Home

pSIH-H1 shRNA Cloning and Expression Lentivectors

image

Contents

1. drug selectable marker or truncated H2Kk protein cell surface marker for detection and selection of transduced cells e Hybrid RSV 5 LTR promoter provides a high level of expression of the full length viral construct in 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stable integration of the viral expression construct into genomic DNA e V40 origin for stable propagation of the pSIH plasmid in 293 producer cells e The pUC origin for high copy replication and maintenance of the plasmid in E coli cells e The ampicilin resistance gene for selection in E coli cells WPRE element enhances stability and translation of the CMV driven transcripts e The SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts The pSIH1 H1 Puro Vector Cat SI500A 1 contains a puromycin resistance gene to enable drug selection of target cells stably expressing the siRNA The pSIH1 H1 copGFP Vector Cat SI501A 1 contains a copGFP gene CopGFP is a novel fluorescent protein derived from copepod plankton Panalina sp which is similar to EGFP but has a brighter color This gene serves as a fluorescent reporter for the transfected or transduced cells The non functional murine cell surface marker H 2Kk with a truncated cytoplasmic domain provides a unique opportunity to detect transduced cells with FITC labeled H 2Kk Ab or select H 2Kk positive cells
2. 5 terminus 3 5 flanking nucleotides on the anti sense strand should be more AT rich than the 3 terminus The template sequences coding for the shRNA targeted to each selected target site must contain both the sense and anti sense strand and be designed to form a stem loop structure when transcribed In addition both the top and bottom strands of the entire shRNA sequence sense loop antisense terminator must be synthesized and annealed to make a double stranded DNA sequence that can be cloned into the pSIH vector The features of the oligonucleotides coding for the shRNA template sequence should include the following 1 The 19 29 nucleotide sense and antisense MRNA sequences Usually longer siRNAs 25 27 nt have better silencing efficiencies although 19 nt oligos are more commonly used For the design of 27 nt oligos we recommend the program available at Dr Gregory Hannon s web site http katahdin cshl org 9331 homepage siIRNA RNAi cgi type shRNA The program is designed to incorporate a few G U mismatches in the sense portion of stem that will help to stabilize hairpins during propagation in bacteria 2 A hairpin loop sequence between sense and antisense portion The 9 nt loop sequence 5 TTCAAGAGA 3 is most commonly used in RNA silencing experiments Brummelkamp 2002 but we have used a 12 nt sequence 5 CTTCCTGTCAGA 3 which generates similar results Loop sequences of 3 to 15 nucleotides have been used successfully
3. by different investigators 3 ATTTTT terminator sequence for RNA polymerase III 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 4 A BamHI and EcoRI restriction site overhang sequences for directional cloning of annealed shRNA template oligonucleotides into the pSIH H1 vector 5 Using of initiation G nucleotide in the first position of sense portion of shRNA is not necessary as RNA polymerase III could initiate transcription from any 1 nucleotide of H1 promoter The top and bottom strands of the shRNA template oligonucleotides should be designed to look like the following diagram after annealing See also Figure 1 RNA Pol III Sense Strand Loop Antisense Strand Terminator EcoRI 5 GATCCNNNNNNNNNNNNNNNNNNNCTT CCT GT CAGANNNNNNNNNNNNNNNNNNNTTTTTG 3 3 GNNNNNNNNNNNNNNNNNNNGAAGGACAGT CTNNNNNNNNNNNNNNNNNNNAAAAACTTAA 5 For each selected template sequence two complementary oligonucleotides the top strand and complementary bottom strand need to be synthesized phosphorylated and annealed before ligation step A 50 uM scale reaction for oligonucleotide synthesis with regular desalting purification is sufficient for cloning into the pSIH H1 Vectors For the best cloning efficiency we recommend to phosphorylate oligonucleotides using T4 polynucleotide kinase The phosphorylation procedure is shown below in step B 1 B Cloning of shRNA Template Oligonucleotide
4. express them in HeLa or HEK 293 cells using chemical transfection For example with these cells the Lipofectamine Reagent Invitrogen Cat 18324 111 with Plus Reagent Invitrogen Cat 11514 015 works well in our hands Alternatively you can use your target cells for this analysis If you have already established a transfection method for your target cells use your established conditions If you do not have an established transfection protocol we recommend you compare efficiencies of several transfection procedures e g Invitrogen s Lipofectamine 2000 Cat 11668 027 Roche FUGENE 6 Cat 11 815 091 001 The goal of these experiments is to achieve at least 90 95 transfection efficiency of target cells which can be measured by analysis of GFP positive cells if you are using constructs with copGFP reporters or H2Kk positive cells for constructs in the pSIH1 H1 H2kk vector For shRNA knockdown studies using transfection it is important to optimize the selected transfection protocol and then keep the parameters constant to ensure reproducible results Depending on what is appropriate for your target gene the silencing efficiency of different shRNA constructs can be estimated by determining the concentration of target mRNA using RT PCR assessing the amount of target protein by Western blot or ELISA or assaying for activity of the target protein Usually shRNA constructs with 70 80 silencing efficiency are suitable for gene f
