pUni/V5-His A, B, and C - Thermo Fisher Scientific
Contents
1. 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 5 887 903 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Liu Q Li M Z Leibham D Cortez D and Elledge S 1998 The Univector Plasmid Fusion System a Method for Rapid construction of Recombinant DNA Without Restriction Enzymes Current Biology 8 1300 1309 Liu Q Li M Z Liu D and Elledge S J 1999 Rapid Construction of Recombinant DNA by the Univector Plasmid Fusion System Methods in Enzymology in press Metcalf W W Jiang W and Wanner B L 1994 Use of the rep Technique for Allele Replacement to Construct New Escherichia coli Hosts for Maintenance of R6K Gamma Origin Plasmids at Different Copy Numbers Gene 36 1 7 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Sternberg N Hamilton D Austin S Yarmolinsky M and Hoess R 1981 Site Specific Recombination and its Role in the Life Cycle of Pl CSH Symp Quant Biol 45 297 309 91999 2006 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 19 invitrogen Corporate Headquarters Invitrogen Corpo2. No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose References Abremski K and Hoess R 1984 Bacteriophage P1 Site Specific Recombination Purification and Properties of the Cre Recombinase Protein J Biol Chem 259 1509 1514 Abremski K Hoess R and Sternberg N 1983 Studies on the Properties of P1 Site Specific Recombination Evidence for Topologically Unlinked Products Following Recombination Cell 32 1301 1311 Abremski K E and Hoess R H 19
3. TM adapt proprietary or specialized vectors for use with the Echo Cloning System The loxP or loxH recombination sites can be introduced into the expression vector of choice using synthetic oligonucleotides The sequences of the loxP and loxH sites are shown below The loxP site consists of a 34 bp sequence containing a 13 bp inverted repeat separated by an 8 bp spacer region Hoess et al 1982 The inverted repeat underlined may form a stem and loop structure that may reduce expression of the gene of interest in some cases A variation of the loxP site loxH was created to eliminate the formation of a stem and loop structure and potentially improve transcription Liu et al 1998 Mutated bases are shown in boldface and underlined e loxP ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTAT e loxH ATT ACC TCA TAT AGC ATA CAT TAT ACG AAG TTA T Note Data from our experiments do not show any difference in expression levels in vectors containing the loxP or the loxH site Consider the following points prior to designing your oligonucleotides e Vectors may be constructed using either the loxP or the loxH site e If any vector to be Echo adapted contains an N terminal fusion then the reading frame noted above should be maintained through the lox site You can Echo adapt your vector at any restriction site that is suitable for your application You may wish to remove the entire multiple cloning site and N or C ter
4. www invitrogen com or from Technical Service see page 18 For a map and a description of the features of pUni V5 His A refer to pages 16 17 pUni Forward priming site 1 351 GAGCTTAGTA CGTACTATCA ACAGGTTGAA CTGCTGATCA ACAGATCCTC Kpn l loxP site 401 TACGCGGCCG CGGTACC ATA ACT TCG TAT AGC ATA CAT TAT ACG EcoR RBS Xhoi RBS Age Bol 445 AAG TTA TCG GAGGAAT TGGCTCGAGG AATTCACCGG TGCCGTGTGG BamH Apa l Aatl Stul Pvu Sac 491 GCGGATCCGG GCCCGACGT C AGGCCTCGAT CGGAG CTC GGT AAG CCT Gly Lys Pro V5 epitope NN 538 ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT AGC CAT CAT Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Ser His His 6xHis tag pUni Reverse priming site ji 1 577 CAC CAT CAC CAT TGA AGCTCGCTA TCAGCCTCGA CTGTGCCTTC His His His His 621 TAGTTGCCAG CCATCTGTTG TTTGCCCCTC CCCCGTGCCT Continued on next page Cloning into pUni V5 His A B and C Continued Multiple Cloning Below is the multiple cloning site for pUni V5 His B Restriction sites are labeled to Site of pUni V5 indicate the actual cleavage site The boxed nucleotides indicate the variable region His B Sequencing and functional testing have confirmed the multiple cloning site The complete sequence of pUni V 5 His B is available for downloading from our Web site www invitrogen com or from Technical Service see page 18 For a map and a description of the features of pUni V5 His B refer to pages 1
