Home

Droplet Digital™ PCR Applications Guide - Gene

1. 100 nM increments 25 nM increments A07 BO7 C08 DO7 E07 F07 Q07fHO7 AOS BO9 CO9 DO9 E09 FO9 GO9 HOY A11 B11 C11 40 000 gt nu 35 000 30 000 oO E 25 000 5 20 000 Zo E E 15 000 O 10 000 5 000 0 0 50 000 100 000 150 000 200 000 250 000 300 000 Event number B 22 5 20 2 E 17 5 D gt gt 15 4 2 12 5 2 3 10 2 7 5 3 n A 25 07 l l l l l l l l l O 50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 950 1 000 Primer concentration nM C D AOG BO6 C06 DOG E06 FOG G06 HOG BO7 B08 DO7 DO9 FO8 FO9 25 000 25 000 i 20 000 i 20 000 oO O 15 000 15 000 Q E av E i S 10 000 4 Me e tl lt O 5 000 j 5 000 H 0 O 0 40 000 80 000 120 000 O 20 000 40 000 60 000 80 000 100 000 Event number Event number Fig 9 9 Good separation of positive and negative droplets in EvaGreen ddPCR reactions A B combined primer concentration between 75 250 nM is shown with 100 200 nM being optimal C effect of EvaGreen ddPCR reaction with 900 nM primers on increasing concentrations of DNA D decreasing the primer concentration to 100 nM produces a uniform cluster of negative droplets Droplet Digital PCR Applications Guide 89 Droplet Digital PCR Tips Assay Considerations and Troubleshooting Mutant DNA Bo7 BOS C03 C04 DO3 DO5 E03 E04 F05 FOS G06 G07 25 0
2. Standard methodes for quantifying NGS libraries have disadvantages Electrophoresis and spectrophotometry measure total nucleic acid concentrations whereas optimal cluster density or template to bead ratio depends on the appropriate concentration of PCR amplifiable DNA molecules Incorrectly adapted products or adapter adapter dimers cannot be distinguished easily from bona fide library fragments These undesirable species can compete for binding sites on the flow cell inhibit cluster formation increase the likelinood of suboptimal loading and reduce the total number of high quality reads These methods also have low sensitivity consuming nanograms of precious samples and are not suitable for high throughput workflows A more accurate method to quantify libraries before sequencing is required to maximize usage of sequencing platforms ddPCR provides an absolute standard free method to measure library concentration and quality while optimizing overall NGS performance ddPCR makes very precise and accurate measurements of the library stock concentrations for flow cell loading The digital nature of droplet partitioning is conducive to accurate quantification by reducing competing PCR reactions Droplet Digital PCR Applications Guide Next Generation Sequencing Library Analysis ddPCR Quantification on Illumina TruSeq v2 Chemistry For the Illumina MiSeq and HiSeg platforms the total possible reads is directly related to the concent
3. CNV analysis by ddPCR involves quantification of target and reference loci through the use of duplex target and reference assays In QuantaSoft software copy number is determined by calculating the ratio of the target molecule concentration to the reference molecule concentration times the number of copies of reference species in the genome usually 2 A CNV N A concentration of target species B concentration of reference species N number of copies of reference loci in the genome usually 2 The error bars on a CN estimate in QuantaSoft software are the 95 confidence interval of this measurement CNV Analysis in Homogeneous Samples Analysis of CNV in homogeneous samples involves evaluation of CN state from a sample source where every cell is presumed to be identical in CN state Examples include CYP2D6 genotyping in patient samples trisomy 21 detection in a clonally derived Down syndrome cell line and counting transgene copies in a genetically modified organism GMO plant stock The challenge in homogeneous samples is largely a function of the level of discrimination required at a high CN state to differentiate between adjacent CN states For some applications for example binning cancer patient samples by oncogene amplification status discrimination between high CN states for instance 50 vs 51 copies may not be as critical as discriminating between CN states of 2 vs 10 vs 50 CNV Analysis in Heterogeneous
4. Subsampling example Suppose a person has a total of 100 000 copies of a particular target in his or her blood 5 L total volume and you take 5 ml of plasma On average this 5 ml will contain 100 copies of target But if you take 100 x 5 ml samples about 16 of them will contain less than 90 copies and about 16 of them will contain more than 110 copies of target This type of variability is inherent in any type of subsampling Figure 1 illustrates subsampling error that arises because a small volume was taken from a large amount of starting material If the 12 ul of sample has 5 target molecules ul and you take 1 ul of the sample 1 12th of the whole and count the number of molecules in that subsample you may expect to see 5 molecules However it is unlikely that you ll see exactly 5 Instead you might see 3 4 6 7 or 8 molecules This uncertainty is what we mean by the subsampling error Subsampling statistics provide a lower limit on the measurement error completely Independent of the instrument used for measurement Any additional error introduced by instrumentation would be added on top of this error In ddPCR in the low concentration regime this unavoidable subsampling error is the most significant source of measurement error More droplets will not change this error 200 targets in 20 000 droplets and 200 targets in 100 000 droplets five wells will lead to the same subsampling error Count molecules in a subsample Most of the 2
5. microRNA NGS next generation sequencing NTC no template control PBMC peripheral blood mononuclear cell PCR polymerase chain reaction qPCR quantitative PCR RED rare target sequence detection rare event detection RFU relative fluorescence units RMD rare mutation detection RNA ribonucleic acid RSD rare sequence detection RI ddPCR reverse transcription Droplet Digital PCR RI qPCR reverse transcription quantitative PCR SNP single nucleotide polymorphism T melting temperature UDG uracil DNA glycosylase UNG uracil N glycosylase Appendix C Acronyms Droplet Digital PCR Applications Guide 99 index ABS 19 20 28 29 59 98 absolute quantification 1 2 7 8 17 19 20 28 29 54 59 68 74 adverse drug response 37 algorithm 6 29 87 Poisson 6 10 29 33 35 36 Ambion 60 62 human brain reference 60 amplicon 13 15 17 24 25 27 28 40 42 46 51 53 reference 28 40 42 amplification 2 4 7 11 12 20 23 30 39 reaction 11 12 amplitude 5 7 9 21 23 27 29 48 51 66 67 69 74 76 78 82 87 90 fluorescence 7 23 27 29 75 76 82 88 90 annealing temperature 15 23 24 27 46 assay 7 9 17 19 21 23 27 29 31 36 38 43 45 54 56 57 59 63 65 67 71 73 80 82 87 93 94 dyes 59 hydrolysis 12 rare mutation detection 13 79 RNaseP anchor 74 Droplet Digital PCR Applications Guide base composit
6. 500 O 500 1 000 1 500 2 000 2 500 3 000 3 500 1 000 0 1000 2 000 3 000 4 000 5 000 10 kb milepost FAM VIC 793 100 kb milepost FAM VIC 230 9 000 8 000 m 8 000 i S Cue 7 000 3 7 000 A 6 000 4 d z od pepe Me o 6 00047 4 LS Bs AD amp 5 000 a amp ate pis 4 000 a 3 000 E 3 000 gt ein 000 4 al y h r EY 3 PSA 2 000 ie aes gt SO 1 000 gt 1 000 y O T T T T O T T T T 1 000 0 1000 2000 3 000 4 000 5 000 1 000 0 1000 2 000 3 000 4 000 5 000 Channel 2 amplitude Fig 8 3 Milepost assay results to determine the quality of DNA by a linkage study microRNA Amplification by ddPCR A method for absolute quantification of microRNA miRNA described here shows the day to day reproducibility of a tenfold change in the starting quantity of synthetic template mir 210 An example ddPCR amplification of an miRNA synthetic template mir 210 was done in a two step reaction The reverse transcription RT reaction was done in bulk solution and the cDNA was partitioned into droplets before PCR amplification miRNA synthetic template for mir 210 RNase free HPLC purified was obtained from Integrated DNA Technologies Inc The miRNA synthetic templates in TE buffer at a final concentration of 1 uM were aliquoted into individual use tubes and frozen at 80 C Each miRNA stock was loaded in RNase free water on ice just before performing an RT assay Reverse transcription of the synthetic miRNA templates was
7. of droplets that do not reach end point This is another advantage of conducting many thousand PCR reactions 20 ul sample Figure 1 13 8 Droplet Digital PCR Applications Guide Droplet Digital PCR A02 B02 C02 DO2 E02 F02 G02 H02 A02 B02 C02 DO2 E02 F02 G02 H02 A02 B02 C02 DO2 E02 F02 G02 H02 8 000 7 000 6 000 5 000 4 000 fee A Het 3 000 2 000 Channel 2 amplitude 1 000 9 T T T T 0 T T T T T 0 T T I I 0 20 000 40 000 60 000 80 000 100 000 120 000 0 20 000 40 000 60 000 80 000 100 000 120 000 0 20 000 40 000 60 000 80 000 100 000 120 000 Event number Event number Event number B 1 400 1 100 High E Medium 1 080 1 200 A Low 1 060 _ 000 q Y y AAA 1 040 800 1 020 H 1 000 4 980 Measured concentration copies ul 600 Tight concentrations 400 960 940 200 _920 0 900 0 2 4 6 8 10 0 2 4 6 8 10 Well location 8 replicates Well location 8 replicates Fig 1 13 The power of thousands of replicates using ddPCR A threshold options B measured concentration for different threshold settings Figure 1 13 shows the effect of varying the threshold value Figure 1 13A on concentration Figure 1 13B Eight ddPCR replicate wells are shown in the plots in Figure 1 13A Three scenarios are tested for discriminating positive high amplitude from negative low ampli
8. Sciences Inc to sell products using the LabChip technology for research use only These products are licensed under U S Patent Numbers 5 863 753 5 658 751 5 436 134 and 5 582 977 and pending patent applications and related foreign patents for internal research and development use only in detecting quantitating and sizing macromolecules in combination with microfluidics where internal research and development use expressly excludes the use of this product for providing medical diagnostic or any other testing analysis or screening services or providing clinical information or clinical analysis in any event in return for compensation by an unrelated party EXP S Caliper Bio Rad s real time thermal cyclers are covered by one or more of the following U S patents or their foreign counterparts owned by Eppendorf AG U S Patent Numbers 6 767 512 and 7 074 367 Web site www bio rad com USA 800 424 6723 Australia 61 2 9914 2800 Austria 01 877 8901 Belgium 09 385 55 11 Brazil 55 11 3065 7550 Canada 905 364 3435 China 86 21 6169 8500 Czech Republic 420 241 430 532 Denmark 44 52 10 00 Finland 09 804 22 00 France 01 47 95 69 65 Germany 089 31 884 0 Greece 30 210 9532 220 Hong Kong 852 2789 3300 Hungary 36 1 459 6100 India 91 124 4029300 Israel 03 963 6050 Italy 39 02 216091 Japan 81 3 6361 7000 Korea 82 2 3473 4460 Mexico 52 555 488 7670 The Netherlands 0318 540666 New Zealand 64 9 415 2280 Norway 23 38 41 30 Poland 48 22 331 99 99 Portug
9. design 11 13 15 19 40 46 51 53 59 66 73 78 80 86 assay 11 13 15 40 46 53 73 78 86 experimental 19 51 53 59 primer 11 12 80 detection of rare sequences 7 detection system 4 56 two color 4 DG8 17 18 31 52 81 83 84 91 digital PCR 1 7 30 81 disease 7 37 autoimmune 37 DNA 2 3 5 9 11 12 14 17 20 24 26 28 34 38 41 44 46 49 91 58 62 65 68 70 72 74 18 79 81 90 94 96 98 99 digested 16 17 42 84 foreign 54 genomic 9 26 41 44 53 68 96 human 16 46 48 51 53 74 human genomic 9 42 44 68 inhibitory secondary 42 quantification 8 46 restriction digested 28 total 54 undigested 72 73 83 84 ANTP 14 double negative droplets 6 double positive droplets 6 50 51 74 double stranded DNA 24 88 98 droplet 1 9 11 12 17 22 24 26 36 38 41 43 45 47 53 55 58 64 72 74 85 87 89 91 92 94 98 volume 31 32 35 Droplet Digital PCR 1 5 7 11 12 28 53 58 66 75 78 83 91 94 Droplet Digital PCR Applications Guide 101 Index 102 drug response 37 adverse 37 dsDNA 12 24 98 dUTP 69 81 92 93 98 dyes 3 11 13 24 59 assay 59 intercalating 3 EEF2 61 63 electrophoresis 64 70 endonuclease 16 43 enhancers 13 46 T 13 enzyme 16 28 42 43 46 59 60 72 80 82 83 A cutter 42 43 6 cutter 42 43 methylation insensitive 42 restriction 16 28 42 43 72 80 83 FRBB2 60 63 98 99 overexpression 60 EvaGre
10. from high copy templates Removal of PCR efficiency bias error rates are reduced by removing the amplification efficiency reliance of PCR enabling accurate quantification of targets Simplified quantification a standard curve is not required for absolute quantification QX100 QX200 Workflow Bio Rad s QX100 or QX200 ddPCR system Figure 1 1 combines water oil emulsion droplet technology with microfluidics The QX200 droplet generator partitions samples into 20 000 droplets Figure 1 2 PCR amplification is carried out within each droplet using a thermal cycler After PCR droplets are streamed in single file on a QX200 droplet reader which counts the fluorescent positive and negative droplets to calculate target DNA concentration Fig 1 2 In ddPCR a single PCR sample is partitioned into 20 000 discrete droplets 2 Droplet Digital PCR Applications Guide Droplet Digital PCR Droplet Generation Before droplet generation ddPCR reactions are prepared in a similar manner as real time PCR reactions that use TaqMan hydrolysis probes labeled with FAM and HEX or VIC reporter fluorophores or an intercalating dye such as EvaGreen ddPCR must be performed with the proprietary reagents developed specifically for droplet generation by Bio Rad Reagent mixes include the ddPCR supermix for probes and QX200 ddPCR EvaGreen supermix to partition DNA and the one step RI ddPCR kit for probes to partition RNA Samples are
11. ieee 7 A E H 3 D 3 45 9 HE 39 8 is g 241 F 20 3 a z i 121 497 8 3 T O 01 E O O O Z 0 1 ca Z Z Z Z Z Z Z Z Z a a a a a a a a a O O O O O O Q O O O O O O O O O O O LO LO LO LO LO LO LO LO LO O O O O O O O O O LO LO LO LO LO LO LO LO LO ag ag ag ag ag ag ag ag ag O O O O O O O O O Sample Fig 6 4 Twofold dilution series demonstrating linearity across two log orders Droplet Digital PCR Applications Guide 61 Gene Expression Figure 6 5 is an example of normal breast tissue compared with HER2 tissues fresh frozen 3 440 40 1780 39 E 1 000 4090 940 1170 eis 1 58 z 7 217 ME 1 27 1 0 O 100 5 g z S ale q E 10 15 HE J O oO O 1 0 010 E 8 0 0636 Q oO N w 0 10 E O Z 0 0133 Y 0 01 0 01 CR560536 cD CR560258 cD CR562124 cD CR561507 cD Ambion normal Sample Fig 6 5 Comparison of HER2 expression levels of fresh frozen tumor versus normal tissue Figure 6 6 shows the quantification of RNA transcript levels compared with DNA copy number Commercial Applied Biosystems ERBB2 GAPDH PL and EEF2 gene expression TaqMan assays were tested with breast tumor FFPE samples ddPCR was used to determine the amounts of transcripts in a subset of 12 samples from the genomic copy number study above that are normalized to commonly expressed genes GAPDH and E
12. qPCR in separate mixtures This method allows for the measurement of multiple messages from a single RNA sample It also enables you to use different PCR reaction conditions and priming methods To measure gene expression with PCR you must first convert the RNA into DNA by reverse transcription There are three types of primers that may be used in reverse transcription Oligo dT priming with oligo dT results in CDNA synthesis that is biased to the 3 end of polyadenylated transcripts and will create only cDNA from mRNA templates Random primers random priming is not subject to end bias and is not limited to mRNA but it is sensitive to the sequence and secondary structures of the template m Sequence specific primers sequence specific primers can be designed adjacent to the PCR target but the ability to perform multiplex qPCR from an individual sample is limited Droplet Digital PCR Applications Guide 57 Gene Expression Similar to RT qPCR reverse transcription Droplet Digital PCR RT ddPCR approaches can also use a one step or two step protocol Choose your approach based on your experimental purpose Two Step Reverse Transcription ddPCR Obtain RNA Use a commercial kit to extract RNA Store at 100 ng ul in 1 10 TE buffer 0 1x TE or other appropriate buffer at 80 C Generate cDNA Generate cDNA according to standard protocols We recommend Bio Rad s Script Select CDNA synthesis kit for oligo dT
13. B02 C02 DO2 E02 F02 G02 H02 7 000 6 000 5 000 4 000 3 000 Channel 2 amplitude 2 000 1000 T T i 0 20 000 40 000 60 000 80 000 100 000 Event number Fig 8 5 Dilution series of an assay targeting chromosome 10 of the human genome Figure 8 6 represents an example of such a multiplexing strategy being used with one FAM channel assay and two HEX channel assays in a 2 D plot of the data 30 000 Chr10q1 25 000 Chri0q1 Chr13g3 Chr13q3 e A A MM g i ay g 20 000 RPPSO O IG a a ve ane z y z S 15 000 x0 E g 10 000 5 000 OTe eT ee spe PEE tall i a e 8 RESY 4 0 T T T T T 0 2 000 4 000 6 000 8 000 10 000 12 000 Channel 2 amplitude Fig 8 6 2 D plot of FAM amplitudes channel 1 vs HEX amplitudes channel 2 for a multiplex experiment Droplet Digital PCR Applications Guide Additional Applications In this experiment a single FAM assay was used RPP30 at standard 1x final concentration and two different HEX assays at different concentrations Chr13q3 and Chr10q1 Assay Chr10q1 was used at 1 2x standard concentration and assay Chr13q3 was used at 1x final concentration in the reaction All three assays were present along with template in the supermix before making droplets Using tools in QuantaSoft software to manually group populations the four upper droplet clusters gray blue green orange represent tho
14. Channel 1 amplitude q et ge AA MA A AM e Ea e a E M ETRY SE or a gr Ex 7 000 5 6 170 E 6 170 0 O O CE ff O gt e lies 3 5 940 0T 5620 HH i e ee ee ee ee ee S O O 3 g 4 000 1 E E E __A gg AA 2 2 0 616 ee pela e e o o o st T E 5 3 2 A rg S E E E 8 1 490 1 600 1 610 1 520 4 o Cae renee O A A A O O A eee 0 0 AO3 BO3 C03 DO3 EO3 FOS G03 HO3 Sample Fig 9 8 Elimination of secondary structure allows efficient amplification and accurate quantification A fluorescence amplitude plot showing four wells of undigested plasmid DNA left and four wells after restriction enzyme digestion to linearize the plasmid right B concentrations are corrected to the expected value after restriction enzyme digestion right as compared to undigested samples left Droplet Digital PCR Applications Guide 87 Droplet Digital PCR Tips Assay Considerations and Troubleshooting High Fluorescence Amplitude Droplets Droplet coalescence can create droplets that are much higher in fluorescence amplitude than the other positive droplets This can be caused by poor droplet transfer technique or extended storage of the droplets pre or post thermal cycling Adjust the scale on the 1 D or 2 D amplitude charts in order to set the thresholds in these cases Troubleshooting EvaGreen ddPCR Reactions 88 EvaGreen binds to both double stranded DNA and to a lesser extent nonspecif
15. FAM and HEX or VIC dyes as well as duplex analysis of FAM HEX or FAM VIC Using dye combinations in duplex assays enables a multiplex experiment and the ability to quantify and or detect up to two targets per sample Designing an Assay Because manual balancing of all the constraints for primer and probe designs is challenging time consuming and error prone we recommend software tools to ensure that all design constraints are satisfactorily followed One widely used tool for PCR assay design is Primer3 Whitehead Institute for Biomedical Research Massachusetts Institute of Technology MIT Building on this software the easy to use Primer3Plus web interface Untergasser et al 2007 makes the process of assay design even easier Figure 2 2 Droplet Digital PCR Applications Guide 13 Designing Droplet Digital PCR Experiments 14 Primer3Plus lo pick primers from a DNA sequence About Source Code A m Select primer pairs to detect the given template sequence Optionally targets and Task Detection 8 tocho diurciadad nalni cas be wei Pick Primers Reset Form Main General Settings Advanced Settings Internal Oligo Penalty Weights Sequence Quality Sequence Id Paste source sequence below Or upload sequence file Browse Upload File GTGAGGATCTCTGGCGCTGGCAGAAGCAGAATCCTTCAGGCTTTGGCACGCAAGCCTGAGGACCCTCCCCTACCAAGGAC CAGGAAAAGCAGCAGCTGCCTGCTCTCCAGCCTCTGGCAGGAACTCAGGGCCCTGGAGCTGCTGGGGCCAAGCCAAGGCC TCCCCTACCTCAAACCCCAGCTGGGCCCGCTT
16. Fig 7 8 Aqueous phase recovery following droplet amplicon recovery protocol Recovered DNA can be analyzed by gel electrophoresis Figure 7 9 sequencing and ddPCR Figure 7 10 Droplet Digital PCR Applications Guide Next Generation Sequencing Library Analysis bp bp Ladder AF NTC SMNTC AF 1 2 SM1 AFNTCSMNTC AF12 SM1 AFNTCSMNITC AF 1 2 SM 1 1 500 eS cS A A a A e e o 00 850 as 850 700 700 500 500 400 ns 400 300 300 200 150 100 Fig 7 9 Postrecovery analysis of ddPCR products bp base pair NTC no template control In Figure 7 9 four replicate wells are shown for each assay of which three were combined for the droplet breaking protocol and the fourth was read by the QX100 droplet reader Gel analysis and electropherograms of amplicon products made from two different reactions prepared in droplets and no template controls are shown in the panels to the left Lanes 1 2 5 6 9 and 10 are no template controls of the reactions lanes 3 7 and 11 are a Staphylococcus aureus assay and lanes 4 8 and 12 are a different assay for the S aureus template 2 000 1 670 TT 1 600 1 500 I 1 200 800 Concentration copies ul 400 0 0 0809 o Tr SA1 NTC SA2 NTC SA1 1 2 CPD SA2 1 2 CPD Sample Fig 7 10 ddPCR quantification of droplet recovered amplicons CPD copies per dro
17. after PCR without reading them on the QX100 or QX200 system then proceed directly with the following protocol for recovery of DNA from droplets after PCR 1 Pipet out the entire volume of droplets and oil from a well into a 1 5 ml tube combine up to ten replicates if desired 2 Pipet and discard the bottom oil phase after droplets float to the top Droplet Digital PCR Applications Guide 69 Next Generation Sequencing Library Analysis 70 3 Add 20 ul of TE buffer for each well used add additional TE buffer by multiplying by the number of combined replicate wells if applicable 4 In a fume hood add 70 ul of chloroform for each well and cap the tube Add additional chloroform by multiplying by the number of combined replicate wells if applicable 5 Vortex at maximum speed for 1 min 6 In acentrifuge spin down at 15 500 x g for 10 min 7 Remove the upper aqueous phase by pipetting avoiding the chloroform phase and transfer it to a clean 1 5 ml tube this is the recovered DNA 8 Dispose of the chloroform phase appropriately 9 If desired estimate size using Bio Rad s Experion DNA 1K analysis kit chip and or requantify by ddPCR In Figure 7 8 the contents in the Eppendorf tubes following the droplet breaking protocol demonstrate the layers formed by chloroform and the broken aqueous layer The upper aqueous phase can readily be pipetted into a clean tube for downstream analysis Chloroform Aqueous
18. anchor assay RPP30 anchor chromosome 10 VIC 1 kb milepost marker 1 kb iii 10 kb milepost marker FAM lt 100 kb Fig 8 2 Assay design for the milepost assay 100 kb milepost marker FAM Droplet Digital PCR Applications Guide 13 Additional Applications Demonstration of a milepost assay Is presented in Figure 8 3 which shows the 2 D plots of FAM amplitude and VIC amplitude for an RNaseP anchor assay VIC and progressively farther assays on chromosome 10 for ahuman DNA sample The upper left panel demonstrates a control to account for the inherent probability of two copies completely separated from each other RNaseP which is on chromosome 10 and an assay located on chromosome 6 randomly co localizing in the same droplet The remaining panels demonstrate that as the distance between the anchor and the milepost assay on the same chromosome as RNaseP increases the number of double positive droplets decreases At a distance of 100 kb the double positive population is equal to the unlinked control Finer resolution could be done with more milepost assays to cover the range RNaseP chromosome 6 FAM VIC 243 1 kb milepost FAM VIC 1 739 Channel 2 amplitude 14 000 Ba 12 000 E 12 000 O ANG 10 000 se ial 8 000 E 8 000 4 6 000 5 6 0004 Y S 4 000 des x AR O 2 000 4 E gt 2 000 gt iad ad 0 B O i