5. is reduced to three gag rev and pol and these genes are expressed from different plasmids lacking packaging signals and significant homology to pSIH expression vectors VSV G expression vector or each other to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Pseudoviral particles will carry only the expression construct of your target gene e The lentiviral particles produced in this system are pseudotyped with envelope G glycoprotein from Vesicular Stomatitis Virus Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty ombl4 bmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follows standard microbiological practices which include e Wear gloves and lab coat all the time when conducting the procedure e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable mate
6. it provides critical instructions on designing and synthesizing shRNA templates cloning the shRNA templates into the H1 expression cassette of pSIH H1 Vectors and verifying final vector constructs This manual does not include information on packaging the pSIH H1 Vector construct into pseudotyped viral particles or transducing your target cells of choice with these particles This information is available in the user manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells which is available on the SBI web site www systembio com Before using the reagents and material supplied with this system please read the entire manual B Lentiviral shRNA Expression System Short double stranded RNAs with sizes 19 29 bp can efficiently mediate gene silencing in mammalian cells by guiding sequence specific degradation of target mRNA sequences Bernstein 2001 Hammond 2000 Synthetic double stranded siRNA molecules can be introduced into cells to suppress gene expression transiently Alternatively shRNA templates can be cloned into an shRNA expression vector such as SBI s FlV based or HIV based RNAi Cloning and Expression Lentivectors and expressed in the cells of choice Lentiviral expression vectors are the most effective vehicles for delivering genetic material to almost any mammalian cell including non dividing cells and whole model organisms As with standard plasmid vectors it is possible to introduce shRNA l
7. ml ampicillin and grow overnight at 37 C d You could expect to get at least 10 fold more colonies in experimental samples in comparison with negative control vector only ligation reaction C Identify clones with the target shRNA template 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 50 ug ml ampicillin at 37 C for 2 hours with shaking b Take 1 ul of each bacteria culture for PCR screening see C 2 and continue to grow the culture for another 6 hours c Store the bacterial culture at 4 C Page 12 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 2 a Screen for shRNA template inserts Prepare a PCR master mix for each clone you would like to screen for the presence of a shRNA template insert as follows tmn 10 rxn Composition 0 5 ul 5 ul ForwardH PCR Primer 10 uM 0 5 ul 5 ul ReverseH PCR Primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 pl 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA Polymerase 5 U l 24 0 ul 240 ul Total volume Mix the master mix very well and aliquot 24 ul into each well of a 96 well PCR plate or individual tubes Add 1 ul of each bacterial culture from C 1 into each well or tube from C 2 b Mix Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min
8. of shRNA template oligonucleotides using a spectrophotometer and mix equal molar amounts of each strand To check annealing run 5 ul of annealed insert from step B 1 f using a 12 polyacrylamide gel and compare the band s location with that of the original single stranded oligonucleotides Confirm oligonucleotides were correctly synthesized Verify the size of the oligonucleotides using a 12 native polyacrylamide gel Check quality of T4 polynucleotide kinase and T4 DNA ligase Test the activity of your ligase and reaction buffer using a different vector and insert Test the activity of T4 polynucleotide kinase by labeling annealed control Luciferase with 22B_yATP Replace the reagents if they show poor activity 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual Ensure there are no ligation inhibitors present EDTA and high salt can inhibit ligation reactions Make sure that your ds shRNA template oligonucleotide concentration is 14M and use 0 1 1 ul of this oligonucleotide in ligation reaction Higher concentration of ds shRNA template oligonucleotide could reduce yield of shRNA lentivector construct Check the quality of the competent cells Handle the competent cells gently Many cells cannot be refrozen once thawed The quality of the competent cells can be tested by transforming with any circular plasmid Check antibiotic selection The plates used for cloning should contain 50 100 pg m