5. B and C If you wish to include the C terminal tag on your protein of interest you must clone in frame with the C terminal peptide pUni V5 His is supplied in three reading frames Using the diagrams of the multiple cloning site on pages 7 9 determine which version will allow you to clone your gene in frame with the C terminal peptide Ligate your gene of interest into the desired version A B or C of pUni V5 His Transform into PIR1 or PIR2 cells Select transformants on LB plates containing 50 ug ml kanamycin Un BR Ww dy Pick transformants and analyze for the presence of your insert Note We recommend that you sequence your construct to ensure that your gene is in frame with the loxP site and the C terminal peptide if desired Isolate plasmid DNA using the method of choice Proceed to the recombination reaction with the acceptor vector of choice see the appropriate acceptor vector manual Methods Cloning into pUni V5 His A B and C Introduction General Molecular Biology Techniques E coli Strain Maintenance of Plasmids Eukaryotic Expression The Echo Cloning System allows you to express your gene of interest in prokaryotic as well as eukaryotic hosts Careful consideration of the cloning strategy will save you time downstream Diagrams are provided on pages 7 9 to help you ligate your gene of interest into pUni V5 His General considerations for cloning and transfo
6. DNA for automated or manual sequencing we recommend the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 3 Analyze the plasmids by restriction analysis to confirm the presence and correct orientation of the insert Use a restriction enzyme or a combination of enzymes that cut once in the vector and once in the insert Very Few If you obtain very few or no transformants with PIRI cells it may be that your insert is Transformants toxic to E coli An alternative host PIR2 is available that contains the wild type pir gene Expression of the pir gene produces wild type x protein that will maintain copy number at about 15 copies per cell instead of 250 copies Transformation pUC19 plasmid is included to check the transformation efficiency of the One Shot PIRI Control or PIR2 competent cells 1 Prepare LB plates containing 100 ug ml ampicillin 2 Transform with 10 pg of pUC19 per 50 ul of cells using the protocol on page 10 3 Plate 10 ul of the transformation mix plus 20 ul SOC Sequencing We recommend that you sequence your construct to confirm that your gene is in frame with the C terminal peptide if desired In addition if you clone in frame with the loxP site you will need to sequence to confirm the frame The pUni Forward and Reverse Sequencing Primers are included to help you sequence your insert Refer to the diagrams on pages 7 9 for sequence surrounding the multiple cloning site For the complete sequen
7. element see the next page For the complete sequence of the vector you may download it from our Web site www invitrogen com or call Technical Service page 18 Features of pUni V5 His A 2290 nucleotides R6K gamma origin bases 6 397 Uni1 Forward priming site bases 365 383 loxP site bases 418 451 Multiple cloning site bases 464 528 V5 epitope bases 529 570 6xHis tag bases 571 588 Uni1 Reverse priming site bases 592 613 BGH polyadenylation sequence bases 611 819 T7 transcription termination region bases 834 962 Kanamycin resistance gene bases 1141 1935 C Kan promoter bases 1936 2073 C C complementary strand A version only B version only C version only Features of pUni V5 His A B and C Vector Features The table below describes the features of pUni V5 His A B and C vector Feature Description loxP Site specific recombination site for Cre recombinase Hoess et al 1982 pUni Forward priming site Permits sequencing of your insert from the 5 end Multiple cloning site Allows insertion of your gene and facilitates cloning in frame with C terminal epitope tag V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Permits detection of the recombinant protein after expression by western blot or immunoprecipitation 6xHis tag Allows purification of the recombinant protein on metal chelating resin such as TM Probo
8. our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 813 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech_service invitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product
