Manual - Gene Bridges
Contents
1. TRE 2A COMPANY GENE BRIDGES ____ Tachnical Protaco nn Cat No K002 Coun ter Selection BAC Modification Kit Advanced BAC Modification Kit 0 A M NENNE u a _ Om VE nn mn mn 0000 paa o ooo mr E nn z iii LAL ne H l ae I N Version 3 3 May 2014 CONTENTS 1 Counter Selection BAC Modification Kit u222222020000000020nnn0000nonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 3 2 Experimental QUe ne ne a 6 3 How Red ET Recombination Works u 2 222020000nn nann0nonnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn 8 4 Oligonucleotide Design for Red ET Recombination ccccssssseessesesseeeeeeeesseeeseeeesnenseoeees 10 5 Mediator Antibiotic Selection en 11 6 TIEechnical Prol Codl u ea 12 6 1 Generation of a rpsL neo PCR product flanked by homology arms us2222200222 e 12 6 2 Transformation with Red ET expression plasmid PRECET T eee 13 6 3 Inserting the rpsL neo cassette into a BAC 14 6 4 Replacing the rpsL neo cassette by a non selectable UNA 19 6 5 Verification of successfully modified BAC by PCR analysis 21 6 6 MaADS ANO seg entes snoot E A a ca 23 WOUDICSHMOOUING ts aa aaa a a a aeaa aE 26 7 1 Problems with the detection of Streptomycin sensitive clones ee ee e e ee ee 26 1 2 Problems with the Red ET recombination2. 22240022200020200 nenne nnnnnnnnnnnnnnnnnnnnnennnnneennenn 27 8 References and Patents nonren a a ae deen TT 30 8 1 FROTCT CIC CS nen 30 8 2 Pale 25 io eee sw ata Pate secrete ecole oa ER EINER EIER pastes nt erect eee 31 9 Purchaser Notification Warranty uu0000000 00000nnnnnn0nnnnnnnnnnnnnnnnnnnnnunnannnnnnnnnunnnnnnnnnnnnnnnnnnnnnnenn 32 10 Other Products Available from Gene Bridges 4222000000000nnnnnnnnnnn nen nnnn nn nnnnnn nenn nn 33 11 DNA Engineering Services Available from Gene Bridges 22222020200000000n22nnnnn000nonnnn 38 Please read The products listed in this manual are for research purposes only They are not designed for diagnostic or therapeutic use in humans animals or plants Success depends on following the protocols exactly as they are described Do read the trouble shooting guide before beginning your experiments Red ET Recombination is the intellectual property of Gene Bridges GmbH Safety Some chemical reagents used with this system are dangerous if handled carelessiy Take care when using chemical reagents such as isopropanol and ethidium bromide and electrical apparatus high voltage power supplies gel electrophoresis and electroporation apparatus Follow the manufacturers safety recommendations 2 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 1 Counter Selection BAC Modification Kit Introduction The completion of large DNA
3. Im Neuenheimer Feld 584 69120 Heidelberg Tel 49 0 6221 13 70 811 Fax 49 0 6221 13 70 829 contact genebridges com www genebridges com
4. Analyze several colonies by colony PCR e g pick a single colony and resuspend it in 30 ul of sterile water Boil the sample at 98 C for 5 minutes and take an aliquot of 2 ul of the suspension as template for your PCR reaction Two pairs of control primers are included in the kit tube 8 and 9 The primers bind to the pBeloBAC11 backbone and amplify a 1066 bp fragment from the unmodified control BAC a 1797 bp fragment after insertion of the rpsL neo cassette and a 476 bp fragment after replacement of the rpsL neo cassette by the BAC repair oligo see Figure 7 As a further control restriction digestion of mini prep DNA can be performed Figure 8 Mi23 4 5 6 7 8 9 10 11 M kb kb w 3 0 gt EE 3 0 1 6 1 6 1 0 lt 1 0 0 5 0 5 Figure 7 PCR results verifying the successful Red ET Recombination of the control BAC M 1 kb ladder from Gibco Lanes 7 and 2 unmodified control BAC resulting in a 1066 bp band Lanes 3 to 6 successfully modified BACs containing the inserted rosL neo cassette showing a 1797 bp band Lanes 7 to 11 BACs with introduced point mutation resulting in a 476 bp band 2 3 4 5 6 T 8 9 10 11 M wo Eu uw SG w MA Lad u kd a Ge kd oe E a a a 6 0 M 41 Figure 8 Restriction analysis of the original and the modified control BAC after Xhol digestion M 1 kb ladder from Gibco Lanes 1 and 2 unmodified BACs Lanes 4 to 6 successfully modified BACs with the inserted rosL neo c
5. Figure below Figure 11 Counter selection experiment with background smear On the left plate 100 ul of an arabinose induced sample were streaked on a LB plated conditioned with Cm 15 ug ml and Str 50ug ml The right plate shows the result of the uninduced control plate Arrows indicate str colonies 26 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 7 2 Problems with the Red ET recombination Problems with the recombination reaction can be caused by a number of different factors Please review the information below to troubleshoot your experiments We highly recommend performing a positive control experiment using the components provided in the kit For homologous recombination the two DNA molecules must share two regions of perfect sequence identity Several wrong nucleotides in the homology region can completely abolish recombination Since oligonucleotides are used to add the homology regions they have to be synthesized properly and be of excellent quality Take into account that long oligonucleotides especially if they are longer than 80 bp require additional purification steps such as HPLC Also note that the electronic sequences provided for BACs may not be 100 correct lf you are trying to target a repeated sequence in your BAC you may experience problems because the homology region at the end of the linear fragment can go to more than one site It is therefore best not to target repeat
6. from the tube to the chilled electroporation cuvette Electroporate at 1350 V 10uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using a 1 mm electroporation cuvette Other devices can be used but 1350 V and a 5 ms pulse are recommended Resuspend the electroporated cells in 1 ml LB medium without antibiotics and return them to the microfuge tube Incubate at 30 C for 70 min shaking at 1 000 rpm The Red ET expression plasmid pRedET will be lost at 37 C Using a small loop plate 100 ul cells on LB agar plates containing Tc 3 ug ml plus Cm 15 ug ml for the BAC Incubate the plates at 30 C overnight or for at least 15 h Protect the plates from light by wrapping them up because Tc is sensitive to light Make sure the cells stay at 30 C otherwise the Red ET plasmid will be lost 6 3 Inserting the rpsL neo cassette into a BAC In the next step prepare electro competent cells from the BAC hosts that contain the Red ET expression plasmid shortly after inducing the expression of the recombination proteins In advance prepare the linear DNA fragment the rosL neo counter selection cassette with homology arms that you will insert into your BAC Use tube 3 rpsL neo PCR product and tube 5 control BAC pRedET to perform a control experiment in parallel Day 3 1 14 To start overnight cultures pick one colony from the plate you obtained in 6 2 step 8 and inoculate one microfuge tube contain
