles 94 for 30 sec 50 for 30 sec 72 for 1 5 minutes Final Extension 72 C for 10 minutes Hold indefinite time 4 C A typical touch down procedure e g for trn T L F is shown below The general idea here is to first amplify specific templates and then decrease the annealing temperature to allow the polymerase to function more efficiently on the specific templates Denaturation 94 for 5 min 5 cycles 94 for 30 seconds 52 for 30 seconds 72 for 1 minute 33 cycles 94 for 30 sec 48 for 30 sec 72 for 1 minute Final Extension 72 C for 10 minutes Hold indefinite time 4 C When the thermocycler GeneAmp has the lid heated ca 5 minutes place the plastic tube rack on the heat block Place the tubes in the wells and use the roller to ensure the lids are tightly closed Close the heated lid and begin the thermocycle program To determine whether the amplification was successful the PCR products are run on a 196 TAE agarose minigel Remove 4 ul of the PCR product mix wit
12. EZ VV 1V9 VLD V59 1V9 921 OVL JVV 40 91 281 691 OZ 0 VVV 919 LIV VLD VLL 55V Ads Z un 61 5 V19 V59 1 9 921 9 1 JVV 20382 26 4 02 10 29 LVL LIV LVL DVD OVD 951 6251 051 02 V9 119 21 OVL LIV 51V 4090 lt 0 lt 02 95 vWD 921 LWL V5V L8 L 2061 1861 12 DVL VVV WOL VLV VLV 203 2174 Us uonu S SZ VW 1V9 LLL VOL 19 LVL 921 V19 92 1 1 9261 81 119 WV 129 V9 VLL LOL 40 OLZ EZ V9 LLL VOL MLD LVL DVD 921 V19 0291 OLEL LEZL 12 921 1 LL VIV LVL 5vv 921 1286 1 uonu S 61 1 221 VLL 911 DLV 22V VLD 1 EEB S8 8 12 29 1 LV VVL 79 1 9 1662 61 1 LVV 219 92 199 911 Olr 80t 16 81 921 VOL LVV 91 99 103 1 2041 6 5 12 VVL LLL 299 219 VLD VOV 199 8911 20 686 61 V 192 1V9 LIV VOL LIV 10 p LGE MUI 5 xun s 61 9 92 VOL DWV 129 119 999 eueN uonisog ezis S 9 uenbes JeulJd uonisog ezis S 9 uenbes 1 01 82 old 6 ves L6E 06 014 89 esz LL SjJouuud lt lt lt lt lt lt lt S S8C 6291 46 vqsd 91591 UOJ UI yu 4 0001 008 009 ooz yu 4 6 gt gt gt gt ee old L8v I 9ZEL OZY 8 01 2 94 8911 1se jdoJ40
13. H20 to 100 ml Store in 50 ml aliquots at 20 C Method 1 Perform Southern blots using charged nylon membranes MagnaGraph works well 2 Place the membranes in a heat sealable bag that has been rinsed with water Add 20 ml of hybridization solution per 100 cm of filter seal Prehybridize 1 hour at the hybridization temperature Hybridization conditions Stringent Use Casein Hybridization Solution at 68 for homologous probes OR 5096 Formamide Hybridization Solution at 42 Decrease temperature as necessary Background is usually decreased when using formamide solution Less stringent Use Casein Hybridization Solution at 55 OR 2596 Formamide Hybridization Solution at 42 C Decrease temperature as necessary Background is usually decreased when using formamide solution 3 Denature probe at 95 C in a heat block for 10 min right before use Use 5 yl of digoxigenin labeled probe per ml of hybridization solution Mix well 9 4 Cut off a corner of the bag and squeeze out the prehybridization solution Immediately add 2 5 ml of hybridization solution with denatured probe per 100 cm of filter seal Hybridize overnight at the hybridization temperature in the hot shaker 5 Cut off a corner of the bag Squeeze the hybridization solution into a tube and store at 20 The hybridization solution is stable for over one year at 20 and may be reused multiple times 6 Wash the membrane 2 X 15 minutes in 20 ml
14. 403 403 ZZET 2821 6921 S9T TEST 8 91 9 EGET 8ZET ZvET ZZET 403 226 OSTT VETT 403 9907 403 404 403 403 404 404 404 196 OES 99 64 ZE ZT EZ 816 106 T8S 99S 185 995 226 206 26 26 25 26 2 21 61 092 9T 9T 21 81 9T 9T 9T 02 02 vc v 02 2 2 02 10121504 215 196 065 4 99 221 ADV 292 5v5 DAV 1 229 229 21V 192 5vv SVL 122 21V 155 3v9 2 2 VLL 99V WL VOL v39 v29 122 221 DLV 9V9 V19 5vv 19 vov 21 v5 12V 55V vo v22 991 vv 921 291 221 2 ADL Juv WL 5VA 919 919 219 v39 v39 221 1 9 115 911 911 991 21 e uenbes 1 0002 0081 0091 00 00 0001 gt gt gt gt gt gt gt gt gt gt gt de gt 6971 6 65 veel LELL S06 58 929 1295 82v OLE Stl 1513 62 lewosoqiy 581 48 aJ 9EEE ELEE SSEE GT SIS 89 E TSEE ST ai GBEE OSEE 02 Aad WHEE ELEE DHEE OE ABI 2 2VEE EZEE 02 015 7 ZZTE 0TTE ST ai BE tGOE v 0 22 09 52 1562 9662 ST TS 9262 1682 ST Aas 28 2 182 86 2 02 215 2 5 92 892 gt OAE 8 2 0 92 LT aJ 92 2 2952 ET 5 2 202 0682 ST 15 2 9IZ 9vTZ ST aJ PETZ 8972 0512 2 65 2 6 ST AAI
15. C freezer and then place in refrigerator 4 for 4 hours 9 Centrifuge at 9 000 rpm for 15 minutes at 4 As soon as the rotor stops spinning pour off the supernatant keep the pellet 10 Add 5 0 ml of ice cold 2 M LiCl to the pellet Resuspend and wash the pellet by moving it up and down in the pipet 11 Centrifuge at 9 000 rpm for 15 minutes at 4 As above pour off supernatant as soon as possible 12 Resuspend the pellet in at least 2 0 ml of 2 M potassium acetate pH 5 5 Use more for exceptionally large pellets Resuspension at this stage often requires vortexing and possibly gentle heating in 37 water bath 13 Add 2 5 volumes ca 6 0 ml of ice cold ethanol Store sample at 20 for 2 4 hours overnight is OK 14 Centrifuge the Corex tube at 8 500 rpm for 15 minutes at 4 Pour off the supernatant and let the pellet dry briefly Dissolve the pellet in 5 ml of STE buffer 15 Add ca 2 5 ml of Tris buffered phenol pH 8 0 Add an equal volume of 24 1 solution of chloroform isoamyl alcohol use a glass pipet Cap mix thoroughly and let it stand on ice of 5 mins 16 Centrifuge at 7 000 rpm for 10 minutes at 4 With a sterile Pasteur pipet carefully remove the top aqueous layer and place in a clean sterile Corex tube Be careful not to draw any of the interface or lower phenol layer into the pipet 17 For every 3 ml of supernatant add 1 ml of 4 M ammonium acetate and 2 5 volume
16. C incubator prior to use 103 SECTION 15 REFERENCES Agudo L C I Gavidia P P rez Berm dez and J Segura 1995 PEG precipitation a required step for PCR amplification of DNA from wild plants of Digitalis obscura L BioTech 18 766 768 Anderson R D C Y Bao D T Minnick M Veigl and W D Sedwick 1992 Optimization of double stranded sequencing for polymerase chain reaction products U S Biochemical Comments 19 39 58 Baker S S C L Rugh and J C Kamalay 1990 RNA and DNA isolation from recalcitrant plant tissues BioTechniques 9 268 272 Berger S L and A R Kimmel 1987 Guide to Molecular Cloning Techniques Methods in Enzymology Vol 152 Academic Press Inc New York 812 pp Casanova J L C Pannetier C Javlin and P Kourilisky 1990 Optimal conditions for directly sequencing double stranded PCR products with Sequenase Nucleic Acids Res 18 4028 Chase M W and H H Hills 1991 Silica gel an ideal material for field preservation of leaf samples for DNA studies Taxon 40 215 220 Chi H C J C Hsieh C F Hui and M F Tam 1988 Modified method for double stranded DNA sequencing and synthetic oligonucleotide purification Nucleic Acids Res 16 10382 Dieffenbach C W and G S Dveksler 1995 PCR Primer A Laboratory Manual Cold Spring Harbor Laboratory Press Do N and R P Adams 1991 A simple technique for removing plant polysaccharide contaminants from plant DNA
17. Place the top plate the one with the ears on Make sure the plate is oriented correctly If the top plate gets assembled inside out the gel will not pour correctly as the gel will pull away from the hydrophobic lines Also if you use the comb clamp or upper buffer chamber with the top plate inside out you will put another hydrophobic mark on the real inside of the plate and it won t work in either direction until the marks are cleaned off with 1096 hydrochloric acid 8 Slide the plates to the bottom of the grey cassette until the notches of the rear plate catch on the plate stops of the cassette you can not push the plate any further 9 Make sure the bottoms of the top and rear plates are flush 10 Put top clamp on the gel and lock it into place 11 Put the bottom gel injection device on and clamp it into place Be sure the hole orange gasket is exactly aligned with the hole in the plastic device 12 Lock the plates in place by turning all the cassette clamps to the closed position 13 If you are not using the plates the same day you wash them you may want lightly cover the ends with dry Kimwipes or plastic wrap or at least place the straight edge of the comb between the top of the plates helps to keep dust etc away from the exposed areas of the plates WARNING Unpolymerized acrylamide is highly toxic It is a strong neurotoxin and carcinogen People have died a slow painful death from mishandling this stuff Wear glo
18. S Stoffel S J Scharf R Higuchi G T Horn K B Mullis and H A Erlich 1988 Primer directed enzymatic amplification of DNA with thermostable DNA polymerase Science 239 487 49 Saiki R K U B Gyllensten and H A Erlich 1988 The polymerase chain reaction Chapter 6 Pp 141 152 n Genome Analysis a Practical Approach K E Davies ed IRL Press Washington DC Sambrook J E F Fritsch and T Maniatis 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Press Sanger F Nicklen S and Coulson A R 1977 DNA sequencing with chain terminating inhibitors Proc Nat Acad Sci USA 74 5463 5467 Schierenbeck K A 1994 Modified polyethylene glycol DNA extraction procedure for silica gel dried tropical woody plants BioTech 16 392 394 Scott K D and J Playford 1996 DNA extraction technique for PCR in rain forest plant species BioTech 20 974 979 Thein S L 1989 A simplified method of direct sequencing of PCR amplified DNA with Sequenase T7 DNA polymerase Comments US Biochemical 16 8 Thompson D and R Henry 1995 Single step protocol for preparation of plant tissue for analysis by PCR BioTech 19 394 400 Zhang H R Scholl J Browse and C Somerville 1988 Double stranded DNA sequencing as a choice for DNA sequencing Nucleic Acids Res 16 1220 108
19. you only have to follow the manufacturer instructions Example kits include QI Aquick PCR Purification Kit QIAgen JETquick GENOMED and Wizard PCR Pre DNA purification System Promega We have found the EZNA Cycle Pure kit to be comparable to more expensive ones Column Purification using EZNA Cycle Pure Kit 1 Because you ran 4 ul of your PCR product on a gel you have 21 ul of sample left Add one volume of Buffer XP1 Vortex to mix 2 Load all 42 1 of sample to the HiBind DNA spin column Centrifuge at 10 000 x g for one minute Discard the liquid from the collection tube sink 3 Add to column 700 ul of SPW buffer Note this buffer must be first diluted with ethanol for use Centrifuge at 10 000 x g for one minute Discard the liquid from the collection tube sink 4 Repeat no 3 5 Centrifuge the column without buffer for two minutes to remove residual ethanol 6 Add 30 40 ul of Elution buffer lower amount for light PCR products at 65 70 C use heat block Let stand for one minute Centrifuge at 10 000 x g for one minute 7 Run check gel to estimate quantity of purified PCR product 56 Gel Purification of PCR Products using Qiaquick Gel Extraction Kit Gel Isolation of PCR Product 1 Pour a TAE agarose gel with the wider comb Use the graduated cylinder dedicated to ethidum bromide red tape When the agarose is cooled but prior to solidification add 0 5 jl of ethidium bromide Use comb with wider
20. 1996 Preparation of T overhang vectors with high PCR product cloning efficiency BioTechniques 20 20 22 Hall T C Y Ma B U Buchbinder J W Pyne S M Sun and F A Bliss Messenger RNA for G1 protein of French bean seeds cell free translation and product characterization Proc Natl Acad Sci USA 75 3196 3200 Hansen H H Lemke and U Bodner 1993 Rapid and simple purification of PCR products by direct band elution during agarose gel electrophoresis BioTechniques 14 28 29 Hattori J S Gottlob McHugh and D A Johnson 1987 The isolation of high molecular weight DNA from plants Anal Biochem 165 70 74 He M H Liu Y Wang and B Austen 1992 Optimized centrifugation for rapid elution of DNA from agarose gels Genet Anal Tech Appl 9 31 33 Hillis D M B K Mable A Larson S K Davis and E A Zimmer 1996 Nucleic acids IV Sequencing and cloning Pp 321 384 in D M Hillis C Moritz and B K Mable eds Molecular Systematics Sinauer Associates Sunderland MA H ltke H J G Sagner C Kessler and G Schmitz 1992 Sensitive chemiluminescent detection of digoxigenin labeled nucleic acids a fast and simple protocol and its applications BioTechniques 12 104 113 Holten T A and M W Graham 1991 A simple and efficient method for direct cloning of PCR products using ddT tailed vectors Nuc Acids Res 19 756 105 Innis M A and D H Gelfand 1990 Optimization of PCRs
21. BioTechniques 10 162 166 Doyle J J and E E Dickson 1987 Preservation of plant samples for DNA restriction endonuclease analysis Taxon 36 715 722 Doyle J J and J L Doyle 1987 A rapid DNA isolation procedure for small quantities of fresh leaf tissue Phytochem Bull 19 11 15 Dretzen G M Bellard P Sassone Corsi and P Chambon 1981 A reliable method for the recovery of DNA fragments from agarose and acrylamide gels Anal Biochem 112 295 298 104 Ems S C C W Morden C K Dixon Wolfe C W dePamphilis and J D Palmer 1995 Transcription splicing and editing of plastid RNAs in the nonphotosynthetic plant Epifagus virginiana Plant Molecular Biology 29 721 733 Erlich H A D Gelfand and J J Sninsky 1991 Recent advances in the polymerase chain reaction Science 252 1643 1651 Fang G S Hammar and R Grumet 1992 A quick and inexpensive method for removing polysaccharides from plant genomic DNA BioTechniques 13 52 54 Guidet F 1994 A powerful new technique to quickly prepare hundreds of plant extracts for PCR and RAPD analyses Nuc Acids Res 22 1772 1773 Gyllensten U B 1989 PCR and DNA sequencing BioTechniques 7 700 708 Gyllensten U B and H A Erlich 1988 Generation of single stranded DNA by the polymerase chain reaction and its application to direct sequencing of the BLA DQalpha locus Proc Natl Acad Sci USA 85 7652 7656 Hadjeb N and G A Berkowitz
22. CI 7 17 5 ul 8 6 CTAB 0 7M NaCl 8 7 5 1 10 sacosyl Extraction Buffer 100 ml Wash Buffer 100ml 3 2 g sorbitol 6 4 g sorbitol 5 0 g PEG 6000 5 ml 1M Tris pH 8 0 1 26 g sodium sulphite 1 26 g sodium sulphite 2 5 ml 1M Tris pH 8 0 5 ml 0 5M EDTA pH 8 0 0 5 ml 0 5M EDTA pH 8 0 0 1 ml 8 mercaptoethanol 250 mg BSA bovine serum albumin Make up to 100 ml with H O 125 mg spermine 125 mg spermidine 250 ul B mercaptoethanol Make up to 100 ml with H O 29 EZNA Plant DNA Miniprep Short Method for Dry Samples Have ready to use waterbath set to 65 ethanol 10096 sterile water at 65 RNase stock solution at 20 mg ml e mercaptoethanol 10 mM Tris pH 9 0 at 65 C isopropanol 1 Weigh up to 10 mg of dry tissue samples silica gel herbarium specimen Place in mortar and grind to a powder using liquid nitrogen 2 Transfer powder to a 1 7 ml microfuge tube Add 600 j1 of Buffer Add 20 u1 RNase 20 mg ml Vortex and incubate at room temperature for one minute Add 10 ul of B mercaptoethanol and vortex to mix disperse all clumps 3 Incubate sample in 65 waterbath for at least 5 minutes mixing twice by inverting tubes during this time Miquel s modification for herbarium material incubate overnight 4 Add 140 ul of Buffer P2 and vortex to mix Centrifuge at gt 10 000 x g for 10 min 5 Carefully remove 600 ul of supernatant to a new tube do not disturb the pellet o
23. Chapter 1 Pp 3 12 In PCR Protocols A Guide to Methods and Applications Academic Press New York Junghans H and M Metzlaff 1990 A simple and rapid method for the preparation of total plant DNA BioTechniques 8 176 Kessing B et al 1989 The simple fool s guide to PCR Unpublished manual from a group at the Department of Zoology University of Hawaii Honolulu HI Kretz K A G S Carson and J S O Brien 1989 Direct sequencing from low melt agarose with Sequenase Nucleic Acids Res 17 5864 Krowczynska A M and Henderson 1992 Efficient purification of PCR products using ultrafiltration BioTechniques 13 286 289 Kusukawa N T Uemori K Asada and I Kato 1990 Rapid and reliable protocol for direct sequencing of material amplified by the polymerase chain reaction BioTechniques 9 66 72 Lanzillo J J 1990 Preparation of digoxigenin labeled probes by the polymerase chain reaction Biotech 8 621 622 Lindahl T 1993 Instability and decay of the primary structure of DNA Nature 362 709 715 Liston A and L H Riesberg 1990 A method for collecting dried plant specimens for DNA and isozyme analyses and the results of a field test in Xinjiang China Ann Missouri Bot Gard 77 859 863 Lizardi P M R Binder and S A Shart 1984 Preparative isolation of DNA and biologically active mRNA from diethylaminoethyl membrane Gene Anal Techn 1 33 39 Lunn G and E Sansone 1987 Ethidium bro
24. Shake tubes vigorously with vortex for 15 sec Let tubes sit at room temp 2 3 min Centrifuge tubes at 10 000 X g at 4 C for 15 min RNA Precipitation 1 Carefully pipette aqueous phase into a clean screw cap centrifuge tube discard interphase and lower phase Add isopropanol and 0 8 M sodium citrate 1 2 M NaCl 1 2 volume of the aqueous phase each Cover tube and mix by gentle inversion Let sit at room temperature for 10 min Centrifuge tubes at 10 000 X g at 4 C for 10 min RNA Wash ULP Discard supernatant Wash pellet with 20 ml of 7596 ethanol by votexing briefly Centrifuge at 10 000 X g at 4 C for 10 min Discard supernatant briefly dry pellet 5 10 min not longer Add 250 ul of DEPC treated H O to pellet Resuspend by pipetting up and down a few times Also add 200 1 RNase inhibitor 1 1 Incubate at 55 60 C for 10 min to resuspend pellet Transfer sample to microfuge tube 34 Centrifuge samples at 4 C for 5 min to pellet the material that would not resuspend 7 Pipette supernatant into new microfuge tube The concentration and quality of the RNA can now be determined e g with a spectrophotometer For optimal spectrophotometric measurements RNA aliquotes should be diluted with water or buffer with a pH gt 7 5 Distilled water with pH 7 5 falsely decreases the 260 280 ratio 35 Simple Plant RNA Extraction Modified from Ems et al Plant Molecul
25. The density of this solution should be 1 55 g ml with a refractive index at 20 of 1 386 2 Place a sterile 5 ml disposable plastic culture tube on the pan of an analytical balance Tare the tube and add 2 5 g of powdered CsCl Add 1 0 ml of Tris 10 mM pH 7 5 500 u1 of genomic DNA and 66 jl of ethidium bromide 10 mg ml in dH20 Add an additional 0 934 ml of Tris The final weight should be 5 0 g 3 With a sterile Pasteur pipet add the sample to the centrifuge tube It is important that the tube be completely filled otherwise it will collapse during centrifugation If necessary use the CsCl ethidium bromide solution to top off the tube Place the metal cap on the tube neck apply the heat sealer press until the cap melts down to the shoulder of the tube Remove the heat sealer and immediately apply the heat sink tool to cool the cap Take off heat sink If all the tubes are filled equally they should be the same weight 4 Place the tubes in the centrifuge rotor making sure to place a floating spacer on top of each tube Screw on the rotor cap Place the rotor in the centrifuge Follow the instruction on use of the ultracentrifuge Make sure you know how to use the centrifuge before starting it 5 Centrifuge at 80 000 rpm for 6 10 hours When the run is complete the tubes must be removed with forceps 6 Using long wave U V light observed the position of the DNA band The DNA can be recovered by using a hypodermic needle thr
26. and ethanol Home Made Spin Columns For those on a budget gel spin tubes can also be manufactured in the lab This method is a modification of one described by He et al 1992 It is especially useful as an alternative to CsCl gradient centrifugation for cleaning plant genomic DNA especially if very small amounts of DNA are present in a sample e g following extraction from herbarium specimens 1 Cut off a P 1000 tip so that it fits within a 1 5 ml microfuge tube 2 Stuff a little bit of glass wool Pyrex filtering fiber Cat No 3950 into the tip Use only enough to keep a chunk of agarose from going through do not overpack it or all the buffer you want to collect will get stuck in the wool 3 Autoclave the tubes You do they have to be completely dry before you use them so dry in an oven afterwards We found that microwaving them for 6 10 minutes also works OK if you re in a hurry 4 Run an acetate agarose gel as above and isolate the band s of interest Place the gel chunk in the spin columns 5 Centrifuge at ca 2800g for 45 seconds to one minute We use setting 6 on an Eppendorf Micro Centrifuge 5415C which is 6000 rpm or 2940 relative centrifugal force RCF 21 6 Remove the tip glass wool agarose from the tube There should be ca 10 20 yl of buffer at the bottom that contains your DNA We find that for genomic DNA lots is still left in the wool agarose present in the tip We have experimented with adding a
27. as much DNA hence less is wasted Ed Heist Zoology has a fluorometer that he let s us use to measure the quantity of DNA Calf thymus DNA will be used as a concentration standard The concentration of the calf thymus DNA standard is 100 ng ul We will dilute each sample 1000 fold with low range assay buffer The final concentration of the standard will be 100 ng ml The fluorometer will provide us with measurements of DNA concentration in ng ml Because our samples are diluted 1000X the concentration of the DNA in our tubes will be equal to 1000X the concentration provided by the machine For example if the fluorometer tells us the concentration of our diluted DNA is 25 ng ml we know that the concentration of DNA in our tube is 25 ng pl When the fluorometer is calibrated with low range assay buffer and 100 ng ml calf thymus DNA accurate measurements can be made in the range of 10 500 ng ml diluted 10 500 ng ul concentrated Quantify each sample twice In practice results that agree within 596 should be achieved You can record your results in the table like the one shown below Sample Reading 1 Reading 2 Mean 37 SECTION 6 AGAROSE GEL ELECTROPHORESIS Minigels are run to check for the presence of nucleic acids This is done for example after an extraction protocol to determine whether DNA or RNA was successfully isolated or following a PCR amplification to determine whether the reactions w
