Home

ABI PRISM ® 3100 Genetic Analyzer

1. 1_A01_01 tsa amp 3_CO1_05 tsa i 10_B02_04 tsa E 4_D01_07 fsa i 11 C02 06 fsa E 5 Et1 09 fsa 2 12 D02 08 fsa E amp F 1 11 fsa E 13 E02 10 fsa E 7 GO1 13 sa E 14 F02 12 sa E 8_HO1_15 fsa i 15 G02 14 fsa E 3 A02 02 fsa E 16 H02 16 fsa 8 Run demo 3100 2001 06 04 70 log i 2 BO1 03 fsa 17 objects 76 8KB The default name of the run folder is Run Instrument name date runlD An example of a run folder name is shown below 53 Run 31 00 R abbit 2000 06 09 3 Run number for the day Instrument Year month day name 3 4 Viewing and Analyzing Data Viewing Individual To view sample file data Sample Files Step Action 1 Start Sequencing Analysis software You may have a program icon for Sequencing Analysis on the Start menu If not you can find the Sequencing Analysis program SeqA exe in the following directory D appliedbio SeqAnal Bin You may find it helpful to maximize the Sample Manager window Use the Maximize button E in the upper right corner of the window i Sample Manager _ CXEES NETS MIT J ese mre DEED idit HE c en E tn dd 2 In the Sample Manager window click Add files to open the Add Sample Files dialog box Viewing and Analyzing Data 3 5 3 6 To view sample file data continued Step Action 3 Select the files to add to the Sample Manager window a In t
2. Matrices for dye set E x 08 ES X 0 7 0 5 03 0 4 ae ee IL JL L L 2 noes CoM Lema ne A tt ttt 9 0 44 42 49 4 45 48 7 48 49 20 Intensity vs Bin Number 3000 4000 5000 Intensity vs Sean Number Capillary Number 1 2 Condition Number 3 34 Q Value 0 97 Data Source ox 4 Use the arrow buttons or the slider to review the data for each capillary For a good quality calibration the calibration for each capillary should have a Q value above 0 95 Condition number from 3 5 Note The condition number is specific for each dye set 5 Click Cancel to close the dialog box Note The software automatically overrides failed capillaries However if you are dissatisfied with a particular profile you can override it with a preferred profile For more information see the ABI PRISM 3100 Genetic Analyzer User s Manual Spatial and Spectral Calibrations 4 13 Maintaining the Instrument Overview In This Chapter This chapter contains information about the things you should do to maintain your ABI PRism 3100 Genetic Analyzer Topic See Page Maintenance Task Lists 5 2 Removing Air Bubbles from the Upper Polymer Block 5 4 Checking the Available Space 5 6 Cleaning and Inspecting Syringes 5 8 Removing the Polymer Blocks 5 10 Cleaning the Polymer Blocks 5 11 Putting Fresh Polymer on the Instrument 5 12 Before Installi
3. Step Action 7 Use the buttons at the bottom left of the window to change the display view 000000 Button View Name Description 1 Annotation Summary information about the sample and the run 2 Sequence The nucleotide base sequence text 3 Feature Features added by Factura processing 4 Electrophero Analyzed color data with peaks representing bases gram This view is not available if the data has not been analyzed 5 Raw Data Multicomponented but no baseline correction or mobility correction applied If the sample file has not been analyzed this is the default view 6 EPT Plots of run voltage temperature current and power This area may be blank if EPT data is not available In the electropherogram raw data or EPT views use the commands in the Window menu to zoom in or out 43 Sequencing Analysis File Edit Sample Manager Zoom In Viewing and Analyzing Data To view sample file data continued Step Action 9 To print the sample file a From the File menu choose Print to open the Printing options dialog box b Check the views you want to print c Click OK ffl Printing options Print these Annotation Sequence Feature Table v Electropherogram Raw Data EPT Data Allow for 3 hole punch Cancel Alternatively you can print several sample files at once by checking
4. Step Action 3 Estimate how much free space you need by using the information provided below Approximate Space File Type Required Per File kB Analyzed sample file for DNA sequencing analysis 250 Unanalyzed sample file 100 a The values provided are estimates only The actual file size depends on the run module selected 4 If there is insufficient space a Archive the sample files to another volume b Delete the original files from the drive Checking Database Note The instrument database automatically expands from 2 to 9 GB depending on the Space amount of data that needs to be stored To check the database space Step Action 1 Run the Diskspace utility Note For instructions see the ABI PRISM 3100 Genetic Analyzer User s Manual 2 If the used space is more than 8 GB purge the database of some or all the data Note For instructions see the ABI PRISM 3100 Genetic Analyzer User s Manual Maintaining the Instrument 5 7 Cleaning and Inspecting Syringes When to Clean Thoroughly clean the syringes Syringes 4 Whenever they are removed from the instrument or at least once per week Each time the polymer is replaced including when switching to a new type or lot of polymer Note For more information about Cleaning Syringes see the ABI Prism 3100 Genetic Analyzer User s Manual IMPORTANT Wear gloves while performing the following procedure and any other time you handle the capill
5. Matrix Standard for Dye Set E Matrices Step Action 1 Thaw and mix thoroughly the DS 01 P N 4315974 matrix standard tube 2 Spin the tube briefly in a microcentrifuge 3 NYG Me CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the eyes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive systems and is a possible birth defect hazard Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Prepare the Matrix Standard Set DS 01 for Dye Set E by combining the following in a labeled 1 5 mL microcentrifuge tube Reagent Volume uL Matrix Standard Set DS 01 dROX dTAMRA dR6G 5 dR110 Hi Di Formamide P N 4311320 195 Final Volume 200 4 Vortex thoroughly 5 Spin the mixture briefly in a microcentrifuge 6 Heat the standard tube at 95 C for 5 min to denature the DNA 7 Immediately place the tubes on ice for 2 min 4 6 Spatial and Spectral Calibrations Preparing the To prepare the matrix standards for Dye Set Z Matrices Matrix Standard for Dye Set Z Matrices Step Action 1 Resuspend a tube of BigDye Terminator v 3 0 Sequencing Standard P N 4390303 with 170 uL of Hi Di formamide CHEMICAL HAZARD Formamide is harmful if absorbed through the skin and may cause irritation to the e
6. From the Start menu point to Applied Biosystems and select 3100 Data Collection Software Note Tocreate a shortcut a Navigate to 3100Collection bat in the following directory D appliedbio 3100 Bin b Right click the file c Click Create Shortcut This creates a shortcut named Shortcut to 3100 Collection Software d Drag the shortcut to the desktop The 3100 Data Collection Software opens and the window below displays 3100 Data Collection Software eH mimi lm ele Jn View tus View Arey vew Capt vew 0 D Performing a Sequencing Run 2 5 Setting Software Preferences Introduction The Data Collection software preferences are set during instrument installation however you can view or change these preferences in the Setting Preferences dialog box Viewing the Setting To view the Setting Preferences dialog box Preferences Dialog Box Data Collection Page ew Step Action 1 From the View menu select Preferences or click the Preferences button on the toolbar v A 3100 Data Collection Software The dialog box has two pages as described below Setting Preferences The table below describes the preferences that can be set within this page Preference Description Instrument Name This field automatically populates with demo_3100 You can change it to any name
7. IJssel 31 0 180 392400 31 0 180 392409 or 31 0 180 392499 United Kingdom Warrington Cheshire 44 0 1925 825650 44 0 1925 282502 European Managed Territories EMT Africa English speaking Johannesburg South Africa 27 11 478 0411 27 11 478 0349 Africa French speaking Paris France 33 1 69 59 85 11 33 1 69 59 85 00 India New Delhi 91 11 653 3743 91 11 653 3744 91 11 653 3138 Poland Lithuania Latvia and Estonia 48 22 866 40 10 48 22 866 40 20 Warszawa For all other EMT countries not listed 44 1925 282481 44 1925 282509 Central and southeast Europe CIS Middle East and West Asia Japan Japan Hacchobori Chuo Ku Tokyo 81 3 5566 6230 81 3 5566 6507 Latin America Caribbean countries Mexico and 52 55 35 3610 52 55 66 2308 Central America Brazil 0 800 704 9004 or 55 11 5070 9694 95 55 11 5070 9654 Argentina 800 666 0096 55 11 5070 9694 95 Chile 1230 020 9102 55 11 5070 9694 95 Uruguay 0004 055 654 55 11 5070 9694 95 Getting Help A 5 To Reach Technical At the Applied Biosystems web site you can search through frequently asked Support Through questions FAQs or a solution database or you can submit a question directly to the Applied Technical Support Biosystems Web Site Search FAQs To search for FAQs Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top o
8. discussed 4 2 to 4 5 spectral calibration discussed 4 6 to 4 13 syringes discussed 5 8 T technical support A 1 to A 7 e mail address A 1 Internet address A 6 regional sales offices A 4 to A 5 telephone fax North America A 3 A 4 training obtaining information A 7 U upper polymer block removing air bubbles 5 4 V viewing raw color data in Data Collection software 3 2 to 3 3 sample files in Sequencing Analysis software 3 5 to 3 9 W waste safety 1 3 water and cathode buffer reservoirs filling 2 10 to 2 13 Y yellow capillary in Array View 4 11 Index 2 Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650 638 5884 Worldwide Sales Offices Applied Biosystems vast distribution and service network composed of highly trained support and applications personnel reaches into 150 countries on six continents For sales office locations and technical support please call our local office or refer to our web site at www appliedbiosystems com www appliedbiosystems com AS applied nas HITACHI Applera Corporation is committed to providing the world s leading technology and information for life scientists Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses Printed in the USA 07 2001 Part Number 4315833 Rev C an Applera business
9. 1 leaving the capillary tips in the buffer reservoir Shut down the computer and turn off the instrument Performing a To perform a long term shutdown Long Term Shutdown Step Action 1 Follow the procedure on page 5 16 to remove and store the capillary array off of the instrument 2 Remove from the instrument Syringes from the upper polymer block For instructions see page 5 8 Upper polymer block For instructions see page 5 10 Lower polymer block For instructions see page 5 10 3 Remove from the autosampler Plate assemblies Reservoirs Wipe the autosampler and drip trays with lint free tissue dampened with water Close the instrument doors Maintaining the Instrument 5 17 To perform a long term shutdown continued Step Action 6 Shut down the computer and turn off the instrument 7 Wash the syringes polymer blocks and reservoirs with warm water Rinse with deionized water IMPORTANT Make sure all parts of the array are completely dry before long term storage 5 18 Maintaining the Instrument Getting Help Technical Support Contacting You can contact Applied Biosystems for technical support Technical Support By e mail By telephone or fax Through the Applied Biosystems web site You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In additi
10. 300 14000 sec X Comments New ESSA RPA NOTE dick on the rows to see comnents for he parameters Double clic in the value column to edit values Export Import Delete zl Editing or Creating To edit an existing run module or to create a new run module a Run Module Step Action 1 Click the Module Editor button on the toolbar The Module Editor dialog box opens 2 Select a run module to use as a template 3 Edit the parameter values that you want to change IMPORTANT Only whole numbers are accepted IMPORTANT Be sure that all values are red values in black are not saved Performing a Sequencing Run 2 27 2 28 To edit an existing run module or to create a new run module continued Step 4 Action If you want to Then save the changes to the current Click Save module Note Save cannot be applied to default run modules create a new run module a Click Save As b Enter a unique descriptive name and click OK Enter Name of New Module Ty new module OK Cancel When you are finished click the Close button XJ to exit the Module Editor Performing a Sequencing Run About Viewing and Editing Analysis Modules for DNA Sequencing Introduction Viewing and Editing Analysis Modules for DNA Sequencing The analysis module specifies how the raw data is autoanalyzed at the end of
11. Analysis _ n x File Edit Sample Manager Window Help lt 3 Sample Manager Bl Cancel yaaa fites 4 Remove C Open Fites lass f1557 _ pTa1ooporsidh fknones P 355 iv580 a T 446 1557 pratQoPOPe Bi none P a iv580 P 66 465 1557 pratooPoPe ei TC TN T 46i 1557 prstooPoPe ei Save the project a From the File menu select Save Project b Enter a file name for the project and click Save Viewing and Analyzing Data To view sample file data continued Step Action 6 Double click the sample file name to open a sample file and view its contents Alternatively you can open several sample files at once by highlighting them in the Sample Manager window and clicking the Open Files button If the sample file has been analyzed the file opens to show the electropherogram view il Run demo 3100 2000 04 28 14 400ng B 1 03 abl amp m n NEEFEE n A NENNEN M M MA M GC GTTGC GC TC C TGCCCGC TTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCI 240 250 0 24 1296 97 648 oP AVA EANA ANAS LA i A ALY L 341111 TH LAs za ond M IZ If the sample file has not been analyzed the file opens to show the raw data view For information on how to analyze data see Analyzing or Reanalyzing Data on page 3 10 I WI l LMI li i AUI Viewing and Analyzing Data 3 7 3 8 To view sample file data continued