9. the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 3564 4038 inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3602 3818 RNA polymerase IIl promoter for expression of siRNA insert SV40 Poly A 4110 4241 Transcription termination and polyadenylation SV40 Ori 4250 4396 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 4766 5439 C Allows for high copy replication in E coli AmpR 5584 6444 C Ampicillin resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual RSV 5 LTR Amp f RRE pSIH1 H1 copGFP pUC ORI ee are Econ SV40 ORI BamHI SV40 Poly A 3 ALTR y WPRE feature Location funn Hybrid RSV promoter R U5 long terminal repeat aS for viral packaging and transcription Packaging signa OOOO O O signal e re aca aaaea packaging of viral transcripts Central polypurine tract includes DNA Flap cPPT 1798 1916 region involved in nuclear translocation and integration of transduced viral genome Human cytomegalovirus CMV constitutive promoter for transcription of copGFP Copepod green fluorescent protein similar to copGFP 2279 3037 regular EGFP but with brighter color as a report
10. with Miltenyi s magnetic beads in wide range of human and mouse cell lines except AKR J and CBA Ca mouse strain www miltenyibiotech com 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Two approaches have been developed for in vivo expression of siRNA from plasmid and viral vectors In one approach the sense and anti sense strands are transcribed separately from two independent promoters and form the siRNA duplex Lee 2002 Miyagishi 2002 With the second approach a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin is expressed from a single promoter Abbas Terki 2002 Qin 2003 Wiznerowicz 2003 This sequence is then converted into double stranded siRNA after intracellular processing cleaves the loop Brummelkamp 2002 Paddison 2002 In both approaches the siRNA molecules are transcribed from constitutive RNA polymerase Ill promoters e U6 and or H1 and terminated with TTTTT Ts sequences Tuschl 2002 The U6 and H1 promoters are different in size but contain the same conserved sequence elements Myslinski 2001 The pSIH H1 Vectors are designed to express a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin from a RNA polymerase Ill H1 promoter Abbas Terki 2002 Qin 2003 Wiznerowicz 2003 The hairpin type siRNA shRNA template oligonucleotides need to be cloned into unique BamHI Eco
11. 0A 1 SI502A 1 IV References General references Abbas Terki Blanco Bose N Deglon Pralong W and Aebischer P 2002 Lentiviral mediated RNA interference Hum Gene Ther 13 2197 2201 Buchschacher G L and Wong Staal F 2000 Development of lentiviral vectors for gene theraphy for human diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors concentration to a very high titer and efficient gene transfer into mammalian and non mammalian cells Proc Natl Acad Sci USA 90 8033 8034 Cann A J ed 2000 RNA Viruses A Practical Approach Oxford Univ Press Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A third generation lentivirus vector with a conditional packaging system J Virol 72 8463 8471 Gould D J and Favorov P 2003 Vectors for the treatment of autoimmune diseases Gene Therapy 10 912 927 Lee N S Dohjima T Bauer G Li H Li M J Ehsani A Salvaterra P and Rossi J 2002 Expression of small interfering RNAs targeted against HIV 1 rev transcripts in human cells Nature Biotechnol 20 500 505 Morgan R A Cornetta K and Anderson W F 1990 Application of the polymerase chain reaction in retroviral mediated gene transfer and the analysis of gene marked human TIL cells Hum Gene Ther 1 135 149 Pfeifer
12. A Kessler T Yang M Baranov E Kootstra N Cheresh D A Hoffman R M and Verma I M 2001 Transduction of liver cells by lentiviral vectors Analysis in living animals by fluorescence imaging Mol Ther 3 319 322 Qin X F An D S Chen I S and Baltimore D 2003 Inhibiting HIV 1 infection in human T cells by lentiviral mediated delivery of small interfering RNA against CCR5 Proc Natl Acad Sci USA 100 183 188 Quinn T P and Trevor K T 1997 Rapid quantitation of recombinant retrovirus produced by packaging cell clones Biotechniques 23 1038 1044 Sodroski J G Vector containing HIV packaging sequences packging defective HIV vectors and uses thereof US patent 5 665 577 1997 September 9 Sodroski J G Vectors containing HIV packaging sequences packaging defective HIV vectors and uses thereof US patent 5 981 276 1999 November 9 Sui G Soohoo C Affar E B Gay F Forrester W C and Shi Y 2002 A DNA vector based RNAi technology to suppress gene expression in mammalian cells Proc Natl Acad Sci U S A 99 5515 5520 Wiznerowicz M and Trono D 2003 Conditional suppression of cellular genes lentivirus vector mediated drug inducible RNA interference J Virology 16 8957 8961 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual HIV vector reviews Federico M Methods in Molecular Biology Volume 229 Lentivirus gene engineering