28. be flipped i e turned into the reverse complement to allow alignment with existing sequences For genes that were cloned and sequenced using a universal primer present on the plasmid the orientation of the fragment is not known A convenient way to quickly find the orientation is to copy the sequence and paste it into the window at NCBI BLAST http www ncbi nIm nih gov 80 BLAST and conduct a blastn nucleotide search This program will align your sequence with others like it thus giving you the proper orientation For genes longer than 700 bp we usually have to sequence it in parts For example rbcL is ca 1400 bp in length We usually get good sequence reads for 700 bp so a primer at the 5 end will generate enough sequence to overlap sequence generated from the primer at the 3 end When assembling these contiguous fragments contigs I paste the separate contigs into different windows Once the sequences are moved to the proper position aligned and edited they can be concatenated This is done simply by copying and pasting from one sequence line into the other Any conflicts between the two sequences on the parts that overlap must be resolved Generally one places less confidence in sequence generated near the 5 and 3 ends In some instances it is not possible to unambiguously assign a base to A adenine C cytosine G guanine or T thymine In these instances ambiguous bases can be used The following table
29. dH20 40 ul total Method 1 Amplify the gene of interest in the usual manner to determine the appropriate conditions for proper symmetric amplification prior to probe construction 2 PCR mix for probe construction 15 5 yl dH50 25 10X PCR buffer 25yl DIG dNTP mix i15yl 25 mM MgCl e 10 1 forward primer at 10 uM 10l reverse primer at 10 yM 05uyl DNA PCR product read Section 7 on considerations 05 ul Taq DNA polymerase 25 ul total 3 Amplify using the parameters determined in step 1 Use a thermocycler with a heated lid 90 4 The probe is ready to denature and use in a hybridization experiment 5 jl of probe per ml of hybridization solution No purification is necessary The probe is stable for over one year when stored at 20 Hybridization with Digoxigenin Labeled Probe Reagents e Casein Hybridization Solution 5X SSC 0 5 casein Sigma C 5890 0 1 N lauroyl sarcosine sodium salt 0 02 SDS Heat to 50 70 C to dissolve Store in 50 ml aliquots at 20 C e LP Buffer 1 0 1 M maleic acid 0 15 M NaCl pH to 7 5 with solid or concentrated NaOH autoclave and store at 4 C e Blocking Reagent 10 casein Sigma C 5890 in LP Buffer 1 Heat to 70 C to put into solution autoclave and store at 4 25 Formamide Hybridization Solution 100 ml 25 ml formamide 25 ul 20X SSC 20 ml blocking reagent 1 ml 10 N lauroyl sarcosine sodium salt 200 ul 10 SDS
30. ethidium bromide add the volume ca 750 ul of 1 butanol H 0 saturated Mix gently by inverting several times Centrifuge for 5 minutes at 4 C Remove the top phase and discard in the butanol waste container 11 To precipitate the genomic DNA add 2 5 volumes of ice cold 10096 ethanol The tube can be stored at 4 for several hours at this stage if desired or centrifuged immediately Centrifuge for 20 minutes pour off the ethanol Wash with 7096 ethanol centrifuge pour off and dry pellet Rehydrate the pellet in TE amount depends on starting amount of DNA and size of final pellet 24 PEG Purification of Genomic DNA Many molecular biological procedures such as PCR restriction endonuclease digestions and sequencing require relatively pure DNA In PCR for example plant DNA contaminated with those ubiquitous secondary compounds and carbohydrates is especially difficult to amplify For those of us interested in quick and dirty or should I say quick and clean methods of purifying genomic DNA this PEG method works amazingly well Although the yield of pure DNA is not as high as with CsCl this does not present a problem when PCR is the goal and only minute amounts of DNA are required It is much faster than purification using long ultracentrifugations and uses 1000X less ethidium bromide The method is based upon the principle that most secondary compounds RNA etc are smaller than genomic DNA and can be separated
31. following table Stock Solution Final Concentration Sodium acetate 2 5 M pH 5 2 5 5 0 25Mto0 3M Sodium chloride 50M 0 10 M optimal lt 0 15 M 1 50 vol Ammonium acetate 40M 13 filter sterilize do not autoclave The choice of salt is determined by the nature of the sample and the intended use of the nucleic acid Samples with phosphate or greater than 10 mM EDTA should not be ethanol precipitated since the salts will come down with the nucleic acid Butanol Extractions DNA can be recovered from dilute solutions by extracting with 2 butanol The water from the sample moves into the butanol which is discarded thus leaving a higher DNA concentration in 15 the aqueous phase Water saturated butanol is also used to remove residual ethidium bromide from samples obtained via CsCl centrifugation or agarose gel purification 16 Plant Genomic DNA Extraction using CTAB Mini Prep Record all information about the samples being processed specifically tissue type leaf flower etc state silica gel dried herbarium sample fresh weight taxon name and collection number on lab notebook paper filed in DNA Extraction book Remove aliquots of DTT and Protease K from freezer place in tube rack and put on ice once thawed Turn on water bath set to 37 C and heating block set to 94 C Fill the heating block wells with distilled water Label on caps enough 2 0 ml tubes as needed number 1 12 and add 1 3 ml of
32. gives the accepted convention for nomenclature of incompletely specified bases Symbol Meaning Origination R GorA puRine Y TorC pYrimidine M AorC aMino K GorT Keto 5 GorC Strong interaction 3 H bonds W AorT Weak interaction 2 H bonds H AorCorT not G H follows G in alphabet B Gor TorC not A B follows A in alphabet V GorCorA not T not U V follows U D GorAorT not C D follows C in alphabet N Gor Aor T or C aNy Gel artifacts may occur for a number of different reasons One of the most common ones involves band compression 2 or more peaks occurring at the same position This usually occurs because of secondary structural features of the DNA template that cause the polymerase to pause Also DNA that is unusually rich in G and C may not fully denature during cycle sequencing thus interferring with the polymerase For templates with high A and T primer binding is less stable and this may cause artifacts False priming can also occur during PCR and sequencing when two or more sites exist for primer annealing In PCR this results in more than one product in sequencing double peaks may appear In some cases this reflects an actual biological phenomenon e g a hybrid organism with different alleles Ultimately cloning may be necessary to properly sequence such alleles 86 SECTION 12 RESTRICTION DIGESTS AND SOUTHERN BLOTTING Restriction enzymes cleave DNA every 4 base pairs where 4 is the number of different nuc
33. in dark bottle in the refrigerator with a layer of buffer on the top Draw the phenol off the bottom for use 7 If the antioxidant 8 hydroxyquinoline is added to 0 1 final concentration e g 0 1 g per 100 ml phenol the shelf life of the phenol will be extended Potassium Acetate 2 M MW 98 148 g mole for RNA extraction 19 63 gm of KAc Bring up to 100 ml with DEPC treated H20 pH to 5 5 with glacial acetic acid Note the acetate concentration will be higher than 2 M see Maniatis 1982 p 447 Potassium Acetate 5 M MW 98 148 g mole 245 4 g of KAc Bring up to 500 ml with dH20 pH to 5 5 with glacial acetic acid Potassium Chloride 2 0 M MW z 74 56 g mole for RNA extraction 74 56 g of KCI Bring up to 500 ml with DEPC treated dH50 Potassium Chloride 3M MW 74 56 g mole for RNA extraction 11 1 8 g of KCl Bring up to 500 ml with DEPC treated dH20 Proteinase Protease K Solution for nucleic acid extractions Sigma P 2143 This particular type has 1 unit mg We want 50 units in each tube that contains 1 ml of water So for 10 tubes you need 500 mg For 20 tubes 1 g Recalculate if using another type of protease Dissolve in a small beaker and aliquot into microfuge tubes Ribonuclease T1 to remove RNA from DNA samples 1900 0115 31 total of 65 7 ul 125 000 units Add 1 0 ul stock for every ml of sample Ribonuclease A to remove RNA from DNA samples Add enough salt buffer 1 0 mM Tris
34. incubator upside down with lid slightly ajar for 30 minutes 2 Centrifuge the tubes briefly short pulse in the room temperature centrifuge 3 Eliminate down sink 200 u1 of the SOC medium and resuspend the cells by gently pipeting up and down Spread 100 jl of the transformation onto LB agar plates containing X Gal IPTG and ampicillin using a sterilized bent glass rod 4 Incubate overnight at 37 C Colony Selection 1 Remove the LB agar plates from the incubator and place in dairy case for at least one hour This helps the development of the blue white color of the colonies 2 Examine the colonies through the bottom of the petri dish using the stereo microscope in room 1052 Mark at least five positive pure white colonies with a Sharpie pen Do not pick colonies that superficially appear white but have a small amount of blue in the center Try to mark white colonies that are well separated from others to make picking easier 65 3 Back in the lab prepare the proper number of 15 ml sterile plastic tubes with blue or orange caps by pipetting 2 ml of LB medium with ampicillin Use the electronic pipetter with a sterile 10 ml disposable pipet 4 Using a sterile toothpick select a marked white colony by simply touching it Drop the toothpick inside the LB tube Continue for all desired colonies Usually we do two colonies per plate 5 Incubate with shaking Clark lab shaker incubator for 18 hours at 37 C Plasm
35. lv 02 125 221 4034 TSLI SZ 592 Sy 92 02 LAV WL 129 404 TSLI 907 S8 S 921 907 02 DLL 2vY 292 203 0 8 SBT Z8ZT 69ZT 94 64 S8 S 66 62 02 992 VJL 199 20 90 SBT 8 9 ZE 58 26 26 02 JLL DLL 50V 204 9 SBT 69 9 9UDN UOLZ1SOd Z1S e uenbes 9upN UO1LZ1SO0g 215 e uenbes uJeulJud 0001 00S ESLI 62 S8 S 25585 150 90 1 v2 Ses 0681 1691 lt lt 4 2 51 1 51 gt gt gt gt 206 592 62592 901585 26585 SLI 62 S8 S 2811 1 611 1029eds pequosuej jeujo1u 1e69 2nN 47 Add Adu 6921 52651 TETT S06 vS8 929 Add Add Add 496 827 OTE ST 94 64 94 76 Add T SIN 8v 07 0681 lt _ 2821 6971 1 6751 2951 2Svl ttvl 22 8821 6921 22 06511 0 229 526 506 12 v98 2v8 079 929 985 295 V2 SOv S8E OEE OTE T T THT 25 26 25 26 10131504 ezis 191 122 Vv IVS VO 29 115 129 WoL 922 21V 991 291 212129 55V 1 9 VLL 992 121 1 9 1 9 21 VLD VOL 992 999 299 LV JVL 399 55V vvv ULL VOL JLL 39V 115 212 WL DVV 211 Vo LVV JVL 212 921 VAD 199 52V vov 6 9 uenbes 1 5 9S19A9H LE9L 9071 201 lt lt lt lt 226 lt 8002 403 TSIT 404 0687 403 TEST 403 9071
36. of 2X SSC 0 1 SDS at the hybridization temperature Store in distilled water at 4 if not performing the detection immediately 92 Chemiluminescent Detection of Digoxigenin Labeled Probe Hybridization Reagents Washing Buffer LP Buffer 1 0 3 Tween 20 Make only as needed doesn t store well LP Buffer 2 Blocking Reagent diluted 1 10 in LP Buffer 1 Make only as needed LP Buffer 3 0 1 M Tris 0 1 M NaCl 50 mM MgCl pH to 9 5 Store at 4 C Anti digoxigenin alkaline phosphatase conjugate Boehringer Mannheim cat 1093 274 Lumi Phos 530 Boehringer Mannheim cat 1275 470 Method Volumes are for 100 cm of membrane steps are done with gentle shaking at room temperature except as noted Never allow the membrane to dry or it cannot be stripped effectively 1 Wash briefly 1 min in 20 ml of Washing Buffer 2 Incubate membrane 30 min in 20 ml of LP Buffer 2 3 Dilute 2 jl of anti DIG alkaline phosphatase conjugate at 75 mU ml in 20 ml LP Buffer 2 Incubate membrane 30 min in 20 ml of dilute anti DIG solution 4 Wash 2 X 15 min in 50 ml Washing Buffer 5 Wash briefly 1 min in 20 ml LP Buffer 3 6 Dilute 100 ul of Lumi Phos at 0 1 mg ml in 10 ml LP Buffer 3 Diluted Lumi Phos may be reused multiple times and is usually good for I week to 1 month depending on usage Store ina dark plastic bottle at 4 C 7 Incubate membrane 5 min in 10 ml of diluted Lumi Phos solution 8 Briefly le
37. same primers label a cocktail tube and determine the amount of dH 0 10X PCR buffer etc that can be pooled by multiplying each volume by the number of tubes required Obviously the DNA is omitted from the cocktail if the tubes are to contain different samples When doing more than 10 tubes add one more to account for pipetting error 17 0 ul dH 0 2 5 pl 10X PCR buffer 1 5 ul MgCl 0 5 ul dNTP dATP dCTP dGTP amp dGTP 2 5 mM each 1 0 yl forward primer 1 0 pl reverse primer 0 5 ul Taq polymerase 1 0 ul Genomic DNA straight or diluted e g 1 9 250 ul Total Promega M1901 500 mM KCI 100 mM Tris HCl pH 9 0 1 Triton X 100 Promega A3513 25 mM 1 19 dilution of stock solution 1250 ug ml 62 5 ug ml 10 uM In the final PCR reaction mixture the concentrations are Promega buffer 50 mM KCI 10 mM TrisHC 1 5 yM MgCL 50 dNTPs 0 4 uM forward and reverse primers 1 Unit Taq polymerase 30 50 ng genomic DNA 44 5 Dispense the correct amount of the cocktail mix to each numbered tube Add the genomic DNAs directly to the solutions The program parameters used for various genes vary considerably see attached Table The following represents a standard amplification protocol that works with many genes Denaturation 94 for 5 min 35 Cycles 94 for 40 sec 50 for 40 sec 72 for 2 5 minutes Final Extension 72 C for 10 minutes Hold indefinite time 4 C
38. to 1 0 ml and attach a 1 0 ml barrier tip Remove exactly 1 0 ml of the aqueous top layer again being careful not to disturb the interface or underlying chloroform if you do centrifuge the tube again Place the aqueous layer in the labeled 1 7 ml microfuge tube 10 Add 2 3 volume 667 u1 of ice cold isopropanol 20 C to each tube Invert several times to mix and place in 20 C freezer These tubes can remain in the freezer for days to weeks We generally precipitate the DNA overnight One can speed up the process by precipitating at 70 C for 20 minutes but this sometimes results in precipitating salts as well 11 Centrifuge the tubes for 15 minutes in the 4 C centrifuge dairy case 17 12 Remove the tubes to a rack Pour off the propanol into sink with running water and invert the tubes on a paper towel to drain After a few minutes the pellets can be dried further in the SpeedVac set at medium heat 13 Rehydrate the dried pellets in 300 yl of TE Mix using a pipet tip until the pellet goes into solution One can allow the pellet to hydrate at 4 C in the dairy case for ca 1 hour if desired If after this time there is still undissolved pellet in the tube it is unlikely that this is DNA To remove it one can briefly centrifuge the tube and then transfer the supernatant to a new tube Optional If one s sample has lots of RNA and you want to remove it RNase A at 1 mg ml can be added to the sample tube Th
39. toweling onto of 88 the filter paper to a height of a few inches Wrap the entire baking dish in plastic wrap Place a weight brick Sigma catalog etc on top of the stack Let the transfer proceed for 12 24 hours The rate of transfer varies depending upon the size of the fragments DNA less than 1 kb transfers within an hour whereas fragments gt 15 kb takes 15 hours or more 11 Peel off filter from gel and papers and soak in 5X SSC for 5 min 12 Allow filter to air dry on a sheet of Whatmann 3MM paper Sandwich filter between MM paper not 3 MM or heavier and dry at 80 under vacuum use gel dryer for 1 hour 13 Store filter in a sealed bag or use directly in hybridization experiment 89 SECTION 13 NON RADIOACTIVE HYBRIDIZATION Non radioactive hybridization techniques offer the advantages of stable probes inexpensive disposal and convenience The use of digoxigenin as a non radioactive label has been shown to be as sensitive as P for detecting picogram amounts of homologous DNA The following procedures were written by Laurie Achenbach SIUC Dept Microbiology and are modifications of H ltke et al 1992 and Lanzillo 1990 Probe Construction Using Digoxigenin in a PCR Amplification Reagents DIG dNTP mix 132yl 1 mM digoxigenin 11 dUTP Boehringer Mannheim cat 1093 088 27 10 mM dTTP i e Perkin Elmer cat ZN808 0007 40yl 10 mM dATP e 40yl 10 mM dCTP 40yl 10 mM dGTP e 12 1 yl
40. u5 52 1eoeds dq ZIT 1 SW 399 OVW GLET Z SOL WOW LUL A93 OZI Z 219 WW 999 A94 0201 2 OVV 929 A93 668 2 LOO 688 LV 292 WLW A93 pL9 Z WWW DLO OVW Ast 9 7 199 VL9 LOW 7 129 VL9 999 09 LLY VOL LVL 4103 OSET 9129 SL 102 921 2 WLO 125 LWW 102 OZT Z W595 203 0201 2 WLL 199 102 196 2 199 L L LVO 203 668 2 WwW VO 102 9 27 WWW 319 OVW 203 669 OL 103 26 2 LL9 WUL 102 129 2 WWO 403 VID LEL MOO 102 7 29L Www 403 I Z LOW awd WOO 403 I OV avd WOO zS 921 196 49 42 sue 0561 021 0201 S68 seg 7 vec lt lt lt lt lt lt lt lt lt lt _ lt lt S94 818 Jooeds Jooeds 00041 0001 009 oo Sjeuud gt o gt gt gt gt gt gt gt lt lt 9119Q4 9 61 vOZL 0201 688 29 ove 651 09 S68 7291 1sejdo10u5 53 21 VIV 2329 J V JV V L 19 999 1 9 555 SOV 2V9 155 LV VOL DLV 191 939 19V 399 92 VL SV DVL 59 1 V92 20 129 1 9 2591 VVV DVL e uenbes 1 104 103 6 Us 10 Ud lt me lt Jooeds Jooeds qug jU41 1u41 7WU4 Lud vv uoxo jul vvn vyn
41. using gel electrophoresis We have successfully used low melting point agarose e g NuSieveTm to purify genomic DNA whereby the band of interest is cut from the gel diluted with water and then used directly in a PCR reaction see Nickrent 1994 A disadvantage of this method is that agarose is still present with the DNA sample and from personal experience the samples cannot be repeatedly frozen and thawed NuSieve genomic DNA does remain useful for up to several weeks at 4 but this seems to be variable based upon the species We have also successfully isolated genomic DNA from agarose gels using DEAE membranes but these are only effective in binding DNA to only 7 kb in length thus much of the high molecular weight DNA is lost For gel purification using PEG 1 Pour a GGB i e with EDTA gel The size of the gel really the comb teeth depends upon the amount of DNA you want to purify Add ca 4 ul of ethidium bromide for every 250 ml of gel 2 For every 100 ml of genomic DNA add 10 yl of Ficoll dye Mix thoroughly by stirring 3 Load the DNA samples into the wells either submarine or if you need to maximize the amount loaded per lane load the well dry For the latter pour the electrode buffer only up to the top edges of the gel run the samples into the gel then cover with buffer for the remainder of the run 4 Visualize the bands with long wave UV light If sufficient migration has taken place turn off the power suppl
42. various pathways one can follow to achieve a DNA sequence Bear in mind that these pathways generally apply to phylogenetic studies of wild not cultivated plants that are far from model organisms such as Arabidopsis or maize Typically the amount of DNA obtained from such plants and its quality is more variable thus forcing the researcher to optimize conditions for each sample 12 Protocol Flow Chart cR 2X CTAB miniprep Standard PCR Promega 10X buffer MgCl2 nucleotides Taq polymerase Column Omega Bio Tek EZNA Plant DNA Mini Kit Q Spin columns PCR beads Amersham Bioscience purRe Taq Ready To Go PCR beads Long PCR Qiagen Taq PCR Core Kit w nucleotides Q solution includes MgClo 4 Column Purification K Gean noie bana 3 Check Gel _ _ oF 196 TAE agarose gel EZNA Cycle Pure Kit Q or V Spin columns if not clean or Qiagen QlAquick PCR Purification Kit multiple bands load entire sample ca 20 pl run 196 TAE agarose gel w EthBr excise amp weigh band 5 Column Purification Qiagen QlAquick Gel Extraction Kit Sigma GenElute Minus EtBr Spin Column The Qiagen columns for these two kits are the same and can be interchanged AND even the EZNA Q spin column 10 Cycle Sequencing 2 11 Reaction Purification 6 Reamplification 7 TA cloning Sephadex spin column purification CENTRI SEP 100 purified DNA 11 quantify DNA 4 pl
43. volumes of 100 ethanol and precipitate at 20 for at least 1 hour 58 overnight OK Centrifuge for 15 minutes in a cold microfuge Carefully discard the ethanol Add ca 1 ml of 7096 ethanol Invert several times and centrifuge again for 15 minutes Discard ethanol and dry pellet in a SpeedVac 10 Resuspend pellet in distilled water or TE about 30 u1 for every 100 ul of dsDNA loaded on the gel If the DNA proves to be unsuitable for sequencing try another ethanol precipitation Resuspend the pellet in 100 TE Add 10 13 M NaOAc and 220 yl 100 ethanol Precipitate at 20 for 30 min or more Centrifuge rinse in 70 ethanol centrifuge dry Obtain DEAE Membrane from Schleicher amp Schull Keene NH 03431 800 245 4024 Grade NA45 3 X 51 cm 0 45 micron S amp S order 23400 The membrane is cut to appropriate size e g 7 5 X 11 mm using a clean razor blade 59 Direct Precipitation of PCR Product using PEG When only a single band is obtained following PCR amplification the product can be quickly cleaned using this method We have gotten excellent sequencing ladders using this approach probably because it gives a higher yield than other methods 1 For 100 ul of PCR product ds DNA extract in equal volume of phenol Tris saturated pH 8 0 Vortex briefly 2 3 6 7 Centrifuge for 10 min at maximum velocity Remove aqueous to new tube Extract again with equal volume