7. replaced by non selectable DNA 4 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Contents of the kit 1 2 pRedET tc Red ET expression plasmid 20 ng ul 20 ul rosL neo_template DNA PCR template for generating a rpsL neomycin kanamycin counter selection selection cassette 10 ng ul 20 ul rosL neo PCR product rosL neomycin cassette flanked by homology arms at the 5 and 3 end for the control experiment 100 ng ul 10 ul BAC repair Oligonucleotide to generate a point mutation resulting in an additional Xhol restriction site 25uM 10ul control BAC pRedET tc Glycerol stock of E coli strain HS996 harboring the expression plasmid pRedET tc as well as a pBeloBAC11 cm derivate for the control experiment 500 ul 25 glycerol BAC rpsL neo pRedET tc Glycerol stock of E coli strain HS996 harboring the expression plasmid pRedET tc as well as the modified control BAC cm with the inserted rpsL neo cassette 500 ul 25 glycerol BAC repaired Glycerol stock of E coli strain HS996 harboring the modified pBeloBAC11 derivate cm after replacement of the counter selection cassette by the BAC repair oligonucleotide 500 ul 25 glycerol PCR primer oligo check up Amplification primer to confirm the correct recombination in the control experiment 10 uM 20 ul PCR primer oligo check down Amplification primer to confirm the correct recombination in the cont
8. sequencing projects including the Human Genome Project has generated an extraordinary amount of primary sequence data The next major challenge is to investigate the components that make up a genome and is often called functional genomics Escherichia coli vectors that can contain large inserts such as bacterial artificial chromosomes BACs offer several advantages for functional genomics They can carry sufficient DNA to encompass most eukaryotic genes including all cis acting regulatory elements as well as many eukaryotic gene clusters prokaryotic regulons and many complete viral genomes in a single molecule However conventional cloning methods rely on the use of restriction enzymes and in vitro purification steps which preclude engineering of large molecules Consequently the usefulness of such molecules has been limited until recently Red ET Recombination relies on homologous recombination in vivo in E coli and allows a wide range of modifications of DNA molecules of any size and at any chosen position Homologous recombination is the exchange of genetic material between two DNA molecules in a precise specific and accurate manner These qualities are optimal for engineering a DNA molecule regardless of its size Homologous recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Because the sequence of the homology regions can be chosen freely any position on a target molec
9. 5 U ul e An annealing temperature of 57 62 C is optimal e Thirty cycles 1 95 1 57 62 C 2 5 72 C 12 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 1 Check 3 ul PCR products on a gel to ensure the PCR was successful The size of the PCR product is for the rpsL neo cassette is 1320 bp plus homology arms 2 Precipitate using 5 ul 3 M NaAc pH 7 0 and 150 ul 100 ethanol Mix well and precipitate for 5 min at 80 C or 30 min at 20 C Spin down the DNA at maximal speed for 5 min 3 Carefully wash the pellet once with 500 ul 70 ethanol Be sure not to wash it away You should see an obvious pellet at the bottom or along the walls of your tube 4 Dry the pellet at 37 C using a heating block for 5 10 min or vacuum dry for 2 min Resuspend in 5 ul 10mM Tris HCl pH 8 0 0 2 0 5 ug ul As an alternative use one of the commercial available PCR purification kits 6 2 Transformation with Red ET expression plasmid pRedET Before starting with the experiment please streak out the glycerol stock of the BAC clone you obtained from the stock center on LB plates conditioned with Cm Day 1 1 Set up an overnight culture Pick one or two colonies and inoculate them in microfuge tubes containing 1 0 ml LB medium with appropriate antibiotics to select for your endogenous BAC Puncture a hole in the lid for air Incubate at 37 C overnight with shaking 2 For testing of the Streptomy
10. C check for tc no or the wrong type of arabinose was used for induction please make sure you use L arabinose some strains e g JM109 DHbdalpha are less efficient in Red ET Recombination than others DH10B HS996 GeneHogs or TOP10 are our preferred strains in very rare cases an elongation of the reaction time for the recombination from 70 min incubation of electroporation to up to four hours is necessary for successful recombination 4 Problems with and after the electroporation 28 cells are not competent enough to take up the linear DNA fragment Please make sure that the cells were kept on ice and that the water respectively 10 glycerol is sufficiently cold Linear DNA has been shown to be about 10 fold less active than DNA transformed in circular form Eppendorf Operation Manual Electroporator 2510 version 1 0 Make sure that the time constant is around 5 ms please make sure that there is no arching during the electroporation process please make sure that after electroporation the cells are plated on the appropriate concentration of antibiotics depending on the copy number of the plasmid or BAC see page 10 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Similar number of colonies on both plates the induced and the un induced one If you obtain a high number of colonies on both plates it indicates that there are still traces of the circular or supercoiled plasm
11. Cre Expression Plasmid 705 Cre cm resistance marker Cre Expression Plasmid 706 Cre tet resistance marker Enhanced Eukaryotic FLP Expression Plasmid pCAGGS FLPe 3 11 DNA Engineering Services Available from Gene Bridges Instead of performing your own DNA manipulations let the Gene Bridges DNA Engineering Service do the work for you We work for many commercial and research organisations across the world to provide DNA modifications in low or high copy plasmids cosmids BACs and the E coli chromosome The available DNA modifications are e Insertion of a selectable or non selectable marker cassette e Deletion of sequences of any size ranging from 1 bp up to more than 100 kb with or without leaving a selectable marker e Replacement of genes on the E coli chromosome e Point mutations e Fusions e Introduction of site specific targeting sites loxP FRT etc e Insertion of restriction enzyme recognition sites e Subcloning of DNA pieces up to 60 kb e Transferring DNA fragments into multiple destination vectors e BAC and cosmid stitching e Substitutions Contact our DNA Engineering Service by email to contact genebridges com or go to www genebridges com for details and prices 38 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 This page intentionally left blank Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 39 Gene Bridges GmbH Commercial Centre