9. where the G or A at position 3 and the G at position 4 shown in bold are the most critical for function The ATG initiation codon is shown underlined Continued on next page Cloning into pUni V5 His A B and C Continued Cloning Considerations Secretion Signals Ligation Refer to the table below for cloning considerations and to the diagrams of the multiple cloning sites on pages 7 9 to assist you If you want to Then recombine into acceptor vectors containing N terminal tags clone your gene in frame with the oxP sequence If you are not using acceptor vectors with N terminal tags then it is not necessary to clone in frame with the loxP sequence express your gene of interest in prokaryotes you may use any one of the ribosome binding sites RBS in the vector if you are cloning your gene such that the initiation codon is within 7 10 base pairs downstream of the RBS Include a RBS between the loxP site and the start codon if you are using Bgl I or any other restriction site after Bgl I include the C terminal tag with the V5 epitope and 6xHis tag clone your gene in frame with the C terminal tag Be sure that your gene does not contain a stop codon not include the C terminal tag include the stop codon for your gene of interest or include one in your 3 primer secrete your recombinant protein using mammalian insect or yeast vectors include the appropriat
10. 6 17 pUni Forward priming site 1 351 GAGCTTAGTA CGTACTATCA ACAGGTTGAA CTGCTGATCA ACAGATCCTC Kpn loxP site 401 TACGCGGCCG CGGTACC ATA ACT TCG TAT AGC ATA CAT TAT ACG EcoR RBS Xho RBS Age Bgl ERN all Tad LH d I 445 AAG TTA TCG GAGGAAT TGGCTCGAGG AATTCACCGG TGCCGTGTGG EH Apa Aari id Sall Sac 491 GCGGATCCGG GCCCGACGTC AGGCCTIGTCG ACGAGCTCCC AG CTC V5 epitope l 536 GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT AGC Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Ser 6xHis tag pUni Reverse priming site 1 f 1 578 CAT CAT CAC CAT CAC CAT TGA AG CTCGCTATCA GCCTCGACTG His His His His His His 621 TGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCCC Continued on next page Cloning into pUni V5 His A B and C Continued Multiple Cloning Below is the multiple cloning site for pUni V5 His C Restriction sites are labeled to Site of pUni V5 indicate the actual cleavage site The boxed nucleotides indicate the variable region His C Sequencing and functional testing have confirmed the multiple cloning site The complete sequence of pUni V5 His C is available for downloading from our Web site www invitrogen com or from Technical Service see page 18 For a map and a description of the features of pUni V5 His C refer to pages 16 17 pUni Forward priming site 1 351 GAGCTTAGTA CGTACTATCA ACAGGTTGAA CTGCTGATCA ACAGATCCTC loxP site Kpn 401 TACGCGGCC
11. 92 Evidence for a Second Conserved Arginine Residue in the Integrase Family of Recombination Proteins Protein Eng 5 87 91 Argos P Landy A Abremski K Egan J B Haggard Ljungquist E Hoess R H Kahn M L Kalionis B Narayana S V L Pierson IIL L S Sternberg N and Leong J M 1986 The Integrase Family of Site Specific Recombinases Regional Similarities and Global Diversity EMBO J 5 433 440 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brake A J Merryweather J P Coit D G Heberlein U A Masiarz G R Mullenbach G T Urdea M S Valenzuela P and Barr P J 1984 a Factor Directed Synthesis and Secretion of Mature Foreign Proteins in Saccharomyces cerevisiae Proc Natl Acad Sci USA 81 4642 4646 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Hoess R H Ziese M and Sternberg N 1982 P1 Site Specific Recombination Nucleotide Sequence of the Recombining Sites Proc Natl Acad Sci USA 79 3398 3402 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M
12. Echo adapt your own vector see pages 13 14 Once you complete ligation of your gene of interest into pUni V5 His A B or C transform the ligation reaction into PIR1 or PIR2 cells The PIR2 strain expresses the product of the wild type pir gene that is required for replication and maintenance of plasmids containing the R6Ky origin In PIR2 plasmids are maintained at approximately 15 copies per cell The PIRI strain contains the mutant pir 116 allele which increases the copy number to approximately 250 copies per cell Both strains are also endA to increase the yield of plasmid during isolation and recA to prevent recombination and rearrangements see page iv for genotypes The table below summarizes the application of these strains Strain Application PIRI General cloning and maintenance of donor vector constructs PIR2 For low copy maintenance of donor vector constructs containing toxic genes or libraries Continued on next page Overview Continued Important Experimental Outline It is absolutely essential to transform your donor vector construct into a strain expressing the product of the pir gene The construct will NOT be maintained or replicated if transformed into a different strain The table below outlines the basic steps needed to clone your gene of interest into pUni V5 His A B or C Step Action 1 Determine a strategy to clone your gene of interest into pUni V5 His A