12. Calibration Display Spatial Calibration Display Spectral Calibration Instrument Condition a A run uses 50 80 uL of polymer This is equivalent to 60 100 runs from one 5 mL syringe A minimum of 100 uL of polymer is required for the instrument to operate IMPORTANT Always replace polymer that is older than 1 week IMPORTANT Ensure there are no air bubbles in the upper and lower polymer block before proceeding To remove any air bubbles see page 5 4 Replace the 1X Genetic Analyzer buffer in the anode buffer reservoir and the cathode buffer reservoir daily or before each batch of runs y Nee CHEMICAL HAZARD Genetic Analyzer Buffer with EDTA may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves IMPORTANT Failing to replace buffer may lead to loss of resolution and data quality IMPORTANT Replenishing buffer and placing the plate requires that the autosampler be in the forward position with the capillary tips removed from the buffer solution Do not leave the autosampler in this position for an extended time because the capillaries will dry out 2 10 Performing a Sequencing Run Making Buffer for a To prepare 50 mL of 1X Genetic Analyzer buffer with EDTA Single Run Step Action 1 Add 5 0 mL of 10X Genetic Analyzer buffer into a graduated cylinder VN Nue CHEMICAL H
13. EPT Data Fytrart data intn sample fles Look for the message Sample Files Successfully Extracted in the Status bar Note The extracted data is unanalyzed Use Sequence Analysis software to analyze the sample files 2 26 Performing a Sequencing Run Viewing Editing or Creating a Run Module Introduction The run module specifies information about how the sample is run e g the duration of the run the run temperature and the injection time Viewing a Run To view a run module Module Step Action 1 Click the Module Editor button on the toolbar The Module Editor dialog box opens In the Modules group box click the Sequencing tab 3 To view the parameters for a particular module select the name of the module from the list All the parameters for the run module are displayed Pl Module E ditor x Modules Module Parameters Sequencing GeneScan Calibration Name SidSeq50_POPSDetauttModule Template StdSec50_POP6 RapidSeq36_POP6DetauttModule 5 P6DefsultModule Paramster Name Value Range 1 Dowr sample frame size 4 nt 1 8 frames L 2 Run Temperature 50 it 25 65 Deg C 3 Cap Fill Volume 184 nt 1 250 steps 4 Pre Run Yullage 122 ual 0 15 kYulls 5 Pre Run Time 180 nt 1 1000 sec 6 Injection Voltags 15 loat 1 15 kVolts 7 Injection Time 20 nt 1 600 sec 8 Run voltage 122 oat 12 2 12 2 kVolts 3 Data Delay Time 1200 Mt1 5600 sec 10 Run Time 6500 int
14. Plate Name Application Wells Status Place a plate into plate position B Linked Plate Records Plate Name Application A SpectralCalibrati Spectral 38 Wells Status pending Processed Plate Records Plate Name Application Wells Status Edit Ursa Delete Import Note When a plate is linked the Plate graphic changes from yellow to green Plate record moves from the Pending Plate Records table to the Linked Plate Records table This may take up to 30 sec The Run Instrument button on the toolbar is enabled meaning that the instrument is ready to run Starting the To start the calibration Calibration Step Action 1 To review the run schedule before beginning the run click the Run View tab 2 Click the Run Instrument button on the toolbar to begin the run The spectral calibration run takes approximately 30 min Run Times The table below lists the spectral calibration run times Capillary Array Length Approximate Run Time cm min 36 40 50 65 4 10 Spatial and Spectral Calibrations Spectral Calibration Result Box When a Capillary Fails When the Calibration Fails At the end of the run while the data is being analyzed the Spectral Calibration Result dialog box opens to indicate which capillaries have passed and which have failed The example below for Dye Set E shows failed capilla
15. Polymer Block Step Action 1 Remove the anode reservoir and properly dispose of the buffer Inspect the O rings Grasp the lower polymer block and pull it straight out 2 3 4 Disconnect the polymer block tube fitting 5 10 Maintaining the Instrument Cleaning the Polymer Blocks When to Clean the Clean the upper and lower polymer blocks Polymer Blocks 4 Before replacing the polymer on the instrument When the polymer has been on the instrument for longer than 1 week Note Polymer older than 1 week may cause a transient increase in current during electrophoresis due to urea decomposition Cleaning the IMPORTANT Do not expose the polymer blocks to any organic solvents Polymer Blocks To wash the upper and lower polymer blocks Step Action 1 Remove the polymer blocks from the instrument as described on page 5 10 2 Use running water or a squirt bottle to rinse the upper polymer block thoroughly with hot water 3 Visually inspect the channels for white residue dried polymer Continue washing the channels until the residue is gone Rinse the block and its channels with deionized water 5 Remove residual water from the polymer block and fittings to ensure that the running polymer is not diluted Force air through the channels using canned compressed air until the channels are dry Note To purchase a 3100 Polymer Cleaning Kit P N 4322931 visit our web
16. are not crushed or damaged Check the level of polymer in the polymer reserve Daily or before syringe to ensure there is at least 1 mL each run Check the polymer block to ensure it fits securely on the Daily instrument Clean the instrument surfaces Daily Check for dried polymer around the polymer block and Daily clean as necessary Check for leaks around the syringes and screw nut Daily Check database space Delete plate records from the Daily page 5 6 instrument database and archive sample files 5 2 Maintaining the Instrument Weekly Tasks Perform the tasks listed below at least once per week Maintenance Task Frequency See Clean the syringes Weekly page 5 8 Clean the water and buffer reservoirs with warm water Weekly Clean the upper and lower polymer blocks Weekly page 5 11 Replace the polymer in the syringes upper polymer Weekly page 5 12 block and capillary array Check the storage conditions of the used arrays Weekly As Needed Tasks Perform the tasks listed below as needed Maintenance Task Frequency See Clean the drip trays As needed x Change the array As needed page 5 15 Remove any dried polymer from the capillary tips Use a As needed lint free wipe moistened with deionized water Calibrate the autosampler Very rarely Users Manual Maintaining the Instrument 5 3 Removing Air Bubbles from the Upper P
17. check boxes Plate View Run View status view Array View Capilary View 1 s m ss of the capillaries to Select capileriestodisplay V fv iv ie T T T T TF TF E be displayed 3 255 260 254 267 274 274 278 28 1 285 288 Intensity vs Run Time mins 3 258 260 254 207 274 274 278 284 285 288 Intensity vs Run Time mins 600 400 200 0 3 200 253 255 260 254 67 274 274 278 28 1 285 288 Intensity vs Run Time mins paw A AA AA an ad TUS k 3 207 274 274 278 284 285 288 258 260 254 Intensity vs Run Time mins 4 gt Sample Files Successfully Extracted Viewing and Analyzing Data 3 3 Viewing Analyzed Data in Sequencing Analysis Software Introduction Locating Sample Files Run Folder Default Name After a run has been extracted to sample files you can use the ABI PRISM9 DNA Sequencing Analysis Software to view the electropherogram data both raw and analyzed Refer to the ABI PRISM DNA Sequencing Analysis Software User Guide P N 4308924 for details on viewing and analyzing Sequencing Analysis data When a run is finished the analyzed sample files are extracted into a run folder along with a run log in the following directory D appliedbio 3100 DataExtractor ExtractedRuns An example of the run folder and its contents is shown below amp D appliedbio 3100 D ataE xtractor ExtractedRuns Run_demo_3100_2001 06 04_70 Piel Eg File Edit View Help
18. e scratches or cracks Refill capillary with fresh polymer and rerun spatial calibration If the spatial calibration continues to be unsuccessful refer to the ABI Prism 3100 User Manual troubleshooting chapter Performing a Sequencing Run 2 3 Starting the Data Collection Software Before You Begin Before starting the ABI PRISM Data Collection Software Step Action 1 Ensure the computer and monitor are powered on IMPORTANT The computer must be powered on before the instrument The default user name is 3100User and the default password is blank Ensure the ABI PRISM 3100 Genetic Analyzer is powered on and the green status light is on solid not flashing Ensure OrbixWeb Daemon is running by finding its button on the Windows NT taskbar A Start E OrbixWeb Daemon If OrbixWeb Daemon is not running go to the Start menu point to Applied Biosystems and select OrbixWeb Daemon Note To create a shortcut a Navigate to orbixd exe in the following directory D dbtools iona orbixweb3 2 bin b Right click the file c Click Create Shortcut This creates a shortcut named Shortcut to orbixd exe d Drag the shortcut to the desktop IMPORTANT OrbixWeb Daemon must be started before the 3100 Data Collection software can run 2 4 Performing a Sequencing Run Starting the Data To start the Data Collection software Collection Software Step Action 1
19. entry Note In addition to the four identifiers you set with the drop down lists all names are automatically appended with the capillary number and a file extension Therefore in the Data Analysis page example shown above the sample name will be Sample Name Well Position Capillary Number ab1 IMPORTANT Using additional filters will create very long file names which mayaffect down stream software analysis Performing a Sequencing Run 2 7 Working with Plate Assemblies Plate Assembly The plate assembly components are assembled as follows Components Plate Retainer Plate Septa MicroAmp Reaction Plate Plate Base The table below contains ordering information for the plate assembly components Component P N 384 Well P N 96 Well Plate Retainer 4317240 4317241 Plate Septa 4315934 4315933 MicroAmp Reaction Plate 4305505 N801 0560 Plate Base 4317236 4317237 2 8 Performing a Sequencing Run Preparing a Plate To prepare a plate assembly Assembly Step Action 1 Secure a clean and dry septa strip on the sample plate IMPORTANT Never use warped plates IMPORTANT Ensure the septa strip lies flat on the plate 2 Place the sample plate into the plate base 3 Snap the plate retainer onto the plate and plate base 4 Ensure the plate retainer holes are aligned with the holes in the septa strip IMPORTANT Damage to the array tips wi
20. or Basecaller 3100RRv2 for rapid run sequencing The files are located in the following directory D appliedbio Shared Analysis Basecaller Params Basecaller Settings are specified in the Preferences dialog box accessed from the Edit menu Ifthe Write Seq Files box is selected text files of the basecalled sequence are written in either ABI or FASTA formats If a Factura Settings File is selected Factura processing will be applied during analysis To view or edit a Factura settings file From the File menu point to Open and select Factura Settings The files are located in the following directory D appliedbio Shared Analysis Factura If you have made changes to the analysis module and you Then want to save the changes a Click Save As to create a new analysis module b Enter a unique descriptive name and click OK don t want to save the changes Click the Close button to close the window 2 30 Performing a Sequencing Run Viewing and Analyzing Data Overview In This Chapter This chapter includes the following topics Topic See Page Viewing Raw Data 3 2 Viewing Analyzed Data in Sequencing Analysis Software 3 4 Analyzing or Reanalyzing Data 3 10 Note This chapter assumes that run data has been extracted into sample files If you are using the ABI PRISM 3100 Genetic Analyzer in conjunction with the BioLIMS9 database syst
21. satisfactory Continue on to step 3 unsatisfactory a Click Cancel to close the Details box and then click Start to repeat the calibration or b Reposition one or more of the red crosses To move a cross change the value in the Capillary Position box and then click outside of that box c Override the data with data from a previous run see the ABI PRISM 3100 Genetic Analyzer User s Manual If the calibration continues to provide unsatisfactory results see If the Calibration Fails on page 4 5 Click OK to close the Perform Spatial Calibration window and to send the passing calibration to the instrument The Question dialog box opens 2 Save spatial calibration data If you choose Yes spatial calibration data will be saved in the database and sentto the instrument vo 4 4 Spatial and Spectral Calibrations To view the spatial calibration results and save the data continued Step Action To Then save this calibration data to the Click Yes Data Collection software database delete this data and use data froma a Click No previous run b Override the current spatial calibration map See the ABI PRISM 3100 Genetic Analyzer User s Manual If the Calibration f the calibration failed or if you do not like the appearance of the passed calibration Fails profile try one or more of the following corrective actions Repeat the
22. site http www appliedbiosystems com and select Store Maintaining the Instrument 5 11 Putting Fresh Polymer on the Instrument When to Change the Polymer Adding or Changing Polymer We recommend that you change the polymer weekly The polymer is good at 25 C for about 7 days CHEMICAL HAZARD POP polymers may cause eye skin and respiratory tract irritation Please read the MSDS for the polymer you are using and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for research and development purposes only Determine whether to add or change the polymer on the instrument before proceeding with instrument preparation If polymer on the instrument is Then less than 1 week old and Ensure there are no air bubbles and then proceed with sufficient in quantity to instrument preparation complete your runs Note For a procedure to remove any air bubbles see ABI PRISM 3100 Genetic Analyzer User s Manual greater than 1 week old Fill the syringes and the upper polymer block with polymer or insufficient in quantity by following the instructions under Change Polymer Wizard to complete your runs P 3100 Data Collection Software File View Instrument iGEM Service Help fi ci K j Plate Editor Module Editor Change Polymer Wizard Install Capillary Array Vizard Autosampler Calibration Vizard Perform Spatial Calibration Display Spati