12. GCC GCC GIG TIC 636 CCGG CIG TCA GCG CAG GGG CGC CCG GIT CTT TIT GTC AAG ACC GAC CIG TCC 687 GGT GCC CTG AAT GAA CTG CAG GAC GAG GCA GCG CGG CTA TCG TGG CTG GCC 738 ACG ACG GGC GTT CCT TGC GCA GCT GTG CTC GAC GTT GTC ACT GAA GCG GGA 789 AGG GAC TGG CTG CTA TIG GGC GAA GIG CCG GGG CAG GAT CTC CIG TCA TCT 840 CAC CTT GCT CCT GCC GAG AAA GTA TCC ATC ATG GCT GAT GCA ATG CGG CGG 891 CIG CAT ACG CTT GAT CCG GCT ACC TGC CCA TTC GAC CAC CAA GCG AAA CAT 942 CGC ATC GAG CGA GCA CGT ACT CGG ATG GAA GCC GGT CTT GTC GAT CAG GAT 993 GAT CIG GAC GAA GAG CAT CAG GGG CTC GUG CCA GCC GAA CIG TIC GCC AGG 1044 CTC AAG GCG CGC ATG CCC GAC GGO GAG GAT CTC GTC GIG ACC CAT GGC GAT 1095 GCC TGC IIG CCG AAT ATC ATG GIG GAA AAT GGO CGC TTT TCT GGA TTC ATC 1146 GAC TG GGC CoG CIG GET GIS GCs GAC CoC IAL CAG GAC ATA GCG TIGE GET 1197 ACC CGT GAT ATT GCT GAA GAG CTT GGC GGC GAA TGG GCT GAC CGC TTC CTC 1248 GIG CTT TAC GGT ATC GCC GET CCC GAT TCG CAG CGC ATC GCC TIC TAT CGC 1299 GIL CIT Gal GAO LIC LIE IGA Figure 10 Sequence of the rpsL neo selection counter selection cassette 24 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Oligonucleotides The two oligonucleotides labeled check up and check down are designed for verification of the correctly recombined BAC clones by PCR They are supplied with the kit tubes 8 and 9 check up 5 GTCGATCAGACTATCAGCGT GAG 3 check down S TACCGAGCTCGAATTCGCCCTATAG 3 The unde
13. and during one hour there is approximately 1 doubling step meaning any daughter cell will still have on average 2 3 copies left and will also go on expressing the recombination proteins The plasmid is actually lost after electroporation and recombination when cells are incubated at 37 C overnight 4 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled 2 C microfuge benchtop centrifuge Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tubes on ice 5 Add 1 2 ul 100 200 ng of the linear rpsL neo cassette to the pellet to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvettes In parallel pipette 1 ul from tube 3 into each of the two tubes of the control 6 Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using an electroporation cuvette with a slit of 1mm Other devices can be used but 1350 V and a 5 ms pulse are recommended 7 Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette back into the mi
14. antibiotics are available from Sigma Stock solutions should be stored at 20 C For selective LB medium the antibiotic is dissolved to the indicated working concentration 1 Chloramphenicol Cm stock solution c 30 mg ml dissolved in ethanol Working concentration 15 ug ml for BACs 50 ug ml for high copy plasmids 2 Tetracycline Tc stock solution c 10 mg ml dissolved in 75 ethanol Working concentration for pRedET is 3 ug ml Tetracycline is light sensitive 3 Kanamycin Km stock solution c 30 mg ml dissolved in ddH20 Working concentration 15 ug ml for BACs 50 ug ml for high copy plasmids 4 Streptomycin Str stock solution c 50 mg ml dissolved in ddH20 Working concentration 50 ug ml Selective LB plates are made by adding 15 g agar to 1 L LB medium After boiling cool to approx 50 C add the required antibiotics to yield the appropriate working concentrations and pour into petri dishes L arabinose stock solution Use 10 L arabinose Sigma A 3256 in ddH20 fresh or frozen in small aliquots at 20 C Use 50 ul stock solution per 1 4 ml LB for induction of recombination protein expression from pRedET Frozen aliquots should not undergo more than three freeze thaw cycles Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 11 6 Technical Protocol 6 1 Generation of a rpsL neo PCR product flanked by homology arms Oligonucleotide design Please follow the advice in Oligonucleoti
15. assette Lanes 7 to 11 BACs with introduced point mutation 22 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 6 6 Maps and sequences Be pRedET 9270 bp repA pSC101 ori Figure 9 Map of the Red ET expression plasmid pRedET tc Transformation of E coli hosts with this plasmid is selected for by acquisition of tc at 30 C Expression of the Red ET Recombination proteins is induced by L arabinose activation of the BAD promoter at 37 C Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 23 Promoter rpsL gene Neomycin Kanamycin 1 GGCCTGGTGA TGATGGCGGG ATCGTTGTAT ATTTCTTGAC ACCTTTTCGG CATCGCCCTA 61 AAATTCGGCG TCCTCATATT GTGTGAGGAC GTTTTATTAC GTGTTTACGA AGCAAAAGCT 121 AAAACCAGGA GCTATTTA ATG GCA ACA GIT AAC CAG CTG GTA CGC AAA CCA CGT 175 GCT CGC AAA GIT GCG AAA AGC AAC GIG CCT GCG CTG GAA GCA TGC CCG CAA 226 AAA CGT GGC GTA TGT ACT CGT GTA TAT ACT ACC ACT CCT AAA AAA CCG AAC 277 TCC GCG CTG CGT AAA GTA TGC CGT GIT CGT CTG ACT AAC GGT TTC GAA GIG 328 ACT TCC TAC ATC GGT GGT GAA GGT CAC AAC CTG CAG GAG CAC TCC GTG ATC 379 CTG ATC CGT GGC GGT CGT GTT AAA GAC CTC CCG GGT GTT CGT TAC CAC ACC 430 GTA CGT GGT GCG CIT GAC TGC TCC GGG GIT AAA GAC CGT AAG CAG GET CGT 481 TCC AAG TAT GGC GTG AAG CGT CCT AAG GCT TAA GGAGGACAATC ATG ATT GAA 534 CAA GAT GGA TIG CAC GCA GGT TCT CCG GCC GOCI TGG GIG GAG AGG CTA TTC 585 GGG TAT GAC IGG GCA CAA CAG ACA ATC GGG TGC TCT GAT
16. c for DNA engineering using recombination in Escherichia coli Nature Genetics 20 123 128 Zhang Y Muyrers J P P Testa G and Stewart A F 2000 DNA cloning by homologous recombination in Escherichia coli Nature Biotech 18 1314 1317 Zhang Y Muyrers P P J Rientjes J and Stewart A F 2003 Phage annealing proteins promote oligonucleotide directed mutagenesis in Escherichia coli and mouse ES cells BMC Molecular Biology 4 1 14 8 2 Patents Red ET recombination is covered by one or several of the following patents and patent applications PCT EP98 07945 Novel DNA Cloning Method ET Priority date December 5 1997 European Patent no 1034260 by Stewart ef al and related patents and applications U S Patent Application no 09 350 830 filed July 9 1999 Directed Cloning and Subcloning US Patent nos 6 355 412 and 6 509 156B by Stewart ef al and related patents and applications These patents and patent applications are owned by Gene Bridges or owned by the EMBL and exclusively licensed to Gene Bridges Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 31 9 Purchaser Notification Warranty This product is the subject of European Patent No 1034260 issued on 12 3 2003 or PCT EP98 07945 and United States Patent No 6 355 412 issued on 12 of March 2002 The purchase of this product conveys to the purchaser the non transferable right to use this product for research purposes only T
17. cassette will be monitored by PCR or DNA mini preparation Due to the insertion of the rpsL neo cassette cells will become Streptomycin sensitive Single colonies must be analyzed to confirm the necessary Streptomycin sensitive phenotype before performing step 3 step 3 The expression of genes mediating Red ET is induced by the addition of L arabinose and a temperature shift from 30 C to 37 C After induction the cells are prepared for electroporation The non selectable DNA which can be either just an oligonucleotide harboring the right and the left homology arms of the selection cassette and a point mutation control reaction or a gene flanked by homology arms will be electroporated Red ET recombination will replace the rpsL neo counter selection selection cassette by the non selectable DNA Only colonies which lost the selection counter selection cassette will grow on Streptomycin containing plates The successful integration of the non selectable DNA will be monitored by PCR or DNA mini preparation Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 7 3 How Red ET Recombination Works In Red ET Recombination also referred to as A mediated recombination target DNA molecules are precisely altered by homologous recombination in E coli which express the phage derived protein pairs either RecE RecT from the Rac prophage or Reda Red from phage These protein pairs are functionally and operationally
