Home

pBAD/Thio His TOPO manual

1. If you perform the SUMO Protease cleavage reaction using purified protein directly eluted from the purification column the salt and imidazole concentrations are likely to exceed the recommended concentrations listed above We recommend performing dialysis to decrease the salt and imidazole concentrations of your purified protein reaction Perform the dialysis overnight at 4 C using a suitable dialysis buffer e g 20 mM Tris HCl pH 8 0 150 mM NaCl 1 mM DTT Note The SUMO Protease will contribute a small amount of salt to the final cleavage reaction see guidelines on page 20 continued on next page Purifying the Recombinant Fusion Protein continued Scaling up Expression for Purification Additional Purification Steps We generally scale up expression to a 50 ml bacterial culture for purification using a 2 ml ProBond or Ni NTA column Depending on the expression level of your recombinant fusion protein you may need to adjust the culture volume to bind the maximum amount of recombinant fusion protein to your column To grow and induce a 50 ml bacterial culture 1 Inoculate 10 ml of S O B or LB containing 50 ug ml kanamycin with a BL21 DE3 transformation reaction Grow overnight at 37 C with shaking 225 250 rpm to ODeoo 1 2 The next day inoculate 50 ml of S O B or LB containing 50 ug ml kanamycin with 1 ml of the overnight culture Note You can scale up further and inoculate all of the 10 ml over
2. The table below describes the items included in the BL21 DE3 One Shot Chemically Competent E coli kit Box 3 Transformation efficiency is gt 1x 10 cfu ug DNA Store Box 3 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose BL21 DE3 Cells 21 x 50 pl pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 50 ul 0 5 mM EDTA pH 8 continued on next page vii Kit Contents and Storage continued Genotype of BL21 DE3 SUMO Protease Unit Definition of SUMO Protease viii Use this E coli strain for expression only Do not use these cells to propagate or maintain your construct Genotype F ompT hsdSy rg ms gal dcm DE3 The DES designation means this strain contains the lambda DE3 lysogen which carries the gene for 17 RNA polymerase under the control of the lacUV5 promoter IPTG is required to induce expression of the T7 RNA polymerase The strain is an E coli B r strain and does not contain the lon protease It also has a mutation in the outer membrane protease OmpT The lack of these two key proteases reduces degradation of heterologous proteins expressed in the strain The following reagents are supplied with SUMO Protease Box 4 Store SUMO Protease at 20 C after first time use or at 80 C for long term storage Avoid multiple fre
3. The table below describes the major steps necessary to clone and express your gene of interest and to generate native protein Protease Remove SUMO and SUMO Protease from cleavage reaction using a nickel chelating resin to obtain native recombinant protein Step Action Page 1 Amplify your PCR product using Taq polymerase and your 8 own primers and parameters Ligate your PCR product into pET SUMO 9 Transform your ligation into competent Mach1 TI1 E coli 10 Select colonies and isolate plasmid DNA Analyze plasmid 11 DNA for the presence and orientation of the PCR product by restriction enzyme digestion or sequencing 5 Select a positive transformant and isolate plasmid DNA 13 15 Transform BL21 DE3 and induce expression with IPTG Purify your recombinant protein 18 19 Cleave SUMO from recombinant protein using SUMO 20 21 Methods Cloning Considerations Introduction Cloning Considerations Important The pET SUMO vector allows expression of a recombinant protein with an N terminal peptide containing the 6xHis tag and SUMO fusion protein General guidelines are provided below to help you design PCR primers to amplify your gene of interest for ligation in pET SUMO Consider the following when designing your PCR primers A ribosome binding site RBS is included upstream of the initiation ATG in the N terminal tag to ensure optimal spacing for proper translation To fuse
4. Note 28 Direct cloning of DNA amplified by proofreading polymerases into pET SUMO is often difficult because proofreading polymerases remove the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3Msodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with a proofreading polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer A sufficient number of PCR products will retain the 3 A overhangs 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Placeon ice and use immediately in the ligation reaction Note If you plan to store your sample overnight before proceeding with the ligation reaction extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend in TE buffer using the starting volume of the PCR You may also gel purify your PCR product after amplification with a proofreading polymerase After purification add Taq polymerase buffer dATP and 0 5 unit of Taq polymerase Incubate the reaction for 10 15 minutes at 72 C a
5. Final volume 200 ul 2 Mix and incubate at 30 C Remove 20 ul aliquots at 1 2 4 and 6 hours Add 20 ul 2X SDS sample buffer see page 33 for a recipe Keep samples at 20 C until experiment is complete 4 Analyze 30 ul of sample by SDS PAGE using a suitable gel continued on next page Using SUMO Protease continued Analyzing Results Varying Parameters for Cleavage Removing SUMO and SUMO Protease Determine the percent protein cleavage by analyzing the amount of cleaved products formed and amount of uncleaved protein remaining after digestion After evaluating the initial results you may optimize the cleavage reaction for your specific protein by optimizing the amount of SUMO Protease incubation temperature or reaction time The percent of 2 ug control substrate hydrolyzed by one unit of SUMO Protease at various temperatures was examined see table below More cleaved protein is formed with SUMO Protease by increasing the incubation time If time is critical add more SUMO Protease to increase hydrolysis Percentage Substrate Hydrolyzed Time 4 C 16 C 21 C 30 C 0 5h 48 73 83 88 1h 60 87 90 93 2h 71 94 94 95 3h 74 95 95 95 Both the SUMO fusion protein and the SUMO Protease contain N terminal polyhistidine tags allowing their removal from the cleavage reaction using affinity chromotography on a nickel chelating resin such as ProBond Resin Cat no
6. K801 01 Dilute the cleavage reaction in the binding buffer for ProBond and perform binding and elution as described in the ProBond Purification manual available at www invitrogen com Note that SUMO and SUMO Protease will remain bound to the resin and the cleaved native protein will be in the flow through fractions TM 21 Troubleshooting TA Cloning Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the TA Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions see pages 25 26 in parallel with your samples Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Suboptimal ratio of vector insert used in ligation reaction Estimate the concentration of the PCR product Use a 1 1 or 1 3 molar ratio of vector insert PCR products stored too long Use fresh PCR products Ligation efficiency is reduced after as little as 1 day of storage Too much salt in the ligation reaction The high salt content of PCR reactions can inhibit ligation Do not use more than 2 3 ul of the PCR sample in the ligation reaction Used a proofreading polymerase Do not use proofreading polymerases as they do not add 3 A overhangs Use Taq polymerase Incomplete extension during PCR Incl
7. allows expression of T7 RNA polymerase from the lacUV5 promoter Studies have shown that there is always some basal expression of T7 RNA polymerase from the JacUV5 promoter in ADE3 lysogens even in the absence of inducer Studier and Moffatt 1986 In general this is not a problem but if the gene of interest is toxic to the E coli host basal expression of the gene of interest may lead to plasmid instability and or cell death To address this problem the pET SUMO vector has been designed to contain a T7lac promoter to drive expression of the gene of interest The T7lac promoter consists of a lac operator sequence placed downstream of the T7 promoter The lac Operator serves as a binding site for the lac repressor encoded by the lacI gene and functions to further repress 17 RNA polymerase induced basal transcription of the gene of interest in BL21 DE3 cells continued on next page T7 Regulated Expression continued BL21 DE3 pLysS Strain Note Using One Shot Mach1 T1 Cells If you discover that your gene is toxic to BL21 DE3 cells you may want to perform your expression experiments in the BL21 DE3 pLysS strain see page ix for ordering information The BL21 DE3 pLysS strain contains the pLysS plasmid which produces T7 lysozyme T7 lysozyme binds to T7 RNA polymerase and inhibits transcription This activity results in reduced basal levels of T7 RNA polymerase leading to reduced basal expression of T7 driven hete
8. plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 pl Primers 100 200 ng each 1 uM each Sterile water add to a total volume of 49 ul Tag Polymerase 1 unit ul 1 ul Final volume 50 pl 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR you may gel purify your fragment before proceeding Take special care to avoid sources of nuclease contamination and long exposure to UV light Alternatively you may optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit Catalog no K1220 01 from Invitrogen can help you optimize your PCR Contact Technical Service page 34 for more information Cloning into pET SUMO Introduction For optimal ligation efficiencies we recommend using fresh less than 1 day old PCR products The single 3 A overhangs on the PCR products will be degraded over time reducing ligation efficiency If this is the first time you are using this kit perform the control reactions on pages 25 26 in parallel with
9. LB containing 50 ug ml kanamycin and 1 glucose if desired 9 Grow overnight at 37 C with shaking Proceed to Pilot Expression next page continued on next page Expressing the PCR Product continued Pilot Expression Inoculate 10 ml of LB containing 50 ug ml kanamycin and 1 glucose if desired with 500 ul of the overnight culture from Step 8 previous page Grow two hours at 37 C with shaking OD o should be approximately 0 4 0 6 mid log Split the culture into two 5 ml cultures Add IPTG to a final concentration of 1 mM to one of the cultures You will now have two cultures one induced one uninduced Remove a 500 ul aliquot from each culture centrifuge at maximum speed in a microcentrifuge for 30 seconds and aspirate the supernatant Freeze the cell pellets at 20 C These are the zero time point samples Continue to incubate the cultures at 37 C with shaking Take time points for each culture every hour for 4 to 6 hours For each time point remove 500 ul from the induced and uninduced cultures and process as described in Steps 4 and 5 Proceed to Analyzing Samples next page 15 Analyzing Samples Materials Needed Preparing Samples Preparing Samples for Soluble Insoluble Protein Polyacrylamide Gel Electrophoresis You will need the following reagents and equipment before beginning e Lysis Buffer see page 33 for recipe e 1Xand 2X SDS PAGE sample buffer see page 33 for reci
10. ProBond Nickel Chelating Resin 50 ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 Ni NTA Agarose 10 ml R901 01 25 ml R901 15 100 ml R901 10 Ni NTA Purification System 6 purifications K950 01 Polypropylene Columns empty 50 R640 50 Overview Introduction Advantages of the Champion pET SUMO System The Champion pET Expression System SUMO Fusion Protein and SUMO Protease Introduction The Champion pET SUMO Protein Expression System utilizes a small ubiquitin like modifier SUMO to allow expression purification and generation of native proteins in E coli SUMO fusions may increase the expression of recombinant proteins and enhance the solubility of partially insoluble proteins In addition the tertiary structure of the SUMO protein is specifically recognized and cleaved by a ubiquitin like protein processing enzyme SUMO Protease When SUMO is fused to the N terminus of your protein cleavage by SUMO Protease results in the production of native protein Use of the Champion pET SUMO Protein Expression System offers the following advantages e May increase expression of recombinant fusion proteins e May increase solubility of recombinant fusion proteins e Allows generation of native protein using SUMO Protease e Easy removal of the SUMO fusion protein and SUMO Protease after cleavage by affinity chromatography on a nickel chelating resin The Champion pET Expressio
11. Shot Chemically Competent E coli 80 C 4 SUMO Protease Protease 80 C Buffers 20 C pET SUMO TA The following reagents are included with the pET SUMO vector Box 1 Note Cloning Reagents thatthe user must supply Taq polymerase Store Box 1 at 20 C Item Concentration Amount pET SUMO vector 25 ng plin 5x10 ul linearized 10 mM Tris HCl pH 8 0 1 mM EDTA pH 8 0 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 42 C 100 ul 500 mM KCI 25 mM MgCl 0 0176 gelatin dNTP Mix 12 5 mM dATP 10 pl 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP in water pH 8 0 continued on next page Kit Contents and Storage continued pET SUMO TA Cloning Reagents continued Unit Definition of T4 DNA Ligase Sequences of the Primers vi Item Concentration Amount 10X Ligation Buffer 60 mM Tris HCl pH 7 5 100 ul 60 mM MgCl 50 mM NaCl 1 mg ml bovine serum albumin 70 mM f mercaptoethanol 1 mM ATP 20 mM dithiothreitol 10 mM spermidine T4 DNA Ligase 4 0 Weiss units yul 25 ul Sterile Water 1 ml SUMO Forward Sequencing 0 1 ug pl in TE Buffer pH 8 0 10 ul Primer 17 Reverse Sequencing 0 1 ug ul in TE Buffer pH 8 0 20 pl Primer Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 0 10 ul Control PCR Template 0 1 ug ul in TE Buffer pH 8 0 10 pl pET SUMO CAT 0 01 ug ul in TE buffer pH 8 0 10 ul One Weiss unit of T4 DNA Ligase cata
12. To stabilize your pET SUMO construct if you are expressing a toxic gene You will need the following reagents and equipment before beginning e Your pET SUMO expression construct gt 10 ug ml e pETSUMO CAT positive control plasmid optional e BL2I DE3 One Shot cells Box 3 included with the kit e S O B or LB containing 50 ug ml kanamycin plus 1 glucose if desired e 37 C incubator shaking and nonshaking e 42 C water bath e 1Misopropyl B D thiogalactoside IPTG Invitrogen Catalog no 15529 019 e Liquid nitrogen Use the protocol below to transform your construct or the positive control into BL21 DE3 One Shot cells You will need one vial of cells per transformation Note You will not plate the transformation reaction but inoculate it into medium for growth and subsequent expression 1 Thaw on ice one vial of BL21 DE3 One Shot cells per transformation 2 Add 5 10 ng plasmid DNA in a 1 to 5 ul volume into each vial of BL21 DE3 One Shot cells and mix by stirring gently with the pipette tip Do not mix by pipetting up and down Incubate on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium N Oy UL ae oe Cap the tube tightly tape the tube on its side for better aeration and incubate at 37 C for 1 hour with shaking 200 rpm 8 Add the entire transformation reaction to 10 ml of
13. at 37 C for 30 minutes Thaw on ice 1 vial of One Shot cells for each transformation QU gy UE woo Pipette 2 ul of the ligation reaction directly into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incubations on ice do not seem to have any affect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C medium Cap the tube tightly and shake horizontally 200 rpm at 37 C for 1 hour Spread 100 200 ul from each transformation on a prewarmed selective plate We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies Incubate plates at 37 C Analyzing Transformants Analyzing Positive 1 Pick 10 colonies and culture them overnight in LB or S O B medium Clones Sequencing Analyzing Transformants by PCR containing 50 ug ml kanamycin 2 Isolate plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 Note Since the pET SUMO vector is a low copy number plasmid you may need to increase the amount of bacterial culture to obtain enough plasmid DNA for sequencing or analysis purposes 3 Analyze the pl
14. genetically modified organisms The parental strain of Mach1 T1 E coli is the non K 12 wild type W strain ATCC 9637 S A Waksman Although the parental strain is generally classified as Biosafety Level 1 BL 1 we recommend that you consult the safety department of your institution to verify the Biosafety Level The composition and or use of this product may be claimed in U S Patent No 5 693 489 licensed to Life Technologies Corporation by Brookhaven Science Associates LLC The 17 expression system is based on technology developed at Brookhaven National Laboratory under contract with the U S Department of Energy and is the subject of patents and patent applications assigned to Brookhaven Science Associates LLC BSA By provisions of the Distribution License Agreement granted to Life Technologies covering said patents and patent applications Life Technologies grants you a non exclusive sub license under patents assigned to BSA for the use of this technology including the enclosed materials based upon the following conditions 1 these materials are to be used for non commercial research purposes only A separate license under patents owned by BSA is required for any commercial use including the use of these materials for research purposes or production purposes by any commercial entity Information about commercial license may be obtained from The Office of Technology Transfer Brookhaven National Laboratory Bldg 475D P O