13. HI and EcoRI restriction enzymes Recommended New England BioLabs EcoRI 20 U l Cat R0101 BamHI 20 U ul Cat RO136S e Qiagen Qiaquick PCR Purification Kit Cat No 28104 For Ligating and Transforming shRNA Constructs e T4 DNA Ligase and 10X ligation reaction buffer Recommended New England BioLabs T4 DNA Ligase 400 U l Cat M02028S Before using dilute T4 DNA ligase 10 fold with 1X T4 DNA ligase buffer to 40 U ul e Competent E coli cells RecA Page 6 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 Recommended Invitrogen OmniMAX 2 T1 cells Cat C8540 03 e Petri plates containing LB Agar media with 50 ug ml Ampicillin For Screening shRNA Inserts e Taq DNA polymerase and 10X reaction buffer Recommended Clontech Titanium Taq DNA polymerase Cat 639208 e dNTP mix Recommended GE Amersham dNTP set Cat 27 2035 01 e PCR machine e 3 1X TAE Agarose gel For Purifying shRNA Consiructs after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation of endotoxin free DNA gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Maxi Kit Cat 12362 gt QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contain
14. RI sites located just downstream of an H1 promoter Figure 1 The pSIH H1 vectors need to be linearized by restriction digest with BamHI and EcoRI and purified to remove the stuffer fragment When linearized the vector contains two unique 5 overhangs to facilitate directional cloning of shRNA template oligos with minimal self ligation background Figure 1 When the shRNA construct is expressed from constitutive H1 promoter and terminated with the TTTTT sequence the shRNA transcript folds into the hairpin structure which is recognized by the DICER enzyme cleaved to form a functional ds siRNA and transferred to a RISC complex for selective digestion of complementary target mRNAs Brummelkamp 2002 Paddison 2002 Figure 2 Two PCR primers are designed for regions flanking the shRNA insert in order to provide a simple way for screening of plasmid clones for the presence of shRNA inserts by PCR Figure 2 Page 4 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 pSIH H1 Vector H1 Promoter 44 EcoRI BamHI P53 siRNA template oligos 1 P Sense Loop Antisense Terminator 5 gatccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttg 3 3 gCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaacttaa 5 Fig 1 Design of the single promoter pSIH H1 shRNA expression cassette The dotted lines at the top of the figure indicate the position of the stuffer frag
15. SBI System Biosciences pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI501A 1 SI502A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual ver 4 080514 pSIH H1 shRNA Cloning and Expression Lentivectors Contents Vi 888 266 5066 Toll Free Introduction and Background Purpose of this Manual Lentiviral shRNA Expression System pSIH shRNA Expression Lentivectors List of Components Additional Required Materials Safety Guidelines 7MOOW gt Protocol A shRNA Oligonucleotide Design and Synthesis B Cloning of shRNA Template into pSIH Vector ssi icici C Identify Clones with shRNA Inserts ss D E Troubleshooting A Using the Positive Control B Troubleshooting Specific Results References Appendix A Maps and Features for pSIH Vectors iiss B Sequences of Luciferase Control shRNA Template Oligos C Related Products 650 968 2200 outside US Cat s SISO0A 1 SI502A 1 Page 1 System Biosciences SBI User Manual I Introduction and Background A Purpose of this Manual This manual provides details and information necessary to clone an shRNA template into the pSIH H1 shRNA Cloning and Expression Vectors pSIH1 H1 Puro pSIH1 H1 H2Kk and pSIH1 H1 copGFP Vectors Specifically
16. T 1798 1916 region involved in nuclear translocation and integration of transduced viral genome CMV promoter 1922 2271 Human cytomegalovirus CMV constitutive promoter for transcription of puromycin Non functional murine cell surface marker H 2Kk with a truncated cytoplasmic domain to detect H2Kk 2279 2878 transduced cells with FITC labeled H 2Kk Ab or select H 2Kk positive cells with Miltenyi s magnetic beads Woodchuck hepatitis virus posttranscriptional WPRE 3314 3854 regulatory element enhances the stability of the viral transcripts Required for viral reverse transcription self 3 ALTR AU3 3993 4467 inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 4031 4247 RNA polymerase IIl promoter for expression of siRNA insert SV40 Poly A 4539 4670 Transcription termination and polyadenylation SV40 Ori 4679 4825 Allows for episomal replication of plasmid in eukaryotic cells pUC Ori 5195 5868 C Allows for high copy replication in E coli AmpR 6013 6873 C Ampicillin resistant gene for selection of the plasmid in E coli The notation C refers to the complementary strand 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual B Sequences of the Luciferase Control shRNA Template Oligonucleotide sense 5 GATCCGTGCGTTGTTAGTACTAATCCTATTTGTGAAGCAGATGAAATAGGGT
17. TGGTACTAGCAACGCACTTTTTG 3 PETTET PEP EE PEPE EPP EP EPP EPP EPP EPP EP EPP EPP EP AEE AEREE rrr rrr rrr 3 GCACGCAACAATCATGAT TAGGATAAACACT TCGTCTACTT TATCCCAACCATGATCGTTGCGTGAAAAACTTAA 5 antisense C Related Products e pPACKH1 Lentivector Packaging Kit Cat LV500A 1 Unique lentiviral plasmids that produce all the necessary HIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles 293TN Producer Cell Line SBI Cat LV900A 1 or ATCC Cat CRL 11268 transiently transfected with the pPACKH1 plasmids and an HIV based lentiviral construct produce packaged viral particles containing a lentiviral construct e SIF Single Promoiter shRNA Cloning Vectors FIV based gt pSIF1 H1 Puro shRNA Cloning and Expression Vector Cat S1100C 1 gt pSIF1 H1 copGFP shRNA Cloning and Expression Vector Cat S1101B 1 These FlV based single promoter shRNA cloning vectors allow you to clone short hairpin siRNA shRNA templates under the H1 promoter and efficiently transduce these shRNA constructs in a wide range of cells They are biologically safer than similar shRNA expression vectors that are based on HIV D Technical Support For more information about SBI products to download manuals in PDF format and to get vector map and sequence information please use our web site http www systembio com For additional information or technical assistance ple