18. cin resistance str streak some colonies carrying the BAC on agar plates containing 50ug ml Str in addition to the appropriate antibiotics for the BAC The colonies should grow on Str plates rpsL neo counter selection only works in E coli strains carrying a mutated rpsL gene conferring a str phenotype Day 2 Before starting e Chill ddH20 or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C 1 Set up one or two microfuge tubes containing fresh 1 4 ml LB medium with appropriate antibiotics and inoculate with 30 ul of fresh overnight culture 2 Culture for 2 3 h at 37 C shaking at 1 000 rpm Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 13 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled 2 C microfuge benchtop centrifuge Discard the supernatant by quickly tipping out the supernatant twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH20 pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tube on ice Take the Red ET Recombination protein expression plasmid pRedET tube 1 Add 1 ul to your cell pellet Mix briefly Keep the tube on ice Transfer the cell suspension
19. crofuge tube Incubate the cultures at 37 C with shaking for 70 minutes Recombination will now Occur Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 15 8 Streak the cultures with a loop 100 ul is sufficient if necessary plate all onto LB agar plates containing Cm 15 ug ml Km 15 ug ml and Tc 3 ug ml Incubate the plates at 30 C overnight to keep pRed ET in the host strain The Red ET recombination protein expression plasmid pRed ET would get lost at 37 C The plates should be incubated longer than 20 hours to obtain large colonies The ratio of induced uninduced bacterial colonies should exceed 100 1 An example is shown on Figure 4 Figure 4 Typical result of a Red ET recombination experiment On the left plate the arabinose induced sample was streaked on a LB plated conditioned with Cm 15 ug ml Km 15 ug ml and Tc 3 ug ml The right plate shows the result of the uninduced control plate 9 Pick 10 single colonies from the induced plates and inoculate each of them in 100 ul of LB medium with Cm Km Tc 15 15 3 ug ml 10 In parallel pick 1 colony from the original BAC plate as control and inoculate 100 ul of LB medium with Cm 15 ug ml 11 Incubate the tubes from steps 9 and 10 at 30 C with shaking at 1100 rpm for 1 2 hours and use these cultures for step 12 13 and 14 12 After the incubation time use a loop to streak a small sample of the culture on LB plates co
20. de Design page 9 for Red ET Recombination The example used for the positive control reaction included in this kit is presented i Choose 50 nucleotides directly adjacent to the left of the site you want to change Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the PCR primer sequence for amplification of the rpsL neo counter selection cassette given in italics below Upper oligonucleotide 5 N s GGCCTGGTGATGATGGCGGGATCG 3 li Choose 50 nucleotides directly adjacent to the right of the site you want to change and transfer them into the reverse complement orientation Order an oligonucleotide with this sequence at the 5 end At the 3 end of this oligo include the 3 PCR primer sequence for the rpsL neo counter selection cassette given in italics below Lower oligonucleotide 5 N so TCAGAAGAACTCGTCAAGAAGGCG 3 If desired include restriction sites or other short sequences in the ordered oligo s between the 5 homology regions and the 3 PCR primer sequences PCR The oligonucleotides are suspended in dH gt O at a final concentration of 10 pmol ul We present one standard PCR protocol however any standard PCR protocol should yield satisfactory results PCR reaction in 50 ul 39 5 ul dH gt O 5 0 ul 10 x PCR reaction buffer 2 0 ul 5 mM dNTP 1 0 ul upper oligonucleotide 1 0 ul lower oligonucleotide 1 0 ul rpsL neo PCR template tube 2 0 5 ul Taq polymerase
21. division Miller Ingmer and Cohen 1995 Because the RepA protein is temperature sensitive T cells have to be cultured at 30 C to maintain the plasmid pSC101 derivatives are easily curable at 37 C to 43 C Experiments have shown that the copy number of the plasmid decreases by about 80 during four generations of bacterial cell growth at 42 C After return of the cultures to 30 C approximately the same number of generations of bacterial cell growth is required for the copy number of the plasmid to return to the level observed before Miller Ingmer and Cohen 1995 Since the plasmid is based on oriR101 it can be propagated in E coli together with most ColE1 derived plasmids Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 9 4 Oligonucleotide Design for Red ET Recombination To target your BAC at the site s you choose you will need to attach short homology regions to a selectable marker This is most conveniently done by ordering two oligonucleotides for use in PCR amplification see Figure 3 Each oligonucleotide consists of two or if desired three parts 1 Required Part A A for the other oligonucleotide is the homology region shared by the target molecule and the linear molecule Choose the way you want to engineer your BAC Often you want to delete a section of your BAC This is accomplished by replacing this section with the selectable marker The homology regions are the 50 bp dir
22. e A phage red yBa operon expressed under the control of the arabinose inducible pBAD promoter Guzman et al 1995 and confers Tetracycline resistance tc The pBAD promoter is both positively and negatively regulated by the product of the araC gene Schleif 1992 AraC is a transcriptional regulator that forms a complex with L arabinose Arabinose binds to AraC and allows transcription to begin In the presence of glucose or the absence of arabinose transcription is blocked by the AraC dimer The plasmid carries the red yBa genes of the phage together with the recA gene in a polycistronic operon under the control of an inducible promoter The recombination window is therefore limited by the transient expression of Red proteins Thus the risk of unwanted intramolecular rearrangement is minimized While constitutive expression of the red y gene has a toxic effect in recA cells like DH10B or HS996 under some conditions thus limiting the efficiency of recombination tightly regulated expression of the y gene together with simultaneous expression of the red a and B genes allows efficient homologous recombination between linear DNA fragments and plasmids resident in cells such as DH10B pRedET is a derivative of a thermo sensitive pSC101 replicon which is a low copy number plasmid dependent on oriR101 The RepA protein encoded by plasmid pSC101 is required for plasmid DNA replication and the partitioning of plasmids to daughter cells at