15. inhibitor used during purification steps SUMO Protease is a cysteine protease Do not add cysteine protease inhibitors to any reactions DTT in SUMO Protease Buffer oxidized Add freshly prepared DTT to the cleavage reaction to a final concentration of 1 mM Recombinant protein denatured Purify your recombinant protein under native conditions SUMO Protease may not recognize denatured SUMO fusion protein No native protein detected after removal of SUMO Protease Native protein located in flow through and not eluted fractions Be sure to check the flow through for your native protein Eluted fractions will only contain the SUMO and SUMO Protease 24 Appendix Performing the Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following TA Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product using the reagents included in the kit and using this product directly in a TA Cloning reaction For each transformation prepare two LB plates containing 50 ug ml kanamycin Use Taq polymerase and the appropriate buffer to amplify the control PCR product Follow the manufacturer s recommendations for the polymerase you are using To produce the 750 bp control PCR product set up the following 50 ul PCR Control
16. is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporati
17. is unstable e Add 1 glucose to the bacterial culture medium during expression e Transform your expression construct into a pLysS containing strain e g BL21 DE3 pLysS continued on next page 23 Troubleshooting continued SUMO Cleavage The table below lists some potential problems and possible solutions that may help you troubleshoot your SUMO Protease cleavage reaction To help evaluate your results we recommend including the expression control supplied with kit in your experiment Problem Reason Solution Large percentage of uncleaved SUMO fusion protein Protein starts with a proline lysine valine or leucine SUMO Protease may not cleave SUMO when your protein starts with one of these amino acids Add a serine to the N terminus of your protein to allow cleavage of SUMO see page 6 for more information Salt concentration in cleavage reaction too high The optimal salt concentration for the cleavage reaction is approximately 150 mM NaCl Dialyze eluted fractions of your purified protein to reduce the salt concentration before performing the cleavage reaction Imidazole concentration in cleavage reaction too high The cleavage reaction should contain a final concentration of less than 150 mM imidazole Dialyze eluted fractions of your purified protein to reduce the imidazole concentration before performing the cleavage reaction Cysteine protease
18. potential problems and possible solutions that may help you troubleshoot your expression experiment To help evaluate your results we recommend including the expression control supplied with kit in your experiment Problem Reason Solution No expression of recombinant protein Gene of interest not in frame with Sequence your construct to verify if the N terminal tag the insert is in frame with the N terminal tag If not in frame redesign your PCR primers Incorrect antibody used for Use the Anti HisG Antibodies or an detection antibody to your protein Low expression of Toxic gene e Add 1 glucose to the bacterial recombinant protein Note Evidence of toxicity includes loss culture medium during of plasmid or slow growth relative to transformation and expression thetontrol e Transform BL21 DE3 cells using the protocol on page 14 then perform the expression by growing cells at room temperature rather than 37 C for 24 48 hours e Transform your expression construct into a pLysS containing strain e g BL21 DE3 pLysS e Transform your expression construct into an E coli strain in which expression of T7 RNA polymerase is tightly regulated e g BL21 AI available from Invitrogen see our Web site for more information Recombinant protein is insoluble Used BL21 Star strain BL21 Star strains may reduce the solubility of your pET SUMO protein Use the BL21 DE3 strain included with the kit Protein
19. proteins Li and Hochstrasser 1999 Mossessova and Lima 2000 For recombinant proteins expressed from pET SUMO cleavage of SUMO by SUMO Protease results in production of native protein with no extra amino acids added between the cleavage site and the start of your protein continued on next page Overview continued Features of the Champion pET SUMO Vector How TA Cloning Works One Shot Mach1 T1 E coli The pET SUMO vector is designed to facilitate cloning of PCR products for regulated expression in E coli Features of the vector include e TY7lac promoter for high level IPTG inducible expression of the gene of interest in E coli Dubendorff and Studier 1991 Studier et al 1990 e N terminal polyhistidine 6xHis tag for detection and purification of recombinant fusion proteins e N terminal SUMO fusion protein for increased expression and solubility of recombinant fusion proteins and generation of native protein following cleavage by SUMO Protease Li and Hochstrasser 1999 Mossessova and Lima 2000 Saitoh et al 1997 e TA Cloning site for efficient cloning of Taq amplified PCR products see below e Kanamycin resistance gene for selection in E coli e lacl gene encoding the lac repressor to reduce basal transcription from the T7lac promoter in the pET SUMO vector and from the JacUV5 promoter in the E coli host chromosome see page 3 for more information e pBR322origin for low copy repli
20. you to rapidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cutoutthe gel slice containing the PCR product and melt it at 65 C in 2 volumes of the 6 M sodium iodide solution 3 Add 1 5 volumes Binding Buffer Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Buffer Centrifuge 1 minute at full speed in a microcentrifuge and discard the flow through Repeat Step 7 Elute the purified PCR product in 40 ul of TE or sterile water Use 2 3 ul for the ligation reaction and proceed as described on page 9 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the ligation reaction page 9 Be sure to make the gel slice as small as possible for best results The cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band 27 Addition of 3 A Overhangs Post Amplification Introduction Before Starting Procedure
21. B agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 2 Tryptone 0 5 Yeast Extract 0 05 NaCl 2 5 mM KCl 10 mM MgCl 1 Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water 2 Make a 250 mM KCI solution by dissolving 1 86 g of KCl in 100 ml of deionized water Add 10 ml of this stock KCI solution to the solution in Step 1 3 Adjust pH to 7 5 with 5 M NaOH and add deionized water to 1 liter Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCl You may also add antibiotic if needed 5 Store at 4 C Medium is stable for only 1 2 weeks continued on next page Recipes continued Lysis Buffer 50 mM potassium phosphate pH 7 8 400 mM NaCl 100 mM KCl 10 glycerol 0 5 Triton X 100 10 mM imidazole 1 Prepare 1 M stock solutions of KH2PO and KoHPO 2 For 100 ml dissolve the following reagents in 90 ml of deionized water 4 7 ml KHPO 2 3 g NaCl 0 75 g KCl 10 ml glycerol 0 5 ml Triton X 100 68 mg imidazole Mix thoroughly and adjust pH to 7 8 with HCl Bring the volume to 100 ml Store at 4 C 2X SDS PAGE 1 Combine the following reagents Sample Buffer 0 5 M Tris HCI pH 6 8 2 5ml Glycerol 10076 2 0 ml B mercaptoeth
22. Box 5000 Upton New York 11973 5000 Phone 516 344 7134 2 No materials that contain the cloned copy of the 17 gene 1 the gene for T7 RNA polymerase may be distributed further to third parties outside of your laboratory unless the recipient receives a copy of this sub license and agrees to be bound by its terms This limitation applies to strains BL21 DE3 BL21 DE3 pLysS and BL21 DE3 pLysE CE6 BL21 SI Competent Cells and any derivatives that are made of them You may refuse this sub license by returning this product unused in which case Life Technologies accept return of the product with a full refund By keeping or using this product you agree to be bound by the terms of this license continued on next page Purchaser Notification continued Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 5 Invitrogen Technology This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer
23. CC GGTGATGCCG GCCACGATGC GTCCGGCGTA GAGGATCGAG ATCTCGATCC T7 promoter lac operator ij 1 T 1 201 CGCGAAATTA ATACGACTCA CTATAGGGGA ATTGTGAGCG GATAACAATT CCCCTCTAGA AATAATTTTG TTTAACTTTA HisG epitope RBS Polyhistidine region r 1 281 AGAAGGAGAT ATACAT ATG GGC AGC AGC CAT CAT CAT CAT CAT CAC GGC AGC GGC CTG GTG CCG CGC GGC AGC Met Gly Ser Ser His His His His His His Gly Ser Gly Leu Val Pro Arg Gly Ser SUMO fusion protein f 354 GCT AGC ATG TCG GAC TCA GAA GTC AAT CAA GAA GCT AAG CCA GAG GTC AAG CCA GAA GTC AAG CCT GAG ACT Ala Ser Met Ser Asp Ser Glu Val Asn Gln Glu Ala Lys Pro Glu Val Lys Pro Glu Val Lys Pro Glu Thr 426 CAC ATC AAT TTA AAG GTG TCC GAT GGA TCT TCA GAG ATC TTC TTC AAG ATC AAA AAG ACC ACT CCT TTA AGA His Ile Asn Leu Lys Val Ser Asp Gly Ser Ser Glu Ile Phe Phe Lys Ile Lys Lys Thr Thr Pro Leu Arg SUMO forward priming site 498 AGG CTG ATG GAA GCG TTC GCT AAA AGA CAG GGT AAG GAA ATG GAC TCC TTA AGA TTC TTG TAC GAC GGT ATT Arg Leu Met Glu Ala Phe Ala Lys Arg Gln Gly Lys Glu Met Asp Ser Leu Arg Phe Leu Tyr Asp Gly Ile 570 AGA ATT CAA GCT GAT CAG ACC CCT GAA GAT TTG GAC ATG GAG GAT AAC GAT ATT ATT GAG GCT CAC AGA GAA Arg Ile Gln Ala Asp Gln Thr Pro Glu Asp Leu Asp Met Glu Asp Asn Asp Ile Ile Glu Ala His Arg Glu oo 642 CAG ATT GGT GOTE EPAM AAG CTTAGGTATT TATTCGGCGC AAAGTGCGTC GGGTGATGCT GTC TAA CCA CCHN TCTGTTC GAATCCATAA Gln Ile Gly Gly SUMO cleavage site 701 GCCAACTTAG TCGAGCACCA CCACCACCAC CACT
24. DNA Template 100 ng 11 10X PCR Buffer appropriate for enzyme 5 pl dNTP Mix 0 5 ul Control PCR Primers 0 1 ug ul each 1 ul Sterile Water 41 5 ul Tag polymerase 1 units ul 1 ul Final volume 50 ul 2 Overlay with 70 ul 1 drop of mineral oil if required 3 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 55 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X Reaction next page 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible Proceed to the Control Ligation continued on next page 25 Performing the Control Reactions continued Control Ligation Reaction Analysis of Results Transformation Control 26 Using the control PCR product produced on the previous page and the pET SUMO vector set up the following ligation reaction 1 Determine the volume of PCR sample needed to achieve a 1 1 molar ratio of vector insert Use sterile water to dilute your PCR sample if necessary 2 Setup the 10 pl ligation reaction as follows Fresh PCR product Xu 10X Ligation Buffer lul pET SUMO vector 25 ng ul 2 pl Sterile water to a total volume of 9 ul T4 DNA Ligase 4 0 Weiss units lu Final volume 10 ul 3 Incubate the ligation reaction at 15 C for 4 hours preferably overni
25. GAGATC CGGCTGCTAA CAAAGCCCGA AAGGAAGCTG AGTTGGCTGC T7 reverse priming site r 1 781 TGCCACCGCT GAGCAATAAC TAGCATAACC Producing PCR Products Introduction Materials Needed Thermostable Polymerases and Polymerase Mixtures Producing PCR Products Note Once you have decided on a PCR strategy and have synthesized the primers you are ready to produce your PCR product Remember that your PCR product will have single 3 adenine overhangs You will need the following reagents and equipment before beginning Note that dNTPs adjusted to pH 8 are provided in the kit e Taq polymerase e Thermocycler e DNA template and primers for PCR product Thermostable polymerases containing extensive 3 to 5 exonuclease activity do not leave 3 A overhangs PCR products generated with Tag polymerase clone efficiently in the TA Cloning System as the 3 A overhangs are not removed If you wish to use a mixture containing Taq polymerase and a proofreading polymerase Taq must be used in excess of a 10 1 ratio to ensure the presence of 3 A overhangs on the PCR product We recommend using Platinum Taq DNA Polymerase High Fidelity see page ix for ordering information If you use a proofreading polymerase mixture that does not have enough Taq polymerase or a proofreading polymerase only you can add 3 A overhangs using the method on page 28 1 Set up the following 50 ul PCR reaction Use less DNA if you are using
26. Invitrogen by technologies Champion pET SUMO Protein Expression System For high level expression and enhanced solubility of recombinant proteins in E coli and cleavage of native protein Catalog no K300 01 Rev Date 18 June 2010 Manual part no 25 0709 MANDO000440 Table of Contents Kit Contents and Storage nuon aene tie E AE tete tenent tenete tenete nennen nnneteteteerte tete teneis v Accessory PrOQUCIS prsti osea aE E E de E durante dip eE EEEE ix Introduction e 1 OVeLtVIe Woo ntes a ose oda cete od E nein dreie iets EA bien ase terre fpei adiu bf en eb tes 1 T7 Reg lated Expression eet eee S dine PD ae n ee ndi deir eie d pine tete res 3 Experimental Outline 5 eade ree rre herir etti he e ede a seges it arte HERE Peer e eden 5 MethodS gue 6 Cloning Considerations eee a dete uid fete anie eve fe UG RR e Iden 6 Producing PCR Products gerettet ree Ege eret e meer gre eie ee ie AE eee eed 8 Cloning into PEF SUMO i sette neses ean n ee iot aiite il e tette ans 9 Transforming One Shot Mach1 T18 Competent Cells te tester eese idied bein pex denda 10 Analyzing Transformants 5 esee eere e ete t ein eee eR nien deir ped ER ce 11 Expressing the PCR Product s ede eene eda esepe sie nee eed qais 13 Analyzing Samples 5 ineo dan Usenet ee aee Gr ee a i Eee a RUE aa UH ae RI RR R SHEETS Rea loe EES 16 Purifying the Recombinant Fusion Protein nennen 18 Usitig SUMO Protease aetan l een ae e E augeret eben
27. anol 0 4 ml Bromophenol Blue 0 02 g SDS 0 4g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed 1X SDS PAGE 1 Combine the following reagents Sample Buffer 0 5 M Tris HCI pH 6 8 1 25 ml Glycerol 100 1 0 ml B mercaptoethanol 0 2 ml Bromophenol Blue 0 01 g SDS 0 2g Bring the volume to 10 ml with sterile water Aliquot and freeze at 20 C until needed Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech supportQinvitrogen com E mail jpinfo invitrogen com E mail e
28. asmids by restriction analysis to confirm the presence and correct orientation of the insert You may sequence your construct to confirm that your gene is in the correct orientation and in frame with the N terminal tag if desired The SUMO Forward and T7 Reverse sequencing primers are included with the kit to help you sequence your insert Refer to the diagram on page 7 for the primer sequences and the location of the primer binding sites You may analyze positive transformants using PCR For PCR primers use the SUMO Forward primer or the T7 Reverse primer and a primer that binds within your insert You will have to determine the amplification conditions If you are using this technique for the first time we recommend performing restriction analysis in parallel Artifacts may be obtained because of mispriming or contaminating template The protocol below is provided for your convenience Other protocols may be suitable Materials Needed PCR SuperMix High Fidelity Invitrogen Catalog no 10790 020 Appropriate forward and reverse PCR primers 20 uM each Procedure 1 For each sample aliquot 48 ul of PCR SuperMix High Fidelity into a 0 5 ml microcentrifuge tube Add 1 ul each of the forward and reverse PCR primer 2 Pick 10 colonies and resuspend them individually in 50 ul of the PCR cocktail from Step 1 above Don t forget to make a patch plate to preserve the colonies for further analysis 3 Incubate the reaction for 10 minute
29. asser M 1999 A New Protease Required for Cell Cycle Progression in Yeast Nature 398 246 251 Mossessova E and Lima C D 2000 Ulp1 SUMO Crystal Structure and Genetic Analysis Reveal Conserved Interactions and a Regulatory Essential for Cell Growth in Yeast Molecular and Cellular Biology 20 2367 2377 Muller S Hoege C Pyrowolakis G and Jentsch S 2001 SUMO Ubiquitin s Mysterious Cousin Nature Rev Mol Cell Biol 2 202 210 Rosenberg A H Lade B N Chui D S Lin S W Dunn J J and Studier F W 1987 Vectors for Selective Expression of Cloned DNAs by T7 RNA Polymerase Gene 56 125 135 Saitoh H Pu R T and Dasso M 1997 SUMO 1 Wrestling with a New Ubiquitin Related Modifier Trends Biochem Sci 22 374 376 Studier F W and Moffatt B A 1986 Use of Bacteriophage T7 RNA Polymerase to Direct Selective High Level Expression of Cloned Genes J Mol Biol 189 113 130 Studier F W Rosenberg A H Dunn J J and Dubendorff J W 1990 Use of T7 RNA Polymerase to Direct Expression of Cloned Genes Meth Enzymol 185 60 89 Weiss B Jacquemin Sablon A Live T R Fareed G C and Richardson C C 1968 Enzymatic Breakage and Joining of Deoxyribonucleic Acid VI Further Purification and Properties of Polynucleotide Ligase from Escherichia coli Infected with Bacteriophage T4 J Biol Chem 243 4543 4555 2010 Life Technologies Corporation All rights r