19. crosshair cursor over the place where you would like to set the threshold and click on the chart The droplets will change color when you are done To analyze the data for a multiplex experiment select Analyze and click the 2 D Amplitude tab Droplet Digital PCR Applications Guide 21 Designing Droplet Digital PCR Experiments bas Concentration o eCarts de rr fats T gjg corets Hifi A N 93 y titi 100 iy i J waah dee Le Ch1 Ch2 18570 Chi Ch2 7737 Ch1 Ch2 11650 Ch1 Ch2 4708 S ii 9000 8000 7000 i 6000 5000 g 5 4000 3000 2000 ER 1000 o 0 1000 2000 3000 4000 5000 6000 7000 Channel 2 Amplitude Fig 2 8 Setting thresholds in a 2 D plot For correct quantification of a duplex experiment use the thresholding tools to ensure correct designation of the droplet populations as double negative gray FAM positive blue VIC HEX positive green and double positive brown positive for FAM and HEX VIC in the same droplet There is an autoanalysis tool as well as several different manual thresholding tools including a free draw tool Once you have selected the desired color tab and draw tool click on the chart and select the droplets They will change color when you are done Merging Wells Selecting the merged button in QuantaSoft software combines the positive and negative droplets from all the wells with the same name
20. data in each well It automatically opens the first well with data to begin the analysis If the plate was set up for ABS analysis automatic thresholding determines concentrations and populates the data tables in the analysis mode of the software Important The concentration reported is copies ul of the final 1x ddPCR reaction Well data must meet certain quality metrics before QuantSoft software will automatically calculate a threshold above which droplets are considered positive The threshold may be manually adjusted on a well by well basis or across an entire plate Figure 2 7 Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments tua Concentration hara tear tad Pro BIO RAD ne t teers E 158 af Mini Bd Fig 2 7 Setting thresholds in a 1 D plot Note Use 1 D plots for temperature gradient experiments and wells containing single assays For all experiments involving duplex assays set thresholds in the 2 D plot view Figure 2 8 For correct quantification of a single color experiment use the thresholding tools to ensure correct designation of the populations as negatives gray and positives blue or green The thresholding tools are on the left side of the screen There is an autoanalysis tool as well as two manual thresholding tools one for individual wells and one for all selected wells Once you have chosen the desired tool place the
21. in ddPCR For instance you may want to add more than two assays to a reaction The QX100 and QX200 Droplet Digital PCR systems can detect fluorescence in two color channels FAM and HEX However there is an added dimension of fluorescence amplitude that can be used to multiplex more than two assays at a time The basic concept for multiplexing is to make use of the differences in fluorescence amplitude signal to change the spatial positioning of the droplet clusters in the 2 D data plots drawn in QuantaSoft software By varying the concentration of the TaqMan assay the end point fluorescence amplitude can be shifted in many assays Due to this shift you can include two or more assays in the FAM and or HEX channels and empirically determine what concentrations will resolve the two assays in separate clusters Droplet Digital PCR Applications Guide 75 Additional Applications 76 A good starting point would be to halve or conversely double the concentration of an assay relative to the standard final 1x concentration in order to spatially resolve the two assays in a 2 D plot of FAM and HEX amplitudes Figure 8 5 is an assay targeting chromosome 10 of the human genome The stock has the highest fluorescence amplitude and subsequent twofold changes in starting concentration demonstrate resolvable droplet populations based on fluorescence amplitude down to one quarter dilution Stock 1 2 1 4 1 8 1 116 1 32 1 64 No assay A02
22. is not conjugated to a G residue Add the recommended primer 900 nM and probe 250 nM concentration Droplet Digital PCR Applications Guide Additional Tips No Concentration Calls on Some Wells Droplet Digital PCR Tips Assay Considerations and Troubleshooting If a concentration estimate fails to appear in the concentration chart in QuantaSoft this indicates the software could not auto analyze or assign droplets to positive or negative populations using its auto analysis algorithm or the well had an unusually low droplet count lt 10 000 Low total droplet counts indicate a problem with the assembly of the reaction mix poor preparation of the sample or poor handling Manually set a threshold and QuantaSoft software will calculate a concentration which will appear in the concentration chart Target Accessibility Strong or excessive secondary structure can prevent a DNA target from being amplified Human gDNA and plasmid DNA can usually be restriction digested to remove inhibiting secondary structure thereby rescuing detection RNA secondary structure is best addressed by changing the location of the assay if possible or reverse transcribing the assay at a warmer temperature Figure 9 8 is an example of poor target accessibility manifested by the significant number of mid level amplitude droplets that is rain which is resolved by performing a restriction digestion on the DNA before ddPCR A AO3 BOS FOS
23. mean Note The theory behind technical errors is explained in Appendix B Droplet Digital PCR Applications Guide 4 Copy Number Variation Analysis Overview Analysis of copy number CN involves determining the number of copies of a given target locus with respect to an invariant reference locus An alteration in copy number state with respect to the reference locus is copy number variation CNV CNV could be a deletion or duplication of a locus with respect to the number of copies of the reference locus and hence genomes present in the cell CNV is a prominent source of interindividual variability in the human genome and CNV has been associated with cancers neurological and autoimmune diseases and adverse drug response The major technical challenge in CN assessment is the ability to discriminate with statistical confidence between consecutive CN states Figure 4 1 Fundamentally as CN state increases the percentage difference in target genomic material between states decreases For example for a given target locus a CN of 3 is 50 more abundant in concentration per genome than a CN of 2 while a CN of 5 is only 25 more abundant per genome than a CN of 4 and so on Current methods to analyze CNV including single nucleotide polymorphism SNP based microarrays comparative genomic hybridization and quantitative PCR qPCR lack the sensitivity and resolution needed for this fine degree of quantitative discrimination in
24. or gene specific priming For random priming we recommend the Script advanced cDNA synthesis kit for RT qPCR Follow the instructions in the manual of the respective cDNA kit Once the reverse transcription is complete reduce the concentration of cDNA to about 0 2 ng ul RNA equivalent and use 5 ul per Droplet Digital PCR ddPCR reaction total volume 20 ul Typically 1 ng 5 ul of 0 2 ng ul of RNA equivalent cONA per ddPCR reaction is adequate to measure most of the transcripts reliably If the RNA is highly degraded or very low quality as is the case with RNA from formalin fixed paraffin embedded FFPE samples or the transcript of interest is expected to be found at less than 1 copy cell such as a transcript from a cancer cell in a large background of normal cells the previous guideline of 1 ng reaction no longer holds Under these situations up to 10 ul of the RT reaction can be added to one ddPCR reaction without altering its performance One Step RT ddPCR Kit for Probes The one step RI ddPCR kit for probes follows the same workflow as the ddPCR supermix for probes with the benefit that you can now directly partition sample RNA instead of DNA The sample is partitioned into 20 000 droplets with target and background RNA randomly distributed among the droplets An RNase inhibitor included in the formulation minimizes template degradation during reaction setup and droplet generation After reverse transcription the resulting cD
25. single positive droplets from double positive droplets Droplet Digital PCR Applications Guide Rare Mutation and Sequence Detection In Figure 5 7 the four clusters represent the droplets as follows Blue cluster top left FAM positive droplets with only mutant template Brown cluster top right double positive droplets with both templates inside Gray cluster bottom left negative droplets with no template Green cluster bottom right VIC positive droplets with only wild type template The orthogonality of the 2 D pattern means the four clusters are located spatially at right angles to each other In an RMD assay clusters are commonly deviated from the corner right angles For example the blue cluster is shifted to right relative to the negative cluster in Figure 5 7 a result of wild type probe labeled with VIC cross reacting with mutant amplicon Also the double positive cluster in an RMD assay is usually located between the two single positive clusters rather than at the upper right corner due to cross reactivity 9 000 8 000 7 000 ae 0 agit pee Bods Seat Ce A S 6 000 Pole eae a CERO E 5 000 4 000 Cc S 3 3000 a pa 2 000 4 A 1 000 AA o E A A E O 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 Channel 2 amplitude Fig 5 7 2 D plot of BRAF V600E assay Statistical Considerations for Rare Detection Experimental Design The limit of detection LoD is the minim
26. size should be no smaller than 13 and no larger than 30 nucleotides Note After you have made the desired changes in Primer3Plus select Save Settings under General Settings and save these parameters in a file To apply these settings in the future upload them by selecting Browse in the General Settings tab find this file and click Activate Settings After you paste your target sequence into the Main window click Pick Primers Figure 2 3 The software provides one or more primer pairs to select or provides an explanation for why the software failed to arrive at any primers Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments Primer3Plus a pick primers from a DNA sequence About Source Code lt Back Pair 1 Left Primer l Primer_f Sequence TACCAAGGACCAGGAAAAGC Start 71 Length 20 bp Tm 592 C GC 500 ANY 3 0 SELF 2 0 Internal Oligo 1 Sequence CCCCTACCTCAAACCCCACC Stan 162 Length 20 bp Tm 63 1 C GC 630 ANY 2 0 SELF 2 0 v Sequence GAACTCTTGGACCCTGTGGA Start 276 Length 20 bp Tm 60 1 C GC 550 ANY 3 0 SELF 00 Product Size 206 bp Pair Any 6 0 Pair End 1 0 Send to PrimeriManager Reset Form Select all Primers GTGAGGATCT CTGGCGCTGG CAGAAGCAGA ATCCTTCAGG CTTTGGCACG CAAGCCTGAG GACCCTCCCC TACCAAGGAC CAGGAAAAGC AGCAGCTGCC TGCTCTCCAG CCTCTGGCAG GAACTCAGGG CCCTGGAGCT GCTGGGGCCA AGCCAAGGCC Ts TGGGCCCGC TTAGCCCACC AGGCATGAGG CCAAGGGCTC C
27. 0 998 E 998 1 020 1 020 4 1070 H k 826 895 1 030 800 655 11M TC g 400 Si O O 0 0 wv eo seo seo ool eo seo seo ool eo ool eel He o a coe N coe A G o a cor N coe coe 9 G O cor O co O co A cor ON ES o o6 95 y oe yA 199 AO ae gt Sample Fig 1 14 QuantaSoft software concentration estimates Twofold A and 10 B dilution series of S aureus template IM in a constant background of human gDNA IM run as a duplex FAM VIC assay The error bars represent Poisson 95 confidence intervals 10 Droplet Digital PCR Applications Guide 2 Designing Droplet Digital PCR Experiments Assay Design for Droplet Digital PCR As with any PCR based technology assay design and sample preparation are important for obtaining high quality data Before running a Droplet Digital ddPCR experiment know the goal or possible expected outcomes of the experiment because different types of experiments require different controls sample preparation amounts of DNA or RNA and data analysis The amplification reaction of target molecules in ddPCR workflows follows similar principles of real time PCR Plan to amplify a 60 200 bp product m Avoid regions that have secondary structure when possible Choose a region that ideally has a GC content of 40 60 Designing Primers Widely accepted quantitative PCR qPCR design guidelines apply to ddPCR primer design Important criteria for s
28. 0 4 68 TIT E oO l 1 46 1 53 E O 0 10 0 01 0 256 256 64 64 16 16 4 4 1 1 Sample Fig 1 11 Sample concentrations are plotted as copies pl from the sample 6 Droplet Digital PCR Applications Guide Droplet Digital PCR Emerging Applications of Droplet Digital PCR Sample partitioning allows the sensitive specific detection of single template molecules as well as precise quantification It also mitigates the effects of target competition making PCR amplification less sensitive to inhibition and greatly improving the discriminatory capacity of assays that differ by only a single nucleotide Digital PCR offers the benefits of absolute quantification and greatly enhanced sensitivity Therefore its application in the following areas is growing Absolute quantification ddPCR provides a concentration of target DNA copies per input sample without the need for running standard curves making this technique ideal for target DNA measurements viral load analysis and microbial quantification Genomic alterations such as gene copy number variation CNV CNVs result in too few or too many dosage sensitive genes responsible for phenotypic variability complex behavioral traits and disease ddPCR enables measurement of 1 2x differences in gene copy number Detection of rare sequences researchers must amplify single genes in a complex sample such as a few tumor cells in a wild type background ddPCR is sensitive eno
29. 00 20 000 15 000 ol gt Channel 1 amplitude 10 000 5 000 aid O 50 000 100 000 150 000 200 000 Event number Fig 9 10 Mutant DNA spiked into increasing amounts of wild type DNA As the total added DNA concentration increases the positive fluorescence amplitudes decrease and the negative fluorescence amplitudes increase Reference Kwok S and Higuchi R 1989 Avoiding false positives with PCR Nature 339 237 238 90 Droplet Digital PCR Applications Guide Appendix A Ordering Information QX200 Droplet Digital PCR ddPCR System 186 4001 186 4002 186 4003 186 4007 186 4008 186 3009 297 11024 186 3051 186 3005 QX200 Droplet Digital PCR System includes droplet generator droplet reader laptop computer software associated component consumables QX200 Droplet Generator includes droplet generator 1 pkg of 24 DG8 cartridges 1 pkg of 24 DG8 gaskets 2 cartridge holders 1 power cord QX200 Droplet Reader includes droplet reader ddPCR manual 2 plate holders USB cable power cord Droplet Generator Cartridges and Gaskets includes 5 pkg of 24 DG8 cartridges 5 pkg of 24 DG8 gaskets DG8 Cartridges for QX100 QX200 Droplet Generator 1 pkg of 24 cartridges DG8 Gaskets for QX100 QX200 Droplet Generator 1 pkg of 24 gaskets Droplet Reader Plate Holder DG8 Cartridge Holder Droplet Generation Oil for Probes 10 x 7 ml Droplet Digital PCR App
30. 00 Droplet Digital PCR ddAPCR System saasaa da 91 dAPOSR REAGENS re aeae ai hands Sa ook op ah E as ios y 92 Thermal Cycler and Plate Sedler cerot iiep li cr a a LATE a ane te hohe e 93 Technical Error Bars in Droplet Digital PCR 0 oooocccccccc ees 94 Subs ampli ankane a a a o ce 94 A A O RO 96 ACKONYING Erica aio rs di Ao Ao 98 EE EA A A SA EA AE A AAA eee 100 v Droplet Digital PCR Applications Guide Droplet Digital PCR Introduction Droplet Digital polymerase chain reaction ddPCR was developed to provide high precision absolute quantification of nucleic acid target sequences with wide ranging applications for both research and clinical diagnostic applications ddPCR measures absolute quantities by counting nucleic acid molecules encapsulated in discrete volumetrically defined water in oil droplet partitions Droplet Digital PCR using Bio Rad s QX100 or QX200 Droplet Digital PCR system overcomes the previous lack of scalable and practical technologies for digital PCR implementation Droplet Digital PCR Applications Guide 1 Droplet Digital PCR ddPCR has the following benefits for nucleic acid quantification Unparalleled precision the massive sample partitioning afforded by ddPCR enables small fold differences in target DNA sequence between samples to be reliably measured Increased signal to noise enrich for rare targets by reducing competition that comes
31. 29 0 46 40 2008 2 Negative 2 46 ES 0 88 34 2009 1 Not done 2 61 0 17 1 42 37 2008 O Not done 1 96 0 98 ipo 45 2006 Negative Not done 2 00 0 63 1 89 41 2008 1 resection Negative 203 085 5101 30 2009 1 Not done ES 0 86 Sor 43 2007 2 Positive 4 76 2 97 8 31 49 2006 3 Not done 4 15 1 79 11 3 28 2010 3 Not done 28 0 33 9 29 1 47 2006 3 Not done 28 4 33 6 SSL CNV copy number variation FISH fluorescence in situ hybridization IHC immunohistochemistry ddPCR provides the advantage of accurate and precise measurements of transcript levels It also provides accurate genomic copy number determinations of samples with low and high order copy changes determined by the ratio of the target concentration to the reference concentration Important considerations for ddPCR applied to gene expression studies include the type of method used to obtain cDNA one step versus two step reverse transcription and optimizing assays for maximum performance Droplet Digital PCR Applications Guide 63 Overview 64 I Next Generation Sequencing Library Analysis Next generation sequencing NGS systems are extremely sensitive to the quantity of library loaded in the sequencing run Overloading frequently produces unusable data and underloading wastes reagents and time Droplet Digital PCR ddPCR complements NGS by offering accurate library concentration measurements and unique quality analyses that are not available with other methods
32. 37 Alul AG CT NEBuffer 1 2 4 CutSmart 37 Haelll GG CC NEBuffer 2 4 CutSmart 37 Bsml GAATGC 1 1 NEBuffer 4 CutSmart 65 BstYI R GATCY NEBuffer 2 4 2 1 60 BSA bovine serum albumin Table 4 3 Recommended restriction enzymes for CNV ddPCR most preferred 6 cutters Restriction Methylation Digestion Digestion Incubation Enzyme Sequence Sensitivity old Buffer new Temperature C Hindlll A AGCTT None NEBuffer 2 NEBuffer 2 1 oe EcoRI G AATTC CoG NEBuffer EcoRI 37 o S buffer NEB nuclear extraction buffer Table 4 4 Conditions for a typical restriction enzyme digestion Reaction Component Final Concentration Volume 50 ul reaction pl 10x digestion buffer 1x 5 gDNA 100 ng ul Variable Restriction endonuclease 10 U ug DNA Variable 100x BSA as needed 1x 0 5 Water Variable BSA bovine serum albumin gDNA genomic DNA Newly designed assays should be run across a thermal gradient for example 65 556 to identify an annealing extension temperature that optimizes separation between positive and negative droplets while minimizing rain droplets that fall between the major positive and negative populations If possible select an annealing extension temperature that optimizes performance of both target and reference assays Droplet Digital PCR Applications Guide 48 Copy Number Variation Analysis DNA Loading for Lower Order CN Analysis diploid CN lt 10 For most routine CNV ddPCR applicatio
33. 46 53 88 90 clusters 46 sequences 47 48 106 Droplet Digital PCR Applications Guide Bio Rad Technical Support For help and technical advice please contact the Bio Rad Technical Support department In the United States the Technical Support department is open Monday Friday 5 00 AM 5 00 PM Pacific time Phone 1 800 424 6723 Email LSG_TechServ_US bio rad com for U S and international customers Online technical support and worldwide contact information are available at www consult bio rad com For more information visit www bio rad com N ddPCRAppGuide No part of this publication may be reproduced or transmitted in any form or by any means electronic or mechanical including photocopy recording or any information storage or retrieval system without permission in writing from Bio Rad Laboratories Bio Rad reserves the right to modify its products and services at any time This applications guide is subject to change without notice Although prepared to ensure accuracy Bio Rad assumes no liability for errors or for any damages resulting from the application or use of this information Black Hole Quencher is a trademark of Biosearch Technologies Inc BLAST is a trademark of the National Library of Medicine CutSmart is a trademark of New England Biolabs Inc Eppendorf and twin tec are trademarks of Eppendorf AG EvaGreen is a trademark of Biotium Inc Bio Rad Laboratories Inc is licensed by Biotium Inc t
34. 5 subsamples contain 4 5 or 6 1 12 shown here EMO molecules this uncertainty is what we mean l by subsampling error 60 molecules in sample Subsample 1 12 e 5 molecules expected Fig 1 Subsampling error due to analyzing part of a larger whole The error due to subsampling is given as Standard deviation yM yM Coefficient of variation Wi where M expected number of target molecules in the ddPCR reaction Droplet Digital PCR Applications Guide 95 Appendix B Technical Error Bars in Droplet Digital PCR Partitioning 96 The second contribution to the technical error bars comes from partitioning of the DNA targets into droplets This is the error that dominates at high concentration The illustration in Figure 2 shows 288 target molecules partitioned into 144 droplets These grids are snapshots in time imagine molecules bouncing around in the sample then at any given instant divide the sample into 288 partitions It s evident that most of the partitions do not contain exactly two molecules Empty droplets 22 19 expected Calculated concentration 1 88 CPD lt Empty droplet A droplets Fig 2 Target molecule partitioning CPD copies per droplet Statistics tells us that we should on average see 19 or more precisely 19 5 empty partitions or droplets in this experiment In a particular instant in time we se
35. 500 cells 37 500 0 25 1 0 1 in 100 000 cells 100 in 300 000 cells 300 000 2 0 2 1 1 in 500 000 cells 100 in 1 500 000 cells 1 500 000 10 0 10 1 Droplet Digital PCR Applications Guide 55 Rare Mutation and Sequence Detection In the example given the measurement error CV is introduced at the time of subsampling at the time of the blood draw not by the measurement system Poisson statistics dictate that if N target molecules are measured in a sample the standard deviation of the measurement is roughly the square root of N In this example if 100 copies of virus are present in the sample the standard deviation of the measurement is 10 and the CV is 10 100 10 This means that we can accurately quantify to 10 100 or more copies of virus in 100 000 PBMCs No detection system can do better than this theoretical limit Factors that Impact RSD Calculations False positive rate the false positive rate must be measured and considered when designing experiments to achieve very low LoD or accurate quantification Sample integrity and preparation it may be useful to spike a PCR control into the original sample and use a second assay in the same well to measure its level This enables you to control for PCR inhibitor and sample preparation failures Pipetting accuracy in dilutions errors introduced by pipetting may contribute to the overall accuracy of the measurement References 56 Benlloch S et al 2006 Detectio
36. ACTGACCAG GAGGCCGAGG TCTCTAACTC TTATCTICCA CAGGGTCCAA GAGTTCATCA GGACCCCCAA GAGTGAGTGA GGGGGCAAGG CTCTGGCACA AAACCTCCTC CTCCCAGGCA CTCATTTATA TTGCTCTGAA AGAGCTTTCC AAAGTATTTA AAAATAAAAA CAAGTTTTCT TACA Fig 2 3 Assay design output Several important design features are not addressed by Primer3Plus or the Primer3 MIT site To ensure primer specificity use tools such as BLAST Basic Local Alignment Search Tool hosted at the National Center for Biotechnology Information NCBI either in the traditional general search form www ncbi nlm nih gov BLAST or a form tailored specifically to check that PCR primers http www ncbi nlm nih gov tools primer blast match only your intended target Check that common SNPs do nat land in your primer sequences Check for the secondary structure of the amplicon using the Mfold program http mfold rna albany edu q mfold Primer binding sites should be predicted to be open that is not base paired in a secondary structure at the PCR annealing temperature Sample Preparation The quality of the nucleic acid preparation from the sample of interest can impact ddPCR results An optimized protocol should be used to extract the DNA or RNA from the raw material you are testing Ensure that the sample has not been degraded for example by heating above 60 C Although some PCR inhibitors are less detrimental to quantification accuracy in ddPCR than in other technologies we recommend rem