18. and bottom strands For the positive control use 1 ul of the Luciferase Control shRNA Template Mix and 1 ul deionized water Incubate the phosphorylation reaction at 37 C for 30 minutes in a thermocycler Heat the reaction mix to 95 C for 2 min in a thermocycler Turn off the thermocycler and let it cool to room temperature Use 0 5 ul of 1 uM shRNA template for the following ligation reaction p20 3 Ligate the shRNA Template into Linearized pSIH H1 Lentivector a Setup 10 ul ligation reactions for each phosphorylated shRNA template as follows 1 0 ul Linearized pSIH H1 Vector 50 ng ul 0 5 ul Phosphorylated ds shRNA template step 1 1M 1 0 ul 10X T4 DNA Ligase Buffer 6 5 ul Deionized water 1 0 ul T4 DNA ligase 40 U nl 10 0 ul Total volume For negative control use insert minus and for positive control use Luciferase shRNA template from step 1 Dilute T4 DNA ligase 400 U ul 10 fold to 40 U ul with 1X T4 DNA ligase buffer if you are using New England Biolabs enzyme b Incubate the ligation reaction at 16 C for 1 2 hrs 4 Transform E coli with the ligation product a For each experimental shRNA template use the whole volume of ligation product for transformation 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual b Follow the manufacturer s protocol for transforming the competent cells c Plate an appropriate amount of cells on LB plates with 50 ug
19. ase call or e mail us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail tech systembio com Page 22 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 VI Licensing and Warranty Statement Limited Use License Use of the pSIH H1 shRNA Cloning and Expression Vector i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms HIV Vector System This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farber Cancer Institute Inc in Boston Massachusetts USA This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Dana Farber Cancer Institute Inc WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use o
20. ed in the user manual gt http www1 giagen com literature protocols pdf QP15 pdf Transfection of pSIH Constructs into Target Cells e Transfection reagent Recommended Lipofectamine 2000 Invitrogen Cat 11668 027 Packaging of pSIH Consiructs in Pseudoviral Particles e pPACKH1 Lentivector Packaging Kit SBI Cat LV500A 1 e 293TN Producer Cell Line SBI Cat LV900A 1 or ATCC 293T 17 Cat CRL 11268 e Lipofectamine Transfection Reagent Invitrogen Cat 18324 111 e Plus Reagent Invitrogen Cat 11514 015 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual F Safety Guidelines SBI s pSIH lentivectors together with the pPACKH1 packaging plasmids comprises a third generation HIV 1 based cloning vector system These lentivectors are based on the vectors developed for gene therapy applications by Dr J G Sodroski US patent 5 665 577 and 5 981 276 This system is designed to maximize its biosafety features including e Deletion in the enhancer of U3 region of LTR ensures self inactivation of lentiviral construct after transduction and integration into genomic DNA of the target cells e RSV promoter upstream of 5 LTR in pSIH expression vector allows efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used in this system e Number of HIV 1 viral genes necessary for packaging replication and transduction
21. entivector constructs in plasmid form into the cells with low to medium efficiency using conventional transfection protocols However by packaging the lentiviral snRNA construct in pseudoviral particles you can obtain highly efficient transduction and heritable expression of siRNA even with most difficult to transfect cells like primary stem and differentiated cells The expression construct transduced in cells is integrated into genomic DNA and provides stable long term expression of the target gene Endogenously expressed siRNA effectors provide long term silencing of the target gene and allow the researcher to generate cell lines and transgenic organisms with a stable knockdown phenotype for functional studies SBI offers a third generation of the most popular HIV 1 based lentivector expression system consisting of three main components 1 The lentiviral expression vector e g pSIH1 H1 Puro 2 The lentiviral packaging plasmids e g PPACKH1 Packaging Plasmid mix 3 A pseudoviral particle producer cell line e g 293TN cells The lentiviral expression vector contains the genetic elements responsible for packaging transduction stable integration of the viral expression construct into genomic DNA and expression of the siRNA effector sequence The packaging vector provides all the proteins Page 2 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 essential