30. cation and maintenance in E coli The pET SUMO vector provides a quick one step cloning strategy for the direct insertion of a PCR product into the vector Taq polymerase has a nontemplate dependent activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized pET SUMO vector supplied in this kit has single 3 deoxythymidine T residues which allow PCR inserts to ligate efficiently into the vector see diagram below n 5 3 One Shot Mach1 T1 competent E coli are included in the kit to provide a host for stable propagation and maintenance of your recombinant plasmid The Mach1 T1 E coli strain is modified from the wild type W strain ATCC 9637 S A Waksman and has the following features e lacZAM15 for blue white color screening of recombinants e hsdR mutation for efficient transformation of unmethylated DNA from PCR applications e ArecA1398 mutation for reduced occurrence of homologous recombination in cloned DNA e endA1 mutation for increased plasmid yield and quality e tonA mutation to confer resistance to T1 and T5 phage T7 Regulated Expression The Basis of T7 Regulated Expression Regulating Expression of T7 RNA Polymerase T7lac Promoter The Champion pET SUMO Protein Expression System uses elements from bacteriophage T7 to control expression of heterologous genes in E coli In the pET SUMO vector expression of the gene of interest
31. eactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Tag DNA Polymerase Recombinant 100 units 10342 053 250 units 10342 012 500 units 10342 020 Platinum Taq DNA Polymerase High 100 units 11304 011 Fidelity 500 units 11304 029 Kanamycin Sulfate 5g 11815 024 25g 11815 032 Isopropylthio B galactoside IPTG 1g 15529 019 CAT Antiserum 50 ul R902 25 You may detect your recombinant fusion protein using one of the Anti HisG antibodies available from Invitrogen The epitope for the Anti HisG antibodies is an N terminal polyhistidine 6xHis tag followed by glycine i e HHHHHHG The amount of antibody supplied is sufficient for 25 western blots Product Quantity Catalog no Anti HisG Antibody 50 ul 940 25 Anti HisG HRP Antibody 50 ul R941 25 Anti HisG AP Antibody 125 ul R942 25 continued on next page Accessory Products continued Purifying Once you have cloned your gene of interest in frame with the N terminal peptide Recombinant containing the polyhistidine 6xHis tag and SUMO you may use Invitrogen s Fusion Protein ProBond or Ni NTA resins to purify your recombinant fusion protein You may TM also use ProBond or Ni NTA resins to remove the SUMO fusion protein and SUMO Protease from the cleavage reaction once you have generated native protein Ordering information for these products is provided below Product Quantity Catalog no
32. eid ii ie dius 20 Troubleshooting n eme ete at este ee eee EU ett er t AAE ETERS 22 LiIJpq ee 25 Performing the Control Reactions arose po ranee ia e T EEE N ea EERE a R E tenente nennen 25 Gel Purifying PCR Products e ettii eer eee e hee t edle t teer ae terat adhe 27 Addition of 3 A Overhangs Post Amplification ccccccscscssesssssscscesesesesesceceeenesesesesesesnsnanssesssssesceceneseseseeees 28 Map and Features of PET SUMO kerrie uereta K a EEKE eE R e ESE a Taa a e EEEE E ETRS 29 MapotpE FSUMO CA Toernee emet aaee erR A endum ned atendido A e edunt 31 Recipes eiie ege eth iet h nh Hatte o Rate E 32 Technical Servicess se tet ee en Ee e ete ee eie e i due ot ees 34 Purchaser Notification Se oe eee ee reges t i rede ede d ineo e EAEE E ESSE a 36 jac M 39 Kit Contents and Storage TM Type of Kit This manual is supplied with the Champion pET SUMO Protein Expression System Catalog no K300 01 Sufficient reagents are provided to perform 20 cloning and expression reactions TM Shipping Storage The Champion pET SUMO Protein Expression System is shipped on dry ice Each kit contains three boxes as described below Upon receipt store the boxes as detailed below Box Component Storage pET SUMO TA Cloning Reagents 20 C One Shot Mach1 T1 Chemically Competent E coli 80 C 1 2 3 BL21 DE3 One
33. en makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 35 Purchaser Notification Introduction Information for European Customers Information for All Non U S Customers Limited Use Label License No 30 T7 Expression System 36 Use of the Champion pET SUMO Protein Expression System is covered under a number of different licenses including those detailed below The following E coli strains are genetically modified as described below e Mach1 T1 Carries the lacZAM15 hsdR lacX74 recA endA tonA genotype e BL21 DE3 Carries the bacteriophage X DE3 lysogen containing the 17 RNA polymerase gene As a condition of sale use of these products must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of
34. eserved For research use only Not intended for any animal or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 39 Notes invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
35. eze thaw cycles at 80 C Store 10X SUMO Protease Buffers at 4 C or 20 C Item Composition Amount SUMO Protease 1 U ul SUMO Protease in 5x50 ul 25 mM Tris HCl pH 8 0 1 Igepal NP 40 250 mM NaCl 500 uM DTT 50 v v glycerol 10X SUMO Protease Buffer 500 mM Tris HCl pH 8 0 500 pl Salt 2 Igepal NP 40 1 5 M NaCl 10 mM DTT 10X SUMO Protease Buffer 500 mM Tris HCl pH 8 0 500 pl Salt 2 Igepal NP 40 10 mM DTT One unit of SUMO Protease cleaves 285 of 2 ug control substrate in 1 h at 30 C Accessory Products Introduction Additional Products Detecting Recombinant Proteins The products listed in this section may be used with the Champion pET SUMO Protein Expression System For more information refer to our Web site www invitrogen com or contact Technical Service page 34 TM Some of the reagents supplied in the Champion pET SUMO Protein Expression System as well as other products suitable for use with the kit are available separately from Invitrogen Ordering information is provided below Product Quantity Catalog no SUMO Protease 250 units 12588 018 One Shot Mach1 T1 Chemically 20x 50 ul C8620 03 Competent E coli One Shot BL21 DE3 Chemically 20 x 50 pl C6000 03 Competent E coli One Shot BL21 DE3 pLysS Chemically 20 x 50 ul C6060 03 Competent E coli Platinum Taq DNA Polymerase 100 r
36. forming One Shot Mach1 T1 Competent Cells next page Note You may store your ligation reaction at 20 C until you are ready for transformation Transforming One Shot Mach1 T1 Competent Cells Introduction l NM AMENO 7 5 Va S0 A o E Materials Needed Preparing for Transformation One Shot Chemical Transformation Protocol Once you have ligated your insert into pET SUMO you will transform your construct into competent E coli One Shot Mach1 T18 chemically competent E coli are included with the kit to facilitate transformation A protocol to transform the competent cells is provided in this section We recommend using the One Shot Mach1 T1 chemically competent E coli supplied in the kit for your transformation reactions Using other F coli strains may result in higher background levels You will need the following reagents and equipment before beginning Ligation reaction from Step 3 previous page One Shot Mach1 T1 chemically competent E coli Box 2 included with the kit one vial per transformation S O C medium Box 2 included with the kit LB plates containing 50 ug ml kanamycin 42 C water bath 37 C shaking and non shaking incubator For each transformation you will need one vial of competent cells and two selective plates Equilibrate a water bath to 42 C Warm the vial of S O C medium from Box 2 to room temperature Warm LB plates containing 50 ug ml kanamycin
37. four amino acids we recommend that you add an additional amino acid preferably serine to the N terminus of your protein see Important note on page 6 Note Any additional amino acids added to the N terminus of your protein will remain following cleavage of the SUMO fusion protein Follow the guidelines below when using SUMO Protease e For optimal results perform the cleavage reaction using partially or fully purified recombinant fusion protein e For most fusion proteins SUMO Protease functions optimally in a reaction mixture containing approximately 150 mM NaCl however conditions may be optimized for your particular protein by varying the NaCl concentration from 100 mM to 300 mM Remember to take into account the contribution of salt from the enzyme i e 12 5 mM in final buffer and from your substrate When setting up your cleavage reaction use the appropriate 10X SUMO Protease Buffer Salt e Keep the imidazole concentration less than 150 mM Concentrations higher than 150 mM can adversely affect the activity of the protease An example of a time course experiment with 10 units of SUMO Protease is provided If the protein of interest is heat labile incubate at 4 C with longer incubation times and or more enzyme see table on next page 1 Add the following to a microcentrifuge tube Fusion Protein 20 ug 10X SUMO Protease Buffer Salt 20 pl Water to a total volume of 190 pl SUMO Protease 10 units 10 ul