37. AGCCCACCAGGCATGAGGCCAAGGGCTCCACTGACCAGGAGGCCGAGG TCTCTAACTCTTATCTTCCACAGGGTCCAAGAGTTCATCAGGACCCCCAAGAGTGAGTGAGGGGGCAAGGCTCTGGCACA AAACCTCCTCCTCCCAGGCACTCATTTATATTGCTCTGAAAGAGCTTTCCAAAGTATTTAAAAATAAAAACAAGTITICT TACA Mark selected region lt gt 11 1 Clear _ Save Sequence Excluded Regions lt gt Targets Included Region Pick left primer Pick hybridization probe Pick right primer or use right primer or use left primer below internal oligo or use oligo below below 5 gt 3 on opposite strand Fig 2 2 Main tab in Primer3Plus In the Main window paste your target DNA sequence in the Paste source sequence below field We recommend the following changes to the default settings when designing ddPCR assays Inthe General Settings window change Concentration of divalent cations to 3 8 Concentration of dNTPs to 0 8 and Mispriming Repeat Library to the correct organism Inthe Advanced Settings window change both the Table of thermodynamic parameters and Salt correction formula to SantaLucia 1998 Inthe Internal Oligo window we recommend setting 15 for the minimum number of bases for the oligo We recommend 64 C as the minimum T_ for the probe 65 C as the optimal T_ for the probe and 70 C as the maximum T_ for the probe These parameters can be relaxed to allow for smaller larger oligos which may be necessary for high GC or low GC targets Oligo
38. CNV analysis Droplet Digital PCR Applications Guide 37 Copy Number Variation Analysis 38 100 90 80 707 60 50 7 40 30 7 Copy number resolution N vs N 1 20 gt 0 0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 Copy number N Fig 4 1 Discrimination between consecutive CN states is more difficult at higher order copy numbers The massive partitioning of a CNV Droplet Digital PCR ddPCR reaction across up to 20 000 droplets enables the fine quantitative discrimination required to resolve consecutive copy number states beyond CN 3 This is due to the high precision of the ddPCR concentration measurement and the absolute nature of the measurement For example a 20 difference in target concentration between a CN 5 vs CN 6 sample can be reproducibly resolved using ddPCR Figure 4 2 This discrimination is both a function of concentration differences between consecutive CN states as well as the amount of DNA assayed per well 7 5 69 D 479 Y Copy number 2 2 04 O 2 02 1 IIA RNA A A l o XA SE 11994 18507 18502 19221 19205 18916 19108 Sample Fig 4 2 ddPCR measurements of MRGPRX1 copy numbers across seven Coriell DNA samples Droplet Digital PCR Applications Guide Copy Number Variation Analysis CNV Calculations
39. DNA molecules and PCR reagents are partitioned into droplets Some droplets will contain one or more copies of the target DNA molecule DNA fragment that contains primer and probe binding sites for a given assay and some will not contain any copies of the target Droplets are subjected to PCR amplification and the targeted PCR product with an associated fluorescence signal is generated in droplets that initially contained the target DNA The concentration of the target species in the original sample is determined from the fraction of droplets that have a fluorescence signal In ddPCR target molecules are distributed randomly into droplets This assumption is at the heart of all digital PCR approaches Random partitioning means a given target molecule is equally likely to end up in any of the 20 000 droplets Random partitioning also means target molecules move independently of each other and do not interact with each other The droplet generator partitions samples into approximately 20 000 droplets of identical volume about 1 nl Some droplets are lost in transfer steps and others are eliminated by the stringent metrics applied by QuantaSoft software as the droplets pass through the droplet reader resulting ultimately in data from 12 000 16 000 droplets being used in subsequent concentration calculations Reading only a subset of the total droplets has no impact on the concentration measurement because the concentration is calculated based on the
40. Droplet Digital PCR Droplet Digital PCR Applications Guide Chapter 1 Chapter 2 Chapter 3 Table of Contents Droplet Digital POR atada ares 1 ae o A NR oe 1 ODA VOKON A A a ee ae N 2 Drople venera ds a A had O a 3 PORAMDINCAUOM r nee a al Behe ehara Ue a Be Bo ed are bee ca 4 Opticas Arare en bae pao a e Send su aaah aie 4 CAROD OSI aia ds sa a ls ea a e aaa aaa 5 Emerging Applications of Droplet Digital PCR nnna sasaaa bis ida T ddPCR for Absolute Quantification and Experimental Considerations o ooooooo oo T Designing Droplet Digital PCR Experiments 0 000s 11 Assay Design for Droplet Digital PCR nnns aa aana a a 11 Designing PIMES is co Oe ence wa es ans A teen des e daa ee det 11 BESIMIN PODE S sra ena didas Bee Bo eee all dees Before ados 12 BESING aN ASSAY eraan ea aiea Eae dd e lada ls aa ioa 13 Sample Prepara id a A A A A A a Ole hate Bok cs ao 15 AGaing DNA tothe R action MIX smera da ias 16 ddPCR Experimental WorklOW cria a a dao E a a bicis ES flee Propero perdio aaneen boob dS ee ace 17 staat Bate wh eae Bg wreck one eres EN aro Se ne aah wee Eder R ee es ee eee ee 18 Setting Up an Experiment in QuantaSoft Software veces dd 19 HODGE CAN earna aa aa Gee aie ma E a nets a a A ios 20 BUTAN AA aaa aaa e a A aa a N ag te NE ea 20 KOTOA aae es as ea seo o esa a a Sd 22 PCR Optimization Using Thermal Gradients occ E di o 23 ddPCR Using the QX200 System and EvaGreen dsDNA Dye 6 e
41. EF2 60 m ddPCR DNA CNV m RNA ERBB2 B 3 EEF2 Her2 Her2 50 RNA ERBB2 B 3 GAPDH PL 40 30 20 Normalized transcript level sb mm m m e m m m e e e m e m fee e m e e a e o o e e e p a e o e e e 38 32 40 34 37 45 41 30 Sample number Fig 6 6 Rank ordering of gene expression levels in 12 clinical samples and genomic copy number status of ERBB2 When we studied the clinical FFPE samples using ddPCR and standard FISH and IHC methods our results demonstrated that ddPCR can rank order the samples in complete agreement with the current standard methods and that ddPCR has the added benefit of providing quantitative results 62 Droplet Digital PCR Applications Guide Gene Expression Table 6 1 shows a comparison of IHC FISH genomic copy number and transcript level in clinical samples The table shows the capability of ddPCR to determine gene copies and FRBB2 cDNA transcript levels when normalized to a reference transcript EEF2 or GAPDH ddPCR results are in excellent agreement with pathology results and have the added benefit of being quantitative Table 6 1 Comparison of clinical pathology results with ddPCR gene expression data Clinical Pathology ddPCR CNVs or Normalized RNA Levels DNA RNA RNA Sample Year Specimen HER2 IHC FISH HER2 HER2 ERRB2 ERRB2 Number Taken Score CEP17 Ratio CEP17 B 3 EEF2 B 3 GAPDH 38 2009 1 0 8 220 022 0 27 32 2010 1 1 2 1 56 0
42. F08 FO9 G07 G08 GO9 H07 HO8 HOY 35 000 30 000 Super clusters 25 000 AA 20 000 15 000 Channel 1 amplitude 10 000 5 000 0 de H I I 0 20 000 40 000 60 000 80 000 100 000 120 000 Event number No template No reverse cDNA control transcription Fig 2 14 Splice variant discrimination using the QX200 ddPCR EvaGreen supermix with a single set of primer pairs 26 Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments Multiplexing with EvaGreen Differences in droplet amplitude due to differences in amplicon length or optimal annealing temperature allow for multiplexing in a single well Figure 2 15 shows a 2 D fluorescence plot containing two amplicons where differences in amplitude are observed due to differences in optimal annealing temperature Primer set 1 has an optimal T_ of 63 C therefore droplets having this target have relatively high fluorescence amplitudes at 63 C Primer set 2 has an optimal annealing extension temperature of 59 C and therefore has a much lower fluorescence amplitude at 63 C Distinct separation of these clusters allows a copy number to be calculated with high precision Figure 2 15 Similarly varying amplicon length instead of PCR efficiency can be used to measure multiple targets in the same well However when using amplicon length to multiplex with EvaGreen it is important to use an optimal annealing exten
43. Ge A ea eA ora pa ia Dat O Two Step Reverse Transcription ddPCR 0 ee ete eee nes 58 OI cr ita e oa PE ESTA ey nee dias ean ta tn tae ieee ao ane CA Ae 58 Generate CDNA bn AS Ba oe Be a ed ek AAA ES a ee AA 58 Droplet Digital PCR Applications Guide iv Table of Contents Chapter 7 Chapter 8 Chapter 9 Appendix A Appendix B Appendix C Index One Step RFAdAPGOGRKIE Tor PODES e scene a a da sia die a ek 58 DATAN SIS axa as A a as a dia 59 GPCR Gene Expression Data aaa a PARRA Aa Bar ee eS 60 FAIA U os aos A ira pi da a a as de SS dica Da 60 AT AGI SIG Res UN Se cria arado avd bon oo 60 Next Generation Sequencing Library Analysis 000 cee ees 64 OVNI ds a hd ooo a aes aed ood a Brae a enn inn ana 64 ddPCR Quantification on Illumina TruSeq v2 Chemistry 0 0 0 ee ee ens 65 Ebay Quality Andys Sce jaca ee A week dee eee AS a ee EH oe RS he arte 66 Next Generation Sequencing ReadS 1 saasaa eaea ee nent eee nes 67 Mallas ING A ails wet i ena inet hana ole ated Wee eh hak hs ou fy Si el BOG a aed 68 Amplicon Recovery from Droplets awe oot ba Pd aah ah ee bed ie Pw ede ed amp woke Fiche we 69 Additional ADOIICALONS casertana ra eck eee Se we eed ie a ee eae ee eee 72 LIRIK ANANSI ky aiae Gale kt id elle a Get lots de abet toe tl fe dowd palette gb ae gett ap tected 12 MIEDOS ASS a na dat A oa E AEN N 73 MICORNAAM Iification by ddPOR ck ac bolitas telnet See tE dear da Brewis ida Sati
44. LL E 200 100 0 N A Go OY Q A A O ES S E N N amp ES e amp os SESESES Channel 2 amplitude B N wo S al Oo N 00 co o a En a N Library Input total brain RNA 8 3 expected PF reads identified Index number Fig 7 7 ddPCR library balancing results PF passing filter Amplicon Recovery from Droplets Bio Rad s ddPCR supermix for probes no dUTP has been optimized for PCR amplification of rare target DNA sequences and for NGS library preparations The droplet PCR supermix provides unbiased amplification and greater template coverage of sequencing template Generate droplets by following the ddPCR standard workflow and protocols If your goal is to read droplets as well as recover material from droplets make the desired number of wells to be read on the QX100 or QX200 system nonrecoverable and also make replicates to be broken open not to be read on the QX100 or QX200 system For example a column of wells could be generated eight wells four of which are read after PCR and four of which are not read In QuantaSoft software set up the plate where only four of the eight wells are read After the QX100 or QX200 system has finished the run remove the plate and pierce the foil of the four remaining unread wells and proceed with breaking the droplets from those wells If your goal is to generate droplets and break them open only
45. NA is amplified for target detection using TaqMan hydrolysis probes After PCR amplification each droplet provides a fluorescent positive or negative signal indicating the target RNA was present or not present after partitioning Each droplet provides an independent digital measurement Positive and negative droplets are counted and software calculates the concentration of target RNA as copies ul 58 Droplet Digital PCR Applications Guide Gene Expression The one step RI ddPCR kit for probes is formulated for efficient and sensitive reverse transcription over a wide linear dynamic range of input RNA for ddPCR Use a commercial kit to extract RNA then store RNA at 100 ng ul in 1 10 TE buffer 0 1x TE or other appropriate buffer at 80 C A unique hot start reverse transcriptase enables convenient reaction setup The reverse transcription reaction is performed at b5 60 C enhancing the specificity and efficiency of primer mediated cDNA conversion The thermostable enzymes allow RNA template to be reverse transcribed and subsequently amplified in the same reaction tube Template specific primer annealing at elevated temperatures significantly improves stringency and melting of secondary structures Data Analysis In QuantaSoft software create a plate map by designing a new plate with a layout according to your experimental design Designate the experiment type as Absolute Quantification ABS in the Well Editor window during plate setup D
46. Rare Mutation and Sequence Detection Overview Droplet Digital PCR ddPCR enables detection and analysis of nucleic acids at a level of sensitivity and precision beyond the capabilities of previous methods Applications that focus on the lower limits of nucleic acid detection can be separated into two classes Rare mutation detection Rare sequence detection Rare mutation detection RMD and rare sequence detection RSD can be classified according to their assay components An RMD assay is made up of a single primer set plus two competitive probes Figure 5 1 RSD uses either a single assay to detect a rare sequence per unit volume Case 1 or two independent noncompetitive assays to detect a rare sequence as a proportion of a more common sequence Case 2 Both RMD and RSD take advantage of the high sensitivity of ddPCR Droplet Digital PCR Applications Guide 45 Rare Mutation and Sequence Detection 46 Measurement Assay Units Examples Components Assay Schematic Rare Mutation Detection Ratio Tumor biopsy 0 01 1 primer pair or a a b mutant detected 2 competitive probes FAM HEX or 1 in 10 000 2 A pei A Singl leotid T y E Single nucleotide polymorphisms SNPs gt ag AIG p Small indels Target DNA SNP Rare Sequence Detection monitoring 1 primer probe set Case 1 Copies volume E Invasive species 1 assay FAM copies ml lake water A m Human imm
47. Samples Some sample types are heterogeneous for CN state meaning that for a given sample of cells some have altered CN status and some do not Examples include a breast cancer biopsy where only a fraction of the cells are amplified for HER2 detection of fetal trisomy 21 from a maternal blood sample or somatic mosaicism in normal tissue In heterogeneous samples the ability to accurately quantify CN alterations is a function of both the percentage of assayed cells with a CN alteration and the increase in CN state of the target gene in those cells It is more challenging to detect CNV for a target locus in a sample where 10 of the cells have CN 3 instead of 2 than in a sample where 10 of the cells have a CN of 10 instead of 2 The problem becomes more difficult as the percentage of cells with the CN alteration decreases Detection of CN variant cells in a heterogeneous sample is a function of both the magnitude of the CN alteration and the rarity of the altered cell Table 4 1 Droplet Digital PCR Applications Guide 39 Copy Number Variation Analysis Table 4 1 Detection of CN variant cells in a heterogeneous sample Sensitivity Required for CN Determination in a Heterogeneous Sample Diploid Copy Number Cells with CN Alteration Wild Type Amplified Discrimination Needed 2 3 5 10 2 10 40 2 50 240 2 3 0 5 1 2 10 4 2 50 24 2 3 0 05 0 1 2 10 0 4 2 50 2 2 3 0 005 0 01 2 10 0 040 2 50 0 240 Pl
48. al 351 21 472 7700 Russia 7 495 721 14 04 Singapore 65 6415 3188 South Africa 27 861 246 723 Spain 34 91 590 5200 Sweden 08 555 12700 Switzerland 026 674 55 05 Taiwan 886 2 2578 7189 Thailand 1800 88 22 88 United Kingdom 020 8328 2000 Bulletin N6492 Rev A US EG 13 1554 0414 Sig 1213
49. al tissue biopsy will provide lt 250 ng of sample meaning lt 5 000 genome copies to screen and at best a 1 in 25 000 LoD With a more typical 100 ng of DNA from a biopsy an LoD of 1 in 10 000 is more practical Sample integrity and preparation the calculations above assume that every target present can be successfully assayed and does not account for nonamplifiable DNA Samples can have varying degrees of degradation and chemical damage FFPE samples for instance are routinely used in cancer research but can provide DNA of poor quality Consider this impact when calculating the amount of starting material needed to effectively screen the desired number of target molecules Sample Preparation To achieve optimal accuracy in copy number measurements restriction digestion of genomic DNA is required Restriction digestion separates tandem gene copies ensuring proper random partitioning into droplets Restriction digestion can also reduce sample viscosity and improve assay performance by improving template accessibility Rare Sequence Detection An RSD application might require one or two assays If the goal is to quantify the amount of target sequence in a given volume of starting material a single assay is used Figure 5 8 If the goal is to quantify the amount of target sequence with respect to a given reference sequence two independent assays are required Figure 5 9 In either case assay design and optimization for RSD has less r
50. and analyzes these data together as a single experiment You can display merged and single wells simultaneously or individually All merged well data are displayed with a closed symbol Figure 2 9 In contrast single well data are displayed with an open symbol see Figure 1 11 10 000 4 000 1 400 HE 1 400 HE 1 360 HE 1 390 HE 1 360 HE a 259 HE icp g 100 64 5 NE O O E S 10 15 2 HE 4 65 ME O E 15 MW O O 0 10 0 01 256 64 16 4 1 Sample Fig 2 9 Merged well data 22 Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments PCR Optimization Using Thermal Gradients Optimizing the annealing temperature of your PCR assay is one of the most critical parameters for reaction specificity Setting the annealing temperature too low may lead to amplification of nonspecific PCR products On the other hand setting the annealing temperature too high may reduce the yield of a desired PCR product Even after calculating the T_ of a primer you may need to determine the optimal annealing temperature empirically because this temperature depends on buffer conditions as well as primer and probe concentrations This involves repeating a reaction at many different temperatures Similar time consuming tests may also be required to optimize the sample denaturation temperature As with classical PCR reactions the optimal annealing temperature for an assay can be easil
51. anning CNV Experiments Assay Design 40 For CNV ddPCR target and reference assays are designed with different probe fluorophores generally FAM target and HEX reference or VIC reference When possible target and reference assays should have amplicons of similar length This is particularly important for fragmented samples like material extracted from formalin fixed paraffin embedded FFPE tissue Because CNV calculates the ratio of target concentration to reference concentration if either target or reference amplicon site in the genome is under represented due to fragmentation the ratio call will be off integer Check for secondary nonspecific products using the UCSC In Silico PCR site http genome ucsc edu cgi bin hgPcr command start This is particularly important for CN variable targets or members of gene families because of the presence of highly similar pseudogenes or homologs An ideal reference assay yields expected concentrations reproducibly and robustly across standard reaction parameters duplex partners and sample sources A reference assay should be CN invariant A good reference assay performs well across a wide range of annealing extension temperatures Examples of human genome reference loci RPPSO NCBI gene 10556 Ultraconserved sequences PMID 15131266 Droplet Digital PCR Applications Guide Copy Number Variation Analysis Running a CNV Assay Select Copy Number Variation CNV as the e
52. antification RED rare target sequence detection rare event detection CNV copy number variation to measure the concentration of target relative to the concentration of a reference Select Apply to load the wells and when finished select OK Once the plate layout is complete select Run to begin the droplet reading process Droplet Digital PCR Applications Guide 19 Designing Droplet Digital PCR Experiments Droplet Reading Following PCR amplification of the nucleic acid target in the droplets place the PCR plate in a QX100 or QX200 droplet reader The droplet reader and QuantaSoft software count the PCR positive and PCR negative droplets to provide absolute quantification of target DNA Droplet reading considerations are as follows Before a run the instrument can be set to interrogate droplets either in rows or columns Ensure there is enough droplet reader oil in the instrument and the waste is empty before arun Each sample is processed individually and interrogated for both FAM and HEX or VIC fluorescence Data from 12 000 16 000 droplets are used in concentration calculations he reader measures fluorescence intensity of each droplet and detects the size and shape as droplets pass the detector droplets are excluded if they do not meet quality metrics Data Analysis 20 After the QX100 or QX200 droplet reader has finished interrogating all wells use QuantaSoft software to analyze the
53. ce consider Increasing the hot start from 94 C for 10 min to 96 C for 10 min Raising the denaturation temperature from 94 to 96 C for the first 5 cycles Purchasing Bio Rad s C1000 Touch thermal cycler with 96 deep well reaction module f drops in concentration estimates are consistently confined only to a quadrant s of the block contact the manufacturer and request thermal couple uniformity analysis and if necessary repair Concentrations Consistently Lower than Predicted 86 If concentrations measured in ddPCR are consistently lower than predicted consider poor target accessibility poor or incorrect assay design or the presence of PCR inhibitors in samples It is possible that the reference concentration measurement that suggests ddPCR concentration calls are low is in fact in error and is reporting a higher than actual concentration ddPCR gives a concentration measurement of intact DNA targets while spectroscopic measurements typically do not distinguish between degraded and intact nucleic acids Also consider the following options Make sure the ddPCR assay has been optimized by running a temperature gradient experiment m Amplicons longer than 150 nucleotides may require longer annealing times during PCR f duplexing 2 assays together for the first time test them in a singleplex assay using the same sample to confirm that the assays are not interfering with one another Verify that the fluorophore
54. ction load 70 ul of droplet generation oil into the bottom wells of the DG8 cartridge Figure 2 4 Attach a gasket across the top of the DG8 cartridge and place it into the QX200 droplet generator Figure 2 5 The droplet generator produces about 20 000 droplets per sample in about 2 5 min for eight samples Droplets should be transferred to a 96 well PCR plate by pipetting gently Fig 2 5 Loaded DG8 cartridge placed in the QX200 droplet generator We recommend designing your experimental plate layout on a 96 well plate in columns because the cartridge contains eight wells After generating droplets in the DG8 cartridge pipet the droplets from the top wells of the cartridge into a PCR plate The PCR plate should be heat sealed using Bio Rad s PX1 PCR plate sealer and pierceable foil heat seal Note Using an alternative seal with glue can damage the droplet reader Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments After heat sealing place the PCR plate in a thermal cycler for PCR using the following guidelines Use a recommended thermal cycling protocol Usea2 5 C sec ramp rate to ensure each droplet reaches the correct temperature for each step during the cycling 40 cycles of PCR is enough for an optimized ddPCR assay Do not exceed 50 cycles After PCR the plate can be left in the thermal cycler overnight at 10 C or stored at 4 C Do not store the plate for mor