23. ectly adjacent to either side of the deleted section You can delete from O bp i e make an insertion to gt 100 kb The exact sequences of the homology regions can be chosen freely according to which position on the target molecule will be modified 2 Optional Part B B Tor the other oligonucleotide This part of the oligonucleotide allows useful sequences such as HA tags Myc tags His tags or restriction sites multiple cloning sites site specific recombination target sites etc to be incorporated into the recombinant product By design these will be incorporated into the recombinant product exactly where desired If the introduction of such operational sequences is not needed this piece can simply be omitted from the oligonucleotide design 3 Required Part C C for the other oligonucleotide This piece usually 18 to 24 nucleotides long primes the PCR amplification of the selectable marker from the provided template sequences are given on page 24 PCR template with annealed oligos PCR product amp Vector Targeting construct N B C 3 A A a C A A B N f N A A Ya u Vector Figure 3 Practical steps involved in Red ET Fig 3 illustrates the principle for modifying episomes such as bacterial artificial chromosomes BACs See text above for further details Sm selectable marker 10 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 5 Media for Antibiotic Selection All
24. equivalent RecE and Reda are 5 3 exonucleases and Rec and Red are DNA annealing proteins A functional interaction between RecE and RecT or between Reda and Red is also required in order to catalyze the homologous recombination reaction Recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Figure 2 The recombination is further assisted by A encoded Gam protein which inhibits the RecBCD exonuclease activity of E coll Double stranded break Bl anaes 3 3 RecE 5 3 z or Redo exonuclease ai 3 KN LLL C C3 C3 O C RecT Single strand or Red I binding proteins 5 3 3 Joint molecule formation DNA replication Figure 2 Mechanism of Red ET Recombination 8 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Double stranded break repair DSBR is initiated by the recombinase protein pairs RecE RecT or Reda Red First Reda or RecE digests one strand of the DNA from the DSB leaving the other strand as a 3 ended single stranded DNA overhang Then Red or RecT binds and coats the single strand The protein nucleic acid filament aligns with homologous DNA Once aligned the 3 end becomes a primer for DNA replication The recombination proteins can be expressed from a plasmid Figure 6 and are therefore transferable to any E coli strain pRedET Figure 9 carries th
25. he linear BAC repair oligonucleotide from the kit tube 4 to perform a control experiment in parallel Day 1 1 Set up overnight cultures LB medium conditioned with Cm Km Tet 15 15 3 ug ml from a single colony of your experiment and of the control and incubate them at 30 C over night Puncture a hole in the lid of the tubes for air Both colonies must show a verified str phenotype see section 6 3 step 14 Day 2 Before starting e Chill ddH2O or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C 2 The next day set up 4 lid punctured microfuge tubes 2 for your own experiment and 2 for control experiment containing 1 4 ml fresh LB medium conditioned with Cm 15 ug ml Km 15 ug ml and Tc 3 ug ml Inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control Incubate the tubes at 30 C for 2 h shaking at 1100 rpm until ODgoo 0 3 3 Add 50 ul 10 L arabinose to one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 3 0 4 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 45 min to 1 h Note It is important that cells are incubated at 37 C the temperature at which al
26. he purchaser can not sell or otherwise transfer this product or its components to a third party No rights are conveyed to the purchaser to use this product or its components for a commercial purpose Commercial purposes shall include any activity for which a party receives consideration of any kind These may include but are not limited to use of the product or its components in manufacturing to provide a service information or data use of the product for diagnostic purposes or re sale of the product or its components for any purpose commercial or otherwise The use of homologous recombination for commercial purposes may infringe the intellectual property covered by the EP 419 621 patent family Products containing the araB promoter are sold under patent license for research purposes only and are non transferable Inquiries for any commercial use including production of material to be sold commercially or used in production or in product development efforts which includes efforts toward regulatory approval should be made directly to Xoma Corporation Berkeley California Xoma Corporation 2910 Seventh Street Berkeley CA 94710 Limited Warranty Gene Bridges is committed to providing customers with high quality goods and services Gene Bridges assumes no responsibility or liability for any special indirect incidental or consequential loss or damage whatsoever This warranty limits Gene Bridges GmbH s liability only to the cost of the
27. id used to prepare the linear fragment left in the sample Since the transformation efficiency of linear fragments is 10 fold less than of circular DNA molecules you may obtain a background even if no traces were visible on an agarose gel If the linear DNA fragment was obtained by restriction digestion use less DNA and gel purify the fragment If the linear cassette was obtained by PCR set up a Dpnl digest for your PCR product and gel purify it at the end If you obtain a very low number of colonies on both plates it indicates that the overall efficiency of Red ET Recombination is very low In this case please control all parameters mentioned in the section for no colonies after Red ET Recombination Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 29 8 References and Patents 8 1 References 30 Angrand P O Daigle N van der Hoeven F Scholer H R and Stewart A F 1999 Simplified generation of targeting constructs using ET recombination Nucleic Acids Res 27 e16 Guzman L M Belin D Carson M J and Beckwith J 1995 Tight regulation modulation and high level expression by vectors containing the arabinose pBAD promoter J Bacteriol 177 4121 4130 Miller C A Ingmer H and Cohen S N 1995 Boundaries of the pSC101 Minimal Replicon are Conditional J Bacteriol 177 4865 4871 Muyrers J P P Zhang Y Testa G and Stewart A F 1999 Rapid modification of bacterial artificial chro
28. ing 1 0 ml LB medium plus Tc 3 ug ml and Cm 15 ug ml for the BAC Also pick one colony from the control plate Puncture a hole in the lid of the tubes for air Incubate the cultures while shaking at 30 C overnight Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Day 4 Before starting e Chill ddH2O or 10 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C 2 The next day set up 4 lid punctured microfuge tubes 2 for your own experiment and 2 for control experiment containing 1 4 ml fresh LB medium conditioned with the same antibiotics as in step 1 Inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control Incubate the tubes at 30 C for 2 h shaking at 1100 rpm until ODeoo 0 3 3 Add 50 ul 10 L arabinose to one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 3 0 4 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 45 min to 1 h Note It is important that cells are incubated at 37 C the temperature at which all proteins necessary for the subsequent recombination are expressed There are about 5 copies of this temperature sensitive plasmid per cell