23. were detected A slow running system can result in a blue peak being partially or totally cut off Add time to the run or change the reagents if they are suspect and then repeat the run Spatial and Spectral Calibrations 4 11 Examining a After completing a spectral calibration it is good practice to check the quality of the Spectral Calibration spectral data for each capillary Profile for Dye Set E To display a current spectral calibration profile stored for a dye set Step Action 1 From the Tools menu select Display Spectral Calibration 3100 Data Collection Software Version 1 0 1 File View Instrument Service Help S Ea Be Plate Editor Module Editor Change Polymer Vizard Install Capillary Array Vizard Autosampler Calibration Wizard Perform Spatial Calibration Display Spatial Calibration 8 oectral Calibration The Question dialog box opens 9 Display matrices from Dye set Previous run Cancel 2 Click Dye set The Select the source to display dialog box opens mE Select the source to display Drop down list NENNEN of dye sets Ol Cancel 4 12 Spatial and Spectral Calibrations To display a current spectral calibration profile stored for a dye set continued Step Action 3 From the drop down list select the appropriate dye set e Dye Set E and click OK The Matrices for Dye Set E dialog box opens
24. 2 Spacing Spacing should match the spacing for the basecaller used Spacing values are usually calculated automatically but you can overwrite values by typing a new value into the Spacing box Basecaller Settings The Basecaller Settings parameter can be used to stop analysis before the Stop Point set on the Sample Manager is reached To use basecaller settings open the Basecaller Settings Preference page by pointing to Preferences on the Edit menu and selecting Basecaller Settings By default no endpoint is applied Peak 1 Location This is the data point that marks the first base peak in the data For more information about determining the optimal Peak 1 Location see the ABI PRISM DNA Sequencing Analysis Software User Guide Start Point This is the scan number at which the basecaller analysis begins By default it is the same as the Peak 1 Location but you can enter a greater number Stop Point This is the scan number at which the basecaller analysis stops By default this is the last point in the sample file but you can enter a smaller number if you want DyeSet Primer File This is the mobility file used during data analysis Factura Settings File Parameters for Factura processing are contained in this file Viewing and Analyzing Data 3 11 Spatial and Spectral Calibrations Overview In This Chapter This chapter includes the following topics T
25. 53 4613 Mariner ESI TOF Mass Spectrometry Workstations Voyager MALDI TOF Biospectrometry Workstations MassGenotyping Solution 1 MGS1 Systems Proteomics Solution 1 PS1 Systems ICAT Reagent 1 800 899 5858 press 1 then press 3 1 508 383 7855 Getting Help A 3 To Contact Technical Support by Telephone or Fax Outside North America A A Getting Help Product Product Area Telephone Fax Biochromatography BioCAD SPRINT VISION and INTEGRAL Workstations and POROS9 Perfusion Chromatography Products 1 800 899 5858 press 1 then press 4 1 508 383 7855 Expedite 8900 Nucleic Acid Synthesis Systems 1 800 899 5858 press 1 then press 5 1 508 383 7855 Pioneer Peptide Synthesizers 1 800 899 5858 press 1 then press 5 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 press 1 then press 5 1 508 383 7855 FMAT 8100 HTS Systems CytoFluor 4000 Fluorescence Plate Reader 1 800 899 5858 press 1 then press 6 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 LC MS Applied Biosystems MDS Sciex 1 800 952 4716 1 508 383 7899 a 5 30 AM to 5 00 PM Pacific time b 8 00 AM to 6 00 PM Eastern time c 9 00 AM to 5 00 PM Eastern time To contact Applied Biosystems Technical Support or F
26. ABI PRISM 3100 Genetic Analyzer Quick Start Guide for Sequencing AS Applied HITACHI Copyright 2001 Applied Biosystems All rights reserved For Research Use Only Not for use in diagnostic procedures Information in this document is subject to change without notice Applied Biosystems assumes no responsibility for any errors that may appear in this document This document is believed to be complete and accurate at the time of publication In no event shall Applied Biosystems be liable for incidental special multiple or consequential damages in connection with or arising from the use of this document FOR LIMITED LICENSE INFORMATION PLEASE SEE THE ABI PRISM 3100 GENETIC ANALYZER USER S MANUAL The ABI PRISM 3100 Genetic Analyzer includes patented technology licensed from Hitachi Ltd as part of a strategic partnership between Applied Biosystems and Hitachi Ltd as well as patented technology of Applied Biosystems ABI PRISM and its design Applied Biosystems BioLIMS GeneScan GeneMapper Genotyper and MicroAmp are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries ABI BigDye Factura Hi Di POP POP 4 and POP 6 are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries AmpliTaq is a registered trademark of Roche Molecular Systems Inc Microsoft Windows and Windows NT are registered trademarks of the Microsoft Corporation
27. AZARD Genetic Analyzer Buffer with EDTA may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Add deionized water to bring the total volume up to 50 mL Mix well Filling the Water IMPORTANT Wear gloves while performing the following procedure and any other time you and Cathode Buffer handle the capillary array glass syringes septa or buffer reservoirs Reservoirs To fill the water and cathode buffer reservoirs Step Action 1 Close the instrument doors 2 Press the Tray button on the outside of the instrument to bring the autosampler to the forward position Tray button Wait until the autosampler has stopped moving then open the instrument doors Remove the cathode buffer reservoir and water reservoirs from the instrument Dispose of remaining fluids and rinse out the reservoirs with deionized water Note The waste is very dilute however you should follow your company s waste disposal practices for appropriate disposal procedures Rinse the cathode reservoir with 1X Genetic Analyzer buffer and fill to the line with 1X Genetic Analyzer buffer about 16 mL Fill the water reservoirs to the line with quality deionized water about 16 mL Performing a Sequencing Run 2 11 2 12 To fill the water and cathode buffer reservoir
28. CTION 3100 Prdecti IDT3100PO 5 BD vz nut STD SEQ INJECTION 3100 Prueclt DT3100POP5 BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100POP5 BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100POP BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100POP5 BD vz mob STDSEQINJECTION 3100 Prdecti DT24 OOPO G DD yvZ mob STD SEQ INJECTION 3100 Praect1 DT3100POP5 BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100POP5 BD vz mob 1X DOWN SAMPLING 3100 Prdecti IDT3100PO 5 BD vz mob 1X DOAN SAMPLING 3100 Praectt DT3100POP5 BD vz mob 1XDOANSAMPLING 3100 Praecti DT31 OOPO G DD vz mob 4X DOWN SAMPLING 3100_Project1 DT3100POP5 BD vz mob 1X DOAN SAMPLING 3100 Praecti DT3100POP5 BD vz mob 1X DOWN SAMPLING 3100 Praect DT3100POP BD vz mob 1X DOWN SAMPLING 3100_Prciect1 E DT3100POP5 BD vz mob 1XDOANSAMPLING 3100 Pract smmcrusbumowEeEMe OOOO Note It may take a while for the new plate record to be saved to the database and added to the Pending Plate Records table as shown below Note The plate record must be deleted from the database first in order to use the same name for another plate record 3100 Data Collection Software Version 1 0 1 LRS_DILUTIOK_2 Sa pending Ks difion2 SQ 95 pening Performing a Sequencing Run 2 21 Linking and Unlinking a Plate Introduction The procedure below describes h
29. GR1316b Spatial and Spectral Calibrations 4 7 Preparing the Plate Creating a Plate Record 4 8 Spatial and Spectral Calibrations To load the standards continued Step Action 2 Centrifuge the plate so that each standard is positioned at the bottom of its well Your samples should Look like this Not look like this Not look like this The sample is positioned correctly in the bottom of the well A r U The sample lies on the side wall because the plate was not centrifuged r U An air bubble lies at the bottom of the well because the plate was not Centrifuged with enough force or Centrifuged for enough time Follow the instructions on pages 2 8 through 2 14 to and Instrument 4 Assemble the plates Check and refill the fluids on the instrument Place the plate on the autosampler To create a plate record for the denatured matrix standards Step Action 1 On the Plate View page of the Data Collection software click New The Plate Editor dialog box opens To create a plate record for the denatured matrix standards continued Step Action 2 In the Plate Editor dialog box a Name the plate b Select Spectral Calibration c Make sure that the appropriate plate size is selected d Click Finish Plate Editor Ea Plate Name SpectralCalib
30. ICAL HAZARD POP polymers may cause eye skin and respiratory tract irritation Please read the MSDS for the polymer you are using and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for research and development purposes only To replace a capillary array or to install a capillary array on an instrument Step Action 1 Close the oven and instrument doors and then press the Tray button 2 From the Tools menu select Install Capillary Array Wizard 3100 Data Collection Software Version 1 0 1 Install Capllary Array Wizard The Install Replace Capillary Array Wizard opens Install Replace Capillary Away Wizard ERTES der minicar 3 Follow the directions given in the wizard to replace or install an array Maintaining the Instrument 5 15 Storing a Capillary Array When to Store off the Instrument Storing the Capillary Array off the Instrument When to Store on the Instrument Storing a Capillary Array on the Instrument Store the capillary array off of the instrument when the capillary array will be unused for longer than 1 week Before storing the capillary array for long periods we recommend filling the capillaries with fresh polymer IMPORTANT If you intend to reuse the capillary array do not let the capillaries dry out Store the capillary array with both ends in fresh 1X Genetic Analyzer buffer IMPORTANT Wear
31. Run Type Analysis Module Rapid DNA sequencing BC 3100RRv2 SeqOffFtOff saz Standard DNA sequencing BC 3100SR_SeqOffFtOff saz Note You can examine the settings for each of these files using DNA Sequencing Analysis software The meanings of the settings are described in the AB PRISM DNA Sequencing Analysis Software User Guide P N 4308924 Samples are automatically grouped so that all runs with the same run module are run sequentially If you want to run the same sample again select a second run module and a second analysis module You can run a sample in a linked plate up to five times Run Module 2 Analysis Module 2 Samples will be automatically grouped so that all runs with the same run module are run sequentially 2 20 Performing a Sequencing Run To enter sample information and save the plate record continued Step Action 8 Make sure the plate record is correct and then click OK Plate E ditor DT3100PO25 BD vz mob STD SEQ INJECTION 3100 Prdect DT3100POPS BD Iz mob STD SEQ INJECTION 3100 Projecti DT3100POP5 BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100PO25 BD vz mob STDSEQINJECTION 3100 Prdecti DT3100PO 5 BDvz mob STD SEG INJECTION 3100 Praecti DT3100POP5 BD vz mob STD SEQ INJECTION 3100 Prdecti DT3100PO2B BD vz mob STD SEQ INJECTION 3100 Pract DT3100POP5 BD vz mob STDSEQINJECTION 3100 Prdecti DT3100POP5 BD vz mob STDSEQINJE
32. SM 3100 Genetic Analyzer User Flowchart for Sequencing User Flowchart Turn on computer OrbixWeb Daemon automatically launches Turn on instrument Launch ABI PRISM 3100 Data Collection Software Present autosampler and place fresh deionized water and 1X GA buffer in positions 1 to 4 Place lower polymer block and anode buffer jar on the instrument Clean the capillary array detection window with ethanol if necessary Place cleaned array on ABI 3100 using the Install Array Wizard The Install Array Wizard takes you through the steps to Install the array Fill a 5 mL reserve syringe and a 250 uL array syringe with ABI 3100 Sequencing polymer Remove bubbles Open the Change Polymer Wizard Log the lot number information in the database Perform spatial calibration Pass Prepare spectral standards and perform spectral calibration Add Hi Di formamide to sequencing samples and mix well Heat denature for 2 minutes at 95 C and immediately chill on ice for 2 minutes Spin samples briefly to eliminate bubbles at bottom of tubes Add plate septa tray cover and plate base and place on autosampler Complete plate record and link to plate assignment Press the green arrow Review extracted sample files in Sequencing Analysis software Repeat spatial calibration without filling the capillary Remove capillary array and clean capillary window Inspect window for damage i