55. cy virus 46 99 hybridization 37 60 63 98 comparative genomic 37 hydrolysis probes 3 12 13 58 IHC 60 62 63 99 intercalating dyes 3 in vitro transcribed RNA 60 99 iScript 58 60 advanced CDNA synthesis kit for RI gPpCR 58 60 Select CONA synthesis kit 58 kinase 60 tyrosine 60 KRAS G12V 50 lake water 46 54 limit of detection 47 51 99 limit of quantification 47 54 99 LNA 46 99 locked nucleic acid 46 99 locus 16 37 39 44 83 reference 37 44 target 37 39 83 LoD 51 56 99 LoQ 54 55 99 measurement error 30 36 56 94 95 melting temperature 11 27 46 49 78 99 method 9 12 31 36 37 45 47 57 60 62 64 68 74 nearest neighbor 12 methylation 16 42 43 Mfold 15 Index microarrays 37 SNP based 37 microfluidic 83 microfluidics 2 3 mir 210 74 75 miRNA 74 75 99 synthetic template 74 MIT 13 15 mosaicism 39 somatic 39 MRGPRx1 38 72 73 multiplexing 24 27 75 76 mutant 46 51 88 90 sequence 4 site 46 mutation 7 13 45 47 56 78 79 99 NaCl 46 NCBI 15 40 NCBI gene 10556 40 NEBuffer 42 43 next generation sequencing 7 16 64 67 99 NGS 7 16 64 67 69 99 no template control 10 24 52 71 81 99 NTC 52 71 81 82 99 nucleic acid 1 2 4 7 8 15 17 20 27 45 46 64 83 86 99 quantification 2 nucleotide 7 12 14 37 46 48 78 83 86 99 oligo 12 14 82 oligo dT 57 58 oligonucleotide 12 parameters 14 23 40
56. d annealing extension temperatures is important Bio Rad s C1000 Touch thermal cycler with 96 deep well reaction module has excellent thermal uniformity To test the module s uniformity use the temperature sensitive assay that has concentration variability and create droplets from the same reaction mixture for the entire plate Check the entire plate for a discrepancy in concentration that exceeds the 95 confidence bounds for the wells If one of the block s Peltier devices is broken or underperforming a drop in concentration will be consistently observed in the same quadrant s of the block Figure 9 7 700 600 500 400 300 200 Concentration copies ul 631 624TH poar OOOH 624111 62111 622111 686111 640 E 6067 coor 52817 556 11 53811 547111 548111 54011 53611 En maT 491 UT 47711 459 387 1 Sample Fig 9 7 Concentration plot of a temperature sensitive assay M with a temperature insensitive assay M concentration across the plate despite having the same amount of input DNA well All sample wells were loaded with 0 5 copies droplet Raji DNA Droplet Digital PCR Applications Guide 85 Droplet Digital PCR Tips Assay Considerations and Troubleshooting The temperature sensitive assay used to generate Figure 9 7 is relatively long and very GC rich 244 bp 74 GC If it is suspected that the variation in concentration is due to thermal cycler performan
57. d type DNA 50 mutant wild type DNA A06 BO6 CO6 DOG E06 FOG GOG HOG AO BO7 CO7 DO7 E07 FO G O7 HO7 ee 14 000 12 000 10 000 8 000 6 000 4 000 Channel 1 amplitude 2 000 O 50 000 100 000 150 000 200 000 Event number 100 wild type DNA 50 mutant wild type DNA Fig 5 3 Two examples of SNP assay temperature gradients A 1 D amplitude plot of the FAM labeled mutant assay results of PISKca_E545k B 1 D amplitude plot of the FAM labeled mutant assay results of Pl8Kca_H1047R Once the best melting temperatures have been identified using 1 D plots use 2 D amplitude plots to assess assay sensitivity Look for no false positives or spray of droplets into the double positive region in the 2 D amplitude plot of the wild type only samples The 2 D amplitude plot for the SNP assay should have no positive droplets in the double positive region in the wild type only well Wild type only control wells should have the same concentration of DNA as the highest concentration experimental well Figure 5 4 shows an example of false positives or spray into the double positive region For more sensitive mutant detection assay redesign may be recommended to resolve this 14 000 12 000 7 10 000 8 000 6 000 Channel 1 amplitude 4 000 2 000 2n O l l l l l l 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 Channel 2 amplitude Fig 5 4 2 D amplitude plot of a wild
58. detection of mutant targets very high loads of DNA are required However for ddPCR amounts of intact human DNA exceeding 66 ng 20 000 genome equivalents 20 pl reaction negatively affect the accuracy of DNA quantification To mitigate this effect gDNA must be fragmented by restriction digestion using an enzyme that cuts around the amplicon s of interest Once fragmented the human gDNA concentration can exceed 1 ug 20 ul reaction without affecting DNA quantification Droplet Digital PCR Applications Guide Rare Mutation and Sequence Detection Rare Mutation Detection Rare mutation detection occurs when a biomarker exists within a background of a highly abundant counterpart that differs by only a single nucleotide Many methods for mutation analysis have poor selectivity and fail to detect mutant sequences with abundances of less than one in 100 wild type sequences Scott 2011 Benlloch et al 2006 Whitehall et al 2009 If enough DNA sample is available for testing a limit of detection of 1 mutant in 100 000 wild type can be detected using a well designed assay and proper experimental setup ddPCR for Rare Allele Detection and Experimental Considerations The partitioning effect which is a hallmark of ddPCR technology has an important impact on the sensitivity and specificity of a PCR reaction For applications reliant on measuring a low abundance rare mutant allele in a large excess of wild type DNA partitioning the sample into dro
59. done in bulk solution using the TaqMan microRNA reverse transcription kit Life Technologies Corporation and using the miRNA RT protocol with the specific RT primers for each miRNA 74 Droplet Digital PCR Applications Guide Additional Applications ddPCR amplification of the cDNA generated in the RT reaction was done by adding 1 33 ul of each cDNA to a 20 ul ddPCR reaction mixture containing 1 ul of 20x TaqMan miRNA reagent Life Technologies specific to the miRNA of interest 10 ul of Bio Rad s 2x ddPCR supermix for probes and 7 67 ul of molecular biology grade water The droplets were generated thermal cycled and detected using standard procedures Day to Day Reproducibility Study mir 210 miRNA mir 210 synthetic templates at 1 6 nm originated from a single 1 UM stock The 1 6 nM stock was used to create nine concentrations 10 ul into 90 ul RNase free water on ice Concentrations 5 9 were used for the titration series with an estimated concentration range of 2 135 0 21 copies ul of ddPCR The data are plotted as individual well replicates duplicates for each day with Poisson 95 confidence intervals in Figure 8 4 10 000 e Day 1 s e Day2 1 000 7 D Oo o O O E t Q gt 3 gt i 0 1 0 1 1 10 100 1 000 10 000 Estimated copies ul Fig 8 4 Day to day reproducibility of mir 210 miRNA assay measured vs theoretical Multiplexing Various schemes can be designed to add complexity to assays run
60. dos 40 Running a CNV Assay merda da a BAe aoe a 41 ResSIACUON DIGSSIOMN pura a a 41 DNA Loading for Lower Order CN Analysis diploid CN lt 10 naana aana a 44 DNA Loading for Higher Order CN Analysis diploid CN gt 10 nananana ee aa 44 Rare Mutation and Sequence Detection ococococonoca ees 45 D E ra EE NE yt A OE A E S EA EE AE A E ir pe ee GON a 45 Rabe Metadon Detechon simran uaa a Grp Gon a A E oes 47 ddPCR for Rare Allele Detection and Experimental Considerati0NS o ooo ooo 47 RMD Experiment Considerations nia a as 48 TESTO ARAN ASS ds is Md E DA o O amp Oo A ee 48 Interpreting 2 D Plot Results for SNP Assays o o ooooocoorra ee teens 50 Statistical Considerations for Rare Detection Experimental Design o oo o 51 Recommended SOTO Sy ri rc ds ond Bde RAE Rae ee Be 52 Experimental Strategies for RMD ss 1ixccos rt ri testi dais ia cetnbek 53 Factors that Impact RMD Calculations o o o ooooonoroono oo 53 Soc co A teen eases etch Epp avn aca dawson el oho ne 53 Rare Sequence DetecuO iia a da ds Sal s e ao Ad oa 53 RASDEXPermental SUIS aca da a rose E ato tra 54 Case 1 Quantification with Respect to Total Starting VolUMEe o o o ooooooooooo o o 54 Case 2 Quantification with Respect to Second DNA Sequence sasa 2 ee eee 55 Factors that Impact RSD Calculations ss arcas a 56 FAC ECOS arena a a ean a date E SESA 56 Gene Expressions aia is AAA ao 57 TNO a ts ito a
61. e 22 empty droplets and we estimate a concentration of 1 88 based on this number The partitioning in Figure 3 shows different instants in time and correspondingly different numbers of empty droplets note that the empty droplets are highlighted by a thicker black line This type of error is governed by Poisson statistics just like the subsampling error and is referred to as the partitioning error Empty droplets 20 Empty droplets 17 Empty droplets 19 Estimated concentration 1 97 CPD Estimated concentration 2 14 CPD Estimated concentration 2 03 CPD Fig 3 Target molecule partitioning repeated three times CPD copies per droplet Droplet Digital PCR Applications Guide Appendix B Technical Error Bars in Droplet Digital PCR Figure 4 illustrates the technical error as a function of CPD for 10 000 droplets Note that the coefficient of variation CV is extremely low across the entire range covered here The dotted lines show the region with CV lt 2 5 0 17 5 1 CPD The black and blue curves match very closely at low CPD meaning that subsampling error is more significant than the partitioning error in this example The blue curve goes up with high CPD as the contrib
62. e 7 2 Targeting both flanking segments ensures testing for both well formed and poorly formed fragments allowing quantification of species possessing both adapter arms Droplet Digital PCR Applications Guide 65 Next Generation Sequencing Library Analysis el H Probe 1 Q F Probe2 Q gt AA PA RP Fig 7 2 Design of the ddPCR library quantification kit for Illumina TruSeq assay An example of the 2 D plot of ddPCR FAM versus HEX data observed for this assay is shown in Figure 7 3 11 000 10 000 9 000 8 000 7 000 6 000 5 000 4 000 Rees 3 000 pe 2 000 ee 1 000 O Channel 1 amplitude O 1 000 2 000 3 000 4 000 5 000 6 000 7 000 Channel 2 amplitude Fig 7 3 2 D plot of ddPCR data from the ddPCR library quantification kit for Illumina TruSeq Library Quality Analysis 66 The ddPCR library quantification kit for Illumina TruSeq contains TaqMan assays designed to detect and quantify both the P5 and P7 adapter arms Each assay can be used to independently confirm the formation of bona fide library fragments by exploiting the ability of the QX100 or QX200 Droplet Digital PCR system to detect subpopulations of templates with differing amplification efficiencies and with different combinations of P5 and P7 moieties A 2 D plot of the library can be used to provide information on the quality of the library Figure 7 4 Inserts of varying sizes within the library can be observed a
63. e EE 74 Day to Day Reproducibility Study mir 210 MIRNA 2 ee ees 75 MOUDE AAA e a aara aaa a eaaa er e west E e Ea SA fee Droplet Digital PCR Tips Assay Considerations and Troubleshooting 78 Assay Dependent cluster SNS casitas hah ee woud oh iid BELG Ree ae 78 Shifted Clusters Due to Probe Cross Reactivity o o ooooooooonoro ear 78 Probe Cross Reactivity Can Identify Off Target Amplification o o o ooooooooooooo o 79 Positive Droplets in No Template Control Wells nnana aaua nooo 81 High Mean Fluorescence Amplitude IntenSity ooooooooororarna eras 82 No or Few Positive Droplets n n anaa dao heehee a8 83 NGOrLow Total NODE COUNL rosada dsd dos 83 Inconsistent Concentration ReSultS o oooooooooorr ee eee eens 84 ASA A eae eens alse ae ths hes ates Ae eae A 84 Effects Of POOr Cycler UAMOAILY tia atte se atop eel a ak eo meee was eee te 85 Concentrations Consistently Lower than Predicted 0 0 ce ee ee eens 86 18 elo ars Mido Sia zt ee ies ee ic ee ee RE aE AN RR a ee a Be 87 No Concentration Calls on Some WellS 2 0 a 87 Tae IAC CCSGIDIIN acia a E ai ato 87 High Fluorescence Amplitude DropletS ooooooooconras naa 88 Troubleshooting EvaGreen ddPCR Reactions o oooooooroonoro ee eee eee nes 88 FRE ICRC Fy cnn a rp fhe gape tee ee se aE doc RPI OR a et Tan RN 90 OrderinGiInionmavlon 24 ease oe a ote ene beens Sees 91 QX2
64. e data are generally comparable on most of the assay locations A few sites are much lower in one step RI ddPCR because those sites may be involved in secondary structures and the priming sites might not be accessible to the reverse transcription enzyme You must decide whether one step or two step RI ddPCR is best for your experiment 800 E Bio Rad Script advanced cDNA synthesis 700 4 kit for RT qPCR E Bio Rad one step RT ddPCR kit for probes 600 4 500 400 300 200 4 100 0 S N vo t LO i oi at md cn Ooo Oo x 12 2 Concentration copies ul OT ON E RE v noto o SU x 0 wo A a o o o E ba a 0 si a o al _ El o om n m A A A A n Y ahi od o e o a a ee ee m lt on zx 222239333039 SR 53 LIIxIx Ta 2 2 Sample Fig 6 2 Comparison of one step RT ddPCR and two step RT ddPCR with in vitro transcribed RNAs spiked in Ambion human brain reference RNA HER2 Study The human epidermal growth factor receptor 2 gene HER2 is encoded by the ERBB2 proto oncogene and is involved in signal transduction for cell growth and differentiation It is a cell surface receptor for tyrosine kinase and a proto oncogene Overexpression of ERBB2 is of clinical relevance in breast cancer because of its prognostic value in correlating elevated expression with worsening clinical outcome ERBB2 assessment is also important because successful antitumor treatment with Herceptin is strongly correlated with ERBB2 overexpression
65. e graph of fluorescence intensity vs droplet number Droplet Digital PCR Applications Guide 5 Droplet Digital PCR Droplet Digital PCR data from a duplex experiment in which two targets are PCR amplified can also be viewed in a 2 D plot in which channel 1 fluorescence FAM is plotted against channel 2 fluorescence HEX or VIC for each droplet Figure 1 10 10 000 9 000 8 000 7 000 6 000 5 000 4 000 Channel 1 amplitude 3 000 2 000 1 000 O 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 Channel 2 amplitude Fig 1 10 2 D plot of droplet fluorescence Because the DNA distribution into the droplets follows a random pattern droplets cluster into four groups FAM negative HEX negative double negative droplets FAM positive HEX negative FAM negative HEX positive FAM positive HEX positive double positive droplets QuantaSoft software measures the number of positive and negative droplets for each fluorophore in each sample The software then fits the fraction of positive droplets to a Poisson algorithm to determine the starting concentration of the target DNA molecule in units of copies ul input Figure 1 11 10 000 1000 1 390 E 1 400 1 400 E 1 400 1 360 Er 1 870 1 380 Er 1 390 E 1 370 1 360 E 260 259 Oo 2 N 64 2 64 8 O O E 15 5 HE 15 YE 9 10 E 4637
66. e mix for a total volume of 25 ul Load 20 ul of this mix into a DG8 droplet generator cartridge and run ddPCR The software reports that the concentration is 8 copies ul Two equivalent methods illustrate how many total copies and how many copies ul of the target DNA were present in the original 10 ul sample Method 1 The ratio of sample to total volume is 10 25 2 5 Since there were 8 copies ul in the final PCR mix there were 8 x 5 2 20 copies ul in the original sample In the full 10 pl of the original sample there were 10 x 20 200 copies of the target DNA Method 2 Since there were 8 copies ul in the PCR mix and a total of 25 ul of the PCR mix was made there were 8 x 25 200 copies of the target DNA in the PCR mix This mix contained 10 ul of the original sample so there were 200 copies of target DNA in the full 10 pl of starting sample and 200 10 20 copies ul of target in the starting sample Copies per Droplet A useful unit for discussing the calculations underlying ddPCR is copies of target per droplet CPD For illustration purposes in this chapter we will use 1 nl volume CPD represents a number per unit volume and not a mass per unit volume CPD is the average number of target copies droplet For a CPD of 2 for example some droplets will have O copies some will have 1 2 3 and so on There are multiple ways to calculate CPD Example 1 CPD total number of molecules total number of droplets If
67. e oo 24 Evatireen and Gene EXDresSiOn cx accu ev ae hei Rea Pa a he ed Ae Be ae 26 Multiplexing With Evaren scs dai ase ee eee ae dean ae Yay 27 Roer sosa sa o is a e e ala R pe Aa A ieee Ae 2T Absolute Quantification and the Statistics of Droplet Digital PCR 28 Running Absolute Quantification Experiments 0 0 ce eee eee eens 28 Absolute Quantification Data AnalySiS 0 ee eee eee eens 29 Droplet Digital PCR Applications Guide Chapter 4 Chapter 5 Chapter 6 Table of Contents Ola SCS O OOP OR sus mati yodo eain a eii o tl dedicaci n 30 Copes DEF MITOS y ya a Ate eh a be doe DA 31 Cope Der DOD Clas rana pos data aa danna 31 LOW SOncen talon EXIME cariat ade E E ds ES 32 Intermediate Concentration Example 33 High Concentration Example da a e ale ee 33 Looking across the Whole Concentration Range 1 0 ce eee eens 34 Concentration acu a da 34 DEMOS res Aia E Pa r 34 Formula for Calculating Concentration tra EA AA AAA Sees 35 Derivation of Concentration Formula nasasa aaea eae a 35 o A mite tok aoe ood O yn aoe See 36 Copy Number Variation Analysis 0 000 cee ees 37 ONES Watson ap A ce 37 CNV GAC UNIONS iye ea dro cn ls Settee da Be dci eee a be terete 39 CNV Analysis in Homogeneous SaMpleS aea eens 39 CNV Analysis in Heterogeneous SampleS o eatea ee ee eee ens 39 Hand ONV EXPDerments oi dad Se it SR a Baw E dd eel ee SS 40 ASSIM DES aa ia aaa abad
68. e than 3 4 days before running it in a QX100 or QX200 droplet reader Setting Up an Experiment in QuantaSoft Software From the computer attached to the droplet reader open QuantaSoft software in the setup mode and design a new plate with a layout according to your experimental design Detailed instructions for how to set up a new experiment and interoret ddPCR data can be found in the user manual Double click on a well in the plate layout to open the Well Editor dialog box Designate the sample name experiment type and which assays correspond to which channels such as FAM and HEX Figure 2 6 You can select several contiguous wells at one time using shift double click or select non contiguous wells using Ctrl double click Either selection will bring up the labeling menu In the Well Editor dialog box input sample names and use the dropdown menu to designate the experiment type Q QuantaSoft ersion 1 3 2 0 E Sample Assay 1 Assay 2 Applied Well Settings Ilo 7 1D Apply Auto Inc Apply Auto Inc Apply Auto Inc rco Name CEI je ERAS FT Name PD Pr ExperimenfENABS1 y id Type U Ch1 Unknown y Iv Type IR Ch2 Reference y M Save Raw Data Y Reset Cancel OK 01 02 03 D4 05 06 07 08 09 10 0 hr control lA RIEA A lWikras if RPP30 Analyze Fig 2 6 Labeling the plate There are three types of experiments that can be selected for each well ABS absolute qu
69. ect FAM and HEX or VIC The autosampler of the droplet reader picks up the droplets from each well of the PCR plate Figure 1 6 Fig 1 6 QX200 droplet reader autosampler 4 Droplet Digital PCR Applications Guide Droplet Digital PCR Droplets are spaced out individually for fluorescence reading by the droplet reader Figure 1 7 Fluorescence in two channels is then measured for individual droplets SSO A Fig 1 7 Separating individual droplets in the QX100 droplet reader Positive droplets which contain at least one copy of the target DNA molecule exhibit increased fluorescence compared to negative droplets Figure 1 8 f a rrr Fig 1 8 Fluorescence readings are measured for each droplet in two channels ddPCR Data Analysis Droplet Digital PCR data can be viewed as a 1 D plot with each droplet from a sample plotted on the graph of fluorescence intensity vs droplet number In Figure 1 9 all positive droplets those above the red threshold line are scored as positive and each is assigned a value of 1 All negative droplets those below the red threshold line are scored as negative and each is assigned a value of 0 14 000 12 000 10 000 y 8 000 6 000 Channel 1 amplitude s 3 323 2 000 gt 4 000 O l I 0 2 000 4 000 6 000 8 000 10 000 12 000 14 000 Event number Fig 1 9 Each droplet from a sample is plotted on th
70. een dsDNA Dye 24 The QX200 system can measure amplified DNA using Bio Rad s QX200 ddPCR EvaGreen supermix template and a pair of primers EvaGreen dsDNA binding dye is similar to SYBR Green in that it fluoresces upon binding double stranded DNA Figure 2 11 FR 0 0 WU Inactive form Active form EvaGreen DNA complex of EvaGreen of EvaGreen Fig 2 11 EvaGreen dye binds to dsDNA via a release on demand mechanism EvaGreen dsDNA binding dye enables double stranded DNA detection with the convenience and savings of only needing primers to amplify and detect product with the added high resolution features of ddPCR ddPCR with EvaGreen can be used with applications such as gene expression copy number variation DNA rearrangement detection micro RNA detection and multiplexing The fluorescence amplitude of each droplet with EvaGreen varies with amplicon length and with PCR efficiency Longer amplicons will bind to more EvaGreen dye molecules and therefore be brighter PCR reactions that are not at their most efficient annealing extension temperature will result in fewer amplicons in each positive droplet at end point and therefore lower fluorescence amplitude Despite the range in positive fluorescence amplitude accurate quantification is still routinely achieved These features provide the user the ability to measure length or PCR efficiency as well as the ability to measure multiple targets in the same well while only using
71. ellent estimate of technical replicate measurement errors A technical replicate in this context is when aliquots of the same sample are loaded into multiple ddPCR wells An interesting and useful feature of ddPCR is that it is possible to estimate the technical replicate error from a single concentration measurement Total errors the recommended error to use in most applications in biology It is the greater of the technical error and the standard error of the mean This method is the preferred one because it prevents underestimation of the error We can say with certainty that if you observe a standard error of the mean that is less than the theoretical technical error you were just lucky and the true error is in reality at least as big as the technical error For experiments with replicates both an empirical error measurement the total error and a theoretical technical replicate error the Poisson error or technical error are calculated In most cases It is more appropriate to report the total error measurement If the wells are true technical replicates as defined above the total error and the Poisson error will be nearly identical for good assays Note Error bars are shown in QuantaSoft software as 95 confidence intervals The closest parallel in quantitative PCR qPCR is the mean 2 times the standard error of the mean Some qPCR systems by default show 68 confidence intervals or the mean 1 times the standard error of the
72. emperature T_ of the mismatched probe is to the annealing extension temperature used for the assay For this reason RMD assays are designed to maximize the I difference between a perfectly matched and a mismatched target A cross reacting probe causes single positive clusters Ch1 Ch2 and or Ch1 Ch2 to migrate toward the axis of the other channel which is most easily viewed in the 2 D amplitude plots see Figure 9 1A Figure 9 1 exemplifies this phenomenon where the FAM probe cross reacts to a PCR product perfectly complemented by the VIC probe resulting in mild to moderate FAM probe cleavage in the droplets This causes an upward shift or migration in the location of the droplets in 2 D space A similar shift is observed for the FAM droplets These shifts are clearly seen in the 2 D amplitude plots By contrast the 1 D amplitude plots and histograms of these same data are difficult to interpret Figures 9 1B E To avoid Droplet Digital PCR Applications Guide Droplet Digital PCR Tips Assay Considerations and Troubleshooting such confusion always classify the droplets of cross reacting assays while viewing the 2 D amplitude plots For users operating QuantaSoft software version 1 2 10 or earlier appropriate droplet classification using a linear threshold may not be possible without misclassifying some droplets Upgrading to QuantaSoft software version 1 3 2 or higher allows tor proper classification using the clustering too