13. G CGGTACC ATA ACT TCG TAT AGC ATA CAT TAT ACG EcoR I RBS Xho RBS Age Bgl rn 9 445 AAG TTA TCG GAGGAAT TGGCTCGAGG AATTCACCGG TGCCGTGTGG gc Apal Aat ll sm Nru Sac Fr 491 GCGGATCCGG GCCCGACGTC AGGCCTTCGC GAGAGCTCAG CTC GGT AAG Gly Lys V5 epitope 940 ccv ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT AGC CAT CAT Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Ser His His 6xHis tag pUni Reverse priming site I l 582 CAC CAT CAC CAT TGA AGCT CGCTATCAGC CTCGACTGTG CCTTCTAGTT His His His His 631 GCCAGCCATC TGTTGTTTGC CCCTCCCCCG Transformation with One Shot E coli Introduction Before Starting Note Preparing for Transformation One Shot Transformation Reaction After ligating the gene of interest into pUni V5 His A B or C transform the recombinant vector into One Shot PIR1 or PIR2 E coli In addition to general microbiological supplies i e plates spreaders you will need the following reagents and equipment e 42 C water bath for heat shocking chemically competent cells e LB plates containing 50 ug ml kanamycin two per transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Individual recombinant plasmids need to be analyzed by restriction analysis or sequencing for the presence and orientation of insert Sequencing primers included in the kit can be used to sequence across an insert in the mu
14. Invitrogen pUni V5 His A B and C Echo Cloning System Construction of a donor vector for recombination with an Echo adapted acceptor expression vector Catalog no ET003 XX Version E 11 November 2010 25 0373 ii Table of Contents Table of Contents 4 5 eto eir t o ete ete isti e e det e D Ed ta died caste ie ieu e Lett RET iii Kat Contents and Storage 3 5 5 ono obo SU cette be en obiit o er Ub ied reta i asad iv Product OESTE U Il et vi ACcessory PrOdUC S 5 oer re Ee o e EA edere UE EE Eee te euer e Re dre ena BO RR eR vii Purchaser Notification eec reete e ee eO er Cero re eo eee a te E netten viii MATEO GUCTION psc 1 OVERVIEW cote eR UR ea RR DERE UE 1 Meth OOS m ainas 5 Clomnganto pUnm V5 Ehs A B and C o Eo rn 5 Transformation with One Shot E coli tette tette tentent tette ente 10 Designing Your Own Echo Adapted Expression Vector cscssssssesssssessessseesssssessesssessessssssesssesuessessseeseeseesseess 13 APP HK quc T 15 RECIPES RR dien centi tete tonto eti eei bote cete tendi tem odd eoe eee Ja 15 Map of pUni V 5 His A Brand Vector atus aa et RO EE RB CR Rp 16 Features of pUni V5 His A B and C Vector sss eene eren enne nnne trennen trennen 17 Technical Servicers i re hero aon ete EB eu rn oi e rie Eq re 18 INO IS NUDO II E EE 19 Kit Contents an
15. atalyze recombination between two loxH sites A nucleophilic hydroxylated tyrosine initiates the DNA cleavage event by attack on a specific phosphodiester bond followed by the covalent attachment of the recombinase to the target sequence through a phosphoamino acid bond Abremski and Hoess 1992 Argos et al 1986 The reaction does not require any host factors or ATP but does require Mg or spermidine for activity Abremski er al 1983 In vitro recombination between two supercoiled substrates each containing a loxP or loxH site results in a supercoiled dimer The extent of the reaction is 10 20 under optimal conditions Abremski and Hoess 1984 Abremski et al 1983 Various Echo adapted acceptor vectors are available and are provided with their own manuals Briefly each vector contains the following features e A loxP ora loxH site for plasmid fusion e A specific promoter residing upstream of the loxP or loxH site for expression in the appropriate host e A resistance marker for selection in E coli and or for creation of stable cell lines in eukaryotes e The pUC origin for high copy replication and maintenance in most E coli strains Echo adapted acceptor vectors may also contain sequences for propagation selection and maintenance for organisms other than E coli For more information on available acceptor vectors visit our Web site www invitrogen com or call Technical Service TM see page 18 If you wish to