38. ght You may also incubate your ligation reaction at room temperature for 30 minutes if desired 4 Transform 2 ul of the ligation reaction into one vial of One Shot Mach1 T1 competent cells using the protocol on page 10 Pick 10 colonies and isolate plasmid DNA Analyze the plasmids for the presence of insert by digesting the DNA with Bsa I to release the 750 kb insert Greater than 80 of the colonies should contain plasmid with the 750 bp insert pUC19 plasmid is included to check the transformation efficiency of the One Shot Mach1 T1 competent cells Transform one vial of One Shot Mach1 T1 cells with 10 pg of pUC19 using the protocol on page 10 Plate 10 ul of the transformation mixture plus 20 ul of S O C on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 21 x 10 cfu ug DNA Gel Purifying PCR Products Introduction Using the S N A P Gel Purification Kit Quick S N A P Method Note Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols The S N A P Gel Purification Kit Catalog no K1999 25 allows
39. he product or its components or derivatives in manufacturing 2 use of the product or its components or derivatives to provide a service information or data 3 use of the product or its components or derivatives for diagnostic purposes 4 transfer or sale of vectors clones or libraries made with the product or components or derivatives of the product or 5 resale of the product or its components or derivatives whether or not such product or its components or derivatives are resold for use in research If the purchaser is not willing to accept these use limitations Life Technologies is willing to accept return of the product for a full refund For information on obtaining a license for commercial purposes contact Vice President Cornell Research Foundation Inc Weill Medical College 418 East 71st St Suite 61 New York NY 10021 Phone 212 746 1267 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 M I Simon ed Academic Press San Diego CA Dubendorff J W and Studier F W 1991 Controlling Basal Expression in an Inducible T7 Expression System by Blocking the Target T7 Promoter with lac Repressor J Mol Biol 219 45 59 Li S J and Hochstr
40. ion Protein Introduction ProBond and Ni NTA Important Performing Dialysis The presence of the N terminal polyhistidine 6xHis tag in pET SUMO allows purification of your recombinant fusion protein with a metal chelating resin such as ProBond or Ni NTA Purify your recombinant protein under native conditions ProBond and Ni NTA are nickel charged agarose resins that can be used for affinity purification of fusion proteins containing the 6xHis tag Proteins bound to the resin may be eluted with either low pH buffer or competition with imidazole or histidine e To scale up your pilot expression for purification see the next page TM e To purify your fusion protein using ProBond or Ni NTA refer to the manual included with each product You may download the manuals from our Web site www invitrogen com e To purify your fusion protein using another metal chelating resin refer to the manufacturer s instructions SUMO Protease is a highly active cysteine protease If you purify your recombinant protein in the presence of protease inhibitors do not use cysteine protease inhibitors e g leupeptin as they will inhibit the cleavage reactions For optimal results we recommend that the SUMO Protease cleavage reaction be carried out in a buffer containing 300 mM NaCl and 150 mM imidazole see guidelines on page 20 SUMO Protease is inhibited when the salt and imidazole concentrations exceed these amounts
41. is controlled by a strong bacteriophage T7 promoter that has been modified to contain a lac operator sequence see below In bacteriophage T7 the T7 promoter drives expression of gene 10 010 T7 RNA polymerase specifically recognizes this promoter To express the gene of interest it is necessary to deliver T7 RNA polymerase to the cells by inducing expression of the polymerase or infecting the cell with phage expressing the polymerase In the Champion pET SUMO System T7 RNA polymerase is supplied by the BL21 DE3 host E coli strain in a regulated manner see below When sufficient T7 RNA polymerase is produced it binds to the T7 promoter and transcribes the gene of interest The BL21 DE3 E coli strain is specifically included in the Champion pET SUMO Protein Expression Kit for expression of T7 regulated genes This strain carries the DE3 bacteriophage lambda lysogen This ADE3 lysogen contains a lac construct consisting of the following elements e the JacI gene encoding the lac repressor e the T7 RNA polymerase gene under control of the lacLIV5 promoter e a small portion of the lacZ gene This lac construct is inserted into the int gene such that it inactivates the int gene Disruption of the int gene prevents excision of the phage i e lysis in the absence of helper phage The lac repressor encoded by lacI represses expression of T7 RNA polymerase Addition of the gratuitous inducer isopropyl B D thiogalacto side IPTG
42. lyzes the exchange of 1 nmol P abeled pyrophosphate into y p P ATP in 20 minutes at 37 C Weiss et al 1968 One unit is equal to approximately 300 cohesive end ligation units TM The Champion pET SUMO Protein Expression System provides a forward and reverse sequencing primer to facilitate sequence analysis of your expression constructs The sequences of the forward and reverse primers are listed below Two micrograms of each primer are supplied Primer Sequence pMoles Supplied SUMO Forward 5 AGATTCTTGTACGACGGTATTAG 3 141 T7 Reverse 5 TAGTTATTGCTCAGCGGTGG 3 325 continued on next page Kit Contents and Storage continued One Shot Mach1 T1 Reagents Genotype of Mach1 T1 One Shot BL21 DE3 Reagents The table below lists the items included in the One Shot Mach1 T1 Chemically Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu ug DNA Store Box 2 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose Mach1 T1 cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 50 ul 0 5 mM EDTA pH 8 Use this E coli strain for general cloning purposes Do not use these cells for expression Genotype F 80lacZAM15 AlacX74 hsdR r mx ArecA1398 end A1 ton A
43. n System is based on expression vectors originally developed by Studier and colleagues and takes advantage of the high activity and specificity of the bacteriophage T7 RNA polymerase to allow regulated expression of heterologous genes in E coli from the T7 promoter Rosenberg et al 1987 Studier and Moffatt 1986 Studier et al 1990 For more TM information about the Champion pET Expression System see page 3 TM In the Champion pET SUMO Protein Expression System you will clone and express your gene of interest as a fusion to SUMO SUMO is the Saccharomyces cerevisiae Smt3 protein which is an 11 kDa homolog of the mammalian SUMO 1 protein Saitoh et al 1997 Smt3 hereby referred to as SUMO is a member of a ubiquitin like protein family that regulates several cellular processes including apoptosis nuclear transport and cell cycle progression Muller et al 2001 Like ubiquitin SUMO covalently attaches to lysine side chains on cellular target proteins however unlike ubiquitin modification SUMO modification leads to changes in protein function and activity rather than protein degradation Studies at Invitrogen have shown that fusion of a heterologous protein to SUMO can lead to increased expression levels as well as enhanced solubility of the recombinant protein The tertiary structure of the SUMO protein is also recognized by a cysteine protease SUMO Protease Ulp which specifically cleaves conjugated SUMO from target
44. nd use in the ligation reaction Map and Features of pET SUMO Map The figure below shows the features of the pET SUMO vector The vector is supplied linearized between nucleotides 653 and 654 with a one base pair 5 T overhang on each strand as indicated The complete sequence of pET SUMO is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 34 E r3 RBS ATG Comments for pET SUMO 5643 nucleotides T7 promoter bases 209 225 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 288 Initiation ATG bases 297 299 HisG epitope bases 309 329 SUMO ORF bases 360 653 SUMO forward priming site bases 549 571 TA Cloning site bases 653 654 T7 reverse priming site bases 783 802 C T7 terminator bases 744 872 Kanamycin resistance gene bases 1431 2246 C pBR322 origin bases 2342 3015 ROP ORF bases 3383 3574 lacl ORF bases 4383 5474 C C complementary strand HisG epitope SUMO continued on next page 29 Map and Features of pET SUMO continued Features of pET SUMO 30 The pET SUMO vector 5643 bp contains the following elements All features have been functionally tested Feature Benefit T7 promoter Allows high level IPTG inducible expression of your recombinant protein in E coli strains expressing the T7 RNA polymerase lac operator lacO Binding site for lac repressor that ser