29. l proteins necessary for the subsequent recombination are expressed There are about 5 copies of this temperature sensitive plasmid per cell and during one hour there is approximately 1 doubling step meaning any daughter cell will still have on average 2 3 copies left and will also go on expressing the recombination proteins The plasmid is actually lost after electroporation and recombination when cells are incubated at 37 C overnight Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 19 4 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled 2 C microfuge benchtop centrifuge Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tubes on ice 5 Add 1 2 ul 100 200 ng of the linear non selectable DNA fragment with homology arms to the pellet to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvettes In parallel pipette 1 ul from tube 4 into each of the two tubes of the control 6 Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using a
30. l targeting constructs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges The functional cassette supplied with the kit FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP combines a prokaryotic promoter gb2 for expression of Kanamycin resistance in E coli with an eukaryotic promoter PGK for expression of Neomycin resistance in mammalian cells High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid FRT or loxP flanked Kanamycin Neomycin resistance template FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP to be used for your own experiments Expression plasmid for FLPe or Cre site specific recombinase in E coli cells Positive controls to introduce a single FRT site into a 15 kb high copy plasmid Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 35 K006 Quick and Easy E coli Gene Deletion Kit Description Contents 36 This kit is designed to knock out or alter genes on the E coli chromosome in less than one week Red ET recombination allows the exchange of genetic information in a base pair preci
31. mosomes by ET recombination Nucleic Acids Res 27 1555 1557 Muyrers J P P Zhang Y Buchholz F and Stewart A F 2000 RecE RecT and Redo Red initiate double stranded break repair by specifically interacting with their respective partners Genes Dev 14 1971 1982 Muyrers J P P Zhang Y Benes V Testa G Ansorge W and Stewart A F 2000 Point mutation of bacterial artificial chromosomes by ET recombination EMBO Reports 1 239 243 Muyrers J P P Zhang Y and Stewart A F 2000 ET cloning Think recombination first Genetic Engineering Principles and Methods Ed J K Setlow 22 77 98 Kluwer Academic Plenum Publishers NY Muyrers J P P Zhang Y and Stewart A F 2001 Recombinogenic engineering new options for cloning and manipulating DNA Trends in Bioch Sci 26 325 31 Reyrat J M Pelicic V Gicquel B and Rappuoli R 1998 Counterselectable Markers Untapped Tool for Bacterial Genetics and Pathogenesis Infection and Immunity 66 4011 4017 Schleif R S 1992 DNA Looping Annu Rev Biochem 61 199 223 Testa G Zhang Y Vintersten K Benes V Pijnappel P Chambers I Smith A J H Smith A G and Stewart A F 2003 Engineering of mouse genome with bacterial artificial chromosomes to create multipurpose alleles Nature Biotechnology 21 443 7 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Zhang Y Buchholz F Muyrers J P P and Stewart A F 1998 A new logi
32. n electroporation cuvette with a slit of 1mm Other devices can be used but 1350 V and a 5 ms pulse are recommended 7 Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette back into the microfuge tube Incubate the cultures at 37 C with shaking for 70 minutes Recombination will now Occur 8 Streak the cultures with a loop between 20 ul and 100 ul is in general sufficient if necessary plate all onto LB agar plates containing the appropriate antibiotics for the BAC e g Cm 15 ug ml for the control and Str 50 ug ml The plates should not contain Tc otherwise the Red ET expression plasmid will either persist or the cells will die 9 Incubate the plates at 37 C over night The Red ET recombination protein expression plasmid pRedET will disappear at 37 C You should obtain gt 50 colonies and the ratio of induced to uninduced bacterial colonies should exceed 10 1 Depending on the amount of cells plated there might be some very limited growth or a kind of smear visible as a background on both plates which can lead to misinterpretations Nevertheless single colonies should be clearly visible at least on the arabinose induced plates see Figure 6 The recombination efficiency of the last step normally exceeds 90 Although most str colonies will contain the correct BAC recombinant it is possible that secondary recombination usually deletions between internal repea
33. nditioned with Str 50 ug ml plus Km 15 ug ml plus Cm 15 ug ml as well as on LB plates conditioned with Km 15 ug ml plus Cm 15 ug ml Incubate the plates at 37 C over night to test the function of the rpsL neo cassette see Figure 5 13 Transfer 30 ul of culture from step 11 into 2 ml of fresh LB culture with the appropriate antibiotics Cm Km or Cm Incubate at 37 C over night with shaking at 1 100 rom These cultures will be used for preparing BAC DNA and or for PCR verification page 20 16 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 14 Add 300 ul of fresh LB medium conditioned with Cm Km Tet 15 15 3 ug ml to the tubes from step 11 and incubate them at 30 C over night These cultures will be used for the second round of Red ET recombination to replace the rosL neo cassette by a non selectable gene or an oligonucleotide Nearly all colonies growing on the agar plates conditioned with the appropriate antibiotics Cm 15 ug ml Km 15 ug ml and Tc 3 ug ml will have successfully undergone Red ET Recombination Nevertheless since the introduced rosL gene was amplified by a PCR reaction some molecules may carry a mutation leading to a Str phenotype although the rpsL neo cassette is still present Such a mutation in the rpsL part of the cassette would result in a high background in the second Red ET recombination step when correctly recombined clones will be selected by Str The BAC rp
34. product 32 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 10 Other Products Available from Gene Bridges General information e Kits are available for non commercial research organizations Commercial companies or for profit organizations require a sub license to use Red ET Recombination The complete product list as well as the all information how to order the kits in your country is given on our website www genebridges com K001 Quick and Easy BAC Modification Kit Description Contents Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 This kit is designed to modify any type of bacterial artificial chromosomes BACs within 1 2 weeks by using a Kanamycin Neomycin cassette This kit is optimized for basic modifications such as insertions or deletions of fragments in any type of bacterial artificial chromosomes BACs leaving a selectable marker gene This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid Tn5 neomycin resistance template to be used for your own experiments Positive control