16. ce of each vector see our Web site www invitrogen com or contact Technical Service page 18 Long Term Once you have identified the correct clone prepare a glycerol stock for long term Storage storage We also recommend that you store a stock of your DNA at 20 C or 80 C l Streak the original colony on LB plates containing 50 ug ml kanamycin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 ug ml kanamycin 3 Grow at 37 C with shaking until the culture reaches stationary phase OD 1 2 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Storeat 80 C Continued on next page 11 Transformation with One Shot E coli Continued Recombination You are now ready to proceed to the recombination reaction You will need 100 ng with Acceptor each of your donor vector and the Echo adapted acceptor vector for the recombination Vector reaction Refer to the appropriate acceptor manual for procedures Plasmid To obtain clean plasmid for recombination and transformation we recommend using the Preparation PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 or other resin based DNA purification systems Designing Your Own Echo Adapted Expression Vector Introduction loxP or loxH Considerations Construction of Echo Adapted Vectors In addition to the already available Echo adapted expression vectors you may want to
17. cin and selection in E coli For a map and more information on each feature see pages 16 17 The Echo system utilizes the cre lox site specific recombination system of bacteriophage P1 Abremski et al 1983 Sternberg et al 1981 The product of the cre gene is a site specific recombinase that catalyzes recombination between two 34 bp loxP sites to resolve Pl dimers generated by replication of circular lysogens Continued on next page Overview Continued Plasmid Fusion loxP or loxH The donor vector and the Echo adapted acceptor vector each contain a single lox site The donor vector contains a loxP site while the acceptor vector 2 5 to 5 8 kb contains either a loxP or loxH site for more information on loxH see below Acceptor vectors contain the appropriate transcription regulatory sequences that will control expression of the gene of interest in the desired host system These acceptor vectors may also carry translation initiation and additional coding sequences for generation of fusion proteins The unique oxP or loxH site is located downstream of these sequences By mixing the donor vector containing the gene of interest with the desired acceptor vector in the presence of Cre recombinase a plasmid fusion is created that expresses the gene of interest in the appropriate host The size of the fusion plasmid can range from 4 8 to 8 1 kb without the gene of interest pUni 2 3 kb gene e o Reco
18. d Storage Types of Kits Available Shipping and Storage Contents One Shot Reagents lv pUni V5 His A B and C Echo Cloning System Donor Vector Module is available in two formats Refer to the table below for the kit you ordered Kit Catalog no Echo Cloning System Donor Vector Module with One Shot PIR1 ET003 10 Chemically Competent E coli Echo Cloning System Donor Vector Module with One Shot PIR2 ET003 11 Chemically Competent E coli The Echo Cloning System Donor Vector module is shipped at room temperature Each kit contains a vector kit Box 1 and One Shot PIRI or PIR2 Chemically Competent E coli Box 2 Reagents Storage pUni V5 His A B and C vector kit Room temperature One Shot PIRI or PIR2 Chemically Competent E coli 80 C The following items are supplied with the Echo Cloning System Donor Vector kit Item Amount pUni V5 His A B and C 20 ug each lyophilized in TE pH 8 0 pUni Forward Sequencing Primer 2 ug lyophilized in TE pH 8 0 pUni Reverse Sequencing Primer 2 ug lyophilized in TE pH 8 0 The table below describes the items included in each One Shot Chemically Competent E coli Kit Store at 80 C Item Composition Amount SOC Medium 2 Tryptone 6ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCI 10 mM M
19. e secretion signal see discussion below or recombine with an acceptor vector containing a secretion signal sequence If you are trying to express a protein that is normally secreted from a eukaryote include the native secretion signal sequence If you are trying to express and secrete a protein that is not normally secreted you can recombine the donor vector with an acceptor vector containing a secretion signal sequence that is appropriate for the host Note You should not use an acceptor vector that contains an N terminal tag i e pcDNA4 HisMax E for recombination and subsequent expression If you are trying to express and secrete a protein that is not normally secreted in yeast include the a factor signal sequence Brake et al 1984 Once you have determined a cloning strategy digest the appropriate version of pUni V5 His A B and C with the selected restriction enzyme Ligate your gene of interest into pUni V5 His A B or C using standard molecular biology techniques Continued on next page Cloning into pUni V5 His A B and C Continued Multiple Cloning Below is the multiple cloning site for pUni V5 His A Restriction sites are labeled to Site of pUni V5 indicate the actual cleavage site The boxed nucleotides indicate the variable region His A Sequencing and functional testing have confirmed the multiple cloning site The complete sequence of pUni V5 His A is available for downloading from our Web site