73. en 3 11 12 24 26 27 88 89 92 93 exonuclease activity 12 experimental plate layout 18 FAM 3 4 6 9 10 13 19 20 22 40 46 48 49 51 59 61 66 67 13 8 82 FFPE 17 40 53 58 60 62 98 FISH 60 62 63 98 fluorescence 5 7 12 13 20 23 27 29 30 48 60 63 66 68 75 76 79 82 88 90 98 99 amplitude 7 23 27 29 75 76 82 88 90 fluorescence in situ hybridization 60 98 fluorescent 2 12 58 fluorophore 3 6 13 29 40 48 86 reporter 3 Droplet Digital PCR Applications Guide footprint 16 amplicon 16 formalin fixed paraffin embedded 17 40 53 58 98 formula 7 14 16 35 salt correction 14 fragmentation 16 17 40 GAPDH 62 63 GAPDH PL 62 GC 11 14 86 98 gDNA 9 10 16 43 46 87 98 gene expression 7 24 26 46 57 59 63 genome 16 17 28 37 39 41 44 46 48 51 53 76 diploid 17 44 haploid 16 41 48 51 human 16 37 40 76 genomic DNA 9 26 41 44 53 68 98 GMO plant stock 39 guidelines 11 13 17 19 52 58 81 design 11 haplotype 72 HER2 39 60 62 63 98 99 HER2 62 Herceptin 60 HEX 3 4 6 13 19 20 22 40 46 99 60 07 75 17 histogram 29 78 79 HIV 46 99 homologs 40 79 hot start 59 81 86 HPLC 74 human 9 10 16 37 40 42 44 AG 48 51 52 53 55 60 68 72 74 76 87 98 99 cells 55 human brain reference 60 human epidermal growth factor receptor 2 gene 60 98 99 human immunodeficien
74. eration Sequencing Reads In Figure 7 6 we demonstrate the relationship between the ddPCR determined library concentration loaded and the number of total reads from sequencing on a MiSeg platform By measuring library concentrations the amount of input can be balanced across samples before loading the NGS instrument Droplet Digital PCR Applications Guide 67 Next Generation Sequencing Library Analysis 107 A O 8 y B O S R Q E 64 A A O nm E A a T 4 ea B 2 Total reads a O PF reads E A Q30 reads O a a gt TS 0 2 4 6 8 10 12 14 16 Concentration pM Fig 7 6 Plot of the reads vs input library concentration Impact of input library concentration on total usable reads Cluster density at 5 pM was approximately 800 000 mm PF passing filter As the cluster density and therefore number of reads is intimately tied to the loading concentration of the prepared library moderate differences can compromise read Capacity and quality of the MiSeg platform NGS library quantification with ddPCR is extremely accurate providing accuracy better than 15 with a confidence level of 95 This method provides absolute quantification eliminating the need to develop standards Use of ddPCR in NGS significantly increases reliability and quality and optimizes use of consumables labor and instrument time Additional information not available with other methods such as adapter adapter dimers and im
75. eratures is shown for three amplicons with different lengths A B and C correlate to 200 99 and 62 bp amplicons respectively The experiment demonstrates the effect amplicon length has on fluorescence amplitude as well as how annealing extension temperature affects amplitude and the ability to resolve products with different lengths based on amplicon size Red arrows show increasing separation between 200 and 99 bp amplicons as the annealing extension temperature is lowered from 65 to 55C Roe 65 C 55 C A04 A05 A06 B04 BOS BOG C04 C05 C06 D04 DOS DOG E04 E05 E06 F04 FOS FOG G04 G05 GO6 HO4 HO5 HO6 40 000 35 000 30 000 25 000 20 000 Channel 1 amplitude 15 000 gt 10 000 5 000 Fig 2 13 Gradient of annealing extension temperatures for three amplicons with different lengths A 200 bp B 99 bp and C 62 bp Droplet Digital PCR Applications Guide 25 Designing Droplet Digital PCR Experiments EvaGreen and Gene Expression Measuring gene expression using ddPCR and EvaGreen allows you to detect and quantify splice variants as well as contaminating genomic DNA Figure 2 14 shows an experiment demonstrating that splice variants can be seen as a cluster of droplets with higher fluorescence amplitude referred to as a super cluster Control samples with no reverse transcriptase added were run to verify that the super cluster was not due to residual genomic DNA FO7
76. es are linked on the same chromosomal strand Droplet Digital PCR Applications Guide Additional Applications 5 r m I I I I i I 4 I I I I Sample 1 Sample 2 Sample 3 i Sample 4 Sample 5 Z 3 Cut Uncut Cut Uncut Cut Uncut Cut Uncut Cut Uncut E root fy Li E i DD Cc I KE CA IIA ES 9 ny O 2 9 ry AA a r 3 I y I I I I i 0 i a a eee ee ee a eee eee es Pe A e eo es at I SS SESS R SSS SCSORRREKRKRBHS S SRSGQORBRREESSS aooeoreeof 7 Fee eee sy ceso Ll LL55o9 2000000000000 A XAO 000 ANAT rT TOMO OTT PR2 eMAMASoSCOMAMN HH HAMMAR HOY FI GSSoSAd o Bao Aas es Cee ooonmnmmoaoomnd a da all AR DA i mmm ma n A ial els eee im On n mM Sample Fig 8 1 CNV of different human samples using restriction digestion vs undigested DNA for the same sample for the MRGPRX1 gene Milepost Assay Linkage studies can also provide information on the quality of the template and allow you to determine how degraded or fragmented the template might be by examining an assay that serves as a positional anchor and a second assay located at a determined distance on the same chromosome This is known as a milepost assay Figure 8 2 represents the assay design scheme for performing a milepost assay Different DNA targets are designed at different lengths from an anchor assay typically 1 kb 10 kb and 100 kb Each milepost marker is run in multiplex with the
77. esignate which assay is the target and which is the reference assay Channel 1 or 2 in the Well Editor window If the plate was set up for ABS analysis automatic thresholding will determine concentrations and populate the data tables in the analysis mode of the software To get the ratio of target over reference for gene expression a duplex assay must be run with two different probes FAM and HEX or VIC In QuantaSoft data analysis a button labeled Ratio will become active if the experiment contains a duplex assay set up with a FAM assay and a HEX or VIC assay Figure 6 1 Clicking on the Ratio button plots the relative ratio of a b the concentration of the FAM assay over the concentration of HEX or VIC assay You can also click the Inverse button Figure 6 1 if you switched the assay dyes where FAM is the reference and HEX or VIC is the target the inverse makes the ratio b a instead of a b Rato at Fractional Abundance a act y 1D Amplitude 2D Amplitude Concentration copy mmber i al Events Fig 6 1 QuantaSoft software ratio feature and inverse checkbox for gene expression ratios Droplet Digital PCR Applications Guide 59 Gene Expression ddPCR Gene Expression Data As shown in Figure 6 2 cDNA copies were made on three in vitro transcribed RNAs with the one step RI ddPCR kit for probes or two step RT gPCR with Script advanced cDNA synthesis kit for RT gPCR Th
78. fraction of droplets that is empty that is the fraction that does not contain any target DNA As an example Suppose a sample contains 1 000 copies ul of a target molecule and the sample is loaded into two ddPCR wells In one well only 10 000 droplets are read by the software and in the other 15 000 droplets are read In both cases the fraction of empty droplets will be the same and thus the concentration in copies ul will be the same in both wells within the limits of the instrument measurement error At the extreme ends of the concentration range for example fewer than ten copies of target in a well or more than 120 000 copies of target in a well fewer droplets in a well will lead to slightly larger error bars Note For simplicity we will use 20 000 partitions in the examples in this chapter Droplet Digital PCR Applications Guide Absolute Quantification and the Statistics of Droplet Digital PCR Copies per Microliter QuantaSoft software provides concentration results in copies of target per microliter copies ul The dynamic range of ddPCR extends from fewer than 0 25 copies ul to more than 5 000 copies ul In many cases the fundamental quantity of interest to a user is the number of copies of target in the starting sample The following example shows how copies ul is converted to copies in the starting material Mix 10 ul of sample with 12 5 ul of ddPCR supermix for probes and 2 5 ul of assay primer and prob
79. g DNA to the Reaction Mix 16 The recommended dynamic range of the QX100 system is from 1 to 120 000 copies 20 ul reaction There are about 120 000 copies in 400 ng of human DNA assuming 1 copy haploid genome To estimate the number of copies ng of DNA for your organism you must know the mass or the number of base pairs in the genome see formula below If the experiment entails quantifying samples known to have extremely high amounts of target molecules such as next generation sequencing NGS libraries plan to reduce the starting sample accordingly If the target copy number genome is unknown we recommend that you determine the optimal starting amount by doing four tenfold dilution series of each sample at the expected digital range By assaying the four data points above and below the expected digital range you ensure that one of the data points is within the optimal digital range To help determine copy number per genome collect the following information 1 If the source or species of the gDNA is known but the genome size of the organism of interest is unknown refer to http www cbs dtu dk databases DOGS index html to determine the size of the genome in question 2 Once the size of the genome is known determine the mass of the genome using the following formula m n 1 096 x 107 g bp where m is the genome mass in grams and n is the genome size in base pairs The following example calculates the mass of the human gen
80. he reporter is cleaved The free reporter fluoresces During annealing the hydrolysis probe binds to the target sequence x u y Reporter Quencher Fig 2 1 In TaqMan assays hydrolysis probes are hydrolyzed by Taq polymerase When designing probes use the following guidelines The probe sequence must be chosen between the two primers of the amplicon Primer sequences cannot overlap with the probe though they can sit directly next to one another The T_ of a hydrolysis probe should be 3 10 C higher than that of the primers Choose a sequence within the target that has a GC content of 30 80 and design the probe to anneal to the strand that has more Gs than Cs so the probe contains more Cs than Gs The probe should be lt 30 nucleotides long because distance between fluorophore and quencher affects baseline signal intensity Longer probes or 1 enhancers are recommended if needed to achieve the required T Probes should not have a G at the 5 end because this quenches the fluorescence signal even after hydrolysis Black Hole Quencher or other nonfluorescent quenchers are recommended m enhancers for probes are recommended for single nucleotide polymorphism SNP and rare mutation detection assays in order to keep the background fluorescence to a minimum Shorter probes discriminate better between single base differences in the target amplicon s The QX100 and QX200 systems are compatible with
81. ically to single stranded DNA Therefore adding excessive amounts of primer or DNA starting materials to EvaGreen ddPCR reactions can result in an inability to distinguish positive droplets from negative droplets The separation of positive and negative fluorescence can be affected by total added DNA including primer concentrations in addition to the previously discussed fluorescence amplitude differences in amplicon length or amplicons with varying PCR efficiencies For good separation a combined primer concentration between 75 250 nM is recommended and 100 200 nM is optimal Figures 9 9A B Figure 9 9C is an example of the effect of EvaGreen ddPCR with 900 nM primers on increasing concentrations of DNA that should be negative for the primer set added Figure 9 9D shows the primer concentration is decreased to 100 nM and the negatives are returned to a uniform cluster of droplets Similarly adding more than 130 ng DNA 20 ul reaction can cause the negative droplets and positive droplets to have poor separation Figure 9 10 shows an experiment with 100 copies ul mutant DNA spiked into increasing amounts of wild type DNA As the total added DNA concentration increases the positive fluorescence amplitudes decrease and the negative fluorescence amplitudes increase Droplet Digital PCR Applications Guide Droplet Digital PCR Tips Assay Considerations and Troubleshooting A 1 uM 300 nM 25 nM
82. ication of this product If no flexibility exists in primer design shift the probe to minimize complementarity to the off target sequence AOQ B09 CO9 DO9 E09 FO9 GO9 HO9 25 000 20 000 oO Lo 2 e st E 15 000 pa wt a gt Ay E iy ie i eee a A i a 1 z a E 10 000 i AO E a G i i I I fas ES hall mee i I I a i i a E 5 0007 i i pa 6 e a a s 1 ws x a a a A 0 i da pos E eij i E L 0 20 000 40 000 60 000 80 000 100 000 Event number Fig 9 3 Annealing extension gradient where the assay detects an off target species Droplet Digital PCR Applications Guide Droplet Digital PCR Tips Assay Considerations and Troubleshooting Positive Droplets in No Template Control Wells Digital PCR can detect very low levels of target DNA so it is important to prevent template amplicon contamination and to run no template controls NTCs Positive droplets in NTC wells that are at intensities equal to those of positive droplets in sample wells are typically caused by template or PCR product amplicon contamination in the reagents Having a clean environment and clean NTC wells that is no positive droplets is imperative when the application is rare sequence detection wells with a low number of positives In Figure 9 4 the first well a contaminated NTC well has four droplets of the same amplitude as those seen in the well on the right positive sample If positive dr
83. igh volumes of digestion buffer are included because of high salt concentrations f possible avoid use of NEBuffer 3 and 3 1 which have the highest salt concentration Digested templates should be diluted a minimum of 10 fold in the final ddPCR reaction setup to reduce the final salt concentration in ddPCR For example no more than 2 ul of a 1x digest reaction should be loaded into a 20 ul ddPCR reaction if possible Many assays will perform well regardless of which NEBuffer is used or the amount of 1x digest reaction loaded into ddPCR Incubate the reaction for 1 hr at the recommended temperature Heat inactivation is not required but can be considered if long term storage of digested template is required Do not heat inactivate at greater than 65 C DNA purification is not necessary after restriction digestion Store digested DNA at 20 C Droplet Digital PCR Applications Guide Copy Number Variation Analysis Lists of recommended restriction enzymes for CNV ddPCR are provided in Tables 4 2 and 4 3 Conditions for a typical restriction enzyme digestion are in Table 4 4 For more information visit the New England Biolabs Inc website www neb com Table 4 2 Recommended restriction enzymes for CNV ddPCR most preferred 4 cutters Restriction Digestion Buffer Digestion Buffer Incubation Enzyme Sequence old new Temperature C CviQl G TAC NEBuffer 2 3 BSA 3 1 25 Msel T TAA NEBuffer 2 4 BSA CutSmart
84. in the tumor about 30 of all breast tumors overexpress ERBB2 Data Analysis Results 60 Results demonstrate that ddPCR can be used to assess expression levels of HER2 transcripts in FFPE human breast tissues samples that were concurrently assessed via pathologists using fluorescence in situ hybridization FISH and immunohistochemistry IHC methods Droplet Digital PCR Applications Guide Gene Expression Figure 6 3 illustrates the determination of ERBB2 transcript levels relative to the EEF2 reference gene The best coverage ERBB2 assay was tested with four fresh frozen breast tumor RNA samples OriGene Technologies Inc FAM ERBB2 concentration VIC EEF2 concentration and normalized ERBB2 to EEF2 concentrations are shown in Figure 6 3 blue green and maroon respectively 4 000 5 3 400 NE 3 200 3 130 ME a N a 2 400 2 04 B Sa Q AA E S mM E L E 1 650 ME E D 1 600 DOU E as S O O 1 57 4 2 1 28 4 1 050 HE 1 030 HE 800 1 658 Me 514 E 215 HE 6 0 0633 4 0 CR560536 cD CR560258 cD CR562124 cD CR561507 cD Sample Fig 6 3 Concentrations of ERBB2 and EEF2 gene expression Figure 6 4 shows a twofold change in sample concentration that demonstrates linearity of the assay spanning two log orders 320 F500 1 1 000 25 P 1 250 241424482 031 p 2370 2286 E TO e 395 FE 394 7 193 FE 160 N S 100 E 3 I O E O E
85. ingle primers include melting temperature T length base composition and GC content In addition because primers are used in pairs ensure that paired primers do not exhibit significant complementarity between 3 ends because this can result in primer dimers Extensive primer dimer formations can significantly decrease or prevent amplification The QX200 Droplet Digital PCR system will support both hydrolysis probe TaqMan and DNA binding dye EvaGreen assays All information in this chapter applies to both types of assay except for the Designing Probes section Droplet Digital PCR Applications Guide 11 Designing Droplet Digital PCR Experiments When designing primers for a target sequence follow these guidelines Design primers that have a GC content of 50 60 m Strive fora T between 50 and 65 C One way to calculate T_ values is by using the nearest neighbor method Use the T_ calculator at http www basic northwestern edu biotools oligocalc html with values of 50 mM for salt concentration and 300 nM for oligonucleotide concentration Avoid secondary structure and adjust primer locations so they are outside the target sequence secondary structure if required Avoid repeats of Gs or Cs longer than 3 bases Place Gs and Cs at the 3 nucleotide of primers when possible Check forward and reverse primer Sequences to ensure no 3 complementarity avoid primer dimers Designing Probes 12 The QX100 Dro
86. ion 11 Basic Local Alignment Search Tool 15 biomarker 47 biopsy 39 46 48 53 94 breast cancer 39 BLAST 15 98 Primer BLAST 80 blood draw 56 blood sample 39 94 maternal 39 buffer 16 18 23 42 43 58 59 TO 74 93 control 18 93 digestion 42 43 restriction enzyme 16 cancer 37 39 48 53 56 58 60 breast 39 60 cDNA 17 26 57 60 63 74 75 98 Celera 16 cell 7 37 39 40 52 54 55 58 60 64 99 surface receptor 60 channel 5 6 9 19 23 27 48 51 59 66 67 69 74 76 78 79 83 85 87 89 90 color 67 75 chloroform 10 Chr10q1 76 77 Chri3q3 76 77 chromosome 73 74 76 chromosome 6 74 chromosome 10 73 74 76 clonally derived Down syndrome cell line 39 CN 37 42 44 72 98 CN states 37 39 CNV 7 19 37 41 43 44 62 63 12 3 98 composition 11 base 11 concentration 2 6 10 12 14 16 20 22 24 28 44 46 48 49 51 54 55 58 65 67 68 71 74 77 82 90 95 96 DNA 2 17 34 48 88 90 oligonucleotide 12 salt 12 16 42 sample 6 30 61 copy number 7 9 16 17 27 37 40 44 53 62 63 72 73 87 98 copy number variation 7 19 24 37 41 63 72 98 CPD 31 33 34 44 71 96 98 cross reactivity 48 51 53 78 79 curve 2 8 28 54 97 CV 54 56 97 98 CYP2D6 39 ddPCR 1 5 7 9 11 14 15 17 20 24 26 33 36 38 40 42 47 51 94 58 60 62 72 74 75 78 81 83 86 88 89 91 95 97 98 denaturation 23 85 86 Index
87. ion between positive and negative populations and minimal probe cross reactivity Figure 5 3 Also be sure to simultaneously check the concentration plots to make sure the concentration is the expected result at the temperature selected In Figure 5 3 wells A H are an annealing extension gradient from 65 55 C respectively Panel A is a 1 D amplitude plot showing the FAM labeled mutant assay results from a temperature gradient on the SNP PlSKca_E545K Wells AO03 H03 contain 100 wild type DNA and AO4 H04 contain 50 wild type mutant DNA Well D was selected at an annealing extension temperature of 61 4 C At lower annealing extension temperatures false positives appear Panel B is a 1 D amplitude plot of FAM labeled mutant assay results of PISKca_H1047R Wells AO6 HO6 contain 100 wild type DNA and AO7 HO7 contain 50 wild type mutant DNA Well B was selected at an annealing extension temperature of 64 5 C At lower annealing extension temperatures the positive clusters for the VIC channel have increasing probe cross reactivity with the nonspecific target causing the wild type droplets to have some level of FAM fluorescence in the FAM channel Droplet Digital PCR Applications Guide Rare Mutation and Sequence Detection 14 000 A03 B03 CO3 DO3 03 FO3 G03 HO3 A04 B04 C04 DO4 E04 F04 G04 H04 12 000 10 000 8 000 6 000 Channel 1 amplitude 4 000 2 000 4 0 50 000 100 000 150 000 Event number 100 wil
88. ions and Troubleshooting No or Few Positive Droplets If a new never before tested assay fails to give positive droplets consider the following i The selected restriction enzyme may have cut within the target locus Recommendation test the assay against DNA digested with a different restriction enzyme as well as undigested DNA The target locus resides in a region that contains secondary structure Recommendation use restriction enzymes to cut the sequences surrounding the region to be amplified in order to limit the number of possible interactions with nearby nucleotides The assay does not work at the predicted temperature Recommendation first perform an annealing extension temperature gradient to determine the temperature at which the assay works The ddPCR reaction mix was not assembled correctly or the probe primers were not ordered correctly One of the assay components was designed incorrectly or a mistake was made during synthesis No or Low Total Droplet Count To determine your droplet count select the well in setup click Analyze then click the Events tab and make sure Total is selected If the total accepted events or droplet counts are less than 10 000 consider the following recommendations Use the recommended concentration of primer 900 nM probe 250 nM and 1x master mix The QX100 and QX200 Droplet Digital PCR systems are compatible only with Bio Rad s ddPCR supermixes Using le
89. ire digestion for optimal target detection regardless of fragmentation cDNA does not require restriction digestion ddPCR Experimental Workflow Droplet Generation For droplet generation transfer 20 ul of a PCR reaction containing sample nucleic acid primers and probes for a TaqMan experiment and the appropriate Bio Rad ddPCR supermix to the middle rows of a DG8 cartridge for a QX100 or QX200 droplet generator Figure 2 4 We recommend creating an initial reaction pool that is slightly more than 20 ul 22 25 ul to ensure that 20 ul of mixture is transferred to the DG8 cartridge Reaction mixes should be combined and well mixed in a separate tube and not in the droplet generator cartridge Reaction mixes should then be transferred to the DG8 cartridge already preloaded in the DG8 cartridge holder Droplet Digital PCR Applications Guide 17 Designing Droplet Digital PCR Experiments PCR 18 Fig 2 4 Loaded DG8 cartridge Note Each DG8 cartridge generates eight wells of droplets Any unused wells on the cartridge must be filled with 1x ddPCR buffer control The Bio Rad ddPCR supermixes have been formulated specifically to work with the droplet chemistry Altering the components used in the QX100 droplet generator or using a different supermix will negatively impact results A 1x final concentration of supermix must be used for proper droplet formation and proper target quantification After loading a 20 ul PCR rea
90. isk of cross reactivity of the target assay with background DNA Droplet Digital PCR Applications Guide 53 Rare Mutation and Sequence Detection RSD Experimental Strategies Some RSD applications require reliable quantification of rare sequences while others require detection of a rare sequence This difference dictates the lower bounds of sensitivity for a given assay and application For RSD the LoD can be defined either in terms of the total volume of material analyzed or in terms of the number of copies of some type of background DNA In RSD absolute quantification of the target sequence is often required In general ddPCR can provide an accurate quantification of a rare target sequence at a low concentration This eliminates the need for absolute standards and standard curves and improves reproducibility across experiments and laboratories In addition in ddPCR small variations in PCR efficiency between wells have no effect on the measured concentration When absolute quantification is applied to an RSD application an important consideration is the limit of quantification or LoQ which is the lowest concentration you can reliably measure within a predetermined variance or coefficient of variation CV For example if you want to quantify within 20 the LoQ is the lowest concentration with which you can reliably measure to within 20 of the real value For RSD to reliably detect 1 in 100 000 cells at least 300 000 backgro