33. Status View tab to monitor the status of the instrument during the run 3100 Data Collection Software x File View Instrument Tools Service Help m Mela mJ Plate view Run View Status View array View Capillary view Instrument Condition r Events Time Remaining this run 00 42 06 Wed Apr 12 16 58 24 PDT 2000 n Bb Laser On m Set run status to STARTING Run Time 00 44 24 Wed Apr 1216 58 24 PDT 2000 E E Off EP Voltage n Started a Gene Scan Run Run demo 3100 2000 04 12 46 i 200 kv Wed Apr 1216 58 23 PDT 2000 Sending run module to the instrument B oven On 15 0 Wed Apr 12 16 37 15 PDT 2000 aus 96 dis connect data communication port Wed Apr 12 17 02 00 PDT 2000 NECI MU sn 36 96 RUN PARAMETERS command reply Wed Apr 12 17 02 03 PDT 2000 Oven Door Closed 36 BEGIN command reply Wed Apr 12 17 02 36 PDT 2000 mA Ret OVEN TEMPERATURE TOLERANCE 3 0 96 Oven temperature ti losampler urn Capillary Array Serial Number demo 4 r Errors Wed Apr 12 16 58 29 PDT 2000 Instrument offline Capillary Array Usage 49 I Waiting for Oven to Stabilize at Run Temperature During the run you can view the data using the Array View and Capillary View pages IMPORTANT Always exit from the Array View and the Capillary View windows Do not leave these windows open for extended periods during a run because un
34. a Sequencing Run To fill the anode buffer reservoir to the fill line with Genetic Analyzer buffer continued Step Action 5 Put the anode buffer reservoir on the instrument Note The meniscus should line up with the fill line 6 If the reservoir fills with fluid repeat this procedure to discard and replace the Genetic Analyzer buffer Note The reservoir could fill during bubble clearing Performing a Sequencing Run 2 13 Placing the Plate onto the Autosampler Placing the Plate To place the plate onto the autosampler onto the Autosampler Step Action 1 Place the plate assembly on the autosampler as shown below Note There is only one orientation for the plate with the notched end of the plate base away from you GR2051 IMPORTANT Ensure the plate assembly fits flat in the autosampler Failure to do so may allow the capillary tips to lift the plate assembly off of the autosampler When the plate is correctly positioned the plate position indicator on the Plate View page changes from gray to yellow Check to ensure this has happened PS Plate placed in position A plate position B No plate in position B Close the instrument doors Note Closing the doors returns the autosampler to the home position placing the tips of the capillaries in buffer 2 14 Performing a Sequencing Run Creating a Plate Record About Plate Records Using
35. al Calibration Display Spectral Calibration Plate View Run View Instrument Condition 5 12 Maintaining the Instrument Changing Polymer To put fresh polymer on the instrument Step Action 1 From the Tools menu select Change Polymer Wizard 3100 Data Collection Software File View Instrument PIGS Service Help Plate View Run View Instrument Condition Change Polymer Vizard Install Capillary Array Wizard Autosampler Calibration Vizard Perform Spatial Calibration Display Spatial Calibration Display Spectral Calibration A warning message displays If the length of the array on the instrument is the same as the length given in the warning message click OK to begin the Change Polymer Wizard The currently installed capillary array is 50cm If this is acceptable continue with the polymer change If this is not acceptable please click cancel install your preferred capillary array and restart this wizard i Cancel Follow the directions given in the wizard to put fresh polymer on the instrument Maintaining the Instrument 5 13 Before Installing a Previously Used Capillary Array Introduction Before you reinstall a capillary array it is recommended that you Clean the front of the detection cell Checkthat the cathode bar is dry Cleaning the This procedure is unnecessary for new arrays unless you h
36. al safety guidelines consult the MSDS Introduction 1 3 After emptying the waste container seal it with the cap provided Dispose of the contents of the waste tray and waste bottle in accordance with good laboratory practices and local state provincial or national environmental and health regulations Site Preparation and A site preparation and safety guide is a separate document sent to all customers who Safety Guide have purchased an Applied Biosystems instrument Refer to the guide written for your instrument for information on site preparation instrument safety chemical safety and About MSDSs Ordering MSDSs 1 4 Introduction waste profiles Some of the chemicals used with this instrument may be listed as hazardous by their manufacturer When hazards exist warnings are prominently displayed on the labels of all chemicals Chemical manufacturers supply a current MSDS before or with shipments of hazardous chemicals to new customers and with the first shipment of a hazardous chemical after an MSDS update MSDSs provide you with the safety information you need to store handle transport and dispose of the chemicals safely We strongly recommend that you replace the appropriate MSDS in your files each time you receive a new MSDS packaged with a hazardous chemical NVON CHEMICAL HAZARD Be sure to familiarize yourself with the MSDSs before using reagents or solvents You can order free additional copies of MSDSs for ch
37. alyzer User s Manual for information 63100 Data Collection Software x File View Instrument Tools Service Help Ep o M ale Plate View Run View Status View Array View Capillary View 4 Run_demo_310 E 0_POP6a3 Pending 2 Run demo 310 Pending 3 Run_demo_310 Sample StdSeq50_POP6a3 Pending 4 Run demo 310 Sample _ StdSeqS0_POP6a3 Pending Run demo 310 Sample StdSeq50 POP6a3 Pending 6 Run demo 310 Sample StdSeq50 POP6a3 Pending u Savunan a Unlinking a Plate To unlink a plate record Record Step Action 1 In the Linked Plate Records table of the Plate View page select the plate record that you want to unlink Click Unlink If the plate record is Then the plate record will completed go to the Processed Plate Records not completed return to the Pending Plate Records table and the plate position indicator will return to yellow Performing a Sequencing Run Starting and Monitoring the Run Starting a Run To start a run Step Action 1 Click the green Run Instrument button to begin the scheduled runs 3100 Data Collection Software File View Instrument Tools Service Help HIB Run Instrument button Monitoring a Run To monitor a run Step Action 1 Click the
38. ary array glass syringes septa or buffer reservoirs Removing Syringes To remove the syringes from the instrument Step Action 1 Remove the syringe guard 2 Grasp the polymer reserve syringe just above the fitting or at the base not the glass barrel and rotate the syringe counterclockwise Do not loosen this fitting while removing the syringe GR1876 IMPORTANT Be careful not to remove the fitting There are several rings and check valves that could come out if this fitting is removed Grasp the array fill syringe and rotate the syringe counterclockwise Properly dispose of any remaining polymer Proceed to Cleaning Syringes below 5 8 Maintaining the Instrument Cleaning Syringes IMPORTANT Wear gloves while performing the following procedure and any other time you handle the capillary array glass syringes septa or buffer reservoirs To clean a syringe Step Action 1 Clean the syringe thoroughly by rinsing the inside and outside of the syringe barrel and the syringe tip with warm water 7 Ne e Do not use hot water Hot water can distort the Teflon in the syringe tip IMPORTANT Be sure there is no dried polymer left in the syringes Rinse the syringe barrel and tip with deionized water Blow dry with compressed air Reassemble the syringe and then inspect it as described below Inspecting a Syringe IMPORTANT After cleanin
39. ave accidently touched the Detection Cell detection cell To clean the detection cell Step Action 1 Put one drop of methanol on the front surface of the detection cell CHEMICAL HAZARD POP polymers may cause eye skin and respiratory tract irritation Please read the MSDS for the polymer you are using and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for research and development purposes only Front surface of detection cell 2 Blow dry the cell using clean pressurized air Checking the When putting a used array back on the instrument be sure that the cathode bar is dry Cathode Bar A wet bar could lead to arcing IMG ELECTRICAL SHOCK FIRE HAZARD Do not leave liquid on the cathode bar This can lead to electric shock or even fire if not kept dry Ensure the cathode bar is dry especially in the center 5 14 Maintaining the Instrument Installing and Removing the Capillary Array When to Change a Capillary Array Installing or Removing the Capillary Array Using the Wizard A capillary array should last approximately 100 runs The following problem may indicate that a new capillary array is required Poorresolution and or decreased signal intensity IMPORTANT Wear gloves while performing the following procedure and any other time you handle the capillary array glass syringes septa or buffer reservoirs CHEM
40. calibration Fill the capillaries with polymer and then repeat the calibration Clean the detection cell and then repeat the calibration Reposition the array window in the detection cell and then repeat the calibration Spatial and Spectral Calibrations 4 5 Performing a Spectral Calibration Introduction Performing a spectral calibration can be divided into three main tasks Setting up the standards Starting the spectral calibration Checking the spectral calibration Note This section describes spectral calibration for dye set E using the Matrix Standard Set DS 01 and dye set Z using the Matrix Standard Set DS XX For information about performing spectral calibration for another dye set see the ABI PRISM 3100 Genetic Analyzer User s Manual A spectral calibration is performed to create a matrix to correct for the overlapping of fluorescence emission spectra of the dyes Application of this matrix to the raw data is called multicomponenting For a more detailed explanation of spectral calibration see the ABI PRISM 3100 Genetic Analyzer User s Manual When to Perform a A spectral calibration must be performed Spectral Calibration 4 whenever you use a new dye set on the instrument After the laser or CCD camera has been realigned by a service engineer If you begin to see a decrease in spectral separation pull up and or pull down peaks Preparing the To prepare the Matrix Standards for Dye Set E Matrices
41. com 2 Click SERVICES amp SUPPORT at the top of the page then click Training Getting Help A 7 Index Numerics 1X running buffer making for a single run 2 11 A adding files to the Sample Manager 3 5 to 3 6 air bubbles removing from upper polymer block 5 4 analysis module selecting 2 20 viewing and editing 2 29 analyzing data See data analysis Array View page 3 3 autoextration failure 2 26 autosampler placing plates 2 14 reservoir positions 2 12 B BioLIMS Project field in plate record buffer making for a single run 2 11 2 19 C capillary array installing removing storing 5 14 to 5 16 chemical safety 1 3 cleaning syringes 5 9 computer checking database space 5 7 checking hard drive space 5 6 customer support See technical support A 1 D data analyzing or reanalyzing 3 10 extracting 2 26 viewing analyzed 3 4 viewing raw 3 2 data analysis Sequencing Analysis software 3 10 to 3 11 Data Collection software starting 2 4 database space checking 5 7 detection cell cleaning 5 14 Display Run Data command 3 2 Documents on Demand A 6 dye set selecting 2 17 E electrical shock warning 1 6 e mail address for technical support A 1 EPT data viewing in Sequencing Analysis 3 8 F Factura analysis applying 3 10 viewing features 3 8 Field Service in North America contacting A 3 Fill Down command 2 19 H hard drive space checking 5 6 I instrument operating 2 25 shutting down 5 17 Inter
42. dules for DNA Sequencing 2 29 Viewing and Analyzing Data OVELVIEW ooa a i EVE NEN NN EGER URNA eR We uoto eere 3 1 Viewing Raw Data ios REL aa CERE ORYT GR a I Ree av n Rd 3 2 Viewing Analyzed Data in Sequencing Analysis Software lll elles 3 4 Analyzing or Reanalyzing Data leleseeeeeeeeee eee 3 10 Spatial and Spectral Calibrations OVERVIEW ve or NEN ue Wes e ER t eu mee et m etd em SUR eU 4 1 Performing a Spatial Calibration 2 0 00 ce cece eee 4 2 Performing a Spectral Calibration 00 0 ee cc eee eee 4 6 5 Maintaining the Instrument Overview vedesi nob EE AER URL DRIVEN a Gee ota Ge eee Blake dus 5 1 Maintenance Task Cisse iaie aa e a a RR RR res 5 2 Removing Air Bubbles from the Upper Polymer Block 0 00 0008 5 4 Checking the Available Space sssseeeeleseeee teens 5 6 Cleaning and Inspecting Syringes 0 0 0 0 ce eh 5 8 Removing the Polymer Blocks 0 0 0 eee cece een eens 5 10 Cleaning the Polymer Blocks 1 0 0 0 ccc ccc ence nee eens 5 11 Putting Fresh Polymer on the Instrument 5 12 Before Installing a Previously Used Capillary Array elles eese 5 14 Installing and Removing the Capillary Array 0 0 cece eee eee ee 5 15 Stonmg a Capillaty Array esee ee ERE DP EE Ue DUARTE CH PER ERU 5 16 Shutting Down the Instrument lsleleeeeeeeeee eee ee ee 5 17 Getting Help Technical Support e
43. e You can view any completed runs that remain in the instrument database Note It may take a few moments to retrieve the data 3 2 Viewing and Analyzing Data To view raw data from a completed run continued Step Action 4 Use the scroll features on the Array View page to view the data IMPORTANT Always exit from the Array View and the Capillary View windows During a run do not leave these pages open for extended periods This may cause unrecoverable screen update problems Leave the Status View window open Capillary Color Data Raw electropherogram display for selected capillary 3100 Data Collection Software File View Instrument Tools Service Help 207 274 274 Intensity vs Run Time mins 3 Eun 2 4 6 8 10 12 14 16 Capillan Number 8 Intensity vs Spectral Bin Intensity vs Cap Number Use this scroll box to Sample Files Suckesstuly Extracted view data block by block Selected capillary to be displayed in the center plot 5 Alternatively to view electropherogram data from several capillaries at once click the Capillary View tab to display the Capillary View page IMPORTANT Always exit from the Array View and the Capillary View windows During a run do not leave these pages open for extended periods This may cause unrecoverable screen update problems Leave the Status View window open File View Instrument Tools Service Help els nno ene Select