45. ng a SUMO CAT fusion protein and was generated by cloning the a Taq amplified PCR fragment encoding the CAT gene into pET SUMO The size of the SUMO CAT fusion protein is approximately 39 kDa The nucleotide sequence of the pET SUMO CAT vector is available for downloading from Web site www invitrogen com or by contacting Technical Service page 34 SO SOE ey ca o Zz 2 pET SUMO CAT Comments for pET SUMO CAT 6307 nucleotides T7 promoter bases 209 225 lac operator lacO bases 228 252 Ribosome binding site RBS bases 282 288 Initiation ATG bases 297 299 HisG epitope bases 309 329 SUMO ORF bases 360 653 SUMO forward priming site bases 549 571 CAT gene bases 654 1313 T7 reverse priming site bases 1443 1462 C T7 terminator bases 1404 1532 Kanamycin resistance gene bases 2092 2907 C pBR322 origin bases 3003 3676 ROP ORF bases 4047 4238 lacl ORF bases 5047 6138 C C complementary strand 31 Recipes LB Luria Bertani Medium and Plates S O B Medium with Antibiotic 32 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C L
46. night culture into 500 ml of medium but you will need to adjust the bed volume of your ProBond or Ni NTA column accordingly Grow the culture at 37 C with shaking 225 250 rpm to an OD 0 5 2 3 hours The cells should be in mid log phase Add IPTG to a final concentration of 0 5 1 mM to induce expression Grow at 37 C with shaking until the optimal time point determined by the pilot expression is reached Harvest the cells by centrifugation 3000 x g for 10 minutes at 4 C Proceed to purification or store the cells at 80 C for future use There may be cases when your specific fusion protein may not be completely purified by metal affinity chromatography Other protein purification techniques may be utilized in conjunction with ProBond or Ni NTA to purify the fusion protein see Deutscher 1990 for more information 19 Using SUMO Protease Introduction Important General Guidelines Recommended Conditions for Cleavage 20 Once you have purified your recombinant fusion protein you may generate native protein by using SUMO Protease to cleave the N terminal peptide containing the 6xHis tag and SUMO General guidelines to use SUMO Protease are provided below We have found that SUMO Protease may not cleave the SUMO protein when the amino acid immediately following SUMO i e the first amino acid of your protein is a proline lysine valine or leucine If your protein starts with one of these
47. on which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com continued on next page 37 Purchaser Notification continued Limited Use Label License No 185 SUMO 38 The purchase price of these products includes limited nontransferable rights to use only the purchased amount of the product solely for internal research The purchaser of this product may not transfer or otherwise sell this product or its components or derivatives to a third party and no rights are conveyed to the purchaser to use the product or its components or derivatives for commercial purposes as defined below Commercial purposes means any activity for which a party receives consideration and may include but is not limited to 1 use of t
48. on and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our Web site www invitrogen com or contact Technical Service page 34 continued on next page Analyzing Samples continued Analyzing Samples Detecting Recombinant Fusion Proteins Assaying for CAT Protein Note The Next Step To determine the success of your expression experiment you may want to perform the following types of analyses 1 Stain the polyacrylamide gel with Coomassie blue and look for a band of increasing intensity in the expected size range for the recombinant protein Use the uninduced culture as a negative control 2 Perform a western blot to confirm that the overexpressed band is your desired protein see below 3 Use the pET SUMO CAT positive control to confirm that growth and induction were performed properly see below To detect expression of your recombinant fusion protein by western blot analysis you may use the Anti HisG Antibodies available from Invitrogen see page ix for ordering information or an antibody to your
49. pes e Reagents and apparatus to perform SDS PAGE electrophoresis e Boiling water bath Once you have finished your pilot expression you are ready to analyze the samples you have collected Before starting prepare SDS PAGE gels or use one of the pre cast polyacrylamide gels available from Invitrogen see below Note If you wish to analyze your samples for soluble protein see below 1 Thaw the samples from Pilot Expression Steps 5 and 7 previous page and resuspend each cell pellet in 80 ul of 1X SDS PAGE sample buffer 2 Boil 5 minutes and centrifuge briefly Load 5 10 ul of each sample on an SDS PAGE gel and electrophorese Save your samples by storing them at 20 C 1 Thaw and resuspend each cell pellet in 500 ul of Lysis Buffer see Recipes page 33 3 Freeze sample in dry ice or liquid nitrogen and then thaw at 42 C Repeat 2 to 3 times Note To facilitate lysis you may need to add lysozyme or sonicate the cells 3 Centrifuge samples at maximum speed in a microcentrifuge for 1 minute at 4 C to pellet insoluble proteins Transfer supernatant to a fresh tube and store on ice 4 Mixtogether equivalent amounts of supernatant and 2X SDS PAGE sample buffer and boil for 5 minutes 5 Add 500 ul of 1X SDS PAGE sample buffer to the pellets from Step 3 and boil 5 minutes 6 Load 10 ul of the supernatant sample and 5 ul of the pellet sample onto an SDS PAGE gel and electrophorese To facilitate separati
50. protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a HisG epitope The WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescence methods For more information refer to our Web site www invitrogen com or contact Technical Service page 34 If you use pET SUMO CAT as a positive control vector you may assay for CAT expression using your method of choice CAT is fused to the N terminal 6xHis tag allowing you to detect CAT expression using western blot analysis and an Anti HisG antibody CAT Antiserum is also available separately from Invitrogen see page ix for ordering information Other commercial kits are available for assaying CAT expression The molecular weight of the CAT fusion protein is approximately 39 kDa Expression of your protein with the N terminal peptide containing the 6xHis tag and SUMO fusion protein will increase the size of your recombinant protein by approximately 13 kDa If you are satisfied with expression of your gene of interest proceed to Purifying the Recombinant Fusion Protein next page If you have trouble expressing your protein or wish to optimize expression refer to the Troubleshooting section page 22 17 Purifying the Recombinant Fus
51. ristics that may affect optimal expression we recommend performing a time course of expression to determine the best conditions for expression of your protein We recommend including the pET SUMO CAT positive expression control supplied with the kit in your experiments to help you evaluate you results The BL21 DE3 E coli strain is specifically designed for expression of genes regulated by the T7 promoter Each time you perform an expression experiment you will transform your plasmid into BL21 DE3 Do not use this strain for propagation and maintenance of your plasmid Use Mach1 T1 cells instead Basal level expression of T7 polymerase particularly in BL21 DE3 cells may lead to plasmid instability if your gene of interest is toxic to E coli Note If you are expressing a highly toxic gene the BL21 DE3 pLysS strain is available from Invitrogen for expression purposes The BL21 DE3 pLysS strain contains the pLysS plasmid to further reduce basal level expression of the gene of interest We do not recommend using BL21 Star DE3 or BL21 Star DE3 pLyssS E coli strains available from Invitrogen for expression of your pET SUMO construct These strains may reduce the solubility of your recombinant SUMO protein pET SUMO CAT is provided as a positive control vector for expression This vector allows expression of an N terminally tagged chloramphenicol acetyl transferase CAT fusion protein that may be detected by western blot or func
52. rologous genes For more information about BL21 DE3 pLysS refer to our Web site www invitrogen com or contact Technical Service page 34 Note that while BL21 DE3 pLysS reduces basal expression from the gene of interest when compared to BL21 DE3 it also generally reduces the overall induced level of expression of recombinant protein One Shot Mach1 T1 competent E coli which do not contain T7 RNA polymerase are included in the kit to provide a host for stable propagation and maintenance of your recombinant plasmid As mentioned on the previous page the presence of T7 RNA polymerase even at basal levels can lead to expression of the desired gene even in the absence of inducer If the gene of interest is toxic to the E coli host plasmid instability and or cell death may result We recommend that you transform your TA Cloning reaction into Mach1 T1 cells for characterization of the construct propagation and maintenance When you are ready to perform an expression experiment transform your construct into BL21 DE9 E coli Experimental Outline Introduction Experimental Outline To clone your gene of interest into pET SUMO you must first generate a PCR product The PCR product is ligated into pET SUMO and transformed into One Shot Mach1 T1 competent cells Since the PCR product can ligate into the vector in either orientation individual recombinant plasmids need to be analyzed to confirm proper orientation