20. gCl 10 mM MgSO 20 mM glucose PIR1 or PIR2 Chemically Competent E coli 11x50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 0 5 mM 50 ul EDTA pH 8 0 Continued on next page Kit Contents and Storage Continued Sequence of The table below lists the sequence and pmoles supplied of the sequencing primers Primers included in this kit Primer Sequence pmoles Supplied pUni Forward Sequencing Primer 5 CTATCAACAGGTTGAACTG 3 345 pUni Reverse Sequencing Primer 5 CAGTCGAGGCTGATAGCGAGCT 3 295 Genotype of E coli Strains Pir Gene PIR1 You may use this strain for cloning and maintenance of your donor vector construct This strain contains a mutant allele of the pir gene which maintains the donor vector construct at 250 copies per cell F Alac169 rpoS Am robAl creC510 hsdR514 endA recAl uidA AMlu I pir 116 PIR2 This strain is recommended for maintaining constructs that express toxic genes or for libraries Use this strain for cloning and maintenance of your donor vector construct This strain contains the wild type pir gene for maintenance of the donor vector construct at 15 copies per cell F Alac169 rpoS Am robAl creC510 hsdR514 endA recAl uidA AMlu I pir PIR1 and PIR2 strains are derived from K 12 strain The pir gene encodes the replication protein 7 that is required to replicate and maintain plasmids containing the R6Ky origin such as pUni V5 His A B and C Prod
21. lls are plated on LB plates containing 100 ug ml ampicillin 25 ug ml streptomycin 50 ug ml kanamycin 15 ug ml tetracycline or 15 ug ml chloramphenicol to verify the absence of antibiotic resistant contamination To verify the absence of phage contamination 0 5 1 ml of competent cells are added to LB top agar and poured onto LB plates After overnight incubation no plaques should be detected Accessory Products Additional Products Echo Adapted Acceptor Vectors The table below lists additional products that may be useful for creating and characterizing recombinant fusion plasmids Product Amount Catalog no One Shot PIR1 Chemically Competent E coli 11x50 ul C1010 10 One Shot PIR2 Chemically Competent E coli 11x50 ul C1111 10 Anti V5 Antibody 50 ul R960 25 Anti V5 HRP Antibody 50 ul R961 25 Anti His C term Antibody 50 ul R930 25 Anti His C term HRP Antibody 50 ul R931 25 Quantity supplied is sufficient for 25 western blots Invitrogen has a variety of Echo adapted acceptor vectors for expression of your gene of interest in bacterial yeast insect and mammalian host systems These include acceptor vectors for inducible or constitutive expression We are constantly adding to our collection of Echo adapted acceptor vectors For more information visit our Web site www invitrogen com or contact Technical Service see page 18 vii Purchaser Notification Li
22. ltiple cloning site to confirm orientation and reading frame For each transformation you will need one vial of competent E coli and two selective plates e Equilibrate a water bath to 42 C e Warm the vial of SOC medium to room temperature e Warm selective plates at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot E coli cells for each transformation 1 Add2 ul of the ligation mix into a vial of PIRI or PIR2 One Shot cells and mix gently by stirring with a pipette tip Do not mix by pipetting up and down Incubate on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer to ice and add 250 ul of room temperature SOC medium Cap the tube tightly and shake 225 rpm the tube horizontally at 37 C for 1 hour N oU d OO Spread 10 50 ul from each transformation onto LB plates containing 50 ug ml kanamycin plates Note We recommend that you plate two volumes to ensure that one plate will have well spaced colonies For plating small volumes add 20 ul of SOC to allow even spreading Incubate overnight at 37 C Pick 10 colonies for analysis see Analysis of Positive Clones next page Continued on next page Transformation with One Shot E coli Continued Analysis of 1 Take the 10 colonies and culture them overnight in LB medium containing 50 ug ml Positive Clones kanamycin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid
23. mbinant Plasmid 4 8 kb gene to 8 1 kb gene pAcceptor 2 5 to 5 8 kb lox loxP or loxH depending on acceptor vector The sequence of the loxP site is shown below It consists of a 34 bp sequence containing a 13 bp inverted repeat separated by an 8 bp spacer region Hoess et al 1982 The inverted repeat underlined may form a stem and loop structure that may reduce expression of the gene of interest in some cases A variation of the loxP site loxH was created to eliminate the formation of a stem and loop structure and potentially improve transcription Mutated bases are shown in boldface e loxP ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTA T e loxH ATT ACC TCA TAT AGC ATA CAT TAT ACG AAG TTA T Note Data from our experiments do not show any difference in expression levels from vectors having the loxP or the loxH site Continued on next page Overview Continued Cre Recombinase Acceptor Vectors Transformation A simple way to think of Cre recombinase MW z 35 kDa is that it is a combination between a restriction enzyme and ligase It binds to specific sequences loxP or loxH sites on the DNA brings together the target sites cleaves them and covalently attaches to the DNA Recombination occurs following two pairs of strand exchanges and ligation of the DNAs in a novel recombinant form Note Cre catalyzes recombination between two loxP sites or between a loxP and a loxH site it does not c
24. minal tags We recommend that you use two unique restriction sites to facilitate directional cloning To Echo adapt an existing supercoiled vector 1 Design and order oligonucleotides that contain either the loxP or loxH site and the appropriate restriction site overhangs for your vector Digest your vector with the appropriate restriction enzymes Anneal the oligonucleotides to create a double stranded fragment Ligate the annealed oligonucleotide into your vector Transform competent E coli and select transformants Qv Ux cde wm ID Isolate recombinant plasmid DNA and sequence to confirm the construction An example of Echo adaptation of a vector is shown on the next page Continued on next page 13 Designing Your Own Echo Adapted Expression Vector Continued Example 14 The example below illustrates how to Echo adapt a vector Sample Multiple Cloning Site Kpn I and Xba I represent the sites you wish to use to clone in the loxP site Digest the vector with Kpn I and Xba I Kpn Xba I GAG ACC GGI ACC GAA TTC GGA TCC GAA Tk TAG ATC CTC TGG CCA TGG CTT AAG CCT AGG CTT AAG ATCI TAG Design Your Oligonucleotides Design two oligonucleotides such that when they are annealed they create a loxP site with ends complimentary to the restriction site overhangs The loxP site is underlined G ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTA TT CA TGC TAT TGA AGC ATA TCG TAT GTA ATA TGC TTC AAT AAG ATC Create Ech
25. mited Use Label License No 22 Vectors and Clones encoding Histidine Hexamer Limited Use Label License No 119 Echo Cloning Products Limited Use Label License No 358 Re search Use Only viii This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany No license is conveyed to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The buyer cannot modify the recombination sequence s contained in this product for any purpose The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is con veyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial applications of any kind including without limitation quality control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional
26. nd In addition the 6xHis tag can also be used for detection of the recombinant protein using the Anti His C term antibody pUni Reverse priming site Permits sequencing of your insert from the 3 end Bovine growth hormone polyadenylation sequence Stabilizes mRNA in eukaryotic cells Goodwin and Rottman 1992 T7 transcription termination region Stabilizes mRNA in E coli Kanamycin resistance gene Allows selection of transformants in E coli R6Ky origin Permits replication and maintenance of plasmid in E coli strains containing the pir 15 copies of plasmid or pir 116 gene 250 copies of plasmid see page iv Metcalf et al 1994 In pUni V5 His A B and C the codon for the terminal threonine residue ACG was replaced with a codon for a serine residue AGC This does not affect subsequent detection using the Anti V5 antibodies Continued on next page 17 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAOs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on