44. e g the instrument s serial number 2 6 Performing a Sequencing Run Data Analysis Page Data Collection Data Analysis T AutoAnalysis v AutoAnalysis On r BioLIMS Enable BioLIMS User Name Beo Passwort passworda Database Name Boms Server Name Fever Sample File Name Prefix Format Sample Name hd wer Position v none z none OK Cancel The table below describes the preferences that can be set within this page Preference Description AutoAnalysis On Select AutoAnalysis On to have samples automatically analyzed by the analysis software after the run Note You will still be able to reanalyze your sample data at a later time BioLIMS Use these settings to have data extracted to a BioLIMS database instead of to sample files on the hard drive Sample File Name Specify the format for the sample file names by using the drop down Prefix Format lists to reorder the identifiers Identifier Origin Run ID Generated by the Data Collection software and contains the capillary number and date Sample Name_ Taken from the Plate Editor spreadsheet entry Well Position Taken from the sample s position on the plate column letter and row number e g C3 Plate Name Taken from the Plate Editor dialog box entry Instrument ID Taken from the Data Collection page preferences entry Array ID Taken from the Install Capillary Array Wizard
45. e instrument this action may require two or more people Introduction 1 7 Performing a Sequencing Run Overview In This Chapter This chapter includes the following topics Topic See Page Before You Begin 2 2 ABI Prism 3100 Genetic Analyzer User Flowchart for Sequencing 2 3 Starting the Data Collection Software 2 4 Setting Software Preferences 2 6 Working with Plate Assemblies 2 8 Checking and Refilling Fluids 2 10 Placing the Plate onto the Autosampler 2 14 Creating a Plate Record 2 15 Linking and Unlinking a Plate 2 22 Starting and Monitoring the Run 2 25 Stopping a Run and Recovering the Data 2 26 Viewing Editing or Creating a Run Module 2 27 About Viewing and Editing Analysis Modules for DNA Sequencing 2 29 Performing a Sequencing Run 2 1 Before You Begin Assumptions The 2 2 Performing a Sequencing Run procedures in this chapter make the following assumptions The computer and the instrument have been correctly configured The instrument has been calibrated spatial and spectral calibrations have been successfully run If necessary refer to Chapter 4 of this guide There is sufficient space on the computer hard drive If necessary refer to Chapter 5 of this guide The samples have been correctly prepared and resuspended For information about sample preparation see the AB PRISM 3100 Genetic Analyzer Sequencing Chemistry Guide P N 4315831 ABI PRI
46. e located on the instrument Each safety label has three parts A signal word panel which implies a particular level of observation or action e g CAUTION or WARNING If a safety label encompasses multiple hazards the signal word corresponding to the greatest hazard is used A message panel which explains the hazard and any user action required A safety alert symbol which indicates a potential personal safety hazard See the ABI PRISM 3100 Genetic Analyzer Site Preparation and Safety Guide for an explanation of all the safety alert symbols provided in several languages As the generator of potentially hazardous waste it is your responsibility to perform the actions listed below Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure the health and safety of all personnel in your laboratory Ensure that the instrument waste is stored transferred transported and disposed of according to all local state provincial or national regulations Note Radioactive or biohazardous materials may require special handling and disposal limitations may apply Ensure that everyone involved with the operation of the instrument has Received instruction in general safety practices for laboratories Received instruction in specific safety practices for the instrument Read and understood all related MSDSs yx eh Avoid using this instrumen
47. e the ABI PRISM 3100 Genetic Analyzer User s Manual Maintaining the Instrument 5 5 Checking the Available Space Introduction Before a run or batch of runs check the available space to ensure there is sufficient space to store the data you will create Every week delete records in the database The procedures that follow tell you Howto check the available space on the hard drive typically located on drive D for the extracted sample files How to check the available space in the instrument database typically located on drive E for the raw data Where to find the procedures for deleting database records Checking Hard To check the hard drive for space for sample files Drive Space Step Action 1 Double click the My Computer icon on the desktop to view the drives 2 Right click the D drive icon and select Properties A My Computer Iofx Fils Edit View Help 18 My Conputer E E des lale Jes e 3 Floppy 4 3100Files D Properties General Tools Sharing Security L2 x Label 3100Files Type Loca Disk File system NTFS Bl Used space Ji Free space 1 644 572 672 bytes 5 305 786 358 bytes 1 53GB 4 94GB 5 350 358 040 bytes Capacity 6 47GB Dive D Compress D cot J ess 5 6 Maintaining the Instrument To check the hard drive for space for sample files continued
48. ect an appropriate file from the Factura Settings File list A FIP Factura Settings File FSFfile FSFfile P For more information about Factura processing refer to the ABI PRism DNA Sequencing Analysis Software User Guide Reanalyzing Sample Files Step 1 2 3 4 5 Check the P box only if you want each sample file printed immediately after analysis This is not recommended If you do check the P box you should be sure that the printing preferences are correctly set To view the printing preferences from the Edit menu point to Preferences and select Printing Preferences 3 10 Viewing and Analyzing Data Analysis Settings on the Sample Manager Window To analyze or reanalyze sample files continued Step Action 6 Review the settings in the Sample Manager window Refer to the table Analysis Settings below for more information 7 Check that the DyeSet Primer file is appropriate to your sequencing chemistry page 2 18 The DyeSet Primer file is the same as the mobility file that you selected in step 3 on 8 Click the Start button 9 Review the analyzed data If necessary change analysis parameters and reanalyze Analysis Settings Item Description Basecaller There are two basecaller options Basecaller 3100SR bcp standard sequencing default spacing range 10 15 Basecaller 3100RRv2 bop rapid run sequencing default spacing 15 2
49. em you may want to refer to the AB PRISM DNA Sequencing Analysis Software User Guide P N 4308924 for information about accessing the database using the analysis program Viewing and Analyzing Data 3 1 Viewing Raw Data Introduction Raw data is data that has been multicomponented corrected for spectral overlap but mobility correction has not been applied There are two formats for viewing the raw data within the ABI PRISM9 3100 Data Collection Software Inthe Array View page in much the same way that you might view the gel file output from a 377 instrument Inthe Capillary View page capillary by capillary Note Only current run data can be viewed during a run you cannot view data from previous runs while the instrument is running IMPORTANT Always exit from the Array View and the Capillary View windows During a run do not leave these pages open for extended periods This may cause unrecoverable screen update problems Leave the Status View window open Viewing Raw Data To view raw data from a completed run Step Action 1 In the Data Collection software click the Array View tab to display the Array View page 2 From the Instrument menu point to Data Acquisition and choose Display Run Data The Select the run to display dialog box opens S Select the run to display X Run demo 3100 2000 04 06 23 OK Cancel 3 From the drop down list select the run that you want to display and click OK Not
50. emicals manufactured or distributed by Applied Biosystems using the contact information below To order documents by automated telephone service 1 From the U S or Canada dial 1 800 487 6809 or from outside the U S and Canada dial 1 858 712 0317 2 Follow the voice instructions to order documents for delivery by fax Note There is a limit of five documents per fax request To order documents by telephone In the U S Dial 1 800 345 5224 and press 1 Toorder in English dial 1 800 668 6913 and press 1 then 2 then 1 In Canada To order in French dial 1 800 668 6913 and press 2 then 2 then 1 From any other country See the specific region under To Contact Technical Support by Telephone or Fax Outside North America To view download or order documents through the Applied Biosystems web site Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page click Documents on Demand then click MSDS 3 Click MSDS Index search through the list for the chemical of interest to you then click on the MSDS document number for that chemical to open a pdf of the MSDS Instrument Safety Labels About Waste Disposal Before Operating the Instrument Safe and Efficient Computer Use For chemicals not manufactured or distributed by Applied Biosystems call the chemical manufacturer Safety labels ar
51. ess CTRL D whenever a field is the same for all samples in the plate record 5 For each sample select the appropriate Run Module from the drop down list Run Module no selection z RapidSeq36_POP6DefautModule StcSeq50 POPBDefaultModule Note If you need to view or edit a run module file see page 2 27 The table below shows the run module to select based on your run type Run Type Run Module Standard DNA sequencing StdSeq50_POP6DefaultModule Rapid DNA sequencing RapidSeq36_POP6DefaultModule Note If you select different modules for different samples the samples will be automatically grouped so that all samples with the same run module are run at the same time Runs are scheduled alphanumerically by run module name not by the order indicated in the plate record nor by sample name To see the scheduled order of the runs select the Run View tab Performing a Sequencing Run 2 19 To enter sample information and save the plate record continued Step Action 6 For each sample select the appropriate Analysis Module from the drop down list IMPORTANT The AutoAnalysis preference must be selected if analysis is to take place automatically after the run see page 2 7 Analysis Module 1 no selection bd no selection BC 3100RRv2 SeqOffFtOff saz BC 3100SR SeqOffFtOff saz The table below shows the analysis module to select based on your run type
52. f the page then click Frequently Asked Questions 3 Click you geographic region for the product area of interest 4 Follow the instructions under the Frequently Asked Questions section 1 to display a list of FAQs for your area of interest Search the Solution Database To search for solutions to problems using the Solution Database Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Frequently Asked Questions 3 Follow the instructions under the Search the Solution Database section 2 to find a solution to your problem Submit a Question To submit a question directly to Technical Support Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Frequently Asked Questions 3 In the Personal Assistance E Mail Support section 3 click Ask Us RIGHT NOW In the displayed form enter the requested information and your question then click Ask Us RIGHT NOW Within 24 to 48 hours you will receive an e mail reply to your question from an Applied Biosystems technical expert To Obtain Technical You can obtain technical documents such as Applied Biosystems user documents Documents MSDSs certificates of analysis and other related documents for free 24 hours a day You can obtain documents Bytelephone Through the Applied Biosys
53. g a syringe always inspect it for missing O rings to avoid leaks during your run To inspect the syringe Step Action 1 Inspect the syringe for two O rings P N 221102 one behind the ferrule and one around the ferrule O rings DULL ULL LG 0 05 0 1 0 15 0 2 0 25 GR0413 Verify that the ferrule is firmly seated in the end of the syringe Maintaining the Instrument 5 9 Removing the Polymer Blocks Removing the Upper To remove the upper polymer block Polymer Block Step Action 1 Remove the syringe guard 2 Remove the syringes as described on page 5 8 3 Disconnect the capillary array from the polymer block Press the Tray button Open the instrument oven and detection block doors Loosen the capillary array nut Pull out the polymer block part way Remove the detection cell from the detection block 929 5 p Remove the capillary array sleeve from the polymer block g If the capillary array is to be reused store it as described on page 5 16 Disconnect the lower polymer block by unscrewing the polymer block tube fitting on the upper polymer block s under right side Grasp the upper polymer block with two hands and pull it straight out The upper polymer block rides on two steel shafts and slides out easily after a spring moves past a check point Removing the Lower To remove the lower polymer block
54. gloves while performing the following procedure and any other time you handle the capillary array glass syringes septa or buffer reservoirs To store the capillary array off the instrument Step Action 1 Fill the capillary array with fresh polymer using the Change Polymer Wizard or manual control commands Remove the syringe guard Remove both syringes from the upper polymer block and properly dispose of any remaining polymer Wash the syringes Remove the capillary array from the instrument using the Install Replace Capillary Array Wizard For instructions see Installing and Removing the Capillary Array on page 5 15 6 Replace the cover over the detection cell 7 a Fill a buffer reservoir with 1X Genetic Analyzer buffer and cover with a septa strip b Insert the capillary tips into the buffer 8 a Fill a storage tube from a new array or a 5 mL ABI 310 buffer vial P N 401955 with septa and cap P N 401956 with 1X Genetic Analyzer buffer b Insert the rod end of the capillary array into the tube vial 9 Wrap the tube with laboratory film such as Parafilm to prevent evaporation 10 Store the capillary array upright 11 Check the 1X Genetic Analyzer buffer level in the reservoir and tube weekly Store the capillary array on the instrument when the capillary array will be unused for less than one month To store the capillary array on the instrument follow