91. itude The number of positive and negative droplets is used to calculate the concentration of the target and reference DNA sequences and their Poisson based 95 confidence intervals Figure 1 12 Droplet Digital PCR Applications Guide 7 Droplet Digital PCR Low Medium High targets concentration concentration concentration O positive 6 34 70 p p p p 143 total 143 143 143 Poisson corrected Poisson corrected Poisson corrected 6 2 143 38 143 96 143 5 100 000 4 5 90 000 4 7 80 000 3 5 E 70 000 0 o z 5 o 37 60 000 o 20 50 000 O O E po 5 D pa 40 000 o E S 1 5 30 000 y 20 000 0 5 y 10 000 0 O O 0 2 0 4 0 6 0 8 1 Fraction of positive droplets p assumes 20 000 droplets reaction Fig 1 12 Estimating target concentration by ddPCR ddPCR is an end point measurement that enables you to quantify nucleic acids without the use of standard curves and independent of reaction efficiency The present or absent digital format Figure 1 12 and ability to draw clear thresholds between positive and negative droplet clusters for ddPCR means we now operate in a regime of absolute DNA quantification without the need for external calibrators or endogenous controls The region separating these clusters is clear such that the concentration output is not significantly affected by the position of the threshold and results are not biased by the small fraction
92. king across the Whole Concentration Range Figure 3 4 shows the number of droplets with O 1 2 3 and so on copies of the target DNA at different DNA concentrations There is a simple mathematical relationship between the fraction of droplets that are unoccupied black bar and the concentration of target molecules As the concentration of input target DNA increases the expected number of unoccupied droplets decreases 0 25 CPD 1 CPD 2 0 CPD 15 000 15 000 15 000 a 15 576 negatives Y 7 358 negatives a li ali o Q Q 10 000 10 000 10 000 5 5 5 18 357 positives amp 5 000 2 5000 12 642 positives E E 4 425 positives E 5 5 5 N Z Z 2 o da a l f P 01234 01234567 0123456789 Number of target molecules in droplet Fig 3 4 Number of droplets with copies of target DNA at different DNA concentrations CPD copies per droplet Note Quantification is impossible when there are no unoccupied droplets which is approached at 8 CPD Concentration Calculation Definitions 34 C copies per droplet CPD E observed fraction of empty droplets Varopet Volume of droplet N _ number of negative droplets neg N total number of droplets Droplet Digital PCR Applications Guide Absolute Quantification and the Statistics of Droplet Digital PCR Formula for Calculating Concentration The formula used by QuantaSoft software to calculate concentration i
93. l PCR Applications Guide Rare Mutation and Sequence Detection We recommend always running negative controls to monitor for all possible sources of false positive droplets given the risk of laboratory contamination when working with templates and amplicons With an extremely sensitive technology such as ddPCR we recommend running enough negative sample controls as part of every experiment so that you can demonstrate that the probability of calling a true negative sample incorrectly is below a certain threshold Experimental Strategies for RMD Once the number of target molecules to be screened has been determined for a given LoD the number of wells required to screen that number of targets must be determined In the QX100 or QX200 Droplet Digital PCR system up to 1 ug of DNA can be loaded into a single well with a recommended limit of 5 000 6 000 copies ul per well To achieve a lower LoD than 1 in 25 000 using human DNA with a copy number of one per haploid more wild type molecules can be screened by running the same sample in multiple wells Factors that Impact RMD Calculations Table 5 1 outlines RMD experimental design based on statistical requirements Additional real world factors will impact these numbers in an assay specific and sample specific way and should be considered when planning an RMD experiment Sample availability depending on the source formalin fixed paraffin embedded FFPE or fresh frozen a typic
94. lecules is described in Table 5 1 The number of wells needed is a conservative estimate The row in bold reflects the best performance in one well Researchers may choose to screen additional wells to ensure detection of more than one positive droplet Table 5 1 Requirements for different LoDs for RMD assuming an ideal assay with a droplet false positive rate of zero Required Starting Material human Total Copies LoD to Screen Diploid Cells Amount of DNA Number of Wells 1 in 1 000 3 000 1 500 0 010 ug 1 1 in 10 000 30 000 15 000 0 10 ug 1 1 in 25 000 75 000 37 500 0 25 ug 1 1 in 100 000 300 000 150 000 1 0 ug 4 1 in 1 00 000 3 000 000 1 500 000 10 0 ug 40 Recommended Controls 52 If a single wild type or negative sample control well is run and the observed positive droplets are zero then it is good practice to require at least three positive droplets in order to call a sample positive The three positive droplets can be in either a single well or across merged wells On the other hand if you run a full plate of negative sample control wells and observe zero positive droplets consider making a positive call based on a single positive droplet However we don t usually recommend this because It may be difficult to control for handling or contamination issues If the same sample is spread across multiple wells then the number of positive droplets should be pooled across all the wells and a similar number of negative cont
95. let Digital PCR Applications Guide 47 Rare Mutation and Sequence Detection RMD Experiment Considerations The first consideration for low level detection is the amount of DNA available If 1 mutant in 100 000 wild type sequences or 0 001 is to be detected then statistically at least 300 000 haploid genomes must be screened For human DNA this is 1 ug of DNA The challenge for RMD assay development is that it must discriminate between two highly similar sequences one of which is significantly more abundant than the other An example of an RMD assay is detection of a single nucleotide polymorphism SNP in a cancer biopsy An RMD assay comprises a single set of primers plus two competitive probes each probe with a different fluorophore one detecting the wild type allele and one detecting the variant allele Testing an RMD Assay 48 RMD assays should be tested for specificity by first running a temperature gradient at a relatively high wild type DNA concentration and then by running a concentration gradient of wild tyoe DNA with a spike in of mutant DNA to assess specificity First run a temperature gradient using both a row column of restriction digested 100 wild type DNA at a concentration between 2 000 5 000 copies ul previously restriction digested and a row column of 2 000 5 000 copies ul wild type DNA including 50 200 copies ul mutant DNA Using the 1 D amplitude plot select the T_ with no false positives good separat
96. lets exist Figure 9 5 When there are no negative droplets Poisson correction cannot be applied and it is not possible to calculate a concentration 4 000 o 3 000 O 2 2 2 000 oO S 1 000 Cc oO E i ci ii 1 000 l l l l l l l 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 Fig 9 5 Example of all droplets being positive containing template for the FAM assay and or the VIC assay Having all positive droplets could arise from multiple issues 1 Polymerase independent probe hydrolysis due to poor long term storage of probe stock solution Such as in a nonbuffered solution for example water at 4 C Reorder the probe and make probe stock solution with 10 mM Tris pH 8 0 8 5 and store at 20 C 2 Polymerase dependent assay components interact with each other in a way that results in premature probe cleavage by the enzyme Identify intra assay interactions and redesign causative component s to reduce binding and cleavage Note Run an NTC well to identify this problem If the negative droplets in the NTC well do not have high fluorescence amplitude droplets then the target concentration is too high If the negative droplets in the NTC well contain high amplitude droplets the cause Is either polymerase independent probe hydrolysis or polymerase dependent intra assay interactions Droplet Digital PCR Applications Guide Droplet Digital PCR Tips Assay Considerat
97. licates are not close the most common causes are poorly mixed reaction mixtures or poor thermal cycler temperature uniformity Insufficient Mixing 84 When creating technical replicates thoroughly mix the reaction mixture master mix sample and assay by pipetting the reaction mixture up and down ten times using 90 volume strokes Alternatively pulse vortex the reaction mixture for 15 sec followed by spinning the sample down Do not assemble or mix reaction mixtures in the DG8 cartridge Figure 9 6 shows replicates that were not sufficiently mixed before droplet generation Droplet Digital PCR Applications Guide 2 000 1 600 1 200 800 400 Channel 1 concentration copies ul Droplet Digital PCR Tips Assay Considerations and Troubleshooting 1 360 an 1 260 TT 1 120 TT 1 120 TT Replicate 1 Replicate 2 Replicate 3 Staphylococcus aureus Replicate 4 Fig 9 6 Quadruplicate replicates drawn from the same poorly mixed reaction solution demonstrate inconsistent concentration readings Effects of Poor Cycler Uniformity If the reaction mixtures used to create technical replicates are thoroughly mixed but there is wide variation in concentration estimates consider the uniformity performance of your thermal cycler Generally this effect is observed only when a temperature sensitive assay is used on a thermal cycler with poor uniformity Uniformity at both the denaturation an
98. lications Guide 91 Appendix A Ordering Information 186 4005 186 4006 186 3004 Droplet Generation Oil for EvaGreen 2 x 7 ml Droplet Generation Oil for EvaGreen 10 x 7 ml ddPCR Droplet Reader Oil 2 x 1 L ddPCR Reagents 92 186 3026 186 3010 186 3027 186 3028 186 3023 186 3024 186 3025 186 3021 186 3022 186 4033 186 4034 186 4035 186 4036 186 3052 ddPCR Supermix for Probes 2 ml 2 x 1 ml 200 x 20 ul reactions 2x supermix ddPCR Supermix for Probes 5 ml 5 x 1 ml 500 x 20 ul reactions 2x supermix ddPCR Supermix for Probes 25 ml 5 x 5 ml 2 000 x 20 ul reactions 2x supermix ddPCR Supermix for Probes 50 ml 10 x 5 ml 5 000 x 20 ul reactions 2x supermix ddPCR Supermix for Probes no dUTP 2 ml 2 x 1 ml 200 x 20 ul reactions 2x supermix ddPCR Supermix for Probes no dUTP 5 ml 5 x 1 ml 500 x 20 ul reactions 2x supermix ddPCR Supermix for Probes no dUTP 25 ml 5 x 5 ml 2 000 x 20 ul reactions 2x supermix One Step RT ddPCR Kit for Probes 2 ml 2 x 1 ml 200 x 20 ul reactions 2x RT ddPCR mix includes 1 manganese acetate tube One Step RT ddPCR Kit for Probes 5 ml 5 x 1 mi 500 x 20 ul reactions 2x RI ddPCR mix includes 2 manganese acetate tubes QX200 ddPCR EvaGreen Supermix 2 ml 2 x 1 ml 200 x 20 ul reactions 2x supermix QX200 ddPCR EvaGreen Supermix 5 ml 5 x 1 ml 500 x 20 ul reactions 2x supermix QX200 ddPCR EvaGreen S
99. long a diagonal path with larger fragments near the negative droplets and smaller inserts in the upper right corner This is because the smaller amplicons produce greater fluorescence during PCR amplification This characteristic pattern enables you to assess the quality of your library At the highest point in the upper right corner is a population that appears separate from the bulk of the library This population is the adapter dimer population with no inserts red circle in Figure 7 4 12 000 a 10000 7 Adapter dimers 5 2 8 000 Q S 6 000 E 4 0007 Decreasing size of library 5 insert with adapters as 2 000 part of construct 0 A A GES ne Penn ST O 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 Channel 2 amplitude Fig 7 4 Additional library information produced by ddPCR Droplet Digital PCR Applications Guide Next Generation Sequencing Library Analysis Droplets that appear above and below the insert population large diagonal cluster of increasing fluorescence represent rare species with three or more adapters ligated to the insert Figure 7 5 These populations can be selected in QuantaSoft software using the lasso function By selecting the desirable bulk population that lies along the diagonal green circle Figure 7 5 excluding the adapter adapter population in one color channel blue circle Figure 7 5 and excluding the undesirable side populations adapter adapter and ext
100. ls A 12 000 D Pod E 10 0004 d 8 000 y 5 2 6 000 4 000 x oO co 5 2 000 es O 0 2000 4 000 6 000 8 000 10 000 12 000 Channel 2 amplitude B C 12 000 O a m wih fo nO 10 000 seni oy a sae die a os inc 2 o 8 000 sN ds y r Sl o ra E ow i 6000 Hee ees aay neh 2 ai 4000 os ds 2 Cc Cc S 2 000 Jeri g a i O O 0 0 0 2000 4 000 6 000 8 000 10 000 12 000 0 2000 4 000 6 000 8 000 10 000 12 000 Event number Event number D E 250 300 200 250 gt gt E 1507 2 ee 2 2 1507 a 100 2 la 1007 50 4 50 0 pi lit O 0 2000 4 000 6 000 8 000 10 000 12 000 0 2000 4 000 6 000 8 000 10 000 12 000 Amplitude Amplitude Fig 9 1 Cross reacting probes in a rare mutation detection assay 2 D amplitude A 1 D amplitude B and C and histogram D and E plots Probe Cross Reactivity Can Identify Off Target Amplification An unexpected extra cluster of positive droplets with fluorescence intensity less than the cluster containing the target of interest can be caused by a sequence variant in the target of interest Figure 9 2 The droplets that cluster around 10 000 relative fluorescence units RFU contain a variant DNA sequence that is not perfectly matched to the designed probe The perfectly matched sequence is the higher cluster around 12 000 RFU Often the distincti
101. n of BRAF V600E mutation in colorectal cancer Comparison of automatic sequencing and real time chemistry methodology J Mol Diagn 8 940 543 Kwok S and Higuchi R 1989 Avoiding false positives with PCR Nature 339 237 238 Scott LM 2011 The JAK2 exon 12 mutations A comprehensive review Am J Hematol 86 668 676 Whitehall V et al 2009 A multicenter blinded study to evaluate KRAS mutation testing methodologies in the clinical setting J Mol Diagn 11 943 552 Droplet Digital PCR Applications Guide 6 Gene Expression Overview Reverse transcription quantitative PCR RT qPCR is a commonly used method in gene expression studies It is straightforward sensitive and has a wide dynamic range There are two types of approaches for the RT qPCR reaction one step and two step RI gPCR One Step RT qPCR One step RI gPCR simplifies the reaction setup by combining the first strand cDNA synthesis reverse transcription and qPCR in one mixture It also greatly reduces the possibility of contamination by eliminating the cDNA to PCR operation step One step RTI qPCR can use only a limited number of probes per sample but because it amplifies the whole sample the sensitivity is greatly enhanced The disadvantage of one step RI qPCR is that it is less amenable to multiplex assays and allows for less flexibility in priming strategies Two Step RT qPCR Two step RI qPCR performs the first strand cDNA synthesis reverse transcription and
102. nd sequence For example to reliably detect an average of 1 virus in 100 000 PBMCs we must screen 300 000 PBMCs or 2 ug of DNA Table 5 1 This requires three wells on the QX100 system two wells at high concentration to screen enough PBMCs for the presence of rare virus and a third well at a lower concentration to quantify the PBMCs This experimental setup is shown in Figure 5 9 Quantify rare sequence DNA from 300 000 B Target gt Quantify background Dilute 100 fold human cells Background Fig 5 9 Detection of a very low target concentration in a high background such as a low viral load in a given number of PBMCs by analyzing samples at two different concentrations The target sequence the rare sequence might be quantified at either concentration depending on the amount present in the starting sample The background sequence is quantified in the low concentration well In the examples shown in Table 5 2 the LoD is defined with respect to the number of human cells The number of wells needed is a conservative estimate that considers that droplets can be lost due to workflow or quality control specifications Table 5 2 Case 2 Experimental setup for different LoD and LoQ in rare sequence detection Number of Wells Human Amount High Low LoD LoQ lt 10 CV Diploid Cells of DNA ug Concentration Concentration 1 in 5 000 cells 100 in 15 000 cells 15 000 0 10 1 O 1 in 12 500 cells 100 in 37
103. ns where a diploid target CN is expected to be 10 or less approximately 0 2 1 0 reference gene copies per droplet CPD of DNA sample should be loaded per well This corresponds to 10 66 ng of human genomic DNA per well DNA Loading for Higher Order CN Analysis diploid CN gt 10 44 When target CN is expected to exceed 10 copies diploid genome lt 15 ng of human genomic DNA should be loaded per well This ensures both target and reference copies fall within the dynamic range of the instrument Table 4 5 For example if a reference locus Is loaded at 1 CPD 1 000 copies ul a target present 20 times more frequently per genome is effectively loaded at 20 CPD 20 000 copies ul which is beyond the range of accurate quantification of the instrument If a reference locus is loaded at 0 2 CPD 200 copies ul a target present 20 times more frequently is loaded at 4 CPD 4 000 copies ul which is within the dynamic range of the instrument For diploid CN gt 50 strategies where multiple wells are used to estimate target and reference concentrations can be used Table 4 5 Sample loading considerations for higher order CN targets 10 50 copies diploid genome Target Loading for CN gt 10 Reference Loading for CN 2 CPD Reference copies ul Target copies ul CN 2 CN 10 CN 20 CN 40 1 1 000 5 000 10 000 20 000 0 2 200 1 000 2 000 4 000 CPD copies per droplet CN copy number Droplet Digital PCR Applications Guide 5
104. o sell reagents containing EvaGreen dye for use in real time PCR for research purposes only FAM and VIC are trademarks of Applera Corporation Herceptin is a trademark of Genentech Inc HiSeq Illumina MiSeq and TruSeq are trademarks of Illumina Inc Illumina is not affiliated with Bio Rad Laboratories Inc lon Torrent and SYBR are trademarks of Life Technologies Corporation TaqMan is a trademark of Roche Molecular Systems Inc The QX100 or QX200 Droplet Digital PCR system and or its use is covered by claims of U S patents and or pending U S and non U S patent applications owned by or under license to Bio Rad Laboratories Inc Purchase of the product includes a limited non transferable right under such intellectual property for use of the product for internal research purposes only No rights are granted for diagnostic uses No rights are granted for use of the product for commercial applications of any kind including but not limited to manufacturing quality control or commercial services such as contract services or fee for services Information concerning a license for such uses can be obtained from Bio Rad Laboratories It is the responsibility of the purchaser end user to acquire any additional intellectual property rights that may be required Bio Rad Laboratories Inc Life Science Group LabChip and the LabChip logo are trademarks of Caliper Life Sciences Inc Bio Rad Laboratories Inc is licensed by Caliper Life
105. ome using the Celera Genomics estimate of 3 0 x 10 bp haploid m 3 0 x 10 bp 1 096 x 10 g bp mago 56 10 OOF Gio bd Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments The example is relevant to any gene that is present at the normal rate of 2 copies diploid genome such as RPP30 and provides a basis for a digital screening experiment to determine the optimal digital range For sample DNA loading follow these guidelines Assess input DNA RNA concentration using A Spectroscopy to ensure the target DNA RNA concentration is being loaded within the dynamic range of detection Note An A measurement depends on various factors and does not distinguish between intact and fragmented targets As such it provides only an estimate of your DNA concentration Add no more than 1 ug of digested DNA to the 20 ul reaction final concentration of 50 ng ul a Intact DNA requires restriction digestion for optimal performance especially at a concentration above 3 ng ul 60 ng 20 ul reaction For copy number and absolute quantification always do restriction digestion at all DNA concentrations unless you want to access proximal replicate sequences Do not perform a restriction digestion of the DNA sample within the amplicon sequence Fragmented DNA for example formalin fixed paraffin embedded FFPE samples may not need restriction digestion However some assays and or targets requ
106. on among two or more positive clusters is desirable because it provides additional information regarding the sample If the mid level cluster represents the detection of a potentially functional homolog consider setting the threshold below this cluster to include it in the quantification or lowering the annealing temperature so that these two clusters merge into one cluster If the mid level cluster is not desired consider setting the threshold above this cluster to exclude it from target quantification Droplet Digital PCR Applications Guide 79 Droplet Digital PCR Tips Assay Considerations and Troubleshooting 80 14 000 12 000 10 000 8 0007 6 0007 Channel 1 amplitude 4 0007 2 0007 i IRN ee 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 Channel 2 amplitude Fig 9 2 Extra droplet clusters To prevent the off target amplification try increasing the annealing temperature of the PCR reaction to improve specificity Figure 9 3 or alternatively try digesting the sample with a restriction enzyme that will cut the nonspecific target while preserving the specific target This latter approach requires some knowledge of the nonspecific target s sequence Assay redesign can often be used to remove subclusters Consider using Primer BLAST to determine whether one of the primers is potentially nonspecific If this is the case examine whether a primer redesign would avoid the amplif
107. oplets in NTC wells occur make sure that good laboratory practices for PCR are being followed in the laboratory Kwok and Higuchi 1989 Suggested guidelines are as follows Wipe down pipets tip boxes and benchtops with 5 10 bleach Prepare master mixes in a template free environment add samples and generate droplets in an amplicon free environment perform PCR and read droplets in a room separate from the sample preparations Do not reuse DG8 droplet generator cartridges oils gaskets plates or pipet tips Wear appropriate personal protective equipment that is discarded or confined to appropriate locations that is template free room for master mix assembly amplicon free room for template addition and droplet generation and PCR and post PCR rooms for droplet reading Channel 2 amplitude al 0 5 000 10 000 15 000 20 000 25 000 Event number Fig 9 4 An example of contamination of an NTC well left with amplitudes similar to a positive template reaction right If desired dUTP containing supermixes ddPCR supermix for probes can be used in conjunction with heat labile uracil N glycosylase UNG or uracil DNA glycosylase UDG to reduce the potential for false positives resulting from the presence of previously amplified products Add the UNG at 0 05 units 20 ul of ddPCR reaction mixture and create droplets as normal Transfer the foil sealed 96 well PCR plate containing droplets to the the
108. ores below 0 85 and wells with fewer than 10 000 droplets After visually inspecting the data you may set a threshold manually and QuantaSoft software will complete the calculations Figure 3 1 shows excellent separation between positive droplets green and negative droplets black in the chart on the left showing droplets event number vs fluorescence amplitude The histogram on the right plots amplitude vs the frequency of the populations of droplets and can assist in setting the threshold 4 Fig 3 1 Example of a well performing assay for absolute quantification QuantaSoft software measures the number of positive and negative droplets for each fluorophore in each sample It then fits the fraction of positive droplets to a Poisson algorithm to determine the starting concentration of the target DNA molecule in units of copies ul input from the sample Figure 3 2 Droplet Digital PCR Applications Guide 29 Absolute Quantification and the Statistics of Droplet Digital PCR 10 000 1 000 1 390 1 400 1 400 1 400 1 360 1 370 1 380 1 390 H 1 370 1 360 Ht 260 259 2 100 2 64 2 64 8 S E 15 5 a 15 12 9 10 4 63 IT 4 68 TIT oO l 1 46 P 1 63 1 O 0 10 0 01 0 256 256 64 64 16 16 4 4 1 1 Sample Fig 3 2 Sample concentrations are plotted as copies pl from the sample Statistics of ddPCR 30 In ddPCR