35. ral times Add 200 ul of buffer P3 Qiagen and mix by inverting the tube several times Spin down the white lysate at highest speed for 15 min Transfer the clear supernatant into a new 1 5 ml Eppendorf tube and add 0 50 ml of 2 propanol Mix by inverting the tube and spin down the DNA at highest speed for 15 min Discard the supernatant and add 0 5 ml of 70 ethanol to rinse the pellet be careful not to loose the small white pellet Spin down the DNA at highest speed for 10 min 10 Clean the inner wall of the tube with a piece of tissue or cotton stick 11 Dry the pellet under the speed vacuum for 2 min or leave the tube open on the bench for 5 to 10 min until the DNA pellet is completely dry Do not overdry the pellet otherwise the DNA will become difficult to re dissolve 12 Resuspend the dry DNA pellet in 30 ul ddH20 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 6 4 Replacing the rpsL neo cassette by a non selectable DNA In the next step the rpsL neo cassette will be replaced by a single stranded oligonucleotide or any non selectable DNA flanked by homology arms Prepare electro competent cells from the BAC hosts that contain the correctly inserted counter selection cassette as well as the Red ET expression plasmid shortly after inducing the expression of the recombination proteins In advance prepare the linear DNA fragment with homology arms that you will insert into your BAC Use t
36. rlined sequence of the BAC repair oligonucleotide tube 4 constitutes the left homology arm The sequence shown in italics constitutes the right homology arm The additional Xhol restriction site is marked in bold BAC repair 5 TGGCCTCCACGCACGTTGTGATATGTAGATGATAACTCGAGGGCCAGTG AATTGTAATACGACTCACTATAGGGCG 3 The oligos below were used to add the 50 bp homology regions italics for Red ET recombination to the rpsL neo selection cassette used in the control reaction The parts of the oligos which serve as PCR primers for amplification of the rpsL neo cassette are underlined An additional Xhol site bold was introduced between the homology region and the PCR primer of the lower oligonucleotide These two oligos are not supplied with the kit Upper 5 TGACGTGGTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCGG CCTGGTGATGATGGCGGGA TCG 3 Lower 5 TACCGAGCTCGAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCCTC GAGTCAGAAGAACTCGTCAAGAAGG 3 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 25 7 Troubleshooting 7 1 Problems with the detection of Streptomycin sensitive clones The detection of Streptomycin resistant str clones after the second Red ET recombination step is sometimes difficult When a larger amount of cells is plated a background smear may lead to the misinterpretation that the Streptomycin selection did not work well The str colonies are nevertheless clearly visible in such a situation see
37. rol experiment 10 uM 20 ul Please store tubes 1 4 and 8 9 at 20 C store tubes 5 7 at 80 C Kit manual with protocols maps and sequences Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 5 2 Experimental Outline step 1 step 2 OH OH L Arabinose O 30 gt 37 HO OH CSM neo PCR product WW rpsL neo hm hm step 3 L Arabinose 30 gt 37 non Sm non Sm PCR product emae hm hm ee ee ee R R R R R R m R Figure 1 Flowchart of the experimental outline for the insertion of a non selectable marker gene e g a point mutation into a BAC 6 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Step 1 The E coli strain carrying the BAC which is to be modified is transformed with the expression plasmid pRedET Step 2 The expression of genes mediating Red ET is induced by the addition of L arabinose and a temperature shift from 30 C to 37 C After induction the cells are prepared for electroporation and the linear rpsL neo counter selection selection cassette PCR product flanked by homology arms hm is electroporated Red ET recombination inserts the functional cassette into the target locus Only colonies carrying the modified BAC will survive Kanamycin selection on the agar plates Grow at 30 C to allow the pRedET plasmid to persist in the cells The successful integration of the counter selection selection
38. s Counter Selection BAC Modification Kit Version 3 3 May 2014 Additional functional cassettes e A001 e A002 e A003 e A004 e A005 e ADOBE e A007 e A008 e A009 e A010 e A011 Pro and Eukaryotic Neomycin Selection Cassette PGK gb2 neo FRT flanked Pro and Eukaryotic Neomycin Selection Cassette FRT PGK gb2 neo FRT loxP flanked Pro and Eukaryotic Neomycin Selection Cassette loxP PGK gb2 neo loxP FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site FRT PGK gb2 neo FRT loxP FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site 2 version loxP FRT PGK gb2 neo FRT FRT flanked Chloramphenicol Selection Cassette FRT cm FRT loxP flanked Chloramphenicol Selection Cassette loxP cm loxP FRT flanked Ampicillin Selection Cassette FRT amp FRT loxP flanked Ampicillin Selection Cassette loxP amp loxP FRT flanked Pro and Eukaryotic Hygromycin Selection Cassette FRT PGK gb2 hygro FRT loxP flanked Pro and Eukaryotic Hygromycin Selection Cassette loxP PGK gb2 hygro loxP Additional strains and plasmids e A104 e A105 e A112 e A113 e A201 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Enhanced FLP Expression Plasmid 707 FLPe with tetracycline resistance marker for use in E coli only Enhanced FLP Expression Plasmid 708 FLPe with chloramphenicol resistance marker for use in E coli only
39. s directly Observation No colonies on your plate after Red ET Recombination If you do not obtain any colonies after recombination the following parameters should be checked 1 The PCR product could be wrong check it by restriction digest or sequencing could be degraded check an aliquot on an agarose gel could have incorrect homology arms Please double check the oligonucleotides used to generate the homology arms for quality and correctness If necessary verify the sequence by sequencing of the PCR product may not be enough increase the amount of PCR product from approximately 200 ng up to 500 ng Please take into consideration that you may also increase non specific background Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 27 2 The BAC may be instable and may have rearranged Digest the BAC and run on a gel preferably PFGE to confirm the approximate size may contain some repeats in the region you are targeting Re check sequence could be wrong make sure that you have the right BAC by isolating DNA and checking the region of the homology arms by PCR If necessary sequence the PCR product to verify the region of homology Some BACs are wrongly annotated inherently instable or a mixture of more than one BAC 3 The Red ET reaction did not take place because there was no expression plasmid present in the cells e g the cells were grown at 37 C instead of 30
40. s to introduce a Tn5 neo cassette in a 150 kb BAC Detailed protocols descriptions of plasmids maps and sequences 33 K003 BAC Subcloning Kit Description Contents 34 This kit is optimized for subcloning of DNA fragments from BACs and cosmids No restriction sites necessary Fragments up to 20 kb can be subcloned High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid Linear vector carrying a ColE1 origin of replication plus Ampicillin resistance gene to be used for the subcloning experiment Positive controls to subclone a 15 kb fragment from a control BAC into the vector delivered with the kit Detailed protocols descriptions of plasmids maps and sequences Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 K004 Quick and Easy Conditional Knockout Kit FRT FLPe and K005 Quick and Easy Conditional Knockout Kit loxP Cre Description Contents This kit is designed to integrate FRT or loxP sites into large vectors at any position within 2 weeks Single FRT or loxP sites are inserted by Red ET recombination of FRT or loxP flanked functional cassettes into any designated locus with subsequent removal of the selection marker by FLPe or Cre recombinases Conditiona