53. s at 94 C to lyse the cells and inactivate nucleases Amplify for 20 to 30 cycles 5 For the final extension incubate at 72 C for 10 minutes Store at 4 C Visualize by agarose gel electrophoresis continued on next page 11 Analyzing Transformants continued If you have problems obtaining transformants or the correct insert perform the Important control reactions described on pages 25 26 These reactions will help you troubleshoot your experiment Long Term Once you have identified the correct clone be sure to purify the colony and Storage make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colony on LB plates containing 50 ug ml kanamycin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 ug ml kanamycin 3 Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Expressing the PCR Product Introduction BL21 DE3 Strain Important Positive Control Basic Strategy Plasmid Preparation BL21 DE3 One Shot E coli Box 3 are included with the Champion pET SUMO Protein Expression Kit for use as the host for expression You will need pure plasmid DNA of your pET SUMO construct to transform into BL21 DE3 for expression studies Since each recombinant protein has different characte
54. the 6xHis tag and SUMO fusion protein to your protein or interest design your forward primer to ensure that your protein is in frame with the N terminal peptide If you wish to generate native protein following SUMO Protease cleavage design your forward primer such that the first 3 bases of the PCR product encode the ATG initiation codon Include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site Refer to the diagram on the next page to help you design your PCR primers If the first amino acid in your protein of interest is proline lysine valine or leucine SUMO Protease may not cleave the SUMO fusion protein In this case we recommend designing your forward PCR primer to introduce a serine at the start of your protein We have found that proteins starting with a serine are cleaved by SUMO Protease with high efficiency You may also introduce any other amino acid except proline lysine valine or leucine to the start of your protein however cleavage efficiency may not be optimal Note Any additional amino acids added to the N terminus of your protein will remain following cleavage of the SUMO fusion protein continued on next page Cloning Considerations continued TA Cloning Site Use the diagram below to help you design appropriate PCR primers to ligate your PCR product into pET SUMO 121 ATAGGCGCCA GCAACCGCAC CTGTGGCG
55. tional assay To propagate and maintain the plasmid transform 10 ng of pET SUMO into One Shot Mach1 T1 cells using the procedure on page 10 The basic steps needed to induce expression of your gene in BL21 DE3 E coli are outlined below 1 Isolate plasmid DNA using standard procedures and transform your construct and the positive control separately into BL21 DE3 One Shot cells 2 Grow the transformants and induce expression with IPTG over several hours Take several time points to determine the optimal time of expression 3 Optimize expression to maximize the yield of protein You may prepare plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 for isolation of pure plasmid DNA Note that since you are purifying a low copy number plasmid you may need to increase the amount of bacterial culture that you use to prepare your plasmid construct continued on next page 13 Expressing the PCR Product continued Ns by D L1 Sy v o 2 E Materials Needed Transforming BL21 DE3 One Shot Cells Cyclic AMP mediated derepression of the lacUV5 promoter in ADE3 lysogens can result in an increase in basal expression of T7 RNA polymerase We recommend adding 1 glucose to the bacterial culture medium to repress basal expression of T7 RNA polymerase for the following conditions e To increase the solubility of your protein e
56. ude a final extension step of 7 to 30 minutes Longer PCR products will need a longer extension time PCR reaction contains artifacts i e does not run as a single discrete band on an agarose gel Optimize your PCR using Taq polymerase e Gel purify your PCR product using nuclease free reagents Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent cells stored incorrectly Store One Shot competent cells at 80 C One Shot transformation protocol not followed correctly Follow the One Shot transformation protocol provided on page 10 Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use LB plates containing 50 ug ml kanamycin to select for pET SUMO transformants e Use LB plates containing 100 ug ml ampicillin to select for the pUC19 transformation control Large number of background colonies Used an E coli strain other than Mach1 T1 for transformation For lowest background levels use the One Shot Mach1 T1 cells included with the kit Single 3 T overhangs on the vector degraded Avoid storing the vector for longer than 6 months or subjecting it to repeated freeze thaw cycles 22 continued on next page Troubleshooting continued Expression The table below lists some
57. urotech invitrogen com SDS SDSs Safety Data Sheets are available on our web site at www invitrogen com sds Certificate of The Certificate of Analysis CofA provides detailed quality control information Analysis for each product The CofA is available on our website at www invitrogen com cofa and is searchable by product lot number which is printed on each box continued on next page 34 Technical Service continued Limited Warranty Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrog
58. ves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the TA Cloning site for efficient translation of PCR product N terminal 6xHis tag Allows purification of recombinant fusion protein on metal chelating resin i e ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti HisG Antibodies SUMO ORF Enhances recombinant protein expression and solubility and allows cleavage by SUMO Protease to produce native protein SUMO Forward priming site Allows sequencing of the insert TA Cloning site 5 T overhangs Allows ligase mediated cloning of Taq amplified PCR products 17 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from bacteriophage T7 which allows efficient transcription termination Kanamycin resistance gene Allows selection of the plasmid in E coli pBR322 origin of replication ori Allows replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor that binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of 17 RNA polymerase Map of pET SUMO CAT Description pET SUMO CAT is a control vector expressi
59. your samples Amount of PCR A 1 1 molar ratio of vector insert produces the best ligation efficiency In general Product to Use 0 5 to 1 0 ul of a typical PCR sample with an average insert length 400 700 bp will give the proper 1 1 molar ratio of vector insert You may also perform a second ligation reaction using a 1 3 molar ratio of vector insert if you are concerned about the accuracy of your DNA concentrations Do not use more than 2 3 ul of the PCR sample in the ligation reaction as salts in the PCR sample may inhibit the T4 DNA Ligase Materials Needed You will need the following reagents and equipment before beginning e PCR product from Step 2 previous page e 10X Ligation Buffer included with the kit e pETSUMO vector included with the kit e Sterile water included with the kit e T4DNA Ligase included with the kit Ligation Reaction 1 Determine the volume of PCR sample needed to reach the required amount of PCR product see above Use sterile water to dilute your PCR sample if necessary 2 Set up the 10 pl ligation reaction as follows Fresh PCR product X ul 10X Ligation Buffer lu pET SUMO vector 25 ng ul 2 pl Sterile water to a total volume of 9 ul T4 DNA Ligase 4 0 Weiss units 1 ul Final volume 10 ul 3 Incubate the ligation reaction at 15 C for a minimum of 4 hours preferably overnight You may also incubate your ligation reaction at room temperature for 30 minutes if desired Proceed to Trans

pBAD/Thio His TOPO manual

Contents

Download Pdf Manuals

Related Search

Related Contents