22. er for the transfected transduced cells Woodchuck hepatitis virus posttranscriptional WPRE 3044 3584 regulatory element enhances the stability of the viral transcripts Required for viral reverse transcription self inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA H1 RNA promoter 3761 3977 RNA polymerase Ill promoter for expression of siRNA insert SV40 Poly A 4269 4400 Transcription termination and polyadenylation SV40 Ori 4409 4555 Allows for episomal replication of plasmid in EA cells pUC Ori 4925 5598 C Allows for high copy replication in E coli AmpR 5743 6603 C ampiciin resistant gene for selection of the p lolasmid in E coli The notation C refers to the complementary strand copGFP 3 ALTR AU3 3723 4197 Page 20 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 RSV 5 LTR Amp 4 RRE J psid1 H1 H2Kk shRNA Vector fe pUC ORI 7 477 bp EcoRI R 3 BamHI SV40 Poly A ie e H2Kk 3 ALTR h H1 WPRE cPPT CMV Feature Location Function RSV 5 LTR 7 414 Hybrid RSV promoter R U5 long terminal repeat required for viral packaging and transcription gag 567 919 Packaging signal RRE 1076 1309 Rev response element binds gag and involved in packaging of viral transcripts Central polypurine tract includes DNA Flap cPP
23. f the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Manageme
24. for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles For production of a high titer of viral particles producer cells e g HEK 293 cells need to be transiently co transfected with the expression and packaging vectors Expression constructs packaged in pseudoviral particles are secreted by producer cells in culture media and could be used directly to transduce expression construct in target cells Following transduction into the target cells this expression construct is reverse transcribed integrated into the genome of the target cell and provides a high level of expression of siRNA For a detailed description of SBI s Lentivector expression system please refer to the Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells user manual C pSIH shRNA Expression Lentivectors The pSIH expression system is a third generation of HlV based expression lentivectors developed for gene therapy applications Sodroski J G 1997 1999 Federico 2003 Heiser 2004 Machida 2003 See section F for safety guidelines The pSIH vectors see detailed functional map in Appendix provide the following features e H1 expression cassette provides constitutive and efficient RNA polymerase Ill dependent transcription of snRNA transcripts in wide range of cell lines e CMV promoter promotes high level of expression of copGFP fluorescent reporter puromycin N acetyl transferase
25. han the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2008 System Biosciences SBI Page 24 ver 4 080514 www systembio com SBI System Biosciences System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Tel 888 266 5066 Toll Free in US 650 968 2200 Fax 650 968 2277 E mail info systembio com Web www systembio com ver 4 080514
26. l ampicillin in the media You can check the activity of the antibiotic by mixing wild type E coli with small numbers of E coli that have been successfully transformed with any plasmid containing the Amp gene 2 Too many clones without shRNA insert Confirm pSIH vector was completely linearized Run a small aliquot of the EcoRI BamHI digested vector A single band should be observed if not redigest and gel purify Confirm activity of the EcoRI and BamHI restriction enzymes Perform a small scale test digestion on the pSIH vector with EcoRI and BamHI separately to confirm they both are able to linearize the vector If not replace the enzyme 3 No product was amplified from selected clones Confirm activity of the Taq DNA polymerase Test the activity of the enzyme reaction by amplifying a known sequence from any plasmid DNA Replace the reagents if they demonstrate poor activity Ensure that you have not picked plasmids without shRNA template insert Colonies without an insert will yield a product of about 100 bp Please also note that due to recombination even when using recA bacteria you will not be able to amplify any product from plasmid isolated from some of the colonies Always confirm that you have rignt insert by sequence analysis of PCR product or sequencing of saran expression cassette in purified lentivector constructs Page 16 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI50
27. ment that is removed during linearization by digesting the vector with BamHI EcoRI Your shRNA template sequence should be designed to directionally insert between the BamHI and EcoRI nucleotide overhangs i e sticky ends This example shows the siRNA sequence targeting the p53 gene shRNA template insert Reverse 1 P Sense Loop Antisense Terminator tccGACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCtttttgaa aggCTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaactt Transcription ttc 5 GACUCCAGUGGUAAUCUAC t shRNA transcript 3 uuCUGAGGUCACCAUUAGAUG Jac Fig 2 Example shRNA template construct targeting the p53 gene The nucleotides for the specific siRNA sequence targeting the p53 gene are shown in capital letters The shRNA sense and antisense sequences flank the region coding for the loop structure In addition a terminator sequence for the RNA polymerase Ill is included after the antisense portion The Forward and Reverse arrows refer to the PCR primers contained in this product to confirm positive clones After transcription a stem loop stem shRNA molecule is produced This molecule is processed by the DICER enzyme to generate a double stranded siRNA effector 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual D List of Components Each pSIH H1 Vector Kit provides enough plasmid for 20 ligation reactions e pSIH1 H1 Puro shRNA Expressi