41. sL neo clones should therefore be confirmed by functional test and restriction digestion analysis or PCR before starting the second round of Red ET recombination see Figure 5 In general one or two out of eight clones analyzed show some growth on the LB plate conditioned with Str 15 Check the Str plate from step 12 and identify the clones which didn t grow on this plate 16 Place the streptomycin sensitive clones from step 14 at 4 C till the BAC rpsL neo clones are confirmed by digestion or PCR After successful confirming that the clones contain the rosL neo insertion in the BAC restriction pattern or PCR product and that the rpsL gene is not mutated functional test str you can go on with the next steps Figure 5 Typical result of a Streptomycin growth test left plate LB Km Cm right plate LB Km Cm Str after insertion of the rpsL neo cassette by Red ET recombination Eight colonies carrying the rpsL neo cassette were analyzed no 1 to 8 clone number 9 is a km control clone Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 17 Protocol Preparation of BAC DNA for analytical purposes Next day 18 1 2 9 Spin down the 2 ml overnight cultures for 1 min at 13 200 rpm Discard the supernatant and resuspend the cell pellet in 200 ul buffer P1 with RNase from QIAGEN DNA Maxi preparation Kit Add 200 ul of buffer P2 Qiagen and mix by inverting the tube seve
42. se specific and faithful manner An FRT flanked Kanamycin resistance marker cassette is supplied with the kit which can be used to replace a gene on the E coli chromosome Red ET recombination can replace fragments as large as 30kb from the chromosome The use of a FRT flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP recombinase step if required FLP expression plasmids can be purchased from Gene Bridges Multiple knock outs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges Strictly controlled recombination process due to an optimized design of the pRedET expression plasmid The genes for the Recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for a convenient removal of the plasmid after recombination Two Red ET Recombination protein expression plasmids pRedET tcf and pRedET amp Any E coli strain can be made Red ET proficient by transformation with these plasmids FRT flanked Kanamycin resistance template FRT PGK gb2 neo FRT to be used for your own experiments Positive controls to replace the gene for mannose transporter manx on the E coli chromosome Detailed protocols descriptions of plasmids maps and sequences Gene Bridge
43. ssibly because of a general inhibition of translation by the wild type ribosome Most of the commonly used E coli strains e g DH10B HS996 DH12S TOP10 carry a mutation in the rpsL gene resulting in Streptomycin resistance which is a prerequisite for this technology If the wild type rpsL gene is introduced via a plasmid into such an E coli host the strain will become Streptomycin sensitive again Using this system we developed a new counter selection system based on an rpsL neo cassette Selection using the antibiotics Streptomycin and Kanamycin is very efficient Therefore overnight incubation is sufficient to achieve recombined clones In addition the entire cassette is just 1 3 kb in size in comparison to around 3 kb of the sacB neo cassette REMINDER Please make sure that the E coli strain you are working with is Streptomycin resistant since the counter selection only works in strains carrying a mutated rpsL gene Introduction of a non selectable marker by Red ET Recombination using the Counter Selection Modification kit This kit is designed for BAC bacterial artificial chromosome modifications like insertion or deletion of non selectable marker genes fragment exchange without leaving a selection marker or introducing short non selectable sequences like point mutations loxP sites or restriction sites In a two step approach a counter selection cassette is first introduced at the location to be modified and in the second step
44. ts in the BAC can also occur The frequency of such secondary recombination events varies greatly from one BAC to another If the targeted BAC vector is inherently unstable due to direct repeats larger numbers of clones have to be screened to confirm correctly recombined ones 20 Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 Figure 6 Typical result of a counter selection experiment On the left plate 50 ul of the arabinose induced sample was streaked on a LB plated conditioned with Cm 15 ug ml and Str 50 ug ml The right plate shows the result of the uninduced control plate To find out which clones have been modified without rearrangement isolate the BAC DNA Pick 10 20 colonies from the experiment and 2 from the control Also pick colonies from the original unmodified BAC plates for DNA preparation and comparison Analyze these DNA preparations using a Restriction digestion of mini prep DNA followed by electrophoresis this is our preferred method because secondary recombination events can be detected and or b PCR amplification of the insertion site using externally located primers with subsequent sequencing across the recombination site s As a further control tube 7 contains E coli harboring the correctly modified product of the control reaction Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 21 6 5 Verification of successfully modified BAC by PCR analysis
45. ule can be specifically altered Zhang and coworkers demonstrated in 1998 for the first time that a pair of phage coded proteins RecE and RecT only need 42 bp long homology arms to mediate the homologous recombination between a linear DNA molecule e g a PCR product and circular DNA plasmid BAC or E coli chromosome One year later the system was extended by the same group in replacing recE and recT by their respective functional counterparts of phage lambda reda and red Muyrers et al 1999 Red ET Recombination utilizes homologous recombination and represents a revolutionary DNA engineering platform that addresses the limitations found in conventional methods Gene Bridges Counter Selection BAC Modification Kit Version 3 3 May 2014 3 rpsL neo counter selection system Besides the well established sucrose based counter selection system sacB neo Gene Bridges has developed a new selection and counter selection system based on the rpsL gene rpsL neo and Streptomycin selection The Streptomycin sensitivity system takes advantage of the fact that the S12 ribosomal protein is the target of Streptomycin a widely used antibiotic Mutations in the rpsL gene encoding this protein are responsible for resistance to high concentrations of Streptomycin However resistance is recessive in a merodiploid strain When both wild type and mutant alleles of rpsL are expressed in the same strain the strain is sensitive to Streptomycin po
Download Pdf Manuals
Related Search