55. h long names cannot be opened by the analysis software 2 16 Performing a Sequencing Run To enter sample information and save the plate record continued Step Action 2 For each sample select the appropriate Dye Set from the drop down list For the ABI PRISM DNA Sequencing Analysis software select Dye Set E BigDye Terminator version 1 0 or Dye Set Z BigDye Terminator version 3 0 Note Itis possible to run different dye sets for different samples in the same run Dye Set no selection IMPORTANT Be sure to select the correct dye set for your run s Data collected with the incorrect dye set selected cannot be saved and the runs will have to be repeated because multicomponenting is applied during collection Performing a Sequencing Run 2 17 To enter sample information and save the plate record continued Step Action 3 For each sample select the appropriate Mobility File from the drop down list Mobility File sno selection DP31 00POP6 BD 21 M1 3 v1 mob DP3100POP6 BD M1 3Rev W1 mob DP3100POPB BDv3 21M13 v1 mob DP3100POPB BDv3 M13Rev v1 mob DT3100POPB BDv3 v1 mob DT3100POP6 BD W2 mob DT3100POPB dRhod v1 mob Note You may need to resize the column to see the whole file name To do this place the cursor between the column headers it will become a double headed arrow and drag right Mobility File Comment The table below shows which mobilit
56. he upper pane locate and open the folder that contains the files you want to add b Double click file names to add them to the File name text box c Use the Add All Remove or Remove All buttons as necessary to list all the files that you want in the File Name list box These are the files that will be added to the Sample Manager Look jn 3 analyzed Success x amp Ek P StdP ESCL5 80 338F A02 02ab M amp TD ESCL5 40 338F BO1 03 abi Pr sidP ESCL5 80 357R E02 10 461 MA TD_ESCL5_40_357R_FO1_11 ab1 Pr TD Conwol 40 338F DO O7 ab Mi TD ESCLS 80 338F A01 D1 abi PA TD_Control_40_357R_HO1_15 ab1 M3 TD_ESCL5_80_357R_E01_09 ab1 P TD_Control_80_338F_CO1_05 ab1 H TD_Control_80_357R_GO1_13 ab1 Find file names in this directory pane and click Add to add them to the File name text box File name _05 ab1 TD_Control_40_338F_D01_07 ab1 g File name text box Files of type Sample data files ab1 FleNam adaal TD Control 40 338F DOT O7 ab1 Lea TD_Control_40_357R_HO1_15 ab1 File Name pane TD Control B0 338F C01 05 abl TD Contro 80 357H GOT 13 ab Remo Remove All Finish Cancel Click the Finish button to close the Add Sample Files dialog box The sample files are added to the Sample Manager window Note Only the first 20 characters of the sample file name are displayed in the Sample Manager window d Sequencing
57. ield Service outside North America use the telephone or fax numbers below Region Telephone Fax Eastern As ia China Oceania Australia Scoresby Victoria 61 3 9730 8600 61 3 9730 8799 China Beijing 86 10 64106608 or 86 10 64106617 86 800 8100497 Hong Kong 852 2756 6928 852 2756 6968 India New Delhi 91 11 653 3743 3744 91 11 653 3138 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 79588268 60 3 79549043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 75 0 43 0 1 867 35 75 11 Belgium 32 0 2 532 4484 32 0 2 582 1886 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Italy Milano 39 0 39 83891 39 0 39 838 9492 Region Telephone Fax Norway Oslo 47 23 12 06 05 47 23 12 05 75 Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 12 06 Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d
58. in the United States and other countries Oracle is a registered trademark of the Oracle Corporation pGEM is a registered trademark of Promega Corporation All other trademarks are the sole property of their respective owners Printed in the USA 07 2001 Part Number 4315833 Rev C Contents 1 Introduction Overview oo einen bee iens Men eg eee we hgh ORE RICH 1 1 About This Manual deed eR ie eed eee ao EG aa atte E eda Gene dd 1 2 Eor More Information 5 oo ok deena haa ie el RESO eu ee 1 2 NL A M M art 1 3 2 Performing a Sequencing Run OVerVIeW a eic det rv t EV eie e RUPEE OIN QU aUe 2 1 Before You Besins iie de peck ne ASPERIS URP REC ee ub 8 2 2 ABI PRISM 3100 Genetic Analyzer User Flowchart for Sequencing 2 3 Starting the Data Collection Software 2 0 ee 2 4 Setting Software Preferences lisse 2 6 Working with Plate Assemblies leleeeseeeeee e 2 8 Checking and Refilling Fluids 0 0 0 0 ee cc e 2 10 Placing the Plate onto the Autosampler 0 0 cece eee eee eee ene nee 2 14 Creating a Plate Record ek ee daa eee geile hentia e RUD Ee 2 15 Linking and Unlinking a Plate 2 2 II 2 22 Starting and Monitoring the Run 2 0 0 eee eee 2 25 Stopping a Run and Recovering the Data 0 0 0 eee eee 2 26 Viewing Editing or Creating a Run Module 0 0 00 cece eee eee 2 27 About Viewing and Editing Analysis Mo
59. ition indicator for the linked plate becomes green Plate record moves from the Pending Plate Records table to the Linked Plate Records table Run Instrument r Plate position FEL 00 Data Collection Software Version 1 0 1 File View Instrument Toos Service Helg eI gt t Lele ale Plate View Run View Status View Array view Capillary View Pending Plate Records Pte Name Application Wells Status 082030 GS 96 pending 0824 crosstak GS 96 pending 0827 GS 96 pending B nasa GS aR pending Piace a plate into 08299m GS 96 pending plate position E 50B038 34 spe Spectral 96 pending xl Linked Plate Records Flate Name Application Wells Status Amy late record SQ 96 pending B Processed Plats Records Plate Name Application Wells Status 061430 os 96 processed a 0815 GS 96 processed 081730 Gs 96 processed 081830 GS 96 processed 081930 GS 96 processed 08200m os 06 processed d om e rms Plate record is in the Linked Plate Records table 4 Repeat steps 1 3 to link a second plate if applicable Performing a Sequencing Run 2 23 2 24 To link a plate to a plate record continued Step Action 5 Click the Run View tab to view the run schedule Note Although individual runs can be deleted the order in which the runs are scheduled cannot be altered Run scheduling depends upon a number of factors see the ABI PRISM 3100 Genetic An
60. lace the keyboard on a surface that provides The proper height to position the forearms horizontally and upper arms vertically Support for the forearms and hands to avoid muscle fatigue in the upper arms Position the viewing screen to the height that allows normal body and head posture This height depends upon the physical proportions of the user Adjust vision factors to optimize comfort and efficiency by Adjusting screen variables such as brightness contrast and color to suit personal preferences and ambient lighting Positioning the screen to minimize reflections from ambient light sources Positioning the screen at a distance that takes into account user variables such as nearsightedness farsightedness astigmatism and the effects of corrective lenses When considering the user s distance from the screen the following are useful guidelines The distance from the user s eyes to the viewing screen should be approximately the same as the distance from the user s eyes to the keyboard For most people the reading distance that is the most comfortable is approximately 20 inches The workstation surface should have a minimum depth of 36 inches to accommodate distance adjustment Adjust the screen angle to minimize reflection and glare and avoid highly reflective surfaces for the workstation Use a well designed copy holder adjustable horizontally and vertically that allo
61. ll occur if the plate retainer and septa strip holes do not align correctly The plate retainer holes must align with the holes in the septa strip 9000090 NO 99999 0 6 Performing a Sequencing Run 2 9 Checking and Refilling Fluids Adding or Changing Determine whether to add or change the polymer on the instrument before proceeding Polymer with instrument preparation When to Replace the Buffer If polymer on the instrument is Then less than 1 week old and Ensure there are no air bubbles and then proceed T with instrument preparation sufficient in quantity to complete prep your runs Note To remove any air bubbles see page 5 4 greater than 1 week old or Fill the syringes and the upper polymer block with fresh polymer by following the Change Polymer Wizard For instructions see page 5 13 CHEMICAL HAZARD POP polymers may cause eye skin and respiratory tract irritation Please read the MSDS for the polymer you are using and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Use for research and development purposes only 3100 Data Collection Software File View Instrument BGR Service Help eal E L1 E m j Plate Editor Module Editor Plate View Run View Mit insufficient in quantity to complete your runs Install Capillary Array Wizard Autosampler Calibration Vizard Perform Spatial
62. nal IMPORTANT When naming the plate you can use letters numbers and the following punctuation only _ Do not use spaces When done click Finish The Plate Editor spreadsheet opens Plate Editar File Edit Plate Name MAET Wel Sample Neme Dye Set Mobility File comment BIoLIMS Project Run Module A1 B C1 D1 El Entering Sample To enter sample information and save the plate record Information Step Action 1 In the Plate Editor spreadsheet type the names of all the samples in the Sample Name column Use Edit Copy and Edit Fill Down whenever a field is the same for all samples in the plate record Note Inthe default naming convention the sample name you type is incorporated into the sample file name For example MySample A01 01 ab1 LJ Capillary position Well position Sample name you type The sample file naming convention used can be changed in the Preferences dialog box See page 2 7 for details IMPORTANT When naming the samples you can use letters numbers and the following punctuation only _ Do not use spaces IMPORTANT Be sure that sample file names are not longer than 55 characters An underscore separates each preference selected so be sure to count the underscore in the number of characters There is no automatic error checking for sample names that exceed this limit Sample files wit
63. net address customer training information A 7 Documents on Demand A 6 L linking a plate 2 22 M maintenance discussed 5 2 to 5 18 manuals 3100 set 1 2 matrix standards preparing 4 6 MSDS how to order 1 4 O OrbixWeb starting 2 4 P part numbers manuals 1 2 parts and consumables See user s manual plate assembly placing on autosampler 2 14 plate record creating 2 15 to 2 21 creating for spectral calibration 4 8 linking a plate 2 22 Plate View tab 2 15 2 22 polymer blocks cleaning 5 11 removing air bubbles 5 4 removing from instrument 5 10 polymer adding or changing 2 10 5 12 preferences 2 6 printing sample files 3 9 R raw color data viewing in Data Collection software 3 2 to 3 3 reservoirs filling 2 10 to 2 13 positions on autosampler 2 12 Index 1 run monitoring 2 25 skipping pausing stopping 2 26 starting 2 25 run module selecting 2 19 viewing editing and creating 2 27 S safety discussed 1 3 to 1 7 manual 1 2 sample files maximum length for 2 16 printing 3 9 viewing in Sequencing Analysis software 3 9 Sample Manager window 3 5 adding files to 3 5 to 3 6 sample preparation Sequencing Chemistry Guide 1 2 sample window views Sequencing Analysis described 3 8 Select the run to display dialog box 3 2 Sequencing Analysis software directory path for SeqA exe 2 29 3 5 sample window views described 3 8 Skip to Next Run button 2 26 software preferences 2 6 spatial calibration
64. ng a Previously Used Capillary Array 5 14 Installing and Removing the Capillary Array 5 15 Storing a Capillary Array 5 16 Shutting Down the Instrument 5 17 Maintaining the Instrument 5 1 Maintenance Task Lists Overview This section lists common tasks required to maintain your Genetic Analyzer in good working condition The lists are divided into tables based on how often you should perform each task IMPORTANT Wear gloves anytime you handle the capillary array glass syringes septa or buffer reservoirs Daily Tasks Perform the tasks listed below at least once per day Maintenance Task Frequency See Ensure the reservoir septa are firmly seated and flat Before each run Ensure the plate assemblies were put together properly Before each run page 2 9 IMPORTANT The holes in the plate retainer must align with the holes in the septa or the capillary tips will be damaged Ensure the plate assemblies are positioned on the plate Before each run deck properly Plates should sit snugly on the deck IMPORTANT Never use warped plates Replenish the water and 1X 3100 Genetic Analyzer Daily page 2 10 buffer reservoirs on the instrument Check for bubbles in the polymer block and polymer Daily page 5 4 block channels and remove IMPORTANT Ensure bubbles are purged through the peek tubing into the buffer reservoir Check the loading end header to ensure the capillary tips Daily
65. olymer Block Removing Air Note For information about the Change Polymer wizard see the ABI PRISM 3100 Genetic Bubbles Analyzer User s Manual P N 4315834 To remove air bubbles from the upper polymer block use the Change Polymer Wizard as described in the steps below Step Action 1 Push down on the polymer reserve syringe to move bubbles through to the lower right of the block Push slowly or tap to minimize the amount of polymer used 2 Push down slowly on the array fill syringe to move bubbles down the channel The bubbles will collect where the channels join Bubbles collect here Polymer block tube o o N tc o 3 a Hold down the anode buffer pin valve and simultaneously push down on the array fill syringe to build pressure in the channels b Release the buffer pin valve while still pressing down on the array fill syringe to expel bubbles into the polymer block tube GR1877 5 4 Maintaining the Instrument To remove air bubbles from the upper polymer block use the Change Polymer Wizard as described in the steps below continued Step Action 4 Repeat step 3 as necessary IMPORTANT Make sure all air bubbles are pushed out of the tubing assembly into the lower buffer reservoir before proceeding There should be no bubbles in the tubing or channel of the lower polymer block Note For more information about the Change Polymer Wizard se