28. nt Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other t
29. on Lentivector Cat SI500A 1 50 ul pSIH1 H1 Puro vector non linearized 0 2 ug ul 25 ul Luciferase Control shRNA Template Oligonucleotide Mix 20 uM each 25 ul ForwardH PCR Primer 5 AATGTCTTTGGATTTGGGAATCTTAT 3 7 10 uM 25 pl ReverseH PCR Primer 5 TGGTCTAACCAGAGAGACCCAGTA 3 10 uM e pSIH1 H1 copGFP shRNA Expression Lentivector Cat SI501A 1 50 ul pSIH1 H1 copGFP vector non linearized 0 2 ug pl 25 ul Luciferase Control shRNA Template Oligonucleotide Mix 20 uM each 25 wl ForwardH PCR Primer 5 AATGTCTTTGGATTTGGGAATCTTAT 3 10 uM 25 ul ReverseH PCR Primer 5 TGGTCTAACCAGAGAGACCCAGTA 3 10 uM e pSIH1 H1 H2Kk shRNA Expression Lentivector Cat SI502A 1 50 ul pSIH1 H1 H2Kk vector non linearized 0 2 ug l 25 ul Luciferase Control shRNA Template Oligonucleotide Mix 20 uM each 25 ul ForwardH PCR Primer 5 AATGTCTTTGGATTTGGGAATCTTAT 3 10 uM 25 ul ReverseH PCR Primer 5 TGGTCTAACCAGAGAGACCCAGTA 3 10 uM The kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 12 months from the date received E Additional Required Materials For Phosphorylation and Annealing of shRNA Template Oligonucleotides e 74 Polynucleotide Kinase and 10X reaction buffer Recommended New England BioLabs T4 Polynucleotide Kinase 10 U l Cat M0201S e rATP Recommended GE Amersham Cat 27 2056 01 For Linearizing shRNA Expression Vector e Bam
30. protocols 2003 Humana Press Heiser W C ed Methods in Molecular Biology Volume 246 Gene delivery to mammalian cells Volume 2 Viral Gene transfer techniques 2004 Humana Press Machida C A ed Viral vectors for gene therapy Methods and Protocols 2003 Humana Press Naldini L Lentiviruses as gene transfer agents for delivery to non dividing cells Curr Opin Biotechnol 1998 Oct 9 5 457 63 Page 18 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 V Appendix A Maps and Features for pSIH H1 Vectors RSV 5 LTR AmpR a RRE pSIH1 H1 Puro shRNA Vector cPPT pUC ORI 7 048 bp CMV EcoRI SV40 ORI We BamHI Puro SV40 Poly A f 3 ALTR H WPRE Feature Location Function RSV 5 LTR 7 414 Hybrid RSV promoter R U5 long terminal repeat required for viral packaging and transcription gags 567 919 Packaging signal RRE 1076 1309 Rev response element binds gag and involved in packaging of viral transcripts Central polypurine tract includes DNA Flap cPPT 1798 1916 region involved in nuclear translocation and integration of transduced viral genome CMV promoter 1922 2271 Human cytomegalovirus CMV constitutive promoter for transcription of puromycin Bir 2279 2878 Puromycin resistant marker for selection of the transfected transduced cells Woodchuck hepatitis virus posttranscriptional WPRE 2885 3425 regulatory element enhances
31. rial e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory are to be placed in a durable leakproof container and closed for transport from the laboratory Page 8 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 A Protocol shRNA Template Oligonucleotide Design and Synthesis Typically 4 or 5 target sequences in the gene of interest need to be selected and tested to identify functional siRNAs with at least 70 silencing efficiency of target MRNA Although there is no standard rule for selecting the target mRNA binding sites for siRNA sequences we have found the following criteria useful e 19 29 nt in length usually longer oligos 25 27 nt are more robust and give better silencing efficiencies although 19 nt oligos could be also used e Unique sequence with less than 70 Homology with other mRNA sequences in a RefSeq database Especially avoid homology to other non target MRNA sequences in central portion of siRNA flanking sequences usually tolerate mismatches especially G U and A C without reduction in silencing efficiency e 40 55 GC content e Nomore than 4 consecutive A s or T s e Nomore than 5 consecutive G s or C s e No thermodynamically stable secondary structure lt 0 Kcal mol e A
32. s into pSIH H1 Vector 1 Linearize the pSIH vector with EcoRI BamHI a Setupa50 ul restriction digest as follows 33 8 Deionized water ul 5 ul 10x NEB 3 buffer 0 2 ul 100x BSA 0 5 ul BamHI 20 U uL NEB 0 5 ul EcoRI 20 U uL NEB 10 ul pSIH vector 0 2 ug L 50 ul Total volume b Digest overnight at 37 C c Purify linearized plasmid DNA using Qiagen Qiaquick PCR purification kit Elute purified DNA in 30 uL EB buffer 2 Phosphorylate and Anneal the shRNA Template Oligonucleotides Note This protocol was developed for regular non phosphorylated oligos If your oligonucleotides are already phosphorylated dilute them to 10 uM in 1X T4 polynucleotide kinase buffer heat at 95 C for 2 min and anneal as in steps 1 d 1 e Page 10 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 a Dissolve the shRNA template oligonucleotides in an appropriate amount of deionized water to a final concentration of 20 uM b Setup 20 ul phosphorylation annealing reactions for each experimental shRNA template and Luciferase Control Template Mix as follows ul Top Strand shRNA template oligo 20 uM ul Bottom Strand shRNA template oligo 20 uM ul 10X T4 Polynucleotide Kinase Buffer ul 10 mM ATP ul Deionized water ul T4 Polynucleotide Kinase 10 U nl 20 ul Total volume NONNDNDN For the insert minus control use 2 ul deionized water in place of the top