109. oving as many of these as possible during the nucleic acid purification phase If Known inhibitors cannot be readily removed consider reducing their impact on the PCR reaction by diluting the sample 1 10 Droplet Digital PCR Applications Guide 15 Designing Droplet Digital PCR Experiments For best results restriction digestion of your DNA sample outside of the amplicon region is recommended We have extensively investigated the use of endonucleases for fragmentation and found that a wide range of enzymes with 4 base and 6 base recognition sites perform satisfactorily for this purpose The benefits of predigestion can be achieved with a wide range of enzyme concentrations Considerations should be taken into account in the choice of enzyme for a particular locus 1 The enzyme should not cut within the PCR target sequence itself 2 It is best to use an enzyme that is insensitive to methylation to avoid incomplete fragmentation due to methylation of the target DNA 3 In some instances it is best to digest the target copy to the smallest size fragment that fully contains the amplicon footprint preferably less than a few hundred base pairs 4 lf added at a relatively high concentration some restriction enzyme buffers can result in a significant change in salt concentrations of the reaction mix To avoid this always digest in the lowest possible volume and mix with water before adding the digested DNA to the reaction mix Addin
110. placed into a QX100 or QX200 droplet generator which uses specially developed reagents and microfluidics to partition each sample into 20 000 nanoliter sized droplets As shown in Figure 1 3 target and background DNA are distributed randomly into the droplets during the partitioning process i a Se Target of interest i e 8 Background DNA elie aa A Fig 1 3 In ddPCR a single PCR sample is partitioned into 20 000 droplets Droplet generation produces uniform droplets for the sample enabling precise target quantification Figure 1 4 O Droplets O Fig 1 4 The droplets created by the QX200 droplet generator are uniform in size and volume Sample Oil gt m Droplet Digital PCR Applications Guide 3 Droplet Digital PCR PCR Amplification Droplets are transferred to a 96 well plate for PCR in a thermal cycler We recommend the C1000 Touch thermal cycler with 96 deep well reaction module for PCR Figure 1 5 This high performance thermal cycler has excellent temperature uniformity and settling across all 96 wells to helo ensure successful PCR Fig 1 5 The C1000 Touch thermal cycler provides robust performance for ddPCR experiments Droplet Reading Following PCR amplification of the nucleic acid target in the droplets the plate containing the droplets is placed in a QX100 or QX200 droplet reader which analyzes each droplet individually using a two color detection system set to det
111. plet NTC no template control SA1 S aureus assay 1 SA2 S aureus assay 2 Results of ddPCR concentration plots for the two S aureus reactions carried out in the example are shown Droplet Digital PCR Applications Guide 71 3 Additional Applications Linkage Analysis 12 Physical linkage of two alleles in Droplet Digital PCR ddPCR can be thought of in at least two ways andem repeats of the same sequence Proximity of two sequences targets physically linked on the same piece of DNA We recommend using restriction enzymes to digest the DNA in a copy number variation CNV study and physically separate the two target copies in order to ensure random target distribution into droplets If the copies are not separated then the target can be undercounted because the copies will always segregate into the same droplet This is especially true for tandem copies near each other The extreme sensitivity of ddPCR however allows you to study linkage between targets and to infer the haplotype of samples by comparing digested vs undigested DNA Figure 8 1 represents a study of different human samples using restriction digestion in comparison with undigested DNA for the same sample for the WRGPRX7 gene which has variable copy numbers CNs in different populations In samples 4 and 5 the undigested uncut samples have lower CNs compared to the digested cut DNA of the same sample which suggests the copies in those sampl
112. plet Digital PCR system is compatible only with TaqMan hydrolysis probes The QX200 system is compatible with TagMan hydrolysis probes and EvaGreen double stranded DNA dsDNA binding dye Using EvaGreen or SYBR Green on the QX100 will damage the system Neither the QX100 nor the QX200 system is compatible with SYBR Green Advantages of using hydrolysis probes include high specificity a high signal to noise ratio and the ability to perform multiplex reactions Hydrolysis assays include a sequence spectfic fluorescently labeled oligonucleotide probe in addition to the sequence specific primers TaqMan assays exploit the 5 exonuclease activity of certain thermostable polymerases The hydrolysis probe is labeled with a fluorescent reporter at the 5 end and a quencher at the 3 end When the probe is intact the fluorescence of the reporter is quenched due to its proximity to the quencher Figure 2 1 The amplification reaction includes a combined annealing extension step during which the probe hybridizes to the target and the dsDNA specific 5 to 3 exonuclease activity of Taq or Tth cleaves off the reporter As a result the reporter is separated from the quencher resulting in a fluorescence signal that is proportional to the amount of amplified product in the sample Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments _ 09 y Extension 9 During extension the probe is partially displaced and t
113. plets increases the sensitivity by orders of magnitude by effectively diluting away the background This means that the mutant target is present in droplets at a much greater relative abundance than it would be in bulk solution Considering a rare allele detection scenario where the desired mutant has an abundance of 0 1 relative to wild type DNA Figure 5 2 shows that randomly partitioning the sample into 20 000 1 nl droplets increases the relative abundance by 330 fold resulting in drastic improvement of the achievable sensitivity compared to real time PCR Bulk sample 20 ul Partitioned sample 20 000 x 1 nl ACGTACAC ACGTACAC ACGTACAC ACGTACAC ACGTACAC ACGCACAC ACGTACAC ACGCACAC ACGTACAC ACGTACAC ACGTACAG ACGTACAC ACGTACAC 40 droplets with mutant 19 960 droplets without mutant ACGTACAG 33 mutant abundance ACGTACAC 40 000 wild type molecules 40 mutant molecules 0 1 mutant abundance Fig 5 2 Effect of partitioning on the relative abundance of a mutant target in an excess of wild type DNA Figure 5 2 depicts a bulk 20 ul solution containing 40 mutants and 40 000 wild type DNA molecules with a mutant abundance of 0 1 which is beyond the limit of quantification by real time PCR After random partitioning into 20 000 1 nl droplets there are 40 droplets containing target molecules at a relative mutant abundance of 33 which are easily distinguishable from the 19 960 droplets containing wild type molecules only Drop
114. primers Additionally primer dimers and off target amplicons can be detected as low fluorescence amplitude droplets With the EvaGreen supermix reactions it is possible to simply set the threshold above the primer dimer in order to obtain an accurate quantification of the target without having to redesign the primers Figure 2 12 A B Sample No template control Template No template control Template Annealing a O temperature DI D o 65 C 55 C 65 C 55 C A02 B02 C02 D02 E02 FO2 GO2 HO2 A04 B04 C04 D04 E04 F04 G04 H04 i l 300 30 000 250 T 243 236 h 237 mh 200 20 000 150 100 Channel 1 amplitude 50 Channel 1 concentration copies ul 10 000 6 0641 0 0671 0 261 0 0 135 0 131 0 196 0 261 0 12 A02 B02 C02 DO2 E02 FO2 G02 HO2 A04 B04 C04 DO4 E04 F04 G04 H04 Primer dimer Sample Primer dimer frequency increases at 000 250 000 lower annealing temperatures and is visible in the no template control wells 0 m ocio aa a Event number Fig 2 12 Accurate quantification of target is obtained using Bio Rad s QX200 system with the QX200 ddPCR EvaGreen supermix A threshold set above primer dimer B accurate quantification of the target is obtained without redesigning primers Droplet Digital PCR Applications Guide Designing Droplet Digital PCR Experiments In Figure 2 13 a gradient of annealing extension temp
115. properly adapted species can be seen We have observed an inverse relationship between the size of the amplicons and fluorescence intensity with our ddPCR library quantification kit for Illumina TruSegq The smaller the amplicon size the higher the fluorescence attained most likely due to PCR efficiency within the droplets This information rich content provides you with a digital quality check in the library construction before a Sequencing run Library Balancing 68 When performing NGS on the MiSeg platform it is important to aim for a cluster density of approximately 800 000 mm for optimal performance ddPCR measurements can be used to establish the functional relationship between input library concentration and the number of usable reads on the MiSeq platform We examined the precision of ddPCR in balancing 12 TruSeq DNA libraries from human genomic DNA using concentration measurements obtained from the QX100 system using the ddPCR library quantification kit Figure 7 7 Based on the ddPCR concentration measurements libraries with an average fragment length of 447 bp could be balanced within less than 15 of each other with a confidence interval of 95 Similar balancing results were observed when RNA Segq libraries with an average fragment length of 280 bp were used Droplet Digital PCR Applications Guide Next Generation Sequencing Library Analysis A 800 700 Ss 600 O z 500 X O L 300
116. ra adapter populations in red circles Figure 7 5 you can then use the Ratio tab in QuantaSoft software to select Fractional Abundance a a b and get a readout of the percentage of your library with inserts This can be a quick and easy readout of the quality of your libraries As anything with two adapters can still contribute to your cluster densities you must include the adapter adapter populations in your quantification and balancing of your libraries for sequencing This quality measurement can be used to enable you to appropriately load and balance your sequencing runs thus compensating for poorly formed library fragments and improving greater reading depth 10 000 8 000 6 0007 4 0007 FAM amplitude 2 000 0 1000 2 000 3 000 4 000 5 000 6 000 7 000 HEX amplitude Fig 7 5 Various species visualized by the ddPCR library quantification kit assay The library quality information obtained from 2 D plots will fuel further investigations into improvements of NGS sequencing possibly by determining library fragment PCR efficiencies Improvements in the NGS workflows will likely result from extremely accurate quantification by ddPCR For example you may be able to eliminate secondary amplification steps if enough library material is generated for sequencing directly after library construction thus avoiding unnecessary steps and further skewing of fragment representation Next Gen
117. ration of prepared library loaded These platforms have a narrow loading concentration range requirement for successful runs To maximize the sequencing information from a given sequencing run accurate measurements of library concentration must be made Measuring concentration by ddPCR before amplification may help determine the number of additional PCR cycles needed if any to obtain enough library for loading Measuring concentration by ddPCR before the library is loaded for sequencing determines concentration and helps identify any library construction quality anomalies accumulated during the process The TruSeg v2 library preparation protocol is shown in Figure 7 1 TruSeq Y adapters containing both P5 and P7 sequences are ligated to library DNA inserts Following PCR amplification the resulting amplicons contain P5 and P7 sequences directionally oriented on either strand of the fragment library P5 N Rd1 SP P DNA insert T A Index A 4 Rd2 SP Q P7 y PS P7 Rd1 SP DNA insert Rd2 SP Index Index AS nd SP Rd1 SP P7 S J N P5 Ligate index adapter P5 Rd1 SP DNA insert Index 5 sr sal Rd2 SP P7 Denature and amplify for final product 4 Fig 7 1 TruSeq v2 library preparation Our duplex assays target the flanks of the library fragments with two probes targeting both the P5 and P7 moieties We can directly measure linkage between probes 1 and 2 because they are co localized in the same droplet Figur
118. rmal cycler and add a 30 min 37 C incubation step in front of the standard recommended thermal cycling protocol During this incubation period UNG will digest U containing products such as those from past experiments performed with the ddPCR supermix for probes UNG is heat inactivated during the first 3 10 min of the 95 C initial PCR hot start step in the standard PCR protocol Droplet Digital PCR Applications Guide 81 Droplet Digital PCR Tips Assay Considerations and Troubleshooting Note The UNG approach can address contamination caused by PCR products created using ddPCR supermix for probes or one step RI ddPCR kit for probes however it will not address contamination caused by sample source templates or PCR products created using droplet PCR supermix Ultramers or long oligo PCR templates are especially problematic because the stock concentration is typically very high and can easily spread to pipets and other surfaces It can be useful to order ultramers with uracils Us in place of a few of the thymidines Ts in order to take advantage of UNG treatment in case contamination becomes a problem High Mean Fluorescence Amplitude Intensity 82 If the fluorescence amplitude of negative droplets is excessively high such that they are all considered positive and therefore concentration cannot be determined it is possible the sample s target concentration is so high that every droplet contains DNA target and no negative drop
119. rol wells should be run Our guidelines assume that the number of positives in no template control NTC wells is also zero which indicates good handling practices If these numbers are not zero the rate of potential false positives must be accounted for in calling a positive sample Control wells may not be zero for the rare sequence This could mean that contaminating template DNA is in the reaction wells If positive droplets in the NTC wells occur make sure that good laboratory practices for PCR are being followed in the laboratory see Kwok and Higuchi 1989 To limit workspace contamination wipe down your pipets tip boxes and benchtops with 5 10 bleach prepare master mixes in a template free environment add samples and generate droplets in an amplicon free environment read droplets in a room separate from the sample preparations do not reuse DG8 droplet generator cartridges oils gaskets plates or pipet tios and wear appropriate personal protective equipment that is discarded or confined to appropriate locations In addition to workspace contamination consider careful experimental setup procedures before droplet generation Be careful about anything that might produce aerosolized DNA We recommend mixing your sample by pipetting up and down the full volume 10 12 times rather than vortexing or centrifuging your plate because removing the seal after these processes can spray contaminating DNA into other wells Droplet Digita
120. rtitioning statistics Table 3 1 Expected percentage of droplets containing target DNA copies Targets Droplets O 78 1 19 5 2 2 4 3 02 4 0 01 High Concentration Example Consider the case in which 50 000 target molecules are present in 20 ul 50 000 targets in 20 ul 2 500 targets ul 2 5 CPD With an average of 2 5 copies of target droplet its not immediately obvious that there will be any empty droplets But Poisson statistics predicts that there will be some empty droplets 1 642 empty droplets and gives a precise relationship between the average number of copies droplet and the expected fraction of empty droplets Table 3 2 shows how many droplets we expect to see with O 1 2 3 4 or more copies droplet when there are on average 2 5 copies of target droplet or 50 000 copies in a 20 ul reaction volume Table 3 2 Expected percentage of droplets containing the target at high concentration Number of Target Molecules Count of Droplets Total Droplets 0 1 642 8 21 1 4 101 20 5 2 5 130 25 1 3 4 275 21 4 4 2 672 13 4 5 1 336 6 68 6 557 2 78 7 199 0 99 8 62 0 31 9 17 0 086 10 4 0 02 11 1 0 0049 Droplet Digital PCR Applications Guide 33 Absolute Quantification and the Statistics of Droplet Digital PCR Even at an average of 5 copies droplet the upper end of the recommended loading range we expect to see about 134 empty droplets in a total of 20 000 droplets data not shown Loo
121. s Concentration In a VN sis Derivation of Concentration Formula The Poisson distribution gives probability Pr n that a droplet will contain n copies of target if the mean number of target copies per droplet is C Ce n Pr n Inputting n O gives the probability that a droplet will be empty for a given value of C Pr 0 e For a large number of droplets the observed fraction of empty droplets E gives a very good estimate of Pr 0 so ESE Solving for C gives C In E Recall that C is copies per droplet To convert to copies per ul divide by the droplet volume Concentration C droplet Combining the two previous equations gives In E droplet Concentration Note that by definition En pa N Combining the two equations above gives Concentration In ow VV ies C An Nee yyy N droplet Droplet Digital PCR Applications Guide 35 Absolute Quantification and the Statistics of Droplet Digital PCR Errors in ddPCR 36 Two types of errors are reported by QuantaSoft software technical errors Poisson errors and total errors Technical errors Poisson errors a measurement error based on known properties of the system that can be calculated based on a single well or by pooling all the droplets from multiple wells One of the assumptions in this error calculation is that the sample in a ddPCR well is a subsample from a larger whole Poisson errors are an exc
122. se droplets pertaining to droplets that are positive for the RPP30 assay The blue clusters are those droplets that are positive for the Chr10q1 assay The green clusters are those droplets that are positive for the Ch13q3 assay The orange clusters are those droplets that are positive for both Chr10q1 and Chr13g3 simultaneously Negative droplets for the RPPSO assay are the lower four droplet clusters gray blue green orange Droplet Digital PCR Applications Guide 77 O Droplet Digital PCR Tips Assay Considerations and Troubleshooting Assay Dependent Cluster Shifts As with any PCR based technology assay design and sample preparation are important for obtaining good quality data Before running a Droplet Digital PCR ddPCR experiment know the goal or possible expected outcomes of the experiment because different types of experiments require different controls sample preparation amounts of DNA or RNA and data analysis Shifted Clusters Due to Probe Cross Reactivity 78 If you see a shift inwards or upwards on the 2 D plot this is most likely probe cross reactivity Probe cross reactivity occurs when a probe binds to a nonperfect sequence and undergoes cleavage Figure 9 1 This is more common in rare mutation detection RMD assays for example single nucleotide polymorphism SNP assays where the two probes differ by only one base The amount of nonspecific probe cleavage is a function of how close the melting t
123. sion temperature for thermal cycling Figure 2 13 16 000 ite ee CERE with me SS amplicons a he alas from both primer sets Annealing extension 63 C 14 000 4 12 000 10 000 Channel 1 amplitude 8 000 4 be Fimerset 2i sen 6 000 4 000 3 000 4 000 5 000 6 000 7 000 Channel 2 amplitude Fig 2 15 Multiplex assays performed using ddPCR with EvaGreen Differences in amplitude are due to differences in optimal annealing temperature T_ melting temperature Reference Untergasser et al 2007 Primer3Plus an enhanced web interface to Primer3 Nucleic Acids Res 35 web server issue W71 W74 Droplet Digital PCR Applications Guide 27 3 Absolute Quantification and the Statistics of Droplet Digital PCR Running Absolute Quantification Experiments Absolute quantification ABS is fundamental to all Droplet Digital PCR ddPCR applications Partitioning template DNA into uniform droplets enables highly quantified measurements of target DNA using the QX200 or QX100 Droplet Digital PCR system and the appropriate automatic statistical analysis in QuantaSoft software ddPCR does not require a standard curve and this simplifies the experimental planning and procedures and reduces result variability and cost Important ABS experiment considerations are as follows Digest the template DNA to fragment the genome Select restriction enzymes that do not cu
124. ss than the recommended concentration of any of these components may lower your droplet count Load the DG8 cartridge with the appropriate volumes of sample and droplet generation oil 20 ul and 70 ul respectively If less than 20 ul of sample is loaded fewer droplets will be generated Be sure to load the sample before the oil Use only purified nucleic acids Any particulate matter for example residual fibers from sample preparation columns or beads in the sample should be removed before assembling the ddPCR reaction mixture because these particulates can clog the DG8 cartridge s microfluidic channels and disrupt droplet generation To remove particulates from purified nucleic acids spin the sample at 10 000 x g for 1 min and transfer the supernatant to a clean tube Droplet Digital PCR Applications Guide 83 Droplet Digital PCR Tips Assay Considerations and Troubleshooting Do not exceed the recommended DNA load 66 ng well undigested DNA or 1 500 ng well digested DNA Use only approved plates Eppendorf twin tec semi skirted 96 well plates catalog 95 1020362 with approved pierceable foil heat seals Bio Rad catalog 181 4040 Properly seal the 96 well plate Under or over sealed plates result in oil evaporation during thermal cycling and compromise droplet data quality If using the PX1 PCR plate sealer Bio Rad catalog 181 4000 seal plates at 180 C for 5 sec Do not use the PX1 sealing protocol twice on
125. t detection 19 99 rare mutation detection 13 45 47 78 79 99 rare sequence detection 45 46 53 55 81 99 rare target sequence detection 19 99 reaction well 20 52 54 RED 19 99 reference 7 9 19 27 29 37 39 44 46 53 59 61 63 86 90 Ambion human brain 60 relative fluorescence units 79 99 resolution 9 24 37 38 74 restriction digestion 16 17 41 42 46 53 72 73 87 RestrictionMapper 42 reverse transcription 57 60 63 74 99 RFU 79 99 RMD 45 48 51 53 78 99 RNA 3 11 15 17 24 57 68 68 78 87 RNase 58 74 75 RNaseP anchor assay 74 RPP30 17 40 73 76 77 RSD 45 53 54 56 99 RTI ddPCR 3 58 60 82 92 99 RI gPCR 57 58 60 99 one step 57 two step 57 60 salt 12 14 16 42 concentration 12 16 42 sample 2 3 5 8 10 13 15 20 22 24 26 29 32 36 38 41 44 46 47 49 51 58 60 64 67 71 74 78 96 heterogeneous 39 40 high background 55 homogeneous 39 SantaLucia 14 sequence 1 2 12 17 19 40 43 45 48 51 55 57 65 69 72 78 81 83 99 wild type 47 48 signal 12 13 30 58 60 75 signal to noise 2 12 single cell analysis 7 single nucleotide polymorphism 7 13 37 46 48 78 99 single stranded DNA 88 99 site 15 16 30 40 46 60 64 primer binding 15 SNP 13 15 37 46 48 50 78 99 solution 47 74 82 85 somatic mosaicism 39 species 16 30 39 46 64 65 67 68 80 rare 6 7 target 30 39 spectrophotome