66. on you can download documents in PDF format from the Applied Biosystems web site Please see the section To Obtain Technical Documents following the telephone information below To Contact Technical You can contact Applied Biosystems Technical Support by e mail for help in the Support by E Mail following product areas Product Product Area E mail address Genetic Analysis DNA Sequencing galab appliedbiosystems com Sequence Detection Systems Real Time pcrlab appliedbiosystems com PCR and PCR Protein Sequencing Peptide and DNA corelab 9 appliedbiosystems com Synthesis Getting Help A 1 A 2 Getting Help Product Product Area E mail address o 9 9 9 9 9 Biochromatography BioCAD SPRINT VISION and INTEGRAL Workstations and POROS Perfusion Chromatography Products Expedite 8900 Nucleic Acid Synthesis Systems MassGenotyping Solution 1 MGS1 Systems PNA Custom and Synthesis Pioneer Peptide Synthesizers Proteomics Solution 1 PS1 Systems ICAT Reagent FMAT 8100 HTS Systems Mariner ESI TOF Mass Spectrometry Workstations Voyager MALDI TOF Biospectrometry Workstations CytoFluor 4000 Fluorescence Plate Reader tsupport appliedbiosystems com LC MS Applied Biosystems MDS Sciex support sciex com Chemiluminescence Tropix tropix appliedbiosystems com To Contact Technical To contact Applied Biosystem
67. opic See Page Performing a Spatial Calibration 4 2 Performing a Spectral Calibration 4 6 Spatial and Spectral Calibrations 4 1 Performing a Spatial Calibration When to Doa A spatial calibration must be performed after each time you Spatial Calibration What a Spatial Calibration Tells You Performing a Spatial Calibration Install or replace a capillary array Temporarily remove the capillary array from the detection block A spatial calibration provides information about the position of the fluorescence from each capillary on the CCD camera It does not provide information about the performance of the capillaries To perform a spatial calibration Step Action 1 From the Tools menu select Perform Spatial Calibration The Perform Spatial Calibration dialog box opens i Perform Spatial Calibration x Spatial calibration progress Click on the Start button to initiate spatial calibration Fill capillaries pere Stat Cancel Select the Fill capillaries check box if the Capillaries have no polymer i e a new capillary array or Polymer in the capillaries has been used in a run Note You do not need to fill the capillaries each time you perform a spatial calibration Click Start The calibration takes approximately 2min without filling the capillaries 6min with filling the capillaries 4 2 Spatial and Spectral Calibrations To perform a s
68. ork with any chemicals or hazardous materials Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or protective clothing For additional safety guidelines consult the MSDS Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation e g fume hood For additional safety guidelines consult the MSDS Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal PNG Ie CHEMICAL WASTE HAZARD Wastes produced by Applied Biosystems instruments are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the manufacturers of the chemicals in the waste container before you store handle or dispose of chemical waste Handle chemical wastes in a fume hood Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or protective clothing For additional safety guidelines consult the MSDS Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation e g fume hood For addition
69. ow to link a plate on the autosampler to the plate record you have created This must be done before a plate can be run IMPORTANT A plate can be linked even if there are no run modules selected for its samples In this case there is no error message and runs for samples in the plate will not be scheduled Linking a Plate toa To link a plate to a plate record Plate Record Step Action 1 Click the Plate View tab on the 3100 Data Collection Software window to go to the Plate View page Plate View tab Plate View Run View Status View Array View Capillary View 2 On the Plate View page a In the Pending Plate Records table click the plate record for the plate you are linking b Click the plate position indicator that corresponds to the plate you are linking Click the plate record Pending Plate Records Plate Name Application Wells Status sa 96 pending Place a plate into plate position B Linked Plate Records Plate Name Application Wells Status A Processed Plate Records Plate Name Application Wells Status Click anywhere on the plate position indicator 2 22 Performing a Sequencing Run To link a plate to a plate record continued Step Action 3 Verify that the plate has been linked Once the plate has been linked the Run Instrument button on the toolbar is enabled meaning that the instrument is ready to run Plate pos
70. patial calibration continued Step Action 4 If the calibration Then succeeded the following dialog box opens A Perform Spatial Calibration a Click Details to view the Spatial Calibration Profile window b Continue on to Viewing Successful Results and Saving the Data below failed an error message box opens providing some information about the reason for the failure Perform Spatial Calibration a Click Details to view the Spatial Calibration Profile window b Do one of the following Click Cancel and then click Start to repeat the calibration Take corrective action as outlined on page 4 5 Spatial and Spectral Calibrations 4 3 Viewing Successful To view the spatial calibration results and save the data Results and Saving the Data Step Action 1 Evaluate the spatial calibration profile Note For information about evaluating the profile see the AB PRISM 3100 Genetic Analyzer User s Manual P N 4315834 OEIL Profile x 400007 300007 200001 100001 0 10000 o 20 40 60 80 100 120 140 160 180 200 220 240 260 Intensity vs Pixel Number Capillary Number 1 2 3 4 5 6 a eal T 8 g AIDS 25 T3 SAIE Capillary Position fiz 27 M2 ps f3 88 pos p19 34 frag 165 180 figs 10 225 p41 When you are finished click OK to close the Spatial Calibration Profile window If the spatial calibration profile is Then
71. ration Application C Sequencing C GeneScan Spectral Calibration Plate Type os wet Comments e Finish Cancel The Plate Editor spreadsheet opens Complete the Plate Editor spreadsheet for the wells you have loaded a Type a name for the samples b Select Dye Set E or Dye Set Z c Select the run module depending on your capillary array size 36 cm Spect36 POP6DefaultModule 50 cm Spect50_POP6DefaultModule d Select the spectral parameter MtxStd Sequencing SetE par or MtxStd Sequencing SetZ par e Click OK IMPORTANT Make sure the correct spectral parameter file has been selected for the type of dyes you are running Selecting the incorrect parameter file will cause the spectral calibration to fail This creates a plate record for the calibration run in the database After a few seconds the entry for the plate record appears in the Pending Plate Records table of the Plate Setup page Spatial and Spectral Calibrations 4 9 Linking the Plate To link the plate record to the plate Step Action 1 In the Pending Plate Records table select the plate record that you just created 2 Click the plate graphic that corresponds to the plate on the autosampler 3100 Data Collection Software x File View Instrument Tools Service Help AS Jm m ele Plate View Run view status view Array View Capillary View Pending Plate Records
72. recoverable screen update problems will occur Leave the Status View window open For more information about the Array and Capillary views see Viewing Raw Data on page 3 2 Performing a Sequencing Run 2 25 Stopping a Run and Recovering the Data Stopping or When a run is in progress the Skip Pause and Stop buttons on the toolbar are Skipping a Run visible 3100 Data Collection Software File View Instrument Tools Service Help Stop button Pause button Skip to Next Run button To stop the current run and Click continue the other scheduled runs the Skip button stop the other scheduled runs a the Stop button b Now in the Question dialog box 1 Stop now or after current run After run Cancel If Autoextraction The auto extractor should have automatically extracted your data from the stopped Fails run If it did not use the Extract data into sample files commands as described below To recover data from a stopped run Step Action 1 From the Instrument menu point to Data Acquisition and select Extract data into sample files 3100 Data Collection Software Version 1 0 1 File View Toos Service Help 5 Rony Skip IG MEX Ronn Plate view pouse Array View Capilary View Stay Manual Control Data Acquisiticn ld Set Cobr Plate Name Applicali GOCE RUT Status to Gamplete rs Display Ruri Dala Display
73. ries represented by x s and passed capillaries represented by dots Passed capillary Failed capillary X E Spectral Calibration Result Found 11 possible spectra for dye set E Please view and editthe spectra LOC JOE PITT x To acknowledge the completed calibration run Step Action 1 In the Spectral Calibration Result dialog box click OK IMPORTANT Review and evaluate the spectral calibration profile for each capillary even if the Spectral Calibration Results box indicated that they all passed See the ABI PRISM 3100 Genetic Analyzer User s Manual If a capillary fails it is automatically assigned the spectral profile of its nearest passing capillary to the left If there are no passing capillaries to the left it will be assigned the profile of the nearest passing capillary to the right These capillaries are marked yellow instead of green in the Array View window e g page 3 3 IMPORTANT For applications where pull up and pull down peaks will cause critical errors we recommend that you repeat the spectral calibration and use a unique spectral for each capillary If the spectral calibration failed or if you do not like the appearance of the passed calibration try one or more of the following Verify that the correct parameter file and run module were selected If not correct and then repeat the run Verify the freshness of the reagents used Verify that all peaks
74. s continued Step Action 8 Place a clean septa strip on each reservoir and dry the outside of the reservoirs using a lint free wipe Note We suggest labeling the reservoirs to prevent mixing them up yx eh Be sure that the septa fit snugly and flush on the tops of the reservoirs in order to prevent damaging the capillary tips Septa is lying flat on the reservoir Fill line Place the reservoirs into position on the autosampler as shown below Water reservoir waste Water reservoir Filling the Anode Change the anode buffer Buffer Reservoir 4 Before each batch of runs or at least every 24 hours Every time you fill the polymer block with new polymer To fill the anode buffer reservoir to the fill line with Genetic Analyzer buffer Step Action 1 Remove the anode buffer reservoir by firmly pulling down and twisting slowly Discard the used buffer appropriately Clean and rinse the reservoir with deionized water and then rinse with buffer 2 3 4 Fill the reservoir to the fill line with fresh 1X Genetic Analyzer buffer about 9 mL PN ne CHEMICAL HAZARD Genetic Analyzer Buffer with EDTA may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Fill line GR1878 Performing
75. s Technical Support in North America use the telephone Support by Telephone or Fax North America or fax numbers in the table below Note To schedule a service call for other support needs or in case of an emergency dial 1 800 831 6844 then press 1 Product Product Area Telephone Fax ABI PRISM9 3700 DNA Analyzer 1 800 831 6844 then press 8a 1 650 638 5981 DNA Synthesis 1 800 831 6844 press 2 then press 18 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 press 2 then press 2 1 650 638 5981 Fluorescent Fragment Analysis including GeneScan applications 1 800 831 6844 press 2 then press 38 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM9 877 and Catalyst 800 instruments 1 800 831 6844 press 2 then press 4a 1 650 638 5981 ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 press 2 then press 62 1 650 638 5981 Peptide Synthesis 433 and 43x Systems 1 800 831 6844 press 3 then press 1a 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 press 3 then press 2a 1 650 638 5981 Sequence Detection Systems Real Time PCR and PCR 1 800 762 4001 then press 1 for PCRa 2 for TaqMan applications and Sequence Detection Systems including ABI Prism 7700 7900 and 57008 6 for the 6700 Automated Sample Prep Systema or 1 800 831 6844 then press 5a 1 240 4
76. ssbernseesrtivsesteerzzespTie bE Eee 4 ee ee Re ke wed A 1 Index Introduction Overview In This Chapter This chapter includes the following topics Topic See Page About This Manual 1 2 For More Information 1 2 Safety 1 3 Introduction 1 1 About This Manual Purpose The purpose of this manual is to give users basic instructions on how to Do a sequencing run Analyze the resulting data Calibrate and perform routine maintenance on the ABI PRISM9 3100 Genetic Analyzer For More Information Where to Find More Other manuals and guides that relate to the ABI PRISM 3100 Genetic Analyzer are Information listed below Part If you want Refer to the Number detailed safety information and information about ABI PRISM 3100 Genetic Analyzer Site Preparation 4315835 preparing your lab for the 3100 Genetic Analyzer and Safety Guide detailed information about the 3100 Genetic ABI PRISM 3100 Genetic Analyzer User s Manual 4315834 Analyzer information about preparing samples and selecting AB PRISM 3100 Genetic Analyzer Sequencing 4315831 and optimizing chemical methods for sequencing Chemistry Guide on the 3100 Genetic Analyzer detailed information about analyzing and viewing ABI PRISM DNA Sequencing Analysis Software 4308924 sequence data using the DNA Sequencing User Guide v 3 7 Analysis program an abbreviated procedure for how to do a typical ABI PRISM 3100 Genetic Analyzer Q