33. se loop and 26 base antisense sequences targets the wild type Firefly Luciferase gene When run in parallel with your experimental annealed double stranded shRNA oligonucleotides Luciferase Control shRNA Template Oligonucleotide Mix serves as positive control to check if your phosphorylation and ligation reactions and transformation procedure work well Using the protocol described in II B ligation with this control insert mix should provide at least 5 10 times more colonies than ligation of the vector without an insert The control pSIH construct with the Luciferase shRNA template can also be used to monitor the efficiency of target Luciferase mRNA silencing A cell line with a constant expression level of Luciferase can easily be generated The level of Luciferase expression should be reduced at least 5 fold after transfection or transduction of the pSIH H1 Luciferase shRNA construct in the Luciferase reporter cell line B Troubleshooting Specific Results 1 Getting Few or No Clones Check design of the shRNA template Check the sequence of the shRNA oligonucleotides to ensure that after sense anti sense annealing the ends present the 5 GATC and 5 TTAA overhangs for proper annealing with the restricted ends of linear pSIH H1 Vector Also confirm that the top and bottom strand sequences are complementary to each other Check annealing To ensure a high percentage 80 of double stranded DNA after annealing check the concentration
34. then 68 C 1 min 25 cycles 68 C 2 min 1 cycle Take 5 ul of PCR product from step d and run it on a 3 agarose EtBr gel in 1X TAE buffer Clones without an insert will yield a product of 105 bp The expected size of amplified clones with a shRNA template insert should be about 150 170 bp depending on expected length of the shRNA template insert see Figure 2 for details Some clones may not yield a product These are results of recombination during propagation in E coli Confirm identity of shRNA template inserts by sequence analysis of positive PCR products using the ForwardH PCR primer D Purify shRNA Lentivector Construct a Take 15 20 ul of each positive bacteria culture from Step C 1 c inoculate each clone in 25 ml of LB broth media with 50 ug ml ampicillin and grow overnight at 37 C with shaking Purify shRNA lentivector construct plasmid DNA in Midi scale using an Endotoxin free plasmid purification kit see section I E Additional Required Materials 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual E Transfection and Analysis of Silencing Efficiency If you are planning to use SBI s pSIH H1 shRNA constructs for viral delivery we recommend first to screen the shRNA constructs generated in section D to determine their effectiveness at knocking down expression of the target gene To rapidly screen the shRNA lentivector constructs in plasmid form you can deliver and
35. unctional analysis studies Once you identify a functional shRNA construct you can package this construct into pseudoviral particles and efficiently transduce these shRNA constructs into target cells of your choice For this purpose you will need to purchase the pPACKH1 Lentivector Packaging Kit SBI Cat LV500A 1 and 293TN Producer Cell Line SBI Cat LV900A 1 The pPACKH1 User Manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells includes the procedural information for packaging the shRNA lentivector constructs This user manual is also available on the SBI web site www systembio com Although you can create stable transfectants with the pSIH constructs using standard transfection and selection protocols transduction of the lentiviral pSIH shRNA constructs using packaged pseudoviral particles is the most efficient way to express siRNA in wide range of cells including dividing non dividing and hard to transfect varieties Page 14 ver 4 080514 www systembio com pSIH H1 shRNA Cloning and Expression Lentivectors Cat s SI500A 1 SI502A 1 lll Troubleshooting A Using the Positive Control The Luciferase Control shRNA Template Oligonucleotide Mix is a mixture of complementary DNA strands with sticky ends 5 GATC and 5 TTAA to match with the BamHI and EcoRI ends on the linearized pSIH H1 Vector The 64 base hairpin shRNA template sequence consisting of 26 base sense 12 ba

Download Pdf Manuals

image

Related Search

Related Contents

Eagle Tree Systems Seagull Glide User's Manual    Packet Tracer – Troubleshooting EtherChannel  SERVICE MANUAL  7 - Firmware Center  User Manual (PDF file) - NPS Department of Oceanography  Lenco CS-450 CD car media receiver  IVEGAN PASTA EQUINOS  User`s Manual for type ACS 400 frequency  Achat de véhicules d`occasion en Allemagne Le trajet de retour  

Copyright © All rights reserved.
Failed to retrieve file