Home

ABI Big Dye

1. Introduction Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Two Kits Available 1 2 Instrument Platforms and Required Software 1 7 Reagents and Storage 1 10 Materials Supplied by the User 1