27. o loxP Adapted Vector Anneal the two oligonucleotides after they are synthesized Ligate the annealed oligonucleotide to the digested vector GAG ACC GGT AC C TAG ATC CTC TGG C TAG G ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTA TT CA TGC TAT TGA AGC ATA TCG TAT GTA ATA TGC TTC AAT AAG ATC Echo Adapted Vector Kpn I Xba GAG ACC GGT AC C ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTA TTC TAG ATC CTC TGG CICA TGG TAT TGA AGC ATA TCG TAT GTA ATA TGC TTC AAT AAG ATC TAG Recipes LB Luria Bertani Medium and Plates Appendix Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic 50 ug ml kanamycin if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic 50 ug ml kanamycin and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 15 Map of pUni V5 His A B and C Vector Map The map below shows the features of pUni V5 His A B and C For a description of each
28. ration 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
29. rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Overview Introduction pUni V5 His A B and C Site Specific Recombination Introduction The Echo Cloning System is based on the univector plasmid fusion system UPS described by Elledge and coworkers which quickly and easily recombines a gene of interest into a series of recipient acceptor vectors Liu et al 1998 Liu et al 1999 The donor vector pUni V5 His A B and C is used for restriction enzyme mediated cloning of a gene of interest and subsequent recombination with an Echo adapted acceptor vector pUni V5 His A B and C is a set of donor vectors approximately 2 3 kb each containing the following features e loxP site placed adjacent to the 5 end of the multiple cloning site for site specific TM recombination with Echo adapted acceptor vectors e Multiple cloning site for insertion of the gene of interest e An optional C terminal tag encoding the V5 epitope for detection and a 6xHis tag for purification e Three reading frames to facilitate in frame cloning with the C terminal tag e Bacterial and eukaryotic transcription termination sequences for efficient processing in the host of choice e R6Ky origin for propagation of the plasmid in strains that express the essential replication protein m encoded by the pir gene e neo gene for resistance to kanamy
30. rmation are discussed below For help with DNA ligations E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning a Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 The E coli strains PIR1 and PIR2 contain the pir required for replication and maintenance of pUni V5 His A B and C The donor vector contains the R6Ky origin and requires the pir gene product for replication pUni V5 His A B and C contain the kanamycin resistance gene to allow selection of the plasmid using kanamycin We recommend using the following procedure to propagate and maintain pUni V5 His A B and C 1 Resuspend each vector in 20 ul sterile water to prepare a ug ul stock solution Store the stock solution at 20 C 2 Use the stock solution to transform a recA endA E coli strain containing the pir gene like PIRI or PIR2 3 Select transformants on LB plates containing 50 ug ml kanamycin 4 Prepare a glycerol stock from a transformant containing plasmid for long term storage see page 11 For eukaryotic expression some researchers include a Kozak consensus sequence Kozak 1987 Kozak 1991 Kozak 1990 Many proteins express well without a Kozak consensus sequence so inclusion of a Kozak consensus sequence is a matter of personal preference and experience An example of a Kozak consensus sequence is G A NNATGG
31. uct Qualification Introduction Restriction Digest Primers One Shot PIR1 and PIR2 Competent E coli vi Invitrogen qualifies the Echo Cloning System Donor Vector kit as described below Supercoiled pUni V5 His is qualified by restriction enzyme digestion Restriction digests must demonstrate the correct banding patterns when electrophoresed on an agarose gel Vector Restriction Enzyme Expected Results bp pUni V5 His A Pvu I inearizes 2290 BamH I linearizes 2290 Bgl II and Bgl I 1498 792 pUni V5 His B Sal I linearizes 2297 BamH I linearizes 2297 Bgl IL and Bgl I 1485 812 pUni V5 His C Nru I linearizes 2295 BamH I linearizes 2295 Bgl II and Bgl I 1483 812 Both primers have been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique To qualify PIR1 and PIR2 cells 1 50 ul of competent cells are transformed with 10 pg of supercoiled pUC19 plasmid Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be e PIRI gt 1 x 10 cfu ug DNA e PIR2 gt 1 x 10 cfu ug DNA Transformation efficiency is also confirmed with supercoiled pUni V5 His 10 pg Transformed cultures are plated on LB plates containing 50 ug ml kanamycin and the transformation efficiency calculated Untransformed ce
Download Pdf Manuals
Related Search