126. t either the target or reference amplicons The restriction digested DNA should be at a higher concentration in order to have a lower concentration in the master mix Note Account for the concentration of the template in any restriction digest and the amount of template in the final 1x ddPCR supermix to backcalculate the original concentration of the stock template 28 Droplet Digital PCR Applications Guide Absolute Quantification and the Statistics of Droplet Digital PCR Note Do not exceed 5 000 copies of target ul of the final ddPCR reaction mix Use a thermal gradient to optimize ddPCR results Inthe Well Editor of QuantaSoft software designate ABS for the experiment type Inthe Well Editor indicate which assay is the target and which assay is the reference when performing multiplex reactions Absolute Quantification Data Analysis The ABS experiment is designed to quantify the concentration of the target and give a result in copies ul of the final 1x ddPCR reaction If the plate was set up for ABS analysis automatic thresholding determines concentrations and populates the data tables in the analysis mode of the software The threshold may be manually adjusted Note specifically any wells that are flagged as No Call in the status column of the data tables QuantaSoft software will return a No Call for wells with too many positive droplets not enough empty droplets to apply Poisson statistics wells with Quality Sc
127. the same plate because this often disrupts the original seal Ensure that the full volume of the generated droplets is transferred into the 96 well plate by inspecting the DG8 cartridge after transfer Use only approved pipet tips for droplet generation and droplet transfer Rainin and Eppendorf tips are approved for use For sample loading use P 20 pipet tips and slowly dispense the sample into the bottom of the DG8 well rather than pipetting at the top edge of the well Then dispense 70 ul of oil into the oil wells Begin droplet generation within 2 min of oil loading Use a manual P 50 pipet with a normal bore P 200 tip not wide or narrow bore to transfer droplets Angle the P 200 tip in the well to prevent the droplets from having to squeeze between the pipet tip and well bottom angle the tip position such that it is not vertical in the well Slowly draw 40 ul of droplets into the pipet tip over 5 sec Typically 5 ul of air will be pulled into the tip which helps prevent the oil from leaking out Position the pipet tio containing the droplets near the bottom of the well and dispense the sample ensuring ample room between the well and the pipet tio so that the droplets do not shear upon dispensing Inconsistent Concentration Results Technical replicates of the same sample should yield concentration estimates that are within the Poisson confidence error bars 95 of the time If the concentration estimates between technical rep
128. thermodynamic 14 particulate 83 Droplet Digital PCR Applications Guide 103 Index 104 partitioning 2 3 7 9 28 30 33 38 41 47 53 58 64 94 96 97 error 96 97 PBMC 55 56 99 PCR 2 4 6 8 11 13 15 20 23 24 27 30 31 40 47 52 54 96 58 64 69 74 78 80 81 82 84 86 88 90 93 99 amplification 2 4 7 20 58 65 66 69 74 efficiency bias 2 inhibitor 15 56 86 Peltier device 85 peripheral blood mononuclear cell 55 99 pipetting accuracy 56 plate sealer 18 84 93 PMID 40 15131266 40 Poisson 6 10 29 33 35 36 56 75 82 84 94 96 error 36 94 Statistics 29 33 56 96 primer 11 15 17 28 24 26 27 30 31 45 46 48 57 59 74 80 83 86 88 89 Primers 13 15 27 Primer BLAST 15 80 PrimerSPlus 13 15 27 primer dimer 11 12 24 probe 3 11 14 17 23 30 31 40 45 46 48 51 57 60 65 66 69 75 8 83 86 91 93 hydrolysis 11 18 82 oligonucleotide 12 TaqMan 46 proto oncogene 60 pseudogenes 40 purification 15 42 qPCR 11 36 37 57 99 Droplet Digital PCR Applications Guide QuantaSoft software 10 19 20 22 29 31 35 36 39 41 59 67 69 77 79 87 quantitative PCR 11 36 37 51 57 99 quencher 12 13 QX100 1 5 12 13 16 20 28 53 55 66 68 69 71 75 83 91 93 QX200 1 4 11 13 17 20 24 26 28 53 66 69 75 83 91 93 rare detection 46 51 assay 46 experimental design 51 rare even
129. ting system you can calculate the measurement error based on the droplet data from a single well This is the technical error also referred to as the Poisson error in QuantaSoft software and it is a good estimate of the errors you can expect to see on true technical replicates defined as aliquots of the same starting material loaded into multiple ddPCR wells The technical error can be calculated from the data points obtained from a single well or multiple wells merged together For a good assay the technical error will be approximately equal to the standard error of the mean Conceptually there are two contributions to the error bars subsampling and partitioning Subsampling 94 In most molecular biology experiments we analyze part of a whole a subsample Examples include Blood sample Tumor biopsy Aliquot from a tube of DNA Droplet Digital PCR Applications Guide Appendix B Technical Error Bars in Droplet Digital PCR Whenever you subsample from a larger volume with the intent to measure properties of the whole volume random effects will lead to slightly different measurements from the subsampled volume Subsampling error is most significant at low concentrations While some quantification systems do not directly report the subsampling error the standard error of the mean the typical error reported for replicates implicitly combines all the different sources of error including the subsampling error
130. try 64 spectroscopy 17 or 1 standard curve 2 7 8 28 54 star activity 42 Index structure 11 12 15 42 57 59 60 83 87 secondary 11 12 15 57 59 60 83 87 subsampling error 95 97 supermix 3 17 18 24 26 28 31 58 69 75 77 81 83 92 93 supernatant 83 TaqMan 3 11 13 17 46 58 62 66 74 75 83 probe 46 target 1 9 11 21 27 35 37 40 42 44 46 48 50 51 53 59 63 65 69 72 73 18 83 86 87 95 96 nucleic acid 1 4 20 technical error 36 94 96 97 temperature 4 11 15 19 21 23 25 21 40 42 43 46 48 49 59 78 80 83 87 99 annealing 15 23 24 27 46 79 80 annealing extension 24 25 27 40 43 48 78 83 85 denaturation 23 85 86 melting 11 27 46 49 78 99 template 2 7 9 10 24 28 32 41 42 51 53 57 59 64 66 69 71 13 75 77 81 82 fragment length 42 synthetic 74 75 thermal cycler 2 4 19 23 81 84 86 93 thymidines 82 T 11 13 14 23 27 46 48 78 99 enhancer 13 transgene 39 trisomy 21 39 fetal 39 tyrosine kinase 60 Droplet Digital PCR Applications Guide 105 Index UDG 81 99 ultraconserved sequences 40 ultramers 82 UNG 81 82 99 uracil DNA glycosylase 81 99 uracil N glycosylase 81 99 uracils 82 VIC 3 4 6 9 10 18 20 22 40 46 48 51 59 61 73 74 78 82 virus 46 55 56 Well Editor 19 29 59 Whitehead Institute for Biomedical Research 13 wild type 7 40
131. tude droplets and the concentration calls associated with each Figure 1 13B A precision of 5 is maintained regardless of the thresholding method used see Fig 1 13B zoomed in view After optimizing the conditions to conduct a ddPCR experiment the precision and resolving power afforded by partitioning are unprecedented Figure 1 14A provides an example of this showing a twofold serial dilution spanning 4 orders of magnitude of Staphylococcus aureus template concentration E FAM channel in a constant background of human genomic DNA QDNA VIC channel run as a duplex assay Figure 1 14B shows a zoomed in view that displays the resolution of small copy number differences using ddPCR for a series of 10 dilutions of the same target and reference assays The error bars represent Poisson 95 confidence intervals Droplet Digital PCR Applications Guide 9 Droplet Digital PCR 100 000 3 10 000 8 2040 e 2950 ee ONE ft 1 000 020 4030 4050 9060 060 952 H9040 A 986 983900 EF 1 000 1 080 O 247 1 100 6T a O 31 5 17 3 10 758 Cc E 1 S _ O 0 1 0 01 wv seo eel seo eel PON ge ol ool ool ool er xo G O G O O O O O O O O yo e b A gt 99 g0 O gee yw or O 2 000 a g 1 600 e 1 360 2 1 200 T E RON S 1 020 1 030 H 1 040 1 030 H 1 060 1 030 1 02
132. type control well containing 2 000 copies pul of an SNP assay with spray of false positives into the double positive region of the plot Droplet Digital PCR Applications Guide 49 Rare Mutation and Sequence Detection Figure 5 5 shows a 2 D plot of a single well with an assay for SNP KRAS G12V that indicates no false positives at 5 000 copies ul This assay can detect 0 001 mutant or 1 mutant in 100 000 wild type targets 8 000 7 000 6 000 5 000 4 000 3 000 Channel 1 amplitude 2 000 P 1 000 O l l l l I I l 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 9 000 Channel 2 amplitude Fig 5 5 2 D amplitude plot of a wild type control well containing 5 000 copies ul of an SNP assay with no spray of false positives into the double positive region of the plot Figure 5 6 shows a 2 D amplitude plot of four combined or merged wells of SNP KRAS G12V detecting 0 002 mutant 8 000 7 000 6 000 4 5 000 4 000 3 000 Channel 1 amplitude 2 000 wees pa 1 000 0 T 0 1 000 2 000 3 000 4 000 5 000 6 000 7 000 8 000 9 000 Channel 2 amplitude Fig 5 6 2 D amplitude plot showing 0 002 mutant detection in four merged wells Interpreting 2 D Plot Results for SNP Assays 50 How does orthogonality affect assay performance The shift of single positive clusters toward the double positive region makes it more difficult to separate
133. ugh to detect rare mutations or sequences Gene expression and microRNA analysis ddPCR provides stand alone absolute quantification of expression levels especially low abundance microRNAs with sensitivity and precision Next generation sequencing NGS ddPCR quantifies NGS sample library preparations to increase sequencing accuracy and reduce run repeats Validate sequencing results such as single nucleotide polymorphisms or copy number variations with absolute quantification Single cell analysis the high degree 10 to 100 fold of cell cell variation in gene expression and genomic content among homogeneous post mitotic progenitor and stem cell populations drives a need for analysis from single cells ddPCR enables low copy number quantification ddPCR for Absolute Quantification and Experimental Considerations In a typical digital PCR experiment the sample is randomly distributed into discrete partitions such that some contain no nucleic acid template and others contain one or more template copies The partitions are PCR amplified to end point and then read using a droplet reader to determine the fraction of positive partitions from which the concentration is estimated by modeling as a Poisson distribution The formula used for Poisson modeling is Copies per droplet In 1 p where p fraction of positive droplets Droplets are assigned as positive or negative by thresholding based on their fluorescence ampl
134. um concentration of the mutant rare sequence that can be reliably differentiated from a negative control 100 wild type In RMD LoD is typically quoted as a ratio or a percentage for example 1 in 10 000 or 0 01 In quantitative PCR the LoD is largely a function of the cross reactivity of the probes In contrast in ddPCR the LoD is determined primarily by the number of wild type molecules that are screened The LoD can be adjusted to the precise requirement of any application by adjusting the number of wells and therefore molecules screened Consider a sample at a mutant or rare sequence concentration of 1 mutant or sequence in 10 000 wild type To guarantee with 95 confidence that at least 1 mutant molecule will be screened in this sample statistics dictates that at least 30 000 wild type molecules must be screened or three times the number of expected wild type target molecules This is about 100 ng well of human DNA where the target has a copy of 1 haploid genome Table 5 1 of molecules to screen 3 x background molecules Droplet Digital PCR Applications Guide 51 Rare Mutation and Sequence Detection Additional wells may be screened to ensure detection of more than one positive droplet For ddPCR the ability to merge multiple wells into a meta well provides more experimental flexibility to tune the experiment to the required LoD 1he number of cells or amount of DNA needed to screen a given number of background mo
135. und cells must be screened Similarly to achieve an LoD of 1 in 1 ml of sample 3 ml of sample must be screened Two different experimental setups are recommended for RSD applications depending on whether detection is with respect to a starting volume of sample or with respect to a second background target that requires quantification Case 1 Quantification with Respect to Total Starting Volume 54 To detect foreign DNA in 5 ml of lake water 15 ml of lake water must be screened The experiment is shown in Figure 5 8 for the case of a single ddPCR well Depending on how much total DNA is extracted from the 15 ml sample more than one well may be needed to analyze the sample because up to 2 5 ug of total DNA can be loaded into one reaction well DNA from 15 ml Target Ez Quantify rare sequence gt starting sample Starting amount Fig 5 8 Strategy for detecting rare foreign DNA in a sample of defined volume Droplet Digital PCR Applications Guide Rare Mutation and Sequence Detection Case 2 Quantification with Respect to Second DNA Sequence To detect a very low target concentration in a high background sample for example 1 copy of virus 100 000 peripheral blood mononuclear cells PBMCs the sample can be analyzed at two different concentrations Figure 5 9 The high concentration wells provide sensitive detection of the rare sequence while the low concentration wells enable quantification of the backgrou
136. uno d deficiency virus HIV A detection copies ml plasma Target DNA Case 2 Ratio E Gene expression 2 independent assays or a a b of rare transcripts 2 primer probe sets FAM HEX or copies unit Viral staging T reference J ndels oo ES A N Target DNA HI Target DNA 22N NO Fig 5 1 Rare mutation detection and rare sequence detection assays For any rare detection assay standard design rules should be used in the design of TaqMan probes and primer sets see Chapter 2 In general primers should be designed to have melting temperatures T_ of 60 C 1 M NaCl 1 uM concentration and should be within 2 C of each other Furthermore the probe must have a melting temperature 3 10 C higher than the primer T_ A temperature binding enhancer such as a locked nucleic acid LNA can be used to shorten the number of nucleotides in the probe while maintaining a higher T Finally the mutant site should be positioned near the middle of the probe sequence Rare detection assay designs should be validated with a temperature gradient to ensure the highest specificity between the mutant and wild type clusters The optimal annealing temperature is defined by the condition in which the mutant probe exhibits no false positives in the wild tyoe only sample and the relative distance between the FAM only mutant and HEX or VIC only wild type clusters is maximal To enable the ultrasensitive
137. upermix 25 ml 5 x 5 ml 2 000 x 20 ul reactions 2x supermix QX200 ddPCR EvaGreen Supermix 50 ml 10 x 5 ml 5 000 x 20 ul reactions 2x supermix ddPCR Buffer Control Kit 9 ml 2 x 4 5 ml 2x buffer Droplet Digital PCR Applications Guide Appendix A Ordering Information 186 4052 QX200 Buffer Control Kit for EvaGreen 9 ml 2 x 4 5 ml 2x buffer 186 3040 ddPCR Library Quantification Kit for Illumina TruSeq 200 x 20 ul 186 3041 reactions includes ddPCR supermix for probes no dUTP 2 x 1 ml vials ddPCR library quantification assay 1 x 200 ul vial for quantification of Illumina TruSeq libraries using the QX100 or QX200 system ddPCR Library Quantification Kit for lon Torrent 200 x 20 ul reactions includes ddPCR supermix for probes no dUTP 2 x 1 ml vials ddPCR library quantification assay 1 x 200 ul vial for quantification of lon Torrent libraries using the QX100 or QX200 system Thermal Cycler and Plate Sealer 185 1197 181 4000 C1000 Touch Thermal Cycler with 96 Deep Well Reaction Module includes C1000 Touch thermal cycler chassis 96 deep well reaction module USB flash drive PX1 PCR Plate Sealer includes heat sealing instrument plate support block that holds 96 well and 384 well plates sealing frame power cord Droplet Digital PCR Applications Guide 93 Appendix B Technical Error Bars in Droplet Digital PCR Because Droplet Digital PCR ddPCR is a digital coun
138. ution of partitioning error increases Note The actual CV calculations contain a Bayesian adjustment at very low and very high CPD lt 100 occupied or lt 100 empty droplets 54 ddPCR error 15 000 droplets Subsampling error l CV 6 011 error 2 57 l 0 1 2 3 4 5 6 CPD Fig 4 Relative contribution of partitioning and subsampling errors to ddPCR error CPD copies per droplet CV coefficient of variation Droplet Digital PCR Applications Guide 97 Appendix C Acronyms Acronyms ABS absolute quantification BLAST Basic Local Alignment Search Tool bp base pair CDNA complementary DNA CN copy number CNV copy number variation CPD copies per droplet CV coefficient of variation ddPCR Droplet Digital PCR DNA deoxyribonucleic acid dsDNA double stranded DNA dUTP 2 deoxyuridine 5 triohosphate ERBB2 human epidermal growth factor receptor 2 gene also HER 2 FFPE formalin fixed paraffin embedded FISH fluorescence in situ hybridization GC guanine cytosine gDNA genomic DNA 98 Droplet Digital PCR Applications Guide GMO genetically modified organism HER2 human epidermal growth factor receptor 2 gene also ERBB2 HIV human immunodeficiency virus IHC immunohistochemistry LNA locked nucleic acid LoD limit of detection LoQ limit of quantification miRNA
139. wing concentration calculation is used assumes an approximate droplet volume of 1 nl or 10 ul Volume analyzed 20 000 x 10 ul droplet 20 ul Copies of target 6 copies 03 ies ul Volume analyzed 20 ul AS Concentration Note he final concentration is the same if we analyze 10 000 droplets and observe three copies of target Volume analyzed 10 000 x 10 ul droplet 10 ul Copies of target 3 copies 0 3 ies ul Volume analyzed 10 l A Concentration Droplet Digital PCR Applications Guide Absolute Quantification and the Statistics of Droplet Digital PCR Intermediate Concentration Example Consider the case in which there are 5 000 target molecules in 20 000 droplets 5 000 targets in 20 ul 250 copies ul 0 25 CPD Random partitioning of target molecules into droplets will lead to some droplets with 2 3 or even 4 copies and correspondingly more than 75 of the droplets will have zero copies Poisson statistics tells us exactly how many droplets to expect in each category Table 3 1 shows the expected percentage of droplets in each category Note that in ddPCR each droplet is distinguished as either empty negative zero targets or occupied positive one or more targets For the 0 25 CPD case 78 not 75 of the droplets will be positive and 22 not 25 will be negative on average Since Poisson statistics arise in multiple different contexts in ddPCR we describe this phenomenon as pa
140. xperiment type in QuantaSoft software when loading wells Double click on the experiment name in the main software window to set the ploidy for the reference Figure 4 3 QuantaSoft Version 14 0 99 Expenments a ABS Chm 8 Duplex Absolute Quantification ABS CNV1 CNV Rare Evert Detection RED Abs Quart a EANA RED Copy Number Variation CNV CNV2 Reference i Copies Background Color J 192 0 0 id Foreground Color __ White Fig 4 3 Setting the ploidy for the CNV reference Note R2 means 2 copies genome diploid or 1 copy haploid genome If CNV experimental type Is not selected for your wells the CNV tab will not be available This affects only the CNV charting calculations and can be applied during setup or any time after data collection For the reference assay select Reference as type Put this assay s concentration as the denominator for example b for the ratio chart and for the fractional abundance chart and assign the CN selected to this assay If both Ch1 and Ch2 are selected as unknown Ch1 is automatically a and Ch2 is automatically both b and the CNV reference Restriction Digestion To achieve optimal accuracy in CN measurements restriction digestion of genomic DNA is required Restriction digestion separates tandem gene copies ensuring proper random partitioning into droplets Figure 4 4 Restriction digestion can also reduce sample viscosit
141. y and improve assay performance by improving template accessibility Single copy variant Two tandem copies Two unlinked copies gt gt E gt O CHO ez gt m zm ea ee _ gt a a m la E 3 positive droplets 3 positive droplets 5 positive droplets inaccurate CNV estimate accurate CNV estimate Fig 4 4 Restriction digestion separates tandem gene copies Droplet Digital PCR Applications Guide 41 Copy Number Variation Analysis 42 Considerations in planning a restriction digestion Do not cut the target or reference amplicon Choose a methylation insensitive enzyme Read the chosen restriction enzyme FAQs on the manufacturer s website They often describe known issues such as star activity For most assays a fragment size of 5 kb or less works fine This can typically be achieved with a 4 cutter or 6 cutter enzyme For some assays smaller template fragment lengths lt 500 bp are required This may be due to nearby inhibitory secondary DNA structures elements that get cut away with a smaller fragment size RestrictionMapper www restrictionmapper org is a website that can help you determine template fragment length and whether your designed amplicon is cleaved by a given restriction enzyme For human genomic DNA use 10 U restriction enzyme ug DNA Up to 20 U enzyme ug DNA is acceptable Higher concentrations of enzyme could be required to resolve higher CN targets Some ddPCR reactions are inhibited when h
142. y determined using thermal cyclers that have a thermal gradient feature The C1000 Touch thermal cycler offers a gradient feature The gradient feature enables you to test a range of temperatures simultaneously optimizing the annealing temperature in a single experiment To find the optimal annealing temperature for your reaction test a range of temperatures above and below the calculated T of the primers The optimal annealing temperature is the one that results in the largest fluorescence amplitude difference between the positives and negatives and that avoids nonspecific amplification It is also important to view the concentration values obtained across the thermal gradient simultaneously when considering the fluorescence amplitude separation of positives and negatives A sample annealing temperature optimization experiment is shown in Figure 2 10 demonstrating separation of positives and negatives of replicate samples across the thermal gradient For two color assays a thermal gradient can be used to identify a temperature where both assays perform well A01 B01 C01 DO1 E01 FO1 G01 HO1 8 000 7 000 6 000 5 000 4 000 gt Channel 2 amplitude 3 000 0 20 000 40 000 60 000 80 000 100 000 Event number Fig 2 10 Thermal gradient optimization Droplet Digital PCR Applications Guide 23 Designing Droplet Digital PCR Experiments ddPCR Using the QX200 System and EvaGr
143. you have 100 000 molecules total and 20 000 droplets then CPD 100 000 molecules 20 000 droplets CPD 5 molecules droplet Example 2 CPD molecules ul x droplet volume ul If you have 20 molecules in a 20 ul sample with 1 nl droplet volume then 20 molecules 20 ul 1 0 molecule ul CPD 1 0 molecule ul 0 001 ul droplet CPD 0 001 Droplet Digital PCR Applications Guide 31 Absolute Quantification and the Statistics of Droplet Digital PCR Low Concentration Example 32 When there are far fewer molecules than partitions for example 500 molecules or less in 20 000 partitions it is relatively easy to see how the ddPCR approach enables accurate quantification Figure 3 3 shows a sample that contains six target DNA molecules If the entire sample is converted into droplets we will expect to find exactly six droplets that contain template since it is statistically highly unlikely that a single droplet will start with more than one target molecule yl ag a Aa ly E tg ee O MO ee A nm pi oi a i ir a i dj E A 5 z i 2 a iy te ye ta ey ey re E 9 f yh a E LIE i i Oe I i L L a my des a kin ole le A ms e L i Pie lo ll la 21 pa eal P ja 2 a Se el La a a 6 copies of target in 20 ul sample Most likely outcome of ddPCR 0 3 copies ul 6 positive droplets Fig 3 3 Outcome of ddPCR in two modes of analysis For 20 000 droplets the follo

Droplet Digital™ PCR Applications Guide - Gene

Contents

Download Pdf Manuals

Related Search

Related Contents

Droplet Digital&trade; PCR Applications Guide - Gene

Contents

Download Pdf Manuals

Related Search

Related Contents

Droplet Digital™ PCR Applications Guide - Gene