44. 00 micropipets work well and place it in a clean 50 ml polyallomer tube Be very careful not to remove any chloroform or interface 19 8 Add 2 3 volume ice cold isopropanol and place in a 20 freezer for at least one hour overnight OK 9 Centrifuge for 20 minutes at 10 000 rpm 10 Gently pour off supernatant leaving the pellet on the bottom of the tube Invert the tube on a Kimwipe to drain off excess isopropanol If the pellet begins to slide down the tube place upright Allow the pellet to air dry until only slightly moist at least one hour 11 Add 3 0 ml of TE and 2 0 ml of 4 0 M NH40Ac Using a 1 0 ml pipet tip that has the tip cut off suspend the pellet in buffer It is wise not to pipet up and down too vigorously for this shears the DNA This following phenol chloroform step is optional but helps remove any remaining protein If omitted simply go to the ethanol precipitation in step 13 12 Add 3 0 ml of phenol Tris saturated pH 8 0 bottom phase and 3 0 ml of chloroform Shake for one minute and centrifuge at 8 500 rpm for 15 minutes Remove the aqueous top phase to a glass Corex centrifuge tube Re extract with an equal volume of chloroform Centrifuge at 8 500 rpm for 10 minutes Remove the aqueous phase to a new glass Corex centrifuge tube 13 Add 2 0 volumes of 100 ethanol Store at 20 C for at least 1 hour 14 Centrifuge at 10 000 rpm for 20 minutes Pour off the ethanol rinse briefly with
45. 000 001 X 10 ul ug Nano n 0 000 000 001 X 10 nm ng Pico p 0 000 000 000 001 X 1072 pg Calculations to prepare dilutions from a stock solution There is a simple formula to help you calculate amounts when preparing dilutions It is where C is the initial concentration or stock solution C is the final concentration V is the initial volume and V is the final volume Initial volume is the amount from the stock that must be added to achieve that final concentration The above equation can be rearranged to give you initial volume V Flow Chart of Protocols Plant Tissue to DNA Sequence This manual provides protocols for many of the methods commonly used in my lab These are presented sequentially but in reality there are often alternate directions one can proceed based upon the outcome of earlier steps For example we frequently produce sufficient PCR product to undergo direct cycle sequencing using that PCR product as a template But when the PCR product concentration is low we may clone it into a plasmid grow these in coli cells extract and purify the plasmids and then use these as templates for cycle sequencing Part of becoming a competent molecular biologist is knowing what protocols are available to use given varying conditions The overall rationale is to use the most efficient means with respect to both time and money to obtain the DNA sequence The following chart was prepared to show the
46. 1 0 mM NaCl pH 7 5 to get 10 mg ml Heat to 100 C for 10 minutes Slow cool to room temp Dispense into aliquots Store at 20 for short term 75 for longer term For RNAase digestion add 10y1 ml of sample in TE 100 Sarcosyl Stock 20 w v for RNA extractions You may need to heat to get into solution pH to 7 0 7 2 with 1 0 M Sarcosyl Rinse Solution for RNA extractions To one liter of dH20 add 5 0 ml of 20 Sarcosyl and 1 0 ml of 0 2 M EDTA 0 1 Sarcosyl 0 2 mM EDTA Use this solution to rinse the Polytron generator and mortar and pestle early stages of extraction SOC Medium 2 096 tryptone 2 5 mM KCI 0 5 yeast extract 10 mM MgCl 10 mM NaCI 20 mM glucose For 250 ml 5 g bacto tryptone 1 25 g yeast extract 0 125 g NaCI 2 5 ml 250 mM KCI Dissolve in 200 ml of deionized water Adjust pH to 7 0 with 5N NaOH Autoclave solution Let cool to 55 C Add 2 5 ml of 1 M MgCl autoclaved solution Add 2 5 ml of 2 M glucose with sterile water Aliquot and store at 4 C Sodium Acetate 3M MW 82 03 g mole 123 g NaAc Bring up to 500 ml with dH20 pH to 5 2 with glacial acetic acid Sodium Borate 0 2 M 200 mM MW 381 37 g mole for RNA extraction 38 13 g of Na2B407 10 H20 Bring up to 500 ml with dH20 pH should be at or near 9 0 Sodium Borate 0 02 M 20 mM MW 381 37 g mole for RNA extraction Dilute 2 0 M sodium borate 1 9 or 3 813 g of Na2B407 10 H20 Bri
47. 2X CTAB to each Place these in heat block two at a time until the buffer is hot 1 For fresh tissue weight out 0 1 g For dry samples herbarium material silica gel dried tissue use 30 40 mg 0 03 g 2 Grind tissue to a powder For fresh tissue liquid nitrogen is quite useful For dry material direct grinding in the mortar is often effective If additional abrasion is needed for tough samples add a small spatula tip of silica gel 3 Add 1 3 ml of hot 94 2X CTAB Continue grinding with pestle 4 Using a 1 0 ml tip with the end cut off pipet sample back into its 2 0 ml microfuge tube Do not exceed 1 1 ml 5 Add 60 ul Protease K 50 units ml i e 3 units and 60 ul DTT Cap and invert to mix 6 Incubate sample for 60 minutes in the 37 C waterbath We have also had success speeding up the process by doing 30 minutes at 45 C It helps to mix the samples every 15 minutes or so 7 Remove tubes from bath place in rack and open all caps Add 2 3 volume 0 79 ml of chloroform isoamyl alcohol 24 1 This will essentially fill the tube Cap tubes tighly and place another rack on top Invert to mix for 5 minutes 8 Place tubes in refrigerated 4 C centrifuge dairy case marked for Genomic DNA Only Centrifuge for 15 minutes While this is happening label 1 7 ml tubes 1 12 9 Gently retrieve the tubes from the centrifuge and place in rack being careful not to disturb the separate phases Set a P 1000 pipet
48. 5 minutes 4 Decant the water on the top of the Sephadex pour slowly so as not to disturb the Sephadex while decanting 5 Add 50 ml of distilled water 6 Stir for 20 minutes 7 Allow to stand 15 minutes and then decant water 8 Add fresh water until is 7596 Sephadex and 25 water This Sephadex can be used directly For storage a week or more the Sephadex must be autoclaved 9 Cover flask with foil Autoclave on liquid setting for 15 20 minutes 10 Store at 4 C B Purification 1 Using a cut off 1 0 ml tip add 800 u1 of Sephadex move pipet through suspension while pipeting to each column 2 Centrifuge 5 minutes at 3400 rpm note position of the column 3 Remove water 4 Centrifuge 5 minutes at 3400 rpm and remove water 5 Place column into a clean 1 7 ml tube 6 Transfer the sequence reaction directly onto the center of the gel without disturbing the gel surface Do not touch the sides of the column 7 Centrifuge 15 minutes at 3400 rpm keep proper orientation of column 8 Dry sample in SpeedVac for 15 minutes at medium heat 74 Purifying Cycle Sequencing Products via Ethanol Precipitation Solutions 3 M sodium acetate NaOAc pH 5 2 95 ethanol 70 EtOH Method 1 For each sequencing reaction prepare a 1 5 ml microfuge tube containing 2 0 ul of 3M NaOAc 50 ul of 95 EtOH 2 Pipette the entire content of the extension reaction into the above tube containing the NAaOAc EtOH mixt
49. 7096 ethanol and dry the DNA pellet by inverting on a Kimwipe Allow the DNA to dry completely at room temperature overnight Alternately the pellet can be dried in a vacuum oven with gentle heat 15 Resuspend the DNA pellet in TE ca 1 0 ml if the pellet is large 0 5 ml if smaller etc Use a cut off tip to pipet the DNA into a labeled 1 5 ml microfuge tube 16 If desired the RNA can be removed from the DNA sample by means of an RNase digestion We use a combination of two enzymes RNase A at 10 50 ug ml of sample and RNase ca 50 units per ml of sample Incubate the samples for 30 minutes at 37 Conduct a phenol chloroform and then chloroform extraction as in step 12 above Ethanol precipitate the DNA as in steps 13 15 17 The quality length of the DNA should next be examined by running it on a 196 agarose gel The quantity can be estimated from the intensity of the stained band in comparison to known standards 20 Genomic DNA Extraction Mini Prep for High Carbohydrate Plants 1 Weigh out 0 1 g of fresh leaves or 20 30 mg of dry tissue Place in a small 2 5 inch wide mortar 2 Grind tissue to a powder using either liquid nitrogen or silica gel 3 Add 1 3 ml of hot 94 2X CTAB containing 1 596 w vol Polyvinylpyrrolidone PVP 40 Continue grinding with pestle until well mixed 4 Pipet extract into a 2 0 ml microfuge tube Add 60 ul Protease K 50 units ml i e 3 units and 60 ul dithiothrei
50. 890 vtIE 9TTE GT 9 WL 9W 0129 IW 5D vIS N ZZIE 0LTE ST DL 209 WY 5D WL VLL 303 ETSN 8062 T6g2 ST 702 97 515 Liv 21v DO ZIS N 5 92 8592 ST WO voL WV VD 215 JOJ TISN 2002 0622 ST VOD 992 992 OSN ENZ ST 92 SLL N09 WV WL 404 SN OST ST 19v O9 JW 255 LW JJ STAT 807 6217 02 29 W 155 Wi Dv 99 Dv J SSN OWT 500 19 99 VLL 9 2219 215 VLL 9919 59 205 99 WL 99 19 909 SD W v95 Wi 501 501 159 Lv v5 155 NOD N95 22 Wv SLL 204 ESN Er 9T ST 205 99 WS 905 Wo 95v 0 ZN 282 482 ST W9 9L 191 195 551 55 3 9 29 2 WY SDV 902 INN 21 IND 99 403 272 Sr 9 6T V IND 5 11991920 TSN TTE 8T 92 9 199922 VD 011504 215 souenbos sand 62571 651 957 2 SN 6 9 8T HO S N SSIL 8ETT ST 404 SN 906 688 8T 0 SN 9 29 9s19A9H ed gs 615 25 Hs 8506 9 92 28 2 9cvc 007 pJeMJO J 6 1 9 gt gt gt gt gt 015 65 85 75 95 SS 75 65 25 6E8L 6 1 66v 6221 056 69 892 Ieuiosoqig 692 6 1 1e9 onN 5 PSI 49 4a0eds 226 1264 1244 6 02 DY 922 999 5VV VYL 5VL 0061 0228 OZ 20 VLL LIO 10 VOL ADL 91 1521 0222 LZ OVV 22D ADL VIV 91 VIV V25 ZELL 922 61 V 21 291 LIV 229 VLL LIV 81 917 928 02 VV JLL LIV 212 VLD 9 121 81 GL 928 02 DDL LLL LV DX OVV ULL 94 q22e 02 V
51. 9 VLV DDL 112 199 29 OVV 204 9001 0926 02 19 V19 221 V55 DLV LOV 199 10 S89 928 02 29 LVL 191 1VV ADL VVJ 203 GL 928 02 VV ALL 554 991 VYY DLV 10 0228 02 LL 99 991 V5V DLV LOL 20 gdie 104 5 q5 e 1 q4 02 VL JVL LLL 21 22 299 212 OWEN 25 S 9e uenbes 1 40 gdie 900L S89 l Jeoeds qooe 1oq1 ose 14 lt lt 8651 8S4 Jooeds jesd 2 0091 007 0021 0001 008 009 00 002 gt gt gt o 0061 1821 CELL 91 91 19931 122 1sejdoJg0 u5 50 61 28 p129 10g unossiw S661 Je JOOH sjeuiud y 902 Z 21 11 DLL 99 VLD V19 861 90 SZ 1 VOL DOV YLL 1 5 vvv Dv VLD VOL 103 2 gd e SZ L DLL DVL JVL 221 VV LVV DVD LVL ZI S e uenbes uJeunud 2 201 LL9 See 2 SJeuuud lt x lt lt lt lt pJ8eMJ0J 818 Jooedsg 0091 00v 0021 0001 008 009 00 002 SJo8uul d gt gt 86 98 99 gdje sejdoiojyu9 1244 9109 ABA ESL 51 10 VES S8 V 8 02 DV VOL VLD 9 151 VLL 29 10 16 11 166 12 LLL VLV WIL LV 1 VOL 92 10 Olt 80t 16 81 221 1V 11V VOL 92 eqsd 6 SZ 929 19 LV DLV LVL 40 5 lt 0 686 ZL 2 211 VW 1V9 DVL YUI
52. 9 hours run time Ne 80 3 Wait a few seconds then select Run Again this should be run module Seq Run 36E 1200 4 Save your gel file at the prompt 5 Make sure the 30 second countdown is complete viewed under the Status window 6 The status window should display something similar to Electrophoresis Voltage kV 1 70 1 68 Electrophoresis Current mA 26 1 50 0 Electrophoresis Power W 44 150 Gel Temp C 51 51 Laser Power W 40 0 40 0 the numbers correspond to the green and grey boxes respectively 7 Make sure you also have the correct run time 8 Close the status and scan windows and flip the computer in use sign down Turn off the monitor C Clean up 1 N The 2 liter graduated cylinder for the 1X TBE should be rinsed well with dH O and then ddH O as do the combs and spacers Everything else gets washed with Alconox and rinsed well with dH O and then ddH O Make sure all lab benches are wiped clean TBE is very sticky clean up all puddles and drops Make sure the heat block or thermal cycler is turned off If you poured two gels make sure that the second gel gets covered Place a 1X TBE soaked Kimwipes on both ends of the gel you can leave the comb in or not Then wrap both ends in plastic wrap Place in refrigerator Post Run Clean up Turn off power switch to the sequencer Open the door and disconnect the three electrical plug ins from the upper and lower buffe
53. BE buffer The stain box stays inside the foil lined box to exclude light Stain for ca 15 minutes in the dark To visualize EthBr stained DNA one must illuminate with U V light NOTE Whenever you turn the U V light on be sure to wear protective goggles for your eyes U V light will cause bums on exposed skin so work quickly and carefully when the light is on Lower the hinged protective shield on the Fisherbrand U V transilluminator before turning on the U V light Darken the room lights and view the gel The ethidium bromide stained gels are imaged using the Nikon950 digital camera After transferring the image to the Del computer the image is later printed on a thermal printer Capturing Gel Images as Digital Computer Files Place gel on the transilluminator opening with the long axis of the gel oriented left to right lanes on left Position the camera mounted on the black hood over the transilluminator opening Plug in the power cord at the junction on the top of the camera Turn camera on by rotating the switch to the manual position Turn off the flash The camera should be in close up mode such that you see a flower not mountain on the LCD screen The camera should also be set to take Black and White photos which you can select in the menu under Special Exposure Mode Turn on the transilluminator and dial the reostat to maximum Use the zoom button to frame the gel as you wish Technically o
54. Glycerol Solution for storing cells Make 50 glycerol solution autoclave For use add 300 1 of 50 glycerol and 700 jl of bacterial cells Mix well and store at 70 IPTG isopropyl 6 D thiogalactoside Make 1 M stock by dissolving 0 238 g in 1 0 ml of water Filter sterilize using Nalgene 0 2 cellulose acetate disposable filter fitted to a 3 or 5 ml syringe Store frozen in the 20 C freezer Add 250 yl of the stock to 500 ml of LB medium for 0 5 mM final concentration Kanamycin Stock solution of 50 mg ml Filter sterilize using Nalgene 0 2 cellulose acetate disposable filter fitted to a 3 or 5 ml syringe Aliquot and store frozen in the 20 C freezer Add 500 u1 to 500 ml of LB medium for a 1 mM final concentration LB Medium Homemade 1 096 tryptone 0 596 yeast extract 1 096 NaCl For 1 0 liter dissolve 10 g of bacto tryptone 5 g bacto yeast extract and 10 g NaCl in 950 ml deionized water Adjust pH to 7 0 with NaOH and bring volume up to 1 0 liter Autoclave on liquid cycle for 20 minutes and allow to cool then add antibiotic if desired Store at 4 C LB Medium Purchased Use Fisher LB Broth BP1426 500 Results in 2 tryptone LB Agar Plate Preparation Weigh out 6 25g of LB broth medium powder and place in a 500ml Pyrex bottle Add 3 75 g granulated agar final 1 596 Add 250ml of distilled water stir bar and then stir on the hot plate without heat Remove fro
55. H group necessary for continued chain elongation When one of these nucleotide analogs is incorporated chain elongation is terminated The result is that the reaction solution now contains a mixture of DNA strands of all possible lengths All those that terminate in A for example have one type of fluorescent label all those with C another etc When these fragments are run on an acrylamide sequencing gel all the fragments are separated based upon their molecular weight shorter fragments migrate farther During electrophoresis the labeled fragments migrate to the bottom of the gel where a laser excites them and causes them to fluoresce A detector then records whether this fragment carried an A C G or T As the electrophoresis proceeds larger and larger fragments pass one at a time before the laser In the end the linear order of the labeled fragments and their colors is recorded in a computer This DNA sequence is output as a graph electropherogram where peak height corresponds to the intensity of the fluorescent signal and peak order the DNA sequence For sequencing plasmids containing inserts gene specific internal primers can be used or universal primers Universal priming regions were purposely designed so that they flank the multiple cloning site of the plasmid vector The figure of the pGEM T plasmid Section 9 shows the T7 and SP6 transcription sites Primers are available that anneal at these sites 71 Sanger Dideoxy Nucleoti
56. NA with 40 ul of buffer EB at 65 C Let stand for one minute Centrifuge for one minute Discard column the purified DNA is now in your tube 57 DEAE Nylon Membrane Protocol 1 Prepare a 1 acetate TAE or borate TBE agarose gel with eithidium bromide ca 10 pl per 100 ml gel We generally use a large gel rig 21 X 7 X 1 3 cm with a 16 place comb The comb teeth are 13 X 11 X 1 5 mm These lanes hold ca 80 90 ul of sample dye The DEAE wicks are cut to 7 5 X 11 mm Four lanes 400 u1 of PCR product provide sufficient DNA for sequencing the entire 18S rDNA 2 Prepare the DEAE membrane by washing 10 min in 10 mM EDTA pH 7 6 8 0 enough to cover membranes ca 2 ml Next wash for 5 min in 0 5 M NAOH Finally rinse the membrane several times in distilled water Store the membrane in water at 4 C until needed The membranes are best if prepared just prior to use 3 Mix ca yl of Ficoll loading dye with every 10 of sample Load the ds PCR product into the gel lanes being careful not to cross contaminate samples skip lanes between different taxa We have found that more sample can be loaded per lane by loading the gel lanes dry For this pour electrode buffer into each chamber until the buffer reaches ca half way up the edge of the agarose gel Load the samples into the gel lanes and begin electrophoresis When the marker dye has migrated into the gel add additional electrode buffer to cover the gel and continue elect
57. Nase can survive even boiling temperatures hence autoclaving is not entirely successful in removing it To completely eliminate RNase all glassware associated with RNA extractions should be baked at 180 200 C for at least 4 hrs For removing RNase from solutions the enzyme RNAasin can be used at 1000 units ml Blumberg 1987 p 24 mentions the need to include at least 1 mm dithiothreitol for proper enzyme activity Solutions used in RNA extractions should be made up in DEPC treated water 0 01 96 let stand 24 hrs autoclave The one exception is ammonium acetate which should be filter sterilized see Maniatis et al 1982 p 447 Vanadyl ribonucleoside complexes also known as ribonucleoside vanadyl complexes are potent inhibitors of ribonuclease activity Berger 1987 These complexes are useful in inhibiting ribonucleases until proteins can be quantitatively removed The detergent sodium dodecyl sulfate SDS also inhibits nucleases and helps separate the proteins from the nucleic acids esp in ribosomes When using SDS avoid the use of potassium salts or temperatures below 10 C since this may cause precipitation of the detergent Sarkosyl and sodium deoxycholate are sometimes used in the place of SDS Polyvinyl sulfate and heparin are nonspecific inhibitors of ribonucleases Blumberg 1987 Phenol and chloroform are the most common reagents used for removing proteins Other compounds such as guanidinium isothiocyanate and guanidinium
58. ample number e g purification number primer and run notes After the gel run is complete these data are tranferred to another Excel file called Autoruns Compilation The Autoruns Compilation file should reflect what was actually loaded on the sequencing gel This file serves as the database for permanently archiving information on all gel runs The file is extremely useful because it allows one to search and sort for all the information listed above This file is present on my DLN s computer Rafflesia and aliases are located on Curupira and Nuytsia Login with password is required to modify the file 84 Editing Sequence Data We open the sequence files in a program called 4Peaks http www mekentosj com 4peaks The program is very intuitive and allows one to easily perform a number of operations on your sequence such as search reverse complement translate to amino acids adjust peak height and width etc We typically copy and paste the good sequence usually the 5 and 3 ends are not used into our multiple sequence alignment program SeAI version 2 0 Rambaut 2004 and keep this window open at the same time as the 4Peaks window We leave the 4Peaks file intact and make all editing changes to the version in SeAI One step translation Mut specific areas Select the proper frame and your done As an easy reference to that the protein translation is displayed right inc IC of your sequence o
59. ant Biology Molecular biology is less of a discipline of its own than a tool used by biologists in diverse fields such as genetics systematics evolutionary biology ecology physiology cell amp developmental biology agriculture and many others Many techniques first introduced in the realm of microbial genetics such as restriction endonuclease digestion transformation cloning and sequencing are all now used in studies of higher plants This manual has a distinct bias toward those techniques I use in the field of plant molecular systematics and evolution The publications in BioTechniques Nickrent 1994 1997 provided succinct summaries of the methods used in my lab over a decade ago Some of these such as the basic PCR reaction have remained relatively unchanged yet others such as the method of obtaining DNA sequences from these products has changed and will continue to change Manual sequencing where the radioactively labeled DNA fragments were visualized via autoradiography film exposed to the gel was replaced by automated DNA sequencing methods Here no radioactively labeled nucleotides are used Instead fluorescent dyes attached to the nucleotides are incorporated during the cycle sequencing reaction These dyes fluoresce one color for each of the four nucleotides when excited with a laser and this fluorescence is detected by a sensor that produces a graphical representation of the sequence called an electropherogram The electro
60. ar Biology 29 721 733 1995 1 Weigh out 2 to 4 g of plant tissue place in mortar 2 Grind tissue to a powder on liquid nitrogen 3 Add frozen powder to baked glass Corex centrifuge tube 30 ml containing hot 60 C phenol emulsion 5 ml phenol plus 6 ml extraction buffer below Stir at 60 C for 5 minutes or incubate in hot water bath and mix occassionally 4 Add 5 ml of chloroform isoamyl alcohol 24 1 stir for 5 minutes 5 Centrifuge in RNase free tube at 10 000 rpm for 10 min at room temperature Transfer the aqueous phase to a new tube Add 5 ml of chloroform isoamyl mix centrifuge as above 6 Transfer aqueous phase to new tube Adjust to 2 M NH4OAc i e add equal volume of 4 molar NH4OAc 7 Add one volume of isopropanol room temperature incubate at room temp for 15 minutes 8 Centrifuge at 10 000 rpm for 20 minutes Wash pellet twice with 70 ethanol and dry 9 Resuspend pellet in 1 0 ml or less of DEPC treated dH20 Extraction Buffer 100 mM Tris pH 8 0 20 mM EDTA 0 4 SDS 0 5 M NaCl 0 1 B mercaptoethanol 36 NUCLEIC ACID CONCENTRATION FLUOROMETRY Nucleic acids can be quantified using spectrophotometry or fluorometry For the former the amount of nucleic acid in a sample is quantified by measuring the absorbance at 260 nm The fluorometer measures the fluorescence of a dye Hoechst H 33258 in the presence of DNA This method is preferred over spectrophotometry because it does not require