77. t in a manner not specified by Applied Biosystems Although the instrument has been designed to protect the user this protection can be impaired if the instrument is used improperly Operating the computer correctly prevents stress producing effects such as fatigue pain and strain To minimize these effects on your back legs eyes and upper extremities neck shoulder arms wrists hands and fingers design your workstation to promote neutral or relaxed working positions This includes working in an environment where heating air conditioning ventilation and lighting are set correctly See the guidelines below MUSCULOSKELETAL AND REPETITIVE MOTION HAZARD These hazards are caused by the following potential risk factors which include but are not limited to repetitive motion awkward posture forceful exertion holding static unhealthy positions contact pressure and other workstation environmental factors Use a seating position that provides the optimum combination of comfort accessibility to the keyboard and freedom from fatigue causing stresses and pressures The bulk of the person s weight should be supported by the buttocks not the thighs Introduction 1 5 Electrical Shock Warnings 1 6 Introduction Feet should be flat on the floor and the weight of the legs should be supported by the floor not the thighs Lumbar support should be provided to maintain the proper concave curve of the spine P
78. tems web site A 6 Getting Help Ordering Documents by Telephone To order documents by telephone 1 From the U S or Canada dial 1 800 487 6809 or from outside the U S and Canada dial 1 858 712 0317 2 Follow the voice instructions to order documents for delivery by fax Note There is a limit of five documents per fax request Obtaining Documents Through the Web Site To view download or order documents through the Applied Biosystems web site Step Action 1 Go to http www appliedbiosystems com 2 Click SERVICES amp SUPPORT at the top of the page then click Documents on Demand 3 In the search form enter and select search criteria then click Search at the bottom of the page 4 In the results screen do any of the following Click the pdf icon to view a PDF version of the document Right click the pdf icon then select Save Target As to download a copy of the PDF file Select the Fax check box then click Deliver Selected Documents Now to have the document faxed to you Select the Email check box then click Deliver Selected Documents Now to have the document PDF format e mailed to you Note There is a limit of five documents per fax request but no limit on the number of documents per e mail request To Obtain Customer To obtain Applied Biosystems training information Training Information Step Action 1 Go to http www appliedbiosystems
79. the Plate Editor to Create a Plate Record Entering Plate Record Information Plate records are data tables in the instrument database that store information about the plates and the samples they contain Note A plate record is similar to a sample sheet or an injection list that you may have used with other ABI PRISM instruments Follow the two procedures below to create a plate record with the Plate Editor See the ABI Prism 3100 Genetic Analyzer User s Manual P N 4315834 for other ways to create plate records and for information about importing and exporting plate records Note You cannot create a plate record while a run is in progress To enter plate record information Step Action 1 Click the Plate View tab on the 3100 Data Collection Software window to go to the Plate View page Plate View tab 2 On the Plate View page click New Or double click the Plate Editor button on the toolbar The Plate Editor dialog box opens Plate E ditor my plate record This is an example plate recnrad Performing a Sequencing Run 2 15 To enter plate record information continued Step Action 3 Use the Plate Editor dialog box to name your plate and to specify the application and plate type Entering comments is optional In the Plate Editor dialog box a Name your plate b Specify the application c Select the plate type d Enter any comments optio
80. the instructions below to perform a short term shutdown 5 16 Maintaining the Instrument Shutting Down the Instrument When to Perform Perform the appropriate shut down procedure as follows Each Shut Down Procedure If the instrument will be unattended for Perform this shut down procedure no more than 1 week with a full buffer reservoir Short term IMPORTANT The key to a successful short term shutdown is keeping the capillary array tip in 1X Genetic Analyzer buffer This prevents the polymer from drying in the capillaries for more than 1 week Long term Performing a To perform a short term shutdown Short Term Shutdown Step Action 1 Fill the capillaries with fresh polymer using manual control commands 2 Push the Tray button to move the autosampler forward 3 Fill the buffer reservoir with 1X Genetic Analyzer buffer to the black line on the reservoir y Ne eh CHEMICAL HAZARD Genetic Analyzer Buffer with EDTA may cause eye skin and respiratory tract irritation Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Fill other reservoirs with fresh deionized water Secure a septa onto each reservoir and place the reservoir in position 1 on the autosampler With the instrument doors open push the Tray button Close the instrument doors The autosampler will move to position
81. the print box for those sample files you want to print and clicking the Start button A r P JEA ojok Viewing and Analyzing Data 3 9 Analyzing or Reanalyzing Data Introduction Note For more information about analyzing data using DNA Sequencing Analysis software see the ABI PRISM DNA Sequencing Analysis Software User Guide When to Analyze Data with DNA Sequencing Analysis Software The sample file will not contain analyzed data if you did not specify an analysis module in the plate record If the sample file does not contain analyzed data you need to analyze the file as described in the procedure below When to Reanalyze Data with DNA Sequencing Analysis Software Reanalyze the sample files using DNA Sequencing Analysis software when you Chose the wrong analysis module file in the plate record Want to see the effect of changing analysis parameters on your data Analyzing or To analyze or reanalyze sample files Action If not already open start the DNA Sequencing Analysis software Add the files that you want to analyze to the Sample Manager window Note See steps 1 4 on pages 3 5 to 3 6 for instructions on how to add files to the Sample Manager window Check the A box for all sample files to be analyzed Note Press CTRL D the fill down command to complete a column for all sample files If you want Factura processing applied to the sample file check the F box and sel
82. the run e g analysis range and size standard parameters To view or edit an analysis module saz file Step Action 1 Start the DNA Sequencing Analysis software You may have an icon for the program on the Start menu If not you can find the DNA Sequencing Analysis software SeqA exe in the following directory D appliedbio SeqAnal Bin 2 From the File menu point to Open and select Seq AZ Settings Edit Sample Manager Window Help New Open Sample Ctrl C ose Clew Factura Settings SUP fares elc m 3 The analysis modules are stored in the following directory D appliedbio Shared Analysis Basecaller Params Select the analysis module that you want to view or edit Open L2 x Look in E Params E El e BC 31C0 SeqOffFt lf saz a BC 31CORR Sex0lfFtOlf saz a BC POPSLR_SeqOIfFtOfl saz ls BC POP amp Seq ffFtOff sez Fie name BC 3100 SegOtfFiOff saz Files of type sezSettinastsa A Cancel 4 Click Open The DNA Sequencing Analysis Setting file opens Performing a Sequencing Run 2 29 To view or edit an analysis module saz file continued Step Action 5 E BC 3100_SeqOfFtOff saz x Basecaller Basecaller Type Basecaller 3100SR v Basecaller Settings Default Settings w Write Seq Files Sequence File Format ABI FASTA You can edit the settings as follows Basecaller Type can be Basecaller 3100SR for standard sequencing
83. uick Start 431532 fragment analysis run view and analyze run data Guide for Fragment Analysis and perform common maintenance operations information on a procedure for block cleaning ABI PRISM 3100 Genetic Analyzer Block Cleaning 4322930 Procedure 1 2 Introduction Safety Documentation User Attention Words Chemical Hazard Warning Chemical Waste Hazard Warning Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as described below Note Calls attention to useful information IMPORTANT Indicates information that is necessary for proper instrument operation 7 Nor Ne gale Indicates a potentially hazardous situation which if not avoided may result in minor or moderate injury It may also be used to alert against unsafe practices PNG Mel Indicates a potentially hazardous situation which if not avoided could result in death or serious injury VW Indicates an imminently hazardous situation which if not avoided will result in death or serious injury This signal word is to be limited to the most extreme situations 7 NL CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments and protocols are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical manufacturer before you store handle or w
84. ws referenced hard copy material to be placed at the same viewing distance as the screen and keyboard Keep wires and cables out of the way of users and passersby Choose a workstation that has a surface large enough for other tasks and that provides sufficient legroom for adequate movement ELECTRICAL SHOCK HAZARD Severe electrical shock which could cause physical injury or death can result from working on an instrument when the high voltage power supply is operating To avoid electrical shock disconnect the power supply to the instrument unplug the power cord and wait at least 1 minute before working on the instrument NONIN ELECTRICAL SHOCK HAZARD To reduce the chance of electrical shock do not remove covers that require tool access No user serviceable parts are inside Refer servicing to Applied Biosystems qualified service personnel Laser Warning PFNO LASER BURN HAZARD An overheated laser can cause severe burns if it comes in contact with the skin DO NOT operate the laser when it cannot be cooled by its cooling fan Always wear laser safety goggles Moving and Lifting PAGON PHYSICAL INJURY HAZARD Improper lifting can cause painful and the Instrument Sometimes permanent back injury Use proper lifting techniques when lifting or moving the instrument Safety training for proper lifting techniques is recommended Do not attempt to lift or move the instrument without the assistance of others Depending on the weight of th
85. y file to select based on your sequencing chemistry DNA Sequencing Chemistry Mobility File ABI Prism BigDye Primer DP3100POP6 BD 21M13 v1 mob chemistry using the 21m13 primer ABI Prism BigDye Primer DP3100POP6 BD M13Rev v1 mob chemistry using the reverse primer ABI PRisM BigDye Primer v 3 0 DP3100POP6 BDv3 21M13 v1 mob chemistry using the 21m 13 primer ABI PRISM BigDye Primer v 3 0 DP3100POP6 BDv3 M13Rev v1 mob chemistry using the reverse primer ABI Prism BigDye Terminator v 3 0 DT3100POP6 BDv3 v1 mob chemistry ABI PRISM BigDye Terminator DT3100POP6 BD v2 mob chemistry ABI PRISM dRhodamine Terminator DT3100POP6 dRhod v1 mob chemistry 2 18 Performing a Sequencing Run To enter sample information and save the plate record continued Step Action 4 Enter a BioLIMS project IMPORTANT A BioLIMS project is required for every sample even if a BioLIMS database is not used a Click in the BioLIMS Project cell for Well A1 b Select a project name from the drop down list BioLIMS Project 3100 Project1 Note For more information about setting up a BioLIMS project see the ABI PRISM 3100 Genetic Analyzer User s Manual c To assign the same project name to each sample in the plate record Click the column header to select the whole column Press CTRL D The Project Name for every sample in the plate record is now the same Note Pr
86. yes skin and respiratory tract It may cause damage to the central nervous system and the male and female reproductive systems and is a possible birth defect hazard Please read the MSDS and follow the handling instructions Wear appropriate protective eyewear clothing and gloves Vortex thoroughly Centrifuge briefly in a microcentrifuge Denature the DNA by heating the tube for 5 min at 95 C c1 AeA OIN Immediately place the tubes on ice for 2 min Loading the To load the standards Standards Step Action 1 Dispense 10 uL of the denatured matrix standard into a 96 well plate wells A1 through H2 as shown below e 60000000000 8 00000000O0O e OO00000000 P OO000000000 QOOOOOOOOOOO 60000000000 sQOOOOOOOOOOO OQOOOOOOOOOOO GR1315b 384 well plate wells A1 A3 C1 C3 E1 E3 etc as shown below 8 y a Lj o OoZzzrzxc c rommoongu 000000000000000 OOOOOOOOOOOOO0000 O000000000000000 OOOOOOOOOOOOO000 OOOOOOOOOOOOOO000 OOOOOOOOOOOOO0000 OOOOOOOOOOOOOO000 OOOOOOOOOOOOO0O000 OOOOOOOOOOOOOO000 OOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOO OOOOOOOOOOOOOOO00 OOOOOOOOOOOOOO0002 OOOOOOOOOOOOOOOO OOOOOOOOOOOOOO0002 OOOOOOOOOOOOOOOO OOOOOOOOOOOOOOOO OOOOOOOOOOOOOOO0 20 21 22 23 24 oooooo 000000 000000 Ooooooo Ooooooo Ooooooo Ooooooo Ooooooo Ooooooo Ooooooo Ooooooo 000000 000000 000000 0900000 o00000 o

ABI PRISM ® 3100 Genetic Analyzer

Contents

Download Pdf Manuals

Related Search

Related Contents

ABI PRISM &reg; 3100 Genetic Analyzer

Contents

Download Pdf Manuals

Related Search

Related Contents

ABI PRISM ® 3100 Genetic Analyzer