61. art This typically occurs at Cycles 94 C Oligonucleotide primer annealing is 100 1 2 3 35 B lt denaturation optimal at lower temperatures typically 37 90 55 C depending upon the primer length and 80 A T G C content For a symmetrical PCR thei vo 70 extension amplification two primers a forward and reverse must be present that bracket the o 60 EN m gene of interest see figure below Chain amp 50 extension via Taq polymerase occurs from amp 40 ipee ali the 5 ends of each of the two primers and P 5 30 10 G C X4 C 40 this step has an optimum temperature of 72 5 C This new chain is complementary to the sequence of the template DNA The time 10 hold required for denaturation and primer 05 E 40 annealing is generally from 30 seconds to Time hours one minute each whereas chain extension requires 1 3 minutes Once one cycle is complete the amount of target DNA in the sample is doubled With increasing numbers of cycles the DNA that is produced can also serve as a template hence the concentration of target DNA increases logarithmically and then tapers off limited by the amount of primer and nucleotide in the original solution For asymmetrical amplifications as occur during cycle sequencing only one primer is used Therefore the number of templates available for the primer to anneal to is less and is determined by the initial concentration of template The increa
62. at Dr Sipes is first in line and we must adjust our usage accordingly Communicate with other workers using the machine to work out the best times for a run Typically one package of acrylamide is sufficient to pour two gels thus you may wish to coordinate with others if you cannot use both These two gels are run back to back because the poured gel cannot be stored for more than one day Before the Gel Run 1 10 or 5X TBE Buffer Always use fresh TBE buffer This buffer only lasts up to about 2 weeks before borate precipitates out of solution Even if the buffer is heated to dissolve the borate it will not work 2 Formamide Aliquots WARNING Formamide is a tetrogen and is harmful by inhalation skin contact and ingestion The deionized formamide is stored in the lab freezer Thaw the bottle on ice or in refrigerator To reduce the exposure of formamide to oxygen make several aliquots of 150 jl this will be plenty for resuspending 96 samples using a filter tip Store aliquots in the 20 C freezer on the top shelf 3 Coolant Check the water reservoir level located on right side of ABI 377 sequencer Refill the reservoir when it is between 1 3 and 1 2 full See user s manual page 8 5 Refilling the Water Reservoir Cleaning and Assembling the Plates and Pouring the Gel A Cleaning the Glass Plates Glass plates are most conveniently cleaned in the SteamScrubber dishwasher Use the science cycle with bo
63. bit of TE 20 u1 and spinning again We still get amplification from this To take it further we are now trying to reuse the spin tubes by freezing them in the ultralow 70 C and then thawing re centrifuging etc 28 Acacia DNA Extraction Miniprep Method Modified from Byrne et al 1993 Journal of Heredity 84 218 220 Grind in a mortar 25 50 mg leaves in liquid nitrogen until a fine powder Add 175 250 yl cold extraction buffer Continue grinding to fully suspend powder in buffer Centrifuge for 5 minutes in a 4 C microfuge at 2000g Resuspend pellet in 20 1 cold wash buffer Add 5 ul 5M NaCl Add 8 u1 8 6 CTAB 0 7M NaCl Mix gently Add 10 ul 5 sarcosyl Mix gently Leave at room temperature for 15 minutes then incubate at 60 C for 15 minutes Add 40 ul chloroform isoamyl alcohol 24 1 mix well and shake gently for 10 minutes Centrifuge at max 12 000 g for 10 15 minutes Transfer aqueous phase to a clean tube Add 2 3 volume isopropanol mix gently by inverting tube Centrifuge at max for 15 minutes pour off isopropanol Add 1 ml 50 isopropanol 0 3 ammonium acetate Do not mix but allow pellet to soak in this solution for 30 minutes Gently pour off the solution and dry the DNA pellet in a SpeedVac Hydrate the DNA in 50 100 1 of TE For samples that give problems with polysaccharides add the following instead of what is given in steps 6 7 and 8 6 Add 27 u1 5M Na
64. bu pp2l1 8221 ZT 92 9 309 51V OL 9 65 47 914 Wibu 6 27 6T 1 IVD 299 VOD CT9 dZ 086 0 216 556 6T 2 929 21V 1V 992 192 15V C2v dZ ST4 y DW 401 68 61 2 92V OW 211 19 8 47 268 228 72 OVL OVV 1V9 122 VOL 212 LOL 9 dZ vI4 Waou 201 68 6T D VOV DLL 19V COS dZ 028 998 058 ZT DM WLY LOL 25V 222920 C2v dZ 4 62 07 02 19 VLD VOV Nl ODA 9 42 Y YIDW pI9 S6S 02 91 99V 2 9 JVJ CTt dZ 2T3 M3Du 62 01 02 19 VLD VOV ALD ODA CTS dZ 5 9 79v 6l1v 6T V 992 ADL JLL JAL ODL LIV 42 T4 M3Du 2 6T L DLL OWL OVD WNL 5154 1404 uo uoijisod 215 5 Du nb uaeulud 5154 1404 uo 131504 215 6 e2uenbas uawWiud 5 5 eld r7 54 4 0213 aL 23 00544 G 000 1 d lt lt _ lt lt lt lt 0002 0081 0091 00 0021 0001 008 009 00 002 4 gt gt gt gt gt gt gt gt sty 8991 Q zi dd 0 8 d y eu vH 55 SECTION 8 PURIFICATION OF PCR PRODUCTS FOR USE IN SEQUENCING REACTIONS There are many kits available to purify DNA products in sizes ranging from 100bp to 10kb The procedures typically use ion exchange columns to remove primers nucleotides polymerases and salts These protocols are very easy
65. cassette and top buffer chamber in place Denature your samples for 2 minutes at 90 C and then place immediately on ice Using either a single channel or an 8 channel pipettor pipette approximately 1 ul of each sample into a well of the loading tray Note that if you are using an 8 channel pipettor to transfer one column of a 96 well plate at a time samples will end up in every third well of the loading tray MAKE SURE THAT THE SAMPLE SHEET REFLECTS THIS According to the manufacturer of the membrane combs it is important that steps 8 through 12 below are done as quickly as possible Ideally the Ficoll solution should remain on top of the gel for as little time as possible Likewise try to minimize the amount of time that your samples are bound to the membrane comb QN N 82 8 Using a 1 ml pipettor inject approximately 700 1000 yl of Ficoll loading buffer 20 Ficoll between the plates at the top of the gel 9 Dip the tips of the membrane comb into the loading tray Allow your samples to wick into the comb for 15 seconds 10 Carefully insert the membrane comb with your samples between the plates at the top of the gel You will easily be able to feel when the comb teeth make contact with the gel itself 11 Fill both buffer chambers with 1X TBE buffer 12 Immediately start the sequencing run When prompted save the file listed to the default location Allow your samples to run into the gel for 60 seconds after ele
66. chloride are also used These chaotropic agents disrupt protein secondary structure including RNases see MacDonald et al 1987 and Cox 1968 cited in Maniatis et al 1982 High lithium chloride LiCl salt concentrations e g 2 M or greater will precipitate larger RNA e g rRNA The small RNA tRNA and 5S rRNA and DNA remain in the supernatant Wallace 1981 recommends adding one volume of 8 M LiCl 4M LiCl in the sample The hot borate method of Hamby et al 1988 uses 1 4 volume of 10 M LiCl 2 5 M More recently the Tri Reagent TM Molecular Research Center 5645 Montgomery Rd Cincinnati OH 45212 has proven useful in rapidly isolating RNA from a variety of organisms including plants The tissue is homogenized in Tri Reagent guanidine thiocyanate and phenol in a mono phase solution centrifuged to separate the phases and the RNA is then precipitated using isopropanol 31 RNA Extraction Using Hot Borate Buffer This method was borrowed and slightly modified from Dr Elizabeth Zimmer who modified the protocol described by Hall et al 1978 Zimmer freezes the plant tissue on liquid nitrogen and then stores at 80 in airtight plastic bags until ready for extraction I found that for some plants the freezing adversely affected RNA yield If at all possible I suggest doing the extraction starting with fresh material The best results are obtained with embryonic or meristematic tissues You will need to get the following
67. coli cells are transformed with the vector Supplied with the Promega pGEM T are JM109 chemically competent cells Transformation is accomplished using a heat shock method not by electroporation as works for other cell strains Following transformation the JM109 cells are grown in SOC medium plated onto LB Luria Bertani agar plates that contain the antibiotic ampicillin IPTG as well as X Gal 5 bromo 4 chloro 3indolyl 8 D galactoside coli cells containing the pGEM T plasmids are resistant to ampicillin hence only those transformed cells can grow on the plates containing this antibiotic The plasmid also has a multiple cloning site intercalated between the ac promoter and the acZa fragment which codes for the first 146 amino acids of the B galactosidase enzyme 61 X Gal is the substrate for 8 galactosidase and its breakdown product results in a blue color Since active B galactosidase is only produced when the ac promoter is on and the lacZa fragment is complemented in trans with the Q fragment of B galactosidase disruption of the promoter by an insert at the multiple cloning site results in no breakdown of X Gal Thus cells that contain a transformed plasmid will appear as white colonies on the plate and cells that were not transformed appear as blue colonies hence the name blue white screening Several white colonies are picked and grown to sufficient density to harvest the plasmid DNA This DNA can then be used for additio
68. ctrophoresis power is applied 13 Pause the run open the instrument door there should be no electrophoresis current at this point and remove the membrane comb from the gel Use a syringe full of 1X TBE to gently flush the Ficoll solution from between the two glass plates 14 Close the instrument door and resume the sequencing run 83 Exporting Data to Other Computers Your gel run file can now be ported to another computer to allow editing without using the Sipes sequencing computer The latter is considered dedicated to the ABI sequencer and is to be used only for data collection and post run operations e g lane tracking The Nickrent lab numbers gel runs sequentially with file names such as 100DN 101DN etc The file folder will contain one file for each sequence lane and each will be numbered such as 23 100DN 1for The folder will also contain a gel file a run file and a log file We typically use AppleTalk via COS PlantNet to connect to the Macintosh computers servers in the Nickrent student lab Curupira If you have problems connecting to Curupira you can place the folder in LabAccess also via AppleTalk See Dr Nickrent or a graduate student regarding how to use file sharing When planning a sequencing run we fill in a blank form composed in MS Excel called Sequencing Run Data Sheet This form has the following information reaction date operator name s gel run number gel run date taxon and collection number s
69. de Sequencing Unknown Sequence 5 TAAAGTATCAGTCT AAAGTATCAGTCT AAGTATCAGTCT AGTATCAGTCT GTATCAGTCT TATCAGTCT ATCAGTCT TCAGTCT CAGTCT AGTCT GTCT TCT CT T Known Primer Sequence ATTTCATAGTCAGA GGTGAAATTCTTGGGA 3 Cycle sequencing with Deoxynucleotides dNTPs Dideoxynucleotides ddNTPs fluorescently labeled Taq DNA polymerase CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT CCACTTTAAGAACCCT DNA Template Primer Pool of fragments each terminated by a labeled nucleotide Smallest fragments pass the laser first Polyacrylamide Gel Electrophoresis Laser excitation of labeled ddNTPs Detector sends signal to computer TCTGACTATGAAAT Sequence Electropherogram ATTTCATAGTCAGA Reverse complement of sequence 72 Cycle Sequencing This protocol has been optimized for all Applied Biosystems thermal cyclers In addition to your primers 10 and samples you will need e ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq DNA Polymerase Applied Biosystem Perkin Elmer GeneAmp PCR System 9700 0 2 ml PCR reaction tubes no mineral oil is required Applied Biosystems MicroAmp reaction tube with cap N801 0540 Method All tubes to be kept on ice throughout these
70. e paper comb you must dry the well of water using a Kimwipe Hold plates cassette upright on lab bench Center comb in the loading region with teeth facing down Slowly and EVENLY insert the comb until it is about 1 2 mm into the gel Plate Check Place the bottom reservoir in the sequencer and plug in the electrode Carefully insert the plates cassette into the woodstove and close the four clamps one hand should always be on the plate cassette IMPORTANT Make sure that the amber colored thingies on the sequencer are pressing firmly against the back plate visible below the hips Sipes machine is weird and sometimes you have to fiddle with jiggle the gel cassette to get it in properly Close door making sure that no wires get pinched in the door The Plate Check Module should be selected to Plate Check E Click the Plate Check icon Then under Window select Status Make sure there is a 30 second countdown If the computer does not do this click on the Cancel icon wait a few seconds then select Plate Check again There is a software bug and sometimes it does not countdown correctly Under the status window there should be NO ELECTROPHORESIS POWER If there is cancel immediately After a few minutes you should observe red black green and blue lines in the Scan Window If you have any large peaks baseline should be smooth Cancel the Plate Check remove and wash plates again Othe
71. e the percentages of agarose to use e g 0 8 for examining chloroplast DNA digests 0 9 for conducting Southern blots 1 0 for examining ribosomal DNA 2 Add glycerol loading dye to tubes ca 4 ul sample 10 ul of dye Load into gel lanes Load molecular weight marker Begin electrophoresis Run times vary depending upon the thickness 87 and size of the gel the buffer used and the current applied to the gel from 1 hour to overnight 3 After electrophoresis stain gel with EtBr and de stain with water The gel should then be marked notch on left side and photographed with fluorescent rulers on each side Southern Blotting Wet Transfer Method 1 Cut off the unused portions of the gel to minimize use of expensive membrane and measure the gel dimensions Photograph the gel with fluorescent rulers on each side Note Sometimes the DNA is depurinated with an acid wash in 0 25 M HCI for 8 minutes at this time This step does not seem to be necessary unless blotting very large gt 15 kb DNA fragments If the gel is left in the too long it may cleaved into tiny fragments that cannot stick to the membrane For these reasons we normally do not do this step 2 Denature gel in 1 5 M NaCl and 0 5 M NaOH for 15 min 3 Neutralize gel in 0 5 M Tris Cl pH 7 0 M NaCl for 10 minutes Pour off solution and repeat 4 Using a paper cutter cut 10 pieces of Whatmann 3 MM filter paper slightly small
72. e to go into solution use heat The buffer is usually ca pH 8 0 without adjustment Do not autoclave CTAB buffer Dithiothreitol DTT 0 5 M FW 154 25 g mole for DNA and RNA extractions 10 ml 25 ml 50 ml 100 ml DTT 07716 1928g 33566 77126 Store solutions as frozen 1 0 ml aliquots in microfuge tubes EDTA 0 5 M pH 8 0 Different amounts depending upon how many water molecules on the EDTA 50 ml 100ml 500ml EDTA Na anhydrous FW 3362 84g 16 8 g 84 05 g EDTA Na H20 FW 354 2 8 85 g 1776 88 55g EDTA Na 2 H20 FW 372 24 93g 18 6 g 93 05g 96 For 500 ml start w ca 430 ml of water add 8 g of NaOH pellets and let go into solution takes time Correct pH to ca 8 0 with 6 0 N NaOH solution plastic bottle The EDTA will go into solution well only when the pH is near 8 0 Autoclave Ethidium Bromide for visualizing DNA and RNA 10 mg ml Light Sensitive Store in dark bottle in refrigerator See Section 14 for disposal Ficoll Loading Dye for high sample low dye ratio agarose gels 25 Ficoll Type 400 Sigma 4375 or Pharmacia 17 0400 01 40 mM Tris pH 8 0 20 mM EDTA 0 0596 Bromophenol Blue For use with single stranded DNA use 2 SDS 20 ml 100 ml Ficoll 50g 250g 1 0 M Tris 800 yl 4 0 ml 0 2 M EDTA 2 0 ml 10 0 ml Bromophenol blue 10 0 mg 50 0 mg dH50 17 0 ml 85 0 ml Glycerol Loading Dye 6X 0 2696 bromophenol blue 3096 glycerol in H20 Store at 4 C
73. e tube is then incubated for ca 1 hour at 37 C Alternately one can add RNase directly to the TE and proceed directly to the ammonium acetate step next 14 Add 200 ul of 4M NH OAc ammonium acetate Mix thoroughly Your total volume is now 500 yl 15 Add 2 volumes 1 0 ml of cold 100 ethanol freezer mix well and store tubes at 20 for at least 1 hour Longer periods days are OK If one wants to proceed quickly the precipitation can be done at 70 for 20 minutes 16 Centrifuge tubes for 15 minutes pour off the ethanol into sink drain on towels and dry the pellet in the SpeedVac all as above with the propanol step 17 Resuspend the DNA pellet in 50 100 u1 of TE optionally w RNase A Label using the ToughTags and a permanent pen taxon name collection number Gen DNA and date 18 Plant Genomic DNA Extraction using CTAB Large Scale Before getting started turn on the centrifuge to precool the chamber The rotor is generally stored precooled glass and plasticware is assumed to be clean and sterile autoclaved You will need the following Equipment e centrifuge e g Sorval RC 5B with 5534 Reagents rotor 2X CTAB buffer centrifuge tubes glass e g Corex 30 ml Protease K stored in 50 units 1 ml aliquots in centrifuge tubes plastic e g Nalgene 50 ml the freezer polyallomer Dithiothreitol DTT 0 5 M Stored as 0 5 ml cheesecloth cut into 6 X 6 squares aliquots i
74. e used a typical UV transilluminator Spectroline to illuminate gels and captured the image on film using a gel doc system Polaroid using 667 film We now have a computer connected to a digital camera Nikon Coolpix 950 that is mounted on an enclosed UV transilluminator Once the gel image is captured and transferred to the computer Del Dimension XPS Pro200n we open the file using NIH Image software The image is then printed on a Mitsubishi thermal printer Rm 1050 common use Ice machine dishwashers dish drier autoclave Rm 1052 collections microscopy This room contains an herbarium case with my collection of dried plant parasites a metal storage case with my fixed parasitic plant specimens and a metal storage case with my 35mm slide collection Equipment includes Dissecting microscope Stereozoom Olympus SZH ZB10 light box Picker for viewing sorting slides and a slide viewer Caramate Singer Rm 1054 walk in cold room Shared with Microbiology Storage for chemicals etc Water bath can be set at 17 C useful for ligation reactions Rm 1055 store room Storage racks and a cabinet for lab supplies tips tubes etc Ultralow 80 C freezer Revco This contains a back up genomic DNA collection and frozen samples fresh frozen silica dried of various plants arranged in boxes by family Rm 1057 backup server This room formerly had various BioRad equipment items run by two Gateway compu
75. eissbach and H Weissbach eds Methods in Enzymology Vol 118 Acad Press Orlando Florida Palumbe S R 1996 Nucleic Acids II The polymerase chain reaction Pp 205 248 in D M Hillis C Moritz and B K Mable eds Molecular Systematics Sinauer Associates Sunderland MA Pikaart M J and B Villeponteau 1993 Suppression of PCR amplification by high levels of RNA BioTechniques 14 24 25 Pisa Williamson D and C W Fuller 1992 Glycerol tolerant DNA sequencing gels U S Biochemical Comments 19 29 36 Pyle M M and R P Adams 1989 Jn situ preservation of DNA in plant specimens Taxon 38 576 581 Rambaut A 2004 Se Al Sequence Alignment Editor version 2 0 11 Department of Zoology University of Oxford Oxford UK Reichardt J K V and S L C Woo 1990 Direct double stranded sequencing of PCR products U S Biochemical Comments 17 21 22 Rogers S O and A J Bendich 1985 Extraction of DNA from milligram amounts of fresh herbarium and mummified plant tissues Plant Mol Biol 5 69 76 Rogstad S H 1992 Saturated NaCI CTAB solution as a means of field preservation of leaves for DNA analysis Taxon 41 701 708 Rowland L J and B Nguyen 1993 Use of polyethylene glycol for purification of DNA from leaf tissue of woody plants BioTechniques 14 735 736 107 Saha B K 1989 Amplification of DNA by PCR for direct sequencing U S Biochemical Comments 16 17 18 Saiki R K D H Gelfand
76. ell 11 Add 1 2 ul of the formamide dye mix to each of your sequencing reactions Mix by stirring with the pipette tip and or gently vortex or flick mix 12 Centrifuge the samples briefly to move all liquids to the bottoms of their tubes Gel Loading and Running Skip this step if using a membrane comb see alternate procedure below A Gel Loading 1 Denature the sequencing reactions when the gel temperature reaches approximately 35 to 40 Denature at 90 in the heat block for 2 min then place the samples on ice Get ice from Andrew Wood s Lab Push the Pause icon and wait for the message saying it is OK to open the instrument panel Rinse the loading wells with 1X TBE using the syringe and needle or with a 1 0 ml pipetter 4 Using a Hamilton gel loading syringe load the gel by loading every other lane Load the odd lanes rinsing the needle twice or thrice with water between loading each lane Load plain formamide dye mix to the flanking lanes Close the door and select Continue Allow electrophoresis to continue for 4 to 5 minutes 6 Select Pause wait for the OK then repeat loading procedure with the even lanes Once lanes are loaded select continue and allow electrophoresis for another 2 minutes OWN B Gel Running Stop the Prerun by selecting Terminate If you haven t chosen your sample sheet on the run window do so now Put your name in the user window and choose
77. ened until the rotor has essentially stopped spinning The door light will then illuminate and the door will open after the button is pushed Ultracentrifuge Beckman This is probably the most sensitive and expensive piece of equipment in the lab This is not meant to discourage its use but all users should read the manual and be checked out by DLN prior to operating this piece of equipment The most important factor to consider is that all tubes placed in the rotor are balanced exactly against the one opposite Thermal Cyclers At present usage is not so great as to require a sign up sheet If this changes we will implement such a policy In the meanwhile simply communicate with other lab users Although we have three thermocyclers it appears the Applied Biosystems machine is more popular than the others mainly owing to the hot lid and small tube volume The Perkin Elmer thermocycler block should be preheated to 94 C prior to inserting the tubes This simulates a hot start and reduces the amount of nonspecific amplification Check the listing of files for commonly used cycling parameters For all thermal cyclers if you see that the temperature is at 4 on a soak cycle feel free to turn it off and put the tubes in a labeled rack in the dairy case even if they are not yours e Water Baths The water bath in room 10464 is generally left off until it is needed The two most common uses are for genomic DNA extractions and rest
78. er accuSpin room temp Micropipets Rainin and Oxford Microwave oven pH meter Fisher Acumet AB15 Picofuge Power supplies constant voltage EC250 90 Power supplies not constant voltage Fisher FB 105 Refrigerator three door dairy case style United Speed Vac Savant Thermocycler Applied Biosystems GeneAmp PCR System 9700 Thermocycler Perkin Elmer Thermocycler RoboCycler Gradient 40 Stratagene Ultracentrifuge bench top Beckman Vacuum pump Savant PLB Vacuum manifold Promega Water bath shaking Belco Hot Shaker Water purification system Barnstead Nanopure Rm 1046A genomic DNA extraction and PCR Centrifuge high speed refrigerated floor model DuPont RC 5B Freezer upright 16 cu ft 20 C Frigidaire Heat block Equatherm Hotplate stirring Corning PC 320 Micropipets Rainin and Oxford Picofuge Qualitron Rotors for RC 5B 8 12 place and swinging bucket Water bath 10 liter Fisher Rm 1048 This room is shared with Dr David Clark in Microbiology We previously used this room when doing manual DNA sequencing that required the use of radioisotopes Since we have converted to automated sequencing we have not used the room for this purpose On the south table I have a photo copystand I also have a high temperature oven Precision Gravity 18EG The freezer is used by Dr Clark for storing isotopes such as S Rm 1047 darkroom shared with Microbiology In the past w
79. er than the gel and soak in 2X SSC 5 Wearing gloves and using clean scissors dedicated for this purpose cut the nylon membrane exactly the same size as the gel Mark the filter top right with a pen to identify your samples It will be assumed that the side without writing is the side in contact with the gel Soak the membrane in distilled water for 2 3 min 6 Place a large 10 cm diameter or larger cover of a Petri dish on a support e g top of a plastic buchner funnel This platform is then placed in an 8 inch Pyrex baking dish Wrap the Petri dish cover with a large piece of 3 MM filter paper and place back in the baking dish This filter paper will act to wick the buffer upward through the gel the membrane stack of filter paper and finally the paper towels Fill container almost to Petri dish with transfer buffer 10X SSC Make sure there are no air bubbles between the glass and the wet paper 7 Place the gel well side down on filter paper saturated with 10X SSC buffer Make sure there are no air bubbles between the gel and the paper 8 Carefully place the nylon filter on the gel lining up the upper edge of the filter exactly with the bottom edge of the wells Again check for air bubbles 9 Place the 2X SSC saturated 3 MM paper sheets on the filter one at a time for the first three being careful not to introduce air bubbles between the paper 10 Cut a stack of paper towels to the size of the 3MM filter paper Stack the
80. ere successful Both DNA and RNA will stain with ethidium bromide and will migrate to different positions based on their molecular weight Lower agarose percentages 0 6 0 396 can resolve DNA in sizes ranging from 1 to 60 kb Maniatis et al 1982 Higher percentage agarose e g 2 works in a range of 0 1 3 kb Most of our applications work somewhere in the middle thus we use a 1 Tris acetate EDTA TAE gel Preparing Minigels 1 It is convenient to prepare agarose in buffer ahead of time and store the solution in small Erlenmeyer flasks for later use The agarose is then simply melted in a microwave oven prior to pouring The agarose can be stored at room temperature for several weeks 2 Choose the appropriate size of minigel rig comb combination based upon the number of samples to be run The 30 ml Owl Scientific rigs Model B1A have combs to accommodate either1O or 12 samples Note that one can also double load by placing two combs in a single gel hence 20 sample lanes 3 Turn the gel mold so that the gaskets are against the inner walls of the electrode chamber Position the comb in the mold depth preset Place gel rig in dairy case on flat tray Make sure the surface is level use floating bubble level and adjust with towels under tray if necessary 4 Microwave the flask with agarose checking occasionally to see whether all the agarose has melted If a microwave is not available melt the agarose in a beaker of water on a
81. et of reactions optimum primer annealing temperature 43 Symmetrical Amplifications The following protocol gives a typical recipe for a symmetrical amplification of a gene This reaction mix can be used for a variety of genes by simply substituting the appropriate forward and reverse primers and by using different thermocycler programs 1 Turn on the thermocycler lid begins heating Remove the 10X PCR buffer water primers genomic DNA and dNTPs from the freezer to begin thawing We keep sterile water frozen in aliquots in the freezer to prevent the growth of fungi etc that may take place more readily at room temperature Place the tubes on ice when thawed Keep the dNTPs on ice at all times once thawed Leave the Taq polymerase in the freezer until you are ready to use it and return it to the freezer promptly when finished The Taq may be used undiluted or diluted e g 1 1 to 1 9 with Taq dilution buffer depending upon its activity We use home made Taq polymerase hence we do not know the exact Unit ul concentration We simply determine empirically the activity on a batch by batch basis Communicate with lab members to keep up on what dilution is to be used for the Taq 2 Label on the lip of the lid the proper number of thin walled 0 2 ml microfuge tubes one for each sample being amplified 3 Dilute the genomic DNA samples e g 1 9 w dH 0 Leave the pipet tip in the tube for later use 4 If all of the tubes use the
82. fully remove excess air from syringe don t push with such force that the unpolymerized gel squirts all over the ceiling Insert the syringe tip tightly into the gel injection device at the bottom of the plates Begin pushing the gel into the plates and don t stop Be prepared to knock on the plates if the gel front begins to get uneven Push in the gel until it begins to come out the top edge 9 Reload the syringe and repeat with other gel 10 Quickly check for any air bubbles that may have formed at either end of the plate You may be able to fish these out with the bubble hook 11 Insert the flat end of the comb into the loading region and reclamp the top clamping device 12 Remove the bottom gel injection device Place the laser beam safety bar back down and make sure all 6 cassette clamps are closed keeping the plates pressed together 13 15 min to 1 2 hour after the gel is poured make sure to place 1X TBE moistened Kimwipes along the bottom edge of the gels then plastic wrap Allow 2 hours for gel polymerization W Jobs to do While the Gel is Polymerizing The following jobs can begin 1 hr before polymerization is complete A Computer Stuff 1 If the computer is on shut it down 2 Turn on the ABI 377 DNA sequencer Wait a moment after the red light goes off and then turn on the Macintosh computer The program must now be restarted Under ABI Prism 377 choose File New a
83. g Most PCR reactions however result in at least a few nonspecific bands that can interfere with cloning a specific fragment Ideally one should optimize the PCR reaction but this is not always possible In this case we use gel purification to isolate the fragment of interest It should also be kept in mind that the 3 A overhangs on the PCR products are removed over time and with excessive manipulation such as electrophoresis and precipitation Cloning Reaction 1 Fill out the cloning sheet which is located in the cloning binder with the species being cloned collection number and either the PCR or purification number 2 Label the proper number of 1 7 ml tubes for the PCR products you will be cloning 3 From the Promega kit located in the 20 C freezer remove the pGEM T plasmid and 2X ligase buffer and thaw in your ice bucket 4 Thaw your PCR products or purifications and then place them on ice 5 On the cloning sheet calculate volumes needed given the number of cloning reactions and prepare a master mix coctail with everything except the PCR product of course PCR product 1 5 3 0 pl X 2X ligation buffer 2 5 ul __ pl pGEM T vector 0 5 pl __ pl T4 DNA ligase 0 5 pl pl Final Volume 50 pl 6 Once you have prepared the master mix vortex the tube and distribute 3 5 ul into each labeled sample tube 7 Add 1 5 ul of the PCR product to each tube Incubate at room temperature for one hour or overnight at 4 C for
84. g it deeper may result in the sample solution flowing into the electrode bad news Make sure the purple sleeve at the top of the electrode is turned so that the hole is not open Analytical and top loading balances Be especially aware of spilled chemicals on and around the analytical balance the top loading balance and the stirring hotplate The next person who encounters some white powder may not know if it is dangerous or not so CLEAN UP after yourself Nanopure water system When filling the carboys with deionized water be sure to monitor the process carefully I strongly recommend setting a lab timer and checking at various intervals to ensure the water does not overflow Oven This oven is used to bake glassware to destroy RNases The temperatures required to accomplish this 200 C for several hours are potentially dangerous Never leave this oven at this temperature unattended for long periods of time e g overnight The oven should not be used to dry glassware or plasticware use the drier in room 1050 for this Safety Working in a molecular biology laboratory presents some hazards hence everyone should be aware of the following safety considerations The red and white safety sheet posted on the wall near the Rm 1046 door explains emergency evacuation procedures locations of fire extinguishers and emergency showers etc All users should read this notice Eating and Drinking No eating or drinking in the lab is al
85. h 10 yl of loading dye and load into the well of the agarose gel with a molecular weight size standard When conducting PCR amplifications from an existing PCR product there are MANY considerations to be aware of The major problem is contamination of pipets in Room 1046A The best way to do this is set up the PCR reaction in 1046A and move the tubes to 1046 Then using the pipets from that room with filter tips add the PCR product to your tubes You should always include a negative control as well as a tube that was the negative from the original PCR negative of the negative 45 Genes Commonly Amplified It is important to consider that each gene has a different range of applicability with regard to resolving divergences among taxa figure below For example rbcL may work very well to resolve families in an order or even genera in a family but it is unlikely to provide sufficient numbers of substitutions to examine species within a genus In general we typically attempt to maximize the number of substitutions K between taxa we are trying to resolve but not to the point of site saturation Frequently we combine information from more than one gene But here it is important to make sure the phylogenetic relationships resolved by the individual genes partitions are not in conflict that is that they are congruent If they are congruent then there is good reason to analyze them together in one data matrix For plants it is also helpf
86. h respect to potassium and 5 M with respect to acetate Magnesium Chloride 1 M FW 203 3 g mole 101 7 g of MgCl 6H20 Bring up to 500 ml with dH20 NET Buffer for DEAE gel purification of DNA 20 mM Tris pH 8 0 0 15 M NaCl 0 1 mM EDTA 2 00 ml 1 M Tris pH 8 0 100ml 2M Tris pH 8 0 3 75 ml 4 M NaCI 3 7 5ml 4M NaCl 50 00 yl 0 2 M EDTA 50 00 ul 0 2 M EDTA 94 20 ml dH20 95 20 ml dH20 100 ml total 100 ml total High Salt NET Buffer for DEAE gel purification of DNA 20 mM Tris pH 8 0 1 M NaCl 0 1 mM EDTA 2 00 ml 1 M Tris pH 8 0 100ml 2MTris pH 8 0 25 00 ml 4M NaCl 25 00 ml 4M NaCl 50 00 ul 0 2 M EDTA 50 00 ul 0 2 M EDTA 72 95 ml dH20 73 95 ml dH20 100 ml total 100 ml total 10X PCR Buffer An alternative to the Promega 10X buffer for PCR amplifications 0 5 M KCI 0 1 M Tris I Triton X 100 For 100 ml of 10X buffer 20 ml of 2 5 M KCI 10 ml of 1 M Tris pH 8 8 10 ml of 10 Triton X 100 Fill to 100 ml with autoclaved dH20 99 Phenol Saturation Protocol 1 Melt the phenol crystals at 68 in a waterbath 2 When melted add an equal volume of 1 0 M Tris pH 8 0 and a stirbar Stir the solutions until the phenol dissolves 3 Let the solution sit long enough for the phases to separate Remove the upper phase with a pipet attached to a hose and the lab vacuum 4 Add one volume of 0 1 M Tris pH 8 0 and stir Test pH and if not at 8 0 repeat steps 3 and 4 1 to 3 times may be needed 6 Store solution
87. hanol Rinse with 7096 ethanol Drain briefly on paper Kimwipe and dry pellets either at room temperature in a desiccator or in a Speed Vac 10 Rehydrate samples in ca 20 ul of TE 26 Gel Spin Method of Cleaning Genomic DNA Commercial Spin Columns The GenElute Agarose Spin Column sold by Supelco Supelco Park Bellefonte PA 16823 0048 cat no 5 6500 is useful for fast recovery of DNA from agarose gels These columns allow isolation of genomic DNA and PCR products for use in PCR and ligation reactions 1 Place the spin column in a microfuge tube put ca 100 yl of TE in the spin column and centrifuge briefly 5 secs on high Discard the TE This washes and hydrates the membrane Place the columns in microfuge tube bottoms on ice 2 Runa TAE agarose gel 0 8 1 that contains ethidium bromide with samples of interest genomic DNA PCR products Visualize the bands on a transilluminator lowest setting possible Working quickly with a sterile scalpel blade cut out the band of interest Don t expose the DNA to UV too long Cut the slice as close to the DNA as possible minimizing the amount of agarose in the chunk Place the gel chunk in the washed spin column 3 Centrifuge the spin column at maximum speed ca 12 000 x g at room temperature for approximately 10 minutes 4 The DNA is now in the buffer collected at the bottom of the tube It can be used for PCR cloning etc or can be precipitated using ammonium acetate
88. hanol and store at 20 for at least 1 hour overnight to many weeks OK 21 18 Centrifuge for 15 minutes pour off the liquid and dry the pellet in the SpeedVac 19 Resuspend the DNA pellet in 50 100 1 of TE RNase added 22 Cesium Chloride Purification of Genomic DNA Equilibrium density gradient centrifugation using cesium chloride CsCl is used to obtain very pure nucleic acids from crude homogenates or to further clean up previous extractions The procedure takes advantage of the fact that the buoyant densities of DNA RNA and protein are different in CsCl Following ultracentrifugation ca 100 000 rpm an RNA pellet forms at the bottom of the tube and DNA remains floating in the solution Ethidium bromide is added to the CsCl so that the DNA can later be viewed and recovered under U V light It is a good idea to dedicate a mortar and pestle for use in grinding the CsCl This should be done ahead of time and the powder stored in a sterile container e g 50 ml disposable tubes The following protocol is written for a Beckman TL 100 desktop ultracentrifuge using the 3 5 ml sealable tubes Beckman Quick Seal polyallomer bell top 3 5 ml capacity 13 X 32 mm 1 Before preparing your samples it is good to have some CsCl ethidium bromide solution available to top off the centrifuge tube if required For 100 ml of this solution 83 33 g CsCI 81 1 ml of Tris 10 mM pH 7 5 2 23 ml of ethidium bromide 10 mg ml
89. he mixture into to the appropriate minigel lane so that when photographed lane number one is to the top left Continue until all the samples and the M W standard DNA is loaded 6 Replace the cover to the electrode box which simultaneously attaches the electrodes and plug in the wires to the power pack The samples should be run towards the red or anode wire Turn on the power pack and using the low milliamperage setting run the gel at ca 75 ma Some power packs automatically adjust the voltage needed to achieve a particular number of milliamps but others do not For the later milliamperage will drop during the run but be careful not to overheat the gel if you adjust the voltage upward Run times will vary slightly but the Owl rigs are normally finished in 40 minutes Stop the run before the bromophenol blue dye exits the gel 39 12 216 11 198 10 180 9 162 8 144 7 126 6 108 5 090 4 072 3 054 2 036 1 636 1 018 506 517 396 344 298 220 201 154 134 75 Staining and Imaging Minigels Put on gloves After turning off the power gently remove the gel mold from the electrode chamber and slip the gel into the plastic staining box containing ethidium bromide EthBr Be aware that EthBr is a toxin mutagen Always wear gloves when working with EthBr The EthBr is kept in a dark bottle in the refrigerator in a 10 mg ml solution For the staining box add 20 yl of EthBr to ca 40 ml of 1X T
90. hotplate 5 Measure out the appropriate volume of hot agarose into a graduated cylinder for the small Owl rigs 30 ml Cool the cylinder by running cold tap water along the outside of the flask When only warm to the touch pour the agarose into the mold inside the dairy case 6 The gel is ready to run after the agarose is solidified ca 15 mins in the dairy case Gels can also be poured at room temperature but they take longer to solidify 38 Preparing Samples and Running Minigels 1 Gently remove the comb by pulling evenly upward 2 Position the gel mold in the electrode chamber and cover with buffer 1 X TAE 3 Since the agarose gel is submarine the samples will be loaded into the lanes under buffer This requires that the samples be heavier than buffer This is accomplished by mixing the samples with glycerol or Ficoll The most frequently used loading dye is a 1 X dye buffer glycerol solution see Solution Recipes 4 An easy way to mix the dye with the sample on a piece of Parafilm Using a permanent marker number the Parafilm with the number of samples to be run Spot out 10 wl of dye near each of the numbers Add an extra spot for the molecular weight standard see Figure that should be run next to your samples 5 Pipet 4 ul of your sample and add to the dye spot of the correct number Hold the tip and eject Place the tip on another pipeter set to 14 ul and draw up the entire sample dye mixture Pipette t
91. id Mini Prep EZNA Column Method We have found that the spin column plasmid purification methodologies developed and marketed by various companies such as EZNA and QIAGEN are extremely useful because they yield high quality and quantity of DNA in less time than the old fashioned alkaline lysis method below The method actually does use an alkaline lysis methodology but the purification is accomplished with a silica gel membrane inside a column 1 Swirl the 15 ml LB tube and pour its contents into a 2 ml microfuge tube Centrifuge the tubes for 2 minutes pour off medium and invert tubes on a paper towel for ca 5 mins to drain 2 Add 250 jl of Solution 1 kept refrigerated and resuspend pelleted bacterial cells by vortexing 3 Add 250 jl of Solution 2 and gently mix by inverting the tubes 4 6 times to mix to obtain a clear lysate A 2 minute room temperature incubation may be necessary Avoid vigorous mixing as this will shear chromosomal DNA and lower plasmid purity 4 Add 350 1 of Solution 3 and invert the tube immediately but gently 4 6 times until a floculent white precipitate forms 5 Centrifuge for 10 minutes at room temperature During centrifugation label the HiBind minprep columns and their collection tubes 6 Pour the supernatants from step 5 into the HiBind columns Centrifuge one minute at room temperataure Discard the flow through 7 Wash HiBind spin column by adding 500 yl of Buffer HB and centrifuge
92. k soln 0 5 ml 0 5 M dithiothreitol DTT Bring up to 50 ml with 0 2 M Na borate pH 9 0 with NaOH Make only as much as you will need do not store To minimize foaming during extraction it is best to add the SDS 2 5 ml of 2096 SDS solution after the plant tissue is homogenized Bromophenol blue 6X Dye 0 26 bromophenol blue 30 glycerol in H20 Store at 4 C Bromophenol blue 1X Dye for agarose gels 25 nil 10X TE 10 ml of 6X glycerol dye above For loading samples add 4 0 of sample to 10 pl of 1 X dye Bromophenol Blue Agarose Gel Loading Dye 25 ml 50 ml 25 Ficoll 625g 125 g 40 mM Tris pH 8 1 ml 2 ml 20 mM EDTA 2 5 ml 5 ml 0 05 BPB 12 5 mg 25 mg Add SDS to 2 for use with single stranded DNA RNA 95 Cesium Chloride Solution for ultracentrifugation of nucleic acids For 100 ml 83 33 g CsCl 8 1 1 ml of Tris 1 0 mM pH 7 5 2 23 ml of ethidium bromide 10 mg ml Chloroform Isoamyl Alcohol for DNA and RNA extractions A mixture of 24 1 by volume Store in a dark bottle under the hood 2X CTAB Buffer for DNA extractions Cetyltrimethylammonium bromide Aldrich 85 582 0 Also called hexadecyltrimethyl ammonium bromide Fisher O3042 500 100 mM Tris 1 4 M NaCl 30 mM EDTA 2 w v CTAB 100 ml 500 ml 1 0 liter Tris base 12146 6 05 g 12 1g NaCl 8 18 g 40 9 g 81 81 g EDTA disodium 14116 558g 11 16g CTAB 20g 10 0 g 20 0 g cetyltrimethylammonium bromide Aldrich 85 582 0 Takes awhil
93. l File in the Run Folder The computer will create the gel image Track lanes You can track lanes under Gel menu Select Track Lanes and then Autotrack After the autotrack is finished click on the triangles at the top of the gel to manually adjust and correct any mistracking From the Gel menu choose Extract Lanes OK A grid will appear select column A for all your samples click on Start button When finsihed close all windows Your sequences will be saved in a folder that has a name such as gelrun date Send your gel run folder to the Nickrent lab computer Curupira via AppleTalk After some time several weeks remove your run folder s from the sequencer computer hard drive The computer needs as much disk space as possible Turn off the monitor amp N Protocol Modifications when using Membrane Combs After pouring your gels DO NOT use the binder clamps to clamp the area around the casting comb Later on when inserting the membrane comb the gap between plates should be as loose as possible 2 Do not perform a pre run It s unnecessary when using the membrane comb But make sure the heating plate is on 3 Make sure that excess water gets removed from the well area after performing the final rinse You may need to invert the gel or use a Kimwipe to facilitate this 4 Put the bottom buffer chamber into the machine and clamp the gel
94. lace the buffer in the boiling water bath to achieve 90 95 C 2 Clean the Polytron generator with 9596 ethanol acetone and then the Sarcosyl rinse solution 3 Weigh out 5 gm of young leaves wash and blot dry if especially dirty 4 Place the leaves in the mortar add enough liquid nitrogen to cover the leaves ca 1 2 full and grind Continue grinding vigorously after the nitrogen has all evaporated until the tissue is a fine powder 5 Transfer the powder to a 2 5 X 20 cm glass test tube with the spoonula Quickly add 25 ml of the hot borate buffer Homogenize the sample with the Polytron using relatively short bursts to keep foaming to a minimum Filter the sample into the Nalgene centrifuge tube using a funnel with Miracloth 32 6 Add the 1 25 ml of 2096 SDS solution and the Protease K solution to the centrifuge tube using a micropipeter Be sure to add these solutions to the liquid below the foam Cap and place in the 37 water bath to incubate for one hour Mix occasionally during this time 7 Place the tube on ice and add 1 0 ml of 2 M KCl Allow to chill for 5 10 minutes 8 Centrifuge the sample at 8 500 rpm at 4 C for 10 minutes Place a Kimwipe in a glass funnel and place the funnel in a baked 30 ml Corex centrifuge tube Remove the samples from the centrifuge and pour the supernatant through the Kimwipe into the Corex tube Add 1 4 the volume ca 3 0 ml of 10 M LiCl Freeze the sample briefly on dry ice or in 70
95. leotides A C G T and n is the recognition sequence for the particular enzyme For EcoRI the recognition sequence is GAATTC The probability of cleavage is therefore 46 or 4 096 bases for this enzyme The average chloroplast genome contains 156 000 base pairs thus one would predict the enzyme to cut the circular molecule into 38 fragments The size of the nuclear genome in plants is much larger ranging from 5 X 107 to 1 25 X 10 Even with the smallest genome one would predict this enzyme to produce over 12 000 fragments thus bands are not resolvable on a gel and the multiple fragments would appear as a brightly staining smear To pick out individual bands one can transfer the DNA from the gel to a charged membrane nitrocellulose or nylon and then hybridize with a DNA probe specific to a gene or group of genes that are complementary to the DNA bound to the membrane This procedure was first developed in 1975 by E M Southern and the method is now called a Southern blot Restriction Digestion of Plant DNA A typical restriction digest is shown below 2 ul DNA plasmid 15 yl 2 1 10 buffer use buffer associated with restriction enzyme lul Enzyme ca 1 unit per microgram of DNA 20 yl Total Digest at 37 C for 1 5 hours or longer Agarose Gel Electrophoresis of Restriction Digests 1 Prepare a TAE agarose gel see Section 6 The electrode buffer will be the same as the type of gel The final purpose for the gel will determin
96. low concentration PCR products 64 Transformation of Competent Cells Chemical Heat Shock Method Before engaging in the transformation one should have already prepared sufficient LB medium and LB agar plates Competent cells are very sensitive to temperature and mechanical lysis hence one should aim to treat them gently When removing the cells from the ultralow freezer always place immediately on ice to thaw 1 Thaw on ice one vial of JM109 E coli cells This MUST be done on ice One tube of cells from Promega can be divided into 8 separate reactions to save money Transfer 25 of cells to each of 7 tubes and leave the remainder in the original tube This last tube can be considered a control since even gentle pipetting can disrupt the cells 2 Add 2 ul of the ligation reaction previous page to the cell tubes and mix gently with the pipet tip by stirring not pipetting up and down 3 Incubate on ice for 20 minutes During this time turn on the heat block set at 42 C 4 Heat shock the cells for 45 50 seconds in a heat block Do not mix or shake Remove and place immediately on ice for 2 minutes 5 Add 475 ul of LB or SOC medium Tape the tubes horizontally on lidded tube rack and add the lid Take the setup to the floor model shaker incubator in the Clark lab Tape the entire setup to the shaker platform Incubate at 37 C for at least 2 hours with shaking 150 rpm Recovery and Plating 1 Dry LB agar plates in
97. lowed Proper Clothing Lab coats are suggested for all lab workers This is especially important for anyone wearing shorts No open toe shoes or sandals are allowed in the lab Take steps to avoid injury by using gloves masks and eyewear when appropriate Accidental Injury Cuts and burns are the most common injuries that occur in labs For minor cuts use the First aid kit located along the east wall of Rm 1046 For more serious injuries go with an attendant to the Student Health Service For accidental introduction of foreign substances in the eye an eyewash station is located in the hallway just outside Rm 1046 At this same location is an emergency shower see below Chemical Spills Spilled acids and volatiles present real hazards hence extreme care should be exercised when cleaning up Most importantly proper clothing lab coat etc and gloves should be worn to prevent incidental contact with the skin To treat small areas of chemical contact rinse with copious amounts of water in the sink For large contact areas use the emergency shower outside Rm 1046 Remember this shower is NOT to be used in case of contact with radioactive materials Chemicals spilled on the floor and lab surfaces must be cleaned up immediately For acids and bases use the lab absorbers that are located on the top shelf in Rm 1048 Dry Chemical Disposal Under no circumstances should dry chemicals be poured down the sink or thrown away in the
98. m hot plate and remove the stir bar Autoclave for 45minutes under liquid setting program 2 Let cool to no less than 50 C should be able to touch the bottle While the medium is cooling get IPTG AMP XGAL out of the freezer and let thaw on ice or inside the dairy case 7 Label 10 petri dishes and note which have IPTG AMP XGAL 8 To the 250ml solution add Stock sol Final Conc Volume of stock to add IPTG 100mM 0 5mM 125041 Amp 50mg ml 50u g ml 25041 Xgal 50mg ml 80u g ml 4001 9 Put the petri dishes around the Bunsen burner The burner sterilizes the air around the dishes thus helping keep down contamination 10 Pour ca 25 ml of the medium into each petri dish ca 1 2 full The petri dishes furthest from burner should be closed to avoid contamination 11 Let the medium cool and solidify Place the petri dishes in a plastic bag and store in the dairy case in box in dark 12 As an alternative 100 ul of 100 mM IPTG and 20 u1 of 50 mg ml may be spread over the surface of an LB ampicillin plate Allow to absorb for 30 minutes at 37 C prior to use Lysis Solution I 100 ml 5 ml 1 M glucose 2 ml 0 5 M EDTA 2 5 ml 1 M Tris Cl pH 8 0 dH5O to 100 ml 98 Lysis Solution II 100 ml Make fresh weekly 2 ml 10 N NaOH 88 ml dH2O 10 ml 10 SDS Lysis Solution III 100 ml 60 ml 5 M KOAc 11 5 ml glacial acetic acid 28 5 ml dH2O Resulting solution is 3 M wit
99. mide destruction and decontamination of solutions Anal Biochem 162 453 458 Maniatis T E F Fritsch and J Sambrook 1982 Molecular cloning a laboratory manual Cold Spring Harbor Laboratory Publ New York Mead D A N K Pey c Herrnstadt R A Marcil and L M Smith 1991 A universal method for the direct cloning of PCR amplified nucleic acid Bio Technology 9 657 663 Mullis K B 1990 The unusual origin of the polymerase chain reaction Scientific American April pp 56 65 Mullis K B Faloona F Scharf S Saiki R Horn G and Erlich H 1986 Specific enzymatic amplification of DNA in vitro the polmerase chain reaction Cold Spring Harbor Symposium on Quantitative Biology 51 263 273 106 Mullis K B and Faloona F A 1987 Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction Meth Enzymol 155 335 350 Murray M G and W F Thompson 1980 Rapid isolation of high molecular weight plant DNA Nucl Acids Res 8 4321 4325 Nickrent D L 1994 From field to film rapid sequencing methods for field collected plant species BioTechniques 16 470 475 Nickrent D L 1997 Update to From field to film Rapid sequencing methods for field collected plant species Pp 269 281 in J Ellingboe and U Gyllensten eds The PCR Technique DNA Sequencing II Eaton Publishing Natick MA Palmer J D 1986 Isolation and structural analysis of chloroplast DNA Pp 167 186 In A W
100. n freezer added to buffer just before funnels use hotplate with beaker and water X TE buffer liquid nitrogen Ammonium acetate 4 0 M mortars and pestles organics chloroform isoamyl alcohol 24 1 thermometer Tris buffered phenol cold isopropanol cold waterbath set to 37 45 C 100 ethanol and 70 ethanol The best DNA extracts come from young plant material Attempt to conduct the extraction soon after collection if refrigeration is not possible You will need ca 3 0 g of leaves for this procedure 1 Heat a water bath on the hotplate to just below boiling 95 Add 25 ml of CTAB buffer to the tubes 2 Place 2 to 3 g of plant tissue in the mortar cover with liquid nitrogen and grind to a fine powder 3 Add 25 ml of the hot CTAB buffer and continue grinding for ca 1 minute Using a funnel with cheesecloth strain the extract into a 50 ml polyallomer centrifuge tube 4 Add 50 units of protease K and 0 5 ml of DTT mix cap and incubate sample in the 37 45 C water bath for 1 hour with occasional swirling 5 Add 2 3 volume of chloroform isoamyl alcohol 24 1 Cap the tube and shake gently for ca 2 or 3 minutes intermittently releasing pressure 6 Balance the tubes w each other or a blank using a twin pan balance All subsequent centrifugation steps assume that you have balanced your tubes Centrifuge at 8 500 rpm for 15 minutes 7 Remove the top aqueous phase with a wide bore pipet P 50
101. n the main lab prepare and label 1 7 ml microfuge tubes with 50 ul of distilled water for each colony 1 With a sterile toothpick touch a colony from the LB agar plate and resuspend it by spinning the toothpick between your fingers in the corresponding tube from above one colony per tube 2 Heat tubes with the resuspended colony at 85 95 for 5 minutes in heating block This produces the lysate 3 In PCR room prepare PCR mix using appropriate primers for each reaction e g T7 amp SP6 or the M13 forward and reverse Reagent Amount Final concentration PCR buffer 10X 2 5 ul 1X MgCl 25mM 1 5 pl 1 5 mM dNTPs 2 5mM each 0 5 ul 50 uM forward primer 104 1 0 yl 0 4 uM reverse primer 104 10 ul 0 4 uM Taq 1 5 0 2 pl 0 5 units DMSO 1254 5 15 05 ul 4 Bring PCR reaction to the main lab add lysate Lysate 2 ul Final volume 25 pl 5 PCR parameters user jfc program colony Denaturation 94 for 5 minutes 30 cycles 95 C for 30 seconds 55 C for 30 seconds 72 C for 2 minutes Final extension 72 C for 10 minutes Hold indefinite time 4 C 6 Run an agarose check gel Expected sizes if negative 85 bp 116 bp 201 bp if positive 201 bp INSERT 7 For purification run another gel Cut out the agarose band that corresponds to the insert and follow the protocol from the QIAGEN gel extraction purification kit Note Colony PCR may not work if for example plastid 16S rDNA has been cloned This i
102. n top of your sequence eoe Sample7 Paks Q searct ATCCCGA TGC arcee Tec EE DI ih TAM Y Quick and Easy Search Find those interesting features in a glance you can search on custom and predefined motifs sequence translation and Sequence Translation Info CTTTTAAAAAGGCCTTACATCCTT CACACGACCAGACTCCATAGTGAT CAGCGCAGAAGTGAGCATCCCTCT TTGAACCTGGACCAGTAACAGGGC TGGCGCAACGGTTCCCACTAACCT TCCTTTTCAGTGTCTCTCTGCTTTA TTGCTTCACACCAGGGACTCTTTT GAGGTTCCGCATACAGATGTGATA Y ANTATATTATGTCCTTGAATOCTT 0 it 1 5 O vA e Speak Press this button or hit the spacebar Details matter Pre s bu r hit the sp x and let the compute Zoom in on your traces using the slider the shift key toggles between horizontal and vertical zoom Display Phred Quality Data You easily find the weak spots in your trace file by looking at the quality data overlay Ready set action The action menu gives you quick access to all frequently needed analysis and editing functions 85 read the sequence out loud Easy for cross checking Everything at hand The drawer gives you quick access to the complete sequence and translation of your trace file Interpretation of Sequence Data When the sequence is pasted into SeAl one must be aware of whether the sequence was generated from a forward or reverse primer The reverse primer sequence must
103. nal PCR reactions or sequencing Note The JM109 cells express the lac repressor 19 which will repress transcription from the ac promoter Thus to perform blue white screening for inserts the IPTG must be added to your plates to express LacZa Remember that competent cells are especially sensitive to temperature and mechanical lysis so keep them on ice and avoid excessive pipetting 62 Xmn 2009 Sca 1890 A r id pGEM T Easy 44 Vector 3015bp T7 Transcription Start 5 TGTAA TACGA CTCAC TATAG GGCGA ATTGG GCCCG ACGTC GCATG CTCCC GGCCG CCATG 3 ATGCT GAGTG ATATC CCGCT TAACC CGGGC TGCAG CGTAC GAGGG CCGGC GGTAC T7 Promoter Apal Aat II Sph BstZ Neo GCGGC CGCGG GAATT eM 7 insert ATCAC TAGTG AATTC GCGGC CGCCT GCAGG TCGAC CGCCG GCGCC CTTAA GCTA 3 TTAGTG ATCAC TTAAG CGCCG GCGGA CGTCC AGCTG ll EcoRI Spel EcoRI Sall BstZ BstZ SP6 Transcription Start GGGA GAGCT TGGAT GCATA GCTTG AGTAT TCTAT AGTGT CACCT 3 GTATA CCCT CTCGA GGGTT GCGCA ACCTA CGTAT CGAAC TCATA AGATA TCACA 5 SP6 Promoter Sac BstX Nsi 63 Ligation and Cloning of PCR Products Typical double stranded PCR products are generally suitable for cloning The quantity and quality of the amplification is usually checked on an agarose gel If a single clear band is obtained the PCR reaction can be used directly for clonin
104. nd then click on Sequence Run Again select File New and then click on Sequence Sample This is your sample sheet Fillin the empty boxes under sample name Leave unused or skipped lanes blank Close this file and save 6 Back to the Run sheet You can now select your sample sheet from the menu Make sure all other options are filled in correctly as in the attached photo Most importantly make sure the Run Module reads Seq Run 36E 1200 and run time 9 hours default is 7 gt 78 Ne Wet Lab Stuff Mix up the 1X TBE You ll need approx 1300 ml 260 ml of 5X TBE sufficient ddH O to reach the 1300 ml mark There is a large plastic graduated cylinder for this purpose If your sequencing reactions are in individual tubes make sure that the heat block is turned on It takes a while for it to warm up Rinse wash plates In the sink wash the outside of the plates with dH O Remove and wash comb with ddH O Wearing powder free gloves rub off any polymerized gel on the plate surface and edges Make sure loading region gets rinsed well Stand plates up in the gel pouring region to dry Let air dry for a few minutes and then you can use a folded Kimwipe to wipe off excess beaded water Wash off cassette by using a dampened paper towel Insert the paper comb Skip this step if using a membrane comb Place the dry glass plates into the cassette and close clamps If using a disposabl
105. ne is supposed to take the photo in close up mode only when the zoom reaches the sweet spot indicated when the flower turns yellow We have found that this doesn t matter i e the photos are fine even when the flower is white Take the photo Plug in the serial cable right side of camera The LCD monitor will go black On the computer double click the Nikon View icon In the window double click Digital Camera It will take some time to connect to the camera Eventually you will see 100 Nikon Double click this and your photo s will appear in the window Drag your photo s to the correct folder on the desktop We have three as follows Genomic DNA PCR Purifications This will take some time to transfer Open the folder that contains your photo file and rename it It will come with a name such as DSCN Name it appropriately e g PCR When you are sure you have an acceptable photo throw away the photo file from the 100 Nikon folder Control A selects all files hit the Delete key and say Yes Close the window Leave the computer on it goes to sleep eventually 10 Turn off the digital camera and unplug the power and serial cables 11 Dispose of the gel in the waste container and clean the surface of the transilluminator Dispose of the agarose gel in the waste bucket Clean off the surface of the transilluminator with dH 0 squirt bottle The photograph files can be printed on a Thermal p
106. ng up to 500 ml with DEPC treated H20 pH should be at or near 9 0 101 Sodium Chloride 5 0 M 146 g of NaCl Bring up to 500 ml with DEPC treated H50 Sodium Dodecyl Sulfate SDS 20 for nucleic acid extractions Lauryl Sulfate Sodium Salt FW 288 4 10 g of SDS bring up to 50 ml with dH50 Gentle heating OK to get to go into solution STE Buffer Salt Tris EDTA for RNA extraction 10 mM Tris 10 mM NaCl 1 mM EDTA 1 0 ml of 1 M Tris 200 ul of 5 M NaCl 0 5 ml of 0 2 M EDTA or 0 2 ml of 0 5 M EDTA Bring up to 100 ml with DEPC treated H20 and pH to 7 5 with TAE Buffer 50X 0 04 M Tris acetate 0 001 M EDTA 500 ml 1 0 liter Tris Base 121g 242 g Glacial Acetic Acid 28 55 ml 57 1 ml 0 5 M EDTA pH 8 0 50 ml 100 ml TE Buffer 10X 10 mM Tris 1 mM EDTA 0 605 g Tris base 0 168 g EDTA disodium dihydrate 2 H50 Bring up to 500 ml pH to 7 5 with HCl Autoclave before use TE Buffer 1X 1 mM Tris 0 1 mM EDTA Dilute 5X TE above 1 4 with sterile water Tris 1 M MW 121 1 g mole 60 55 g of Tris Bring up to 500 ml with DEPC treated H20 pH to 7 5 with conc 102 Tris 2 M MW z 121 1 g mole 121 1 g Tris Bring up to 500 ml with dH20 pH to 7 5 with conc X Gal 5 bromo 4 chloro 3 indolyl 6 D galactoside Make solution to 40 mg ml in dimethylformamide Store in dark container in the freezer Add 40 ul of X Gal to plates and spread Let dry in 37
107. nt to work quickly to avoid thawing the tubes Attempts are made to keep the DNAs sorted alphabetically by genus but some boxes are full and may require some searching Use securing rings on all the Styrofoam Sarstaed boxes to prevent spilling the contents Especially during the humid summer months frost will accumulate around the Styrofoam sublids Use the plastic ice scraper to keep this area clear The rubber gasket on the lid will not fit properly if ice accumulation becomes excessive Frost on the sublids can be quickly removed with hot tap water Everyone should actively work to keep frost accumulation to a minimum on freezer and sample surfaces High speed Sorval Centrifuge This centrifuge is mainly used during DNA and isozyme extractions hence the temperature is set at 4 C Itis a good idea to turn on the machine at least a half hour prior to use to allow the chamber to reach the proper temperature The rotor can then be installed It is best to pre cool the rotor in the dairy case or walk in coldroom first All centrifuge tubes must be balanced against their opposites Use the twin pan balance on the top of the freezer to do this The rotor lid has two threaded rings the outermost one secures the lid to the rotor tighten this one first and the innermost one secures the rotor lid assemblage to the shaft tighten second The time and speed are set manually and the run commences after pushing the start button The door cannot be op
108. o introduce a PCR product into a tube containing genomic DNA Because our genomic DNA samples must be kept in an ultralow freezer by necessity they are present in Rm 1046 instead of 1046A where ideally they would be housed All genomic DNA samples must therefore be brought immediately into Rm 1046A when they are being used not 1046 A number of solutions made in our lab are intended for multiple use such solutions must be labeled with the name of the solution it s molarity and pH the date and initials of who made it These include the reagents needed for agarose gel electrophoresis loading dyes MW marker ladder solutions TAE buffer for agarose gels etc It is more practical for every individual to have his or her own PCR reaction box that includes Taq buffer water MgCl nucleotides etc Although we do not use the darkroom for developing film anymore it is still important to keep it clean and organized At times we conduct agarose gel electrophoresis in this room and sometimes this results in spilled buffer on the bench This should be cleaned up immediately especially if the buffer contains ethidium bromide When taking pictures of agarose gels with the Polaroid camera do not take the last photograph and leave the camera empty Learn to load the film and have it ready for the next person When the back of the camera is open examine the rollers and make sure they are clean dried gel from the film accumulates Specifics on E
109. of chloroform isoamyl alcohol 24 1 Centrifuge for 10 min at maximum velocity Remove aqueous to new tube Add equal volume of 1396 PEG Salt solution Mix well Centrifuge for 10 min at maximum velocity Pour off aqueous Rinse pellet in 70 EthOH Dry pellet in desiccator or vacuum drier Rehydrate pellet in water or TE For every 100 pl of PCR product use 20 jl of water TE 13 PEG Salt Solution 13 g polyethylene glycol MW 8000 9 3 g NaCl Bring up to 100 ml with dH20 60 SECTION 9 TA CLONING AND SEQUENCING OF PCR PRODUCTS Introduction Methods will be described in this manual Section 10 for directly sequencing PCR products One may ask then why would one ever want to clone and sequence a PCR product As it turns out a PCR amplification may result in the production of heterogeneous products Using gel purification as described above one can usually select the band of the correct molecular weight and avoid products that are obviously smaller and larger Situations occur however where products are formed that are the same or nearly the same length but differ in sequence These products will migrate to the same position on an agarose gel and will all be obtained if this band is removed We have encountered this situation when attempting to sequence ribosomal internal transcribed spacers ITS in some wild species of Glycine soybean Attempts to directly sequence such templates results in double peak
110. one minute Discard the flow through 8 Wash HiBind spin column by adding 750 1 of Wash Buffer must be diluted with ethanol and centrifuge for one minute Discard the flow through 9 Repeat step 8 66 10 Centrifuge the empty column for an additional two minutes to remove residual wash buffer 11 Place HiBind column in clean labeled 1 7 ml microcentrifuge tube To elute the DNA add 50 ul of Buffer EB 10 mM Tris HCl pH 8 5 from Qiagen to the center of each HiBind column and let stand for one minute Place the tubes in the centrifuge rotor with their caps facing out Centrifuge for one minute Discard the columns and proceed to restriction digestion to check which plasmids have inserts 67 Plasmid Mini Preparation and Insert Confirmation Alkaline Lysis Method This protocol is essentially as described in Molecular Cloning Sambrook et al 1989 1 Place 1 5 ml of LB medium in 17 X 100 mm sterile snap cap polypropylene tube Fisher 14 956 1J Using a sterile autoclaved wooden stick pick up a single white bacterial colony and inoculate the medium Incubate at 37 overnight with vigorous shaking Pour into a 2 0 ml microfuge tube and centrifuge for 2 min Pour off the supernatant and drain the pellet for 5 min with the tube upside down Resuspend the pellet completely in 100 1 of Lysis Solution I Vortex Let stand at room temperature for 5 min Add 200 jl of freshly made Lysis Solution II Mix by in
111. ough the wall of the tube but this is to be avoided since this will shear genomic DNA Carefully cut off the neck of the centrifuge tube to allow 23 access with micropipet tip Very carefully remove the top layer of CsCl until you reach the DNA band Use aP 1000 tip to start and switch to a P 200 tip when near the band Remove the DNA band and save in a microfuge tube on ice Discard all CsCl ethidium bromide solutions in the ethidium bromide waste container 7 The DNA can be separated from the CsCl salts either using dialysis or by means of a spin column We use the Centricon 100 microconcentrator Amicon Danvers MA 01923 Place the filtrate cap on the sample reservoir and then wet the Centricon membrane with ca 900 yl of Tris 10 mM pH 7 5 Centrifuge at 4 000 rpm for 10 min and discard the Tris 8 Pipet the DNA sample into the reservoir add the retentate cap Balance with 10 mM Tris Centrifuge at 4 000 rpm for 15 minutes Discard the CsCl ethidium bromide into the EthBr waste container 9 To elute the DNA from the membrane use 250 u1 of High Salt NET buffer Add the retentate cap and briefly vortex Allow the liquid to stay in contact with the membrane for about 10 minutes Gently vortex again invert the tube so that the sample runs into the retentate cup Centrifuge opposite direction as previous one for ca 5 minutes at 4 000 Remove the liquid from the retentate cup into a microfuge tube 10 To remove additional
112. pherogram is read by computer software which generates a linear DNA sequence Although the sequence still requires some manual editing the speed of generating of DNA sequences is greatly increased over manually reading sequence from an autoradiograph But already the ABI 377 automated sequencer we use is out dated and will soon be replaced by a capillary sequencer AB3730 Here the chemistry is much the same as before with fluorescent dyes but the matrix through which the DNA fragments migrate is not polyacrylamide but polymer POP 7 contained within thin capillary tubes Furthermore this technology is certain to be replaced by other higher throughput methods that promise to provide longer and more accurate reads at a lower price Indeed whole genomes are now being sequenced using radically different methodologies such as nanopores and pyrosequencing see www 454 com Review of Metric Units Molecular biological procedures require a thorough understanding of the metric system as it applies to mass volume and length Since most protocols use very small volumes of liquids you must be able to do calculations and conversions using the proper units The following table gives the relationships between the commonly used prefixes 11 Prefix Abbreviation Unit multiplication Exponential Commonly Factor Used Units Kilo k 1000 X 10 kg Deci d 0 1 X 10 dm Centi e 0 01 X 10 cm Milli in 0 001 X 10 mm ml mg Micro u 0
113. procedures 1 Prepare primers Mastermix Seq Reac Initial concentration ul sample _ sterile Nanopure H O 2 92 Primer 10 uM 0 08 Total volume 3 0 2 Dilute BigDye with BetterBuffer The Gel Company DAF 5 For each reaction 3 0 ul of BetterBuffer and 1 0 of BigDye Terminator Final vol 4 0 3 Distribute 4 0 ul of the above mix into the 0 2 ml reaction tubes Add 3 0 ul diluted primer to each tube mixing upon addition 4 Using new tips for each sample add 4 ul of purified product 20 30 ng ul to each sequencing reaction Mix gently with the pipet 5 Use the BigDye program under user jfc and then the bigdye run below Keep tubes on ice When thermocycler reaches 96 C hit Pause add tubes secure caps with rolling instrument close heated lid Press Resume and begin run Denaturation Denaturation Annealing Extension Store 94 C 96 50 60 4 3 min 10 sec 5 4 0 min 25 cycles These cycle sequencing products can be purified using either CENTRI SEP Columns with Sephadex or by means of an ethanol precipitation 73 Purifying Cycle Sequencing Products using Sephadex CENTRI SEP Columns A Preparation of Sephadex 1 In a 250 ml flask weight 5 g of Sephadex and add 125 ml of distilled water and stir bar 2 Stir VERY slowly on the stirring hotplate no heat for 20 minutes 3 Allow to stand for 1
114. quipment Operation and Maintenance Ultralow freezers We maintain two 80 C freezers I cannot over emphasize the importance of these freezers and the samples they contain to our research program The one in Rm 1046 contains genomic DNAs of parasitic and nonparasitic plants primer stocks Taq polymerase dNTPs and some of the parasitic plant tissue samples The majority of plant tissue samples fresh silica dried are kept in the freezer in Rm 1055 Any malfunctioning of these freezers should be reported to me DLN at any time day or night In the event of a power outage the freezer in 1046 is connected to an emergency outlet that will continue to have power via the building s generator Such is not the case for the freezer in 1055 If a power outage last for more than 10 hours the samples must be moved to another location Microbiology maintains some overflow freezers albeit with limited space In terms of daily use it is generally a good idea to leave the freezer doors open for as short a period of time as possible Wear gloves before handling any of the metal racks Obtain the samples you need quickly and work with further sorting retrieving etc with the lid closed Monitor the digital readout to avoid excessive temperature change If the temperature increases to 65 C the alarm will sound and will not stop until the preset low temperature has been achieved When working with boxes containing genomic DNA samples it is also importa
115. r chambers and the heating plate Disconnect the coolant tubes and immediately wipe off any residual coolant using Kimwipes Remove the heating plate Make sure the bottom surface is clean otherwise wipe it off with ddH O dampened Kimwipe Return the plate to its designated drawer Make sure the clamps from the heating plate get clamped to hold glass plates in place Use a small beaker to remove the buffer from upper chamber into a plastic beaker Use Kimwipes to dry the gasket area of the upper buffer chamber Remove the upper chamber and wipe off any remaining drops of buffer With one hand holding the cassette plates release the four cassette clamps Remove the cassette plates 81 8 Remove the lower buffer chamber 9 Make sure the inside of the sequencer is CLEAN You may use a ddH O dampened Kimwipe to GENTLY clean any surfaces Do NOT scrub surface of heating pad just gently wipe from side to side The upper and lower buffer chambers get cleaned with dH O only 10 Remove glass plates from cassette and place in sink CAREFULLY use the wedge to pry the plates apart Have patience Place dry Kimwipes across the gel then roll the gel off Discard in designated container 11 Wash the combs and spacers with dH O only Final rinse with ddH O 12 Wash plates as described above 13 Wipe off all lab surfaces 14 Make sure there is enough ddH O for the next user B Post Run Computer Stuff ER Open the Ge
116. r transfer any debris Add 300 u1 of Buffer and one volume of 100 ethanol Vortex thoroughly to obtain a homogeneous mixture precipitate may form but will not affect the procedure 6 Add 800 yl of the mixture to the HiBind DNA column placed in a 2 ml tube supplied with kit Centrifuge for 1 minute Discard the liquid Add the remainder of the sample including any precipitate that has formed and centrifuge as above Discard the liquid and the tube 7 Place the column in a second 2 ml tube Add 750 yl of Wash Buffer diluted with absolute 100 ethanol Centrifuge for 1 minute and discard the flow through Reusing the collection tube repeat this step 8 Centrifuge the empty column 2 minutes at maximum speed to dry this removes residual ethanol 9 Transfer the column to a clean 1 7 ml tube Apply 100 ul of 10 mM Tris buffer pH 9 0 prewarmed to 65 To increase DNA yield incubate the column and buffer for 5 minutes at 65 Centrifuge for 1 minute to elute DNA Add another 100 u1 of Tris buffer to the column incubate and centrifuge This eluate can be kept separate from the first or combined with the first lowers the total concentration of DNA From Omega Bio Tek www omegabiotek com P O Box 47310 Doraville GA 30362 800 832 8896 888 624 1688 fax 30 SECTION 4 PLANT RNA EXTRACTION General Consideration and Rationale RNA is quite prone to degradation due to the extremely resilient ribonucleases R
117. regular trash cans We are required to have waste chemicals removed by the SIUC Center for Environmental Health and Safety telephone 3 24343 The most important thing is to make sure the container is properly labeled as to its contents CEHS provides labels free of charge For waste pickup fill out the online form on the CEHS webpage http www cehs siu edu Also present on the web page is a list of chemicals for that are available for redistribution Liquid Chemical Disposal The same rules apply as with dry chemicals Some liquids can be safely poured down the sink e g Tris buffer sucrose solutions etc If in doubt please ask waste liquid chemical e g phenol chloroform etc should be stored in the hood in an appropriate container that is labeled with the red and white stickers provided by CEHS Ethidium Bromide Ethidium bromide is one of the most dangerous chemicals used in the lab It is a powerful mutagen cancer causing agent therefore exercise extreme caution when using this reagent If you spill any gel buffer containing EthBr put on gloves and clean it up immediately with hot soapy water and a paper towel Do NOT use the sponge that is used for general cleanup in the lab Be especially aware of the bench and transilluminator surfaces in the darkroom All gels pipette tips etc that have come in contact with EthBr should be disposed of properly Waste stained gels are collected in plastic containers in the dark
118. riction digests The bath is kept at 37 so if you readjust it please return it to this temperature when finished Keep an eye on the water levels and replenish when needed A few drops of copper sulfate small white bottle can be added to keep algal growth down UV Transilluminator darkroom The transilluminator should always be used with the protective plastic cover to keep the glass from becoming scratched Be considerate of the next person and wipe off the surface with water and a paper towel Do not leave ethidium bromide to dry on the cover For viewing always lower the glass cover or wear protective goggles Photographs with the Polaroid camera can be taken on top of the glass cover Polaroid Camera The Polaroid camera is to remain with the transilluminator for use in fluorescent photography The camera uses Polaroid 667 film which should be stored in the refrigerator not the freezer As mentioned above the rollers will occasionally require cleaning to ensure smooth removal of the prints pH Meter Please follow the instructions in the booklet for proper calibration and use of the Fisher Acumet AB15 pH meter The standard calibration solutions should be replaced monthly and dated Check the electrode often it should be full of saturated KCI level solution Replace if needed from the bottles in the cabinet above Remember it is never necessary to place the electrode tip more than a centimeter into a solution Immersin
119. rinter Sipes lab 40 Inactivating Ethidium Bromide One of the more hazardous chemicals that exists in a molecular biology laboratory is ethidium bromide EthBr This reagent is indispensable since it can intercalate within the stacked bases of DNA and RNA and when illuminated with U V light produce fluorescence that indicates the presence of nucleic acid Unfortunately EthBr is also a potent mutagen Gloves should always be worn when handling gels etc that contain this chemical Clean up any spills no matter how small EthBr solutions are light sensitive so should be kept in dark bottles away from the light A number of different ways have been proposed to inactivate EthBr some are effective and others are not Many labs simply add sodium hypochlorite to the solution containing EthBr however this does not eliminate the mutagenicity see Lunn and Sansone 1987 A more effective way is as follows 1 Dedicate a large mouth jar 1 0 liter or larger to EthBr waste place in hood area 2 For every liter of buffer containing EthBr add 16 ml of 5096 hypophosphorus acid and 3 g of sodium nitrite NaNO For proper neutralization of EthBr the solution should be below pH 3 0 Gently stir the solution and allow to sit for 24 hours 3 Add ca 3 g of sodium bicarbonate to neutralize the solution Allow to stand for ca 1 hour If the liquid is clear it is safe to pour down the sink If not repeat above procedure
120. room for disposal by CEHS Since the darkroom is now locked same key as lab arrangements must be made to allow CEHS personnel to gain access to dispose of waste gels Glass Disposal broken glass including used disposable pipettes broken glassware etc should not be disposed of in the regular trash cans but should be placed in the waste glass disposal box located under the hood in Rm 1046 When full seal the box with tape label and place in the hallway for removal by the custodian Remember to report any broken glassware so that it can be replaced Sharps Container For disposing of hypodermic needles used razor blades scalpel blades etc please use the red sharps container Rm 1046 provided by CEHS Chemicals When new containers of chemicals arrive in the lab it is standard procedure to label them with the date Check the bottle label for proper storage conditions and then store properly Save the Material Data Safety Sheet and the packing slip often in a pocket on the outside of the box The following is a list of the different chemical storage conditions maintained in my lab Dry Room Temperature Chemicals Most dry chemicals are stored in Rm 1046A in the cabinets or on the black metal shelves the latter for bulk items Dry Room Temperature Desiccated Chemicals Some chemicals must be stored in a desiccator but do not require freezing These are housed in a large glass desiccator in the cabinet below the
121. rophoresis 4 When the band has migrated the desired distance check progress with long wave UV lamp turn off the power remove the gel on its support from the electrode chamber and using a new scalpel blade make an incision just ahead of the band of interest A single large incision can be made if all the products are the same size but do not cut the gel completely in half If more than one band exists in a lane make the incision ahead of only the band of the correct size Using forceps place the prepared DEAE membranes in the incision return the gel to the electrode chamber and continue electrophoresis In approximately 10 minutes the band will completely run into the membrane check with U V light Elution of ds DNA from Membrane 5 Remove DEAE membranes from the gel briefly rinse in the gel electrode buffer to remove residual agarose Place 2 3 membranes per sample in the same microfuge tube 6 Add 350 yl of high salt NET buffer Vortex to move the membranes under the buffer Incubate in a heat block at 65 for 30 45 min with occasional vortexing 7 Move the buffer to another tube Wash the membrane with another 75 jl of high salt NET buffer Incubate at 65 for 10 min Pool the buffers discard membranes 8 Extract the buffer with 3 volumes of water saturated n butanol top phase in bottle Shake centrifuge for ca 5 minutes and remove the top phase into a waste butanol container 9 To the buffer add 2 5
122. roteins Phenol is a strong denaturing agent for proteins In phenol extractions proteins partition into the organic phase and interface whereas nucleic acids partition in the aqueous phase Chloroform is also an effective deproteinizing agent and also helps to remove lipids When phenol is used first it is often followed by a 1 1 mixture of phenol chloroform and then a final extraction with just chloroform This last chloroform extraction helps to remove the last traces of phenol from the sample Chloroform is usually mixed with isoamyl alcohol 24 1 ratio because it helps with the phase separation decreases the amount of material found at the aqueous and organic interface and helps reduce foaming Antioxidants such as 8 hydroxyquinoline or B mercaptoethanol are often added to phenol During phenol extractions the pH of the buffer is important in determining whether DNA and or RNA are recovered At pH 5 6 DNA is selectively retained in the organic phase leaving RNA in the aqueous phase hence water saturated phenol is useful for RNA extractions At pH 8 0 or higher both DNA and RNA are retained in the aqueous phase Phenol can be stored under buffer for up to one month Although phenol is very effective in removing protein many protocols designed for animal tissue use it we have found that most plant tissues can be extracted using only chloroform see 2X CTAB methods below In addition phenol contact with the skin can cause severe b
123. rwise Cancel the Plate Check and proceed to next step Record the position of the baseline in the log sheet PreRun Skip this step if using a membrane comb Place top buffer chamber on the plates and make sure it is securely clamped Plug in Mix IX TBE and add to top buffer chamber to the fill line Make sure there are no leaks Do not fill past the max fill line Wipe up any splashes Fill bottom reservoir until full 79 4 Place heating plate on front of plates and clamp in Careful not to drop the heating plate Plug in electrical ground wire and the two coolant tubes Check that the coolant tubes don t leak note when worn out the rubber rims must be replaced locally at True Value 5 Place the lid on the top buffer chamber and close door making sure not to pinch any wires 6 Select the PreRun icon this should be set for Seq PR 36E 1200 7 Go to Window and select Status Make sure the 30 second count down is complete otherwise cancel and try again 8 During the PreRun you should see the following on the status window Electrophoresis Voltage 1 01 1 00 Electrophoresis Current mA 12 35 0 Electrophoresis Power W 10 50 Gel Temp C 51 Laser Power W 40 0 40 0 the numbers correspond to the green and grey boxes respectively 9 Record the prerun mA in the log sheet 10 Reuspend your samples To your 150 1 aliquot of fomamide add 30 u1 the blue dye blue Dextran EDTA Mix w
124. s because the primers in the reaction will also anneal to coli chromosomal 16S rRNA genes One can also use internal primers from the PCR reaction as opposed to universal primers 70 SECTION 10 DNA SEQUENCING REACTIONS How Sequencing Reactions Work The sequencing protocol described below utilizes the dideoxynucleotide terminated chain elongation method Sanger et al 1977 Since the original description of this method various modifications have been made such as the choice of polymerase and the method in which the DNA fragments are visualized Several different polymerases have been used with this method such as Klenow Fragment modified T7 DNA polymerases and Taq DNA polymerase The latter is used almost exclusively now because cycle sequencing requires an enzyme that can tolerate high temperatures without denaturing For cycle sequencing the DNA template is first denatured at 94 Next the temperature is lowered and the primer is annealed to the template DNA figure next page A labeling reaction then extends from the growing nucleotide strand at the 5 end of the primer by incorporating deoxyadenosine triphosphate nucleotides that are fluorescently labeled Each nucleotide A C G and T has a different fluorescent moity that emits a different color when excited with a laser The growing strands are terminated because the reaction mixture also contains a small proportion of dideoxynucleotides ddNTPs which lack the 3 O
125. s at some positions In addition PCR amplifications may result in too few products of the desired size to allow direct sequencing An efficient way to overcome these problems is to clone and sequence these PCR products Because of the way cloning works a plasmid picks up only one insert and each colony derived from an E coli cell that was transformed started with only one plasmid There are numerous cloning vectors available on the market however we have had good success using TA Cloning as described by Mead et al 1991 This cloning method takes advantage of the fact that Taq polymerase has nontemplate dependent terminal transferase activity which adds a single deoxyadenosine A to the 3 end of all PCR products Linearized plasmid vectors are used which have deoxythymidine T ends that are complementary to the A overhangs of the PCR product In the TOPO TA Cloning Kit Invitrogen the plasmid vector is supplied linearized with 3 thymidine T overhangs that are complementary to the A overhangs on PCR products It also has a topoisomerase that is covalently bound to the vector in its activated form This method allows ligation to occur at room temperature within five minutes Although it works very well the kit is rather expensive so we use the Promega the pGEM T Easy Vector System This kit requires the addition of DNA ligase and the reaction occurs in one hour at room temperature Following the ligation reaction competent
126. s of ice cold ethanol 10 ml Cap invert to mix and store 2 4 hours at 20 18 Centrifuge the sample at 8 500 rpm for 15 minutes at 4 C Pour off the supernatant and let the pellet air dry for a few minutes until just moist no ethanol odor Dissolve the RNA pellet in 1 0 ml of DEPC treated water or TE buffer if you wish Store the RNA at 20 C or colder 33 TRIzol RNA Isolation Method Reagents TRIzol Reagent final concentration Other Reagents Phenol in saturated buffer 38 96 380 ml liter 0 8 M sodium citrate 1 2 M NaCI Guanidine thiocyanate 0 8 M 118 16 g Isopropanol Ammonium thiocyanate 0 4 M 76 12 g Chloroform Sodium acetate pH5 0 1 M 33 4 ml of 3M stock 75 EtOH Glycerol 50 ml DEPC treated ddH O H O to 1 liter Homogenization 1 Grind 1 g tissue in liquid nitrogen in a motar and pestle For some tissues the preparation will need to be scaled up or replicated to obtain enough total RNA to recover 5ug poly A see below This must be determined empirically Put tissue into a plastic screw cap centrifuge tube containing 15 ml TRIzol reagent Incubate samples for 5 min at room temp or 60 C Phase Separation Homogenize tissue with homogenizer for 15 sec repeat once Centrifuge samples at 12 000 X g at 4 C for 10 min Put supernatant into new screw cap tube Discard pellet or save if you want DNA Add 3 ml chloroform to each tube
127. se in DNA amount through the PCR reaction is arithmetic linear not logarithmic For more discussion of the PCR process see Kessing et al 1989 Saiki et al 1988 Mullis 1990 and Dieffenbach and Dveksler 1995 42 Symmetrical PCR Amplification Uem QS A X CAGGTACGTT ACCGGGACGT C C c Ed dw d EGC CTGCA dca primer 5 forward primer S 5 MEEL EE TGGCCCTGCA 5 A a Two Double stranded DNA Products 3 EN 3 5 5 es 3 5 N 3 In the Nickrent lab there are three thermocyclers Perkin Elmer Cetus RoboCycler Gradient 40 temperature cycler Stratagene and Applied Biosystems GeneAmp PCR System 9700 For the first two machines mineral oil must be placed above the sample to prevent excessive evaporation of the reaction mix The GeneAmp thermocycler does not require mineral oil in the tubes because the lid is heated thus preventing condensation from accumulating on the inside of the sample tubes Refer to the manuals for proper operation of these machines The RoboCycler is very useful for optimization of PCR reaction conditions This machine has four independent heating cooling blocks 3 heating 1 cooling and a robotic arm that moves the sample tubes between blocks Most importantly it also has a temperature gradient block that allows for a linear temperature gradient range of 14 This feature can be used to determine in one s
128. sink in room 1046A Beware some of these are hazardous Frozen Desiccated Dry Chemicals A large number of chemicals used for isozymes are stored in small plastic desiccator containers in the 207 C freezer Rm 1046 A few chemicals used for DNA e g DTT also reside here Check the Excel printout of lab chemicals if you do not know where a particular chemical resides Acids and Bases Acids are stored in the metal cabinets under the hood Bases should not be stored in the same enclosed space as acids Organics Our small collection of organic liquids is housed under the center island sink in Rm 1046 Volatiles Volatile liquids such as ethanol and methanol are stored in the labeled metal cabinet under the counter in Rm 1046 Rm 1064 near the Vivarium office is also available for storing larger quantities of volatiles we currently have methanol stored there A key to this room can be obtained from personnel working in the Medical School stock room upstairs LSID or the Microbiology stock room Edna Hand Rm 129 LS IT 555555555555 555955555565 55995555556555595555556555995555566555995 Enzymes enzymes are expensive and most are very sensitive to temperatures above 0 C For this reason all enzymes should be kept on ice and returned to the freezer as quickly as possible after use 5555555555 555555 555555555555555555555555555555555555555555555555 10 SECTION 2 INTRODUCTION Molecular Methods in Pl
129. t excess liquid drain off of the membrane 9 Seal the damp membrane in a heat sealable bag that has been rinsed with water 10 Incubate the sealed membrane for 15 min at 37 11 Expose to X ray film at room temperature Start with a 1 4 hour exposure and increase time as necessary When using homologous probes a 20 min exposure may be sufficient When using heterologous probes you may need to expose overnight Multiple exposures may be taken as luminescence continues for at least 24 hours If the membrane will be used for another hybridization perform the following steps 93 12 Immediately after exposure to film slit the bag remove the membrane and wash at least 5 min in distilled water The membrane may be stored in water for several days before stripping 13 Wash 2 X 15 min in 0 2M NaOH 0 1 SDS at 37 C 14 Wash 2 min in 2X SSC 15 Prehybridize and hybridize as usual OR store in a sealed bag with sterile water at 4 94 SECTION 14 SOLUTION RECIPES Ammonium acetate 4 0 M for precipitating nucleic acids 154 18 g of NH4OAc Bring up to 500 ml with dH20 Filter sterilize do not autoclave Ammonium persulfate 10 w v for acrylamide gels 5 g ammonium persulfate Bring up to 50 ml with dH20 Store as 1 5 ml aliquots in freezer Borate Extraction Buffer for RNA extraction Final conc 0 2 M borate 30 mM EDTA 5 mM dithiothreitol 1 SDS For 50 ml of extraction buffer 7 5 ml 0 2 M EDTA stoc
130. teeth 10 lanes Remember you should skip a lane between each sample 2 Load the entire contents of the PCR reaction ca 21 ul sample plus 5 jl of loading dye into every other lane of the agarose gel The gel typically runs at 75 volts ca 100 mA for 40 minutes 3 Use eye protection for the UV light Remove the gel on gel mold and take it to the transilluminator Slide off onto the surface Keep the UV light setting at low Visualize the band of interest and excise it using a sterile scalpel blade Place band in a preweighed 1 7 ml microfuge tube Determine the weight of the band using the analytical balance Column Purification 1 Add three volumes remember 100 mg 100 yl of buffer QG 2 Incubate at 50 C for 10 minutes in heat block Vortex every 2 minutes to dissolve the agarose gel plug This should be completely dissolved and yellow in color after 10 minutes note the QG buffer has a pH indicator in it If any color other than yellow the pH must be adjusted by adding 10 1 of 3 0 M Na acetate 3 Add one gel plug volume of isopropanol Mix 4 Place entire contents of tube in column and centrifuge for one minute at 10 000 g 5 Discard the flow through the add 500 u1 of buffer QG Centrifuge for one minute 6 Add 750 yl of buffer PE and let stand for 3 minutes Centrifuge one minute 7 Discard the flow through Centrifuge the empty column for two minutes 8 Place column in a new labeled 1 7 ml tube Elute the D
131. ters The room is now used only for the Plant Biology backup server Macintosh iMac Rm 1056 phytotron This facility is being used by Dr Stephen Ebbs in Plant Biology The headhouse portion contains growth chambers an autoclave and a dishwasher Available for use in room 1045 Dr Clark kindly allows us to use his shaking incubator New Brunswick when we are cloning The key on the lab keychain will open this door In the past the east side of Rm 1046 was dedicated to isozyme work however our research focuses mainly on DNA these days When isozymes are being run shelf space in the dairy case is used to run starch gels The dairy case in Rm 1046 is currently the only refrigerator 4 C space in that room Should extra storage space be required use the walk in cold room 1054 Room 1046A is a non PCR product environment This means that none of the pipetters tube racks ice buckets etc from Rm 1046 should be brought into this room Similarly none of these items in Rm 1046A should be left into Rm 1046 Tube racks buckets pipets etc can be brought into the room on a short term basis to run gels but then promptly returned to Rm 1046A To help all of us remember this we have designated the red ice buckets and tube racks for 1046A and all other colors for 1046 It is very important that all users adhere to this segregational policy to avoid contamination For example one of the worst possible type of contamination would be t
132. th steam and options chosen Place glass plates in the special plate rack Fill soap reservoir with Alconox powder 11 2 spoonfuls Fill the Nalgene container on top with Nanopure water use autofill option for 20 liters Connect the SteamScrubber to the sink and turn on all the way only the hot water NnBWN 76 7 Close the door plug the machine into an electrical outlet and press the start button The steam and pure light should be on B Plate Assembly 1 Wear powder free vinyl gloves in drawer next to freezer 2 Make sure plates combs and spacers are completely clean and dry 3 Make sure plates are oriented correctly Each plate has an etched mark on the outside though the mark is faint on the bottom plate hipped plate The outside of the top plate plate can also be recognized by the two hydrophobic lines caused by the top clamp and top buffer chamber gaskets 4 Make sure the cassette is clean and dry 5 Place the bottom plate hipped on the frame with the outside of the plate facing down 6 Place the spacers on each side of the plate so that the open notched ends are at the top and open towards the inside of the plate Make sure spacer bottom is flush with the bottom edge of the plate Once spacers are in the correct position you may stick the spacers in place by touching a dampened finger to the spacer and then sticking the spacer to the glass plate 7
133. tol DTT 5 Incubate sample in a 37 C waterbath for 30 minutes to one hour Mix every 15 minutes 6 Briefly centrifuge the sample to remove debris Decant supernatant to a new labeled 2 0 ml tube 7 Add 2 3 volume ca 0 8 ml of phenol chloroform isoamyl alcohol 24 1 Shake well for 2 to 3 minutes 8 Centrifuge for 15 minutes at 4 at maximum speed ca 10 000 rpm 9 Carefully retrieve the tubes from centrifuge remove the aqueous top layer using a wide bore barrier tipped 1 0 ml pipette approximately 0 75 ml and place in a 1 7 ml microfuge tube 10 Add 2 3 volume of chloroform isoamyl alcohol 24 1 Shake well for 2 to 3 minutes 11 Centrifuge for 15 minutes at 4 at maximum speed ca 10 000 rpm 12 Retrieve the tubes from centrifuge remove the aqueous top layer using a wide bore barrier tipped 1 0 ml pipette approximately 0 75 ml and place in a 1 7 ml microfuge tube 13 Add 0 66 volumes ca 0 5 ml of ice cold 20 isopropanol Invert several times to mix and place in the 20 freezer for at least 30 minutes overnight is OK 14 Centrifuge the tubes for 15 minutes 15 Pour off the isopropanol being careful not to lose the pellet Drain the pellet by inverting on a towel Dry the pellet at room temp or in the SpeedVac medium heat 16 Add 300 jl of TE optionally w an RNase added and 200 u1 of NH4OAc Mix gently to get the pellet into solution 17 Add 1 0 ml of 10096 et
134. ul to know whether the nuclear chloroplast and mitochondrial genes are congruent If they are then one can feel more confident that the organismal phylogeny is being tracked as opposed to the phylogeny of just one gene These can be very different for good biological reasons hybridization introgression chloroplast capture lineage sorting and horizontal gene transfer nad2 5 cox 2 3 1 3 4 5 7 cox1 mm m m uu 2 matR 9 mm m eee 5 1 5 mm m 550 rDNA trn T L F ps genes mmm m mo momo ndhF atpB rbcL spacer psb A B C D o m 16S 23S rDNA S n es trn genes amp spacers oe Arginine decarboxylase Malate synthase Glyceraldehyde 3 phosphate dehydrog Glycerol 3 phosphate acyltransferase Phytochromes RNA polymerase m m m m Eee Glutamine synthase 3 ae Adh aunn Pistillata 9 5 85 Waxy granule bound starch synthase m mmm LSU rDNA LE EM M eee SSU rDNA Population Species Genus Family Order Phylum The following pages give schematic diagrams of the genes commonly amplified in plant phylogenetic studies and their primers 46 SIT 02 IOV LIL 403 62 5875 66 62 94 SII 2 ody 02 2 9 999 VOL 404 ZE 5875 25 26 94 706 662 872 91 Liv 291 299 2511 WAMO 892 S92 682 792 02 VDD DLL J04v2 S8 S Wd vb vz SLI 94 Op 09
135. ure Mix thoroughly 3 Vortex the tube and leave at room temperature for 15 min in dark drawer to precipitate the extension product 4 Centrifuge the tube at room temperature for 20 min at maximum speed 5 Carefully decant the supernatant with a pipette and discard 6 Rinse the pellet with 250 ul of 7096 EtOH 7 Vortex briefly 8 Centrifuge for 5 min at room T at maximum speed 9 Carefully decant the supernatant and discard 10 Dry pellet in the SpeedVac for 15 min or until dry Do not overdry At this point the reaction is stable for up to a year at 20 C Just prior to electrophoresis the sample is resuspended in a 1 5 2 0 yl of a formamide gel loading buffer heated to 90 C 2 minutes to denature the DNA and then chilled on ice 75 SECTION 11 AUTOMATED SEQUENCING THE ABI 377 The ABI 377 automated DNA sequencer is located in the Sipes lab LS II room 473 Because Dr Sipes has kindly made her lab available to us we must be extremely considerate of her time and equipment The DNA sequencer is an expensive instrument therefore nobody should attempt to use it without proper training and supervision Additionally there are serious safety concerns associated with using the sequencer First the gel contains acrylamide which is a neurotoxin Second when the sequencer is running it uses very high voltage thus presenting the potential for electrocution Schedule your use of the machine bearing in mind th
136. urns thus it shouldbe considered hazardous 14 Protease The most common proteolytic enzyme used in nucleic acid extractions is protease K e g Sigma P4755 which is generally made up in 50 units ml aliquots and stored frozen for immediate use during extractions Solutions are generally incubated with this enzyme at 37 for at least one hour Other Extraction Buffer Components Two common reducing agents often found in extraction buffers are D mercaptoethanol or dithiothreitol DTT We prefer the use of DTT because it is not as volatile as B mercaptoethanol and is therefore easier on the nose EDTA is also present to chelate Mg ions thus mediating aggregation of nucleic acids to each other and to proteins Isopropanol and Ethanol Precipitations The most common method of concentrating nucleic acids is with an alcohol precipitation This occurs in the presence of a salt see below at low temperatures 20 or less Either 2 0 volumes of ethanol can be used to precipitate DNA or 0 6 volumes of isopropanol Isopropanol is often used for the first precipitation but not for final ones since it tends to bring down salts more readily than ethanol Isopropanol can also be used when the volume of the tube will not allow the addition of 2 volumes of ethanol The nucleic acid is collected by centrifugation at 10 000 rpm for ca 15 20 minutes The most common monovalent cations used in nucleic acid precipitations are shown in the
137. verting the tube several times Store on ice for 5 min Add 150 1 of Lysis Solution III Mix by shaking the tube several times Store on ice for 5 min 10 Centrifuge 1 5 min 11 Transfer the supernatant to a fresh tube 12 Add 450 ul of phenol chloroform Vortex Spin 5 min Transfer the upper aqueous phase to a fresh tube 13 Add 900 ul of 100 ethanol Vortex 14 Centrifuge 1 minute pour off ethanol rinse pellet with 70 EtOH dry pellet in SpeedVac OR Precipitate 20 min at 70 C Centrifuge 20 min rinse with 70 EtOH dry pellet 15 Resuspend in 20 40 ul TE with 20 ug ml RNase A 2 ul of 10 mg ml RNase A plus 1 ml TE 16 Digest 2 4 ul with appropriate restriction enzyme and run on an agarose gel A mini prep shortcut for purifying plasmids was published by Zhou et al Biotechniques 8 172 173 1990 however we have found that the result is less pure than the alkaline lysis method 68 Restriction Digest of Plasmid DNA Once it is determined which plasmids contain inserts this DNA can be used for sequencing The plasmid must first be linearized by conducting a restriction digest A typical digest 1s Restriction Digest X1 X Sterile H O 15 pl ul 10X buffer 2 ul ul Enzyme EcoRI l ul ul BSA x ul ul DNA 2 ul Total 20 ul Incubate reaction in 37 C water bath for at least 1 hr Run samples on 1 TAE agarose gel 69 Colony PCR An Alternative to the Mini Prep I
138. ves wear a lab coat and eye protection C Pouring the Gel Before pouring the gel make sure that you have combs with flat edges that are not damaged Have a pair of scissors a syringe and beaker on hand Since each Long Ranger Singel packs cost about 12 50 each we pour two gels from one pack 77 Place both assembled gel plates cassettes on a platform of plastic tip boxes 2 Remove combs from loading region and unclip the top clamping device but have the combs ready for use Lift the laser beam safety bar so that it is easier to view the gel while pouring For gel preparation follow protocol on Singel package remove the BLACK clip and mix contents of the compartments by hand thoroughly but gently for 12 minutes 4 Remove the RED clip and mix content of compartments well by hand for 1 minute Now proceed without hesitation through the rest of the steps Your gel is already in the process of polymerizing and you only have a couple of minutes to complete the gel pouring Remove the WHITE clip filter Hold the bag so that contents drain into the filter end Roll or fold over pouch to the indicated line 6 With scissors cut the pouch on the embossed line across the filter port Avoid introducing air bubbles as you squeeze out the contents by letting the gel solution trickle down the side of the beaker Squeeze out all of the gel solution Suck up about 30 ml of the gel contents from the beaker with the syringe Care
139. y Lower the buffer by removing with a plastic disposable 50 ml syringe till it just touches the top edges of the gel Excess buffer can be blotted off the top of the gel with a Kimwipe 5 Under U V light use a sterile scalpel blade and cut a well just ahead of the genomic DNA band It is OK to cut the well completely to the bottom of the gel mold the buffer will not leak through Work quickly do not expose the DNA to U V light any longer than necessary Remove any buffer that leaks into the well with a 1 ml micropipet and fill the wells with 2596 PEG solution 20 25 polyethylene glycol w v in 1X GGB buffer 6 Continue electrophoresis until the genomic DNA band migrates into the well If your well is cut close to the band this should take place in about 10 minutes If the band is very light you 25 probably will not see it once it migrates into the well Use the flanking bands to estimate when the light bands have entered the well 7 Remove the PEG with DNA to a 1 5 ml microfuge tube Add 0 5 volume of phenol Tris buffered pH 8 0 and 0 5 volume of chloroform Mix briefly centrifuge for 10 minutes and remove aqueous top phase to new tube Extract with an equal volume of chloroform Save aqueous phase in new tube 8 Precipitate the DNA with ethanol Add 0 66 volume of ammonium acetate and then 2 volumes of 100 ethanol Place in 70 freezer for ca 10 minutes 9 Centrifuge at 4 for 20 minutes Pour off et

Molecular Manual (pdf file) - Daniel L. Nickrent

Contents

Download Pdf Manuals

Related Search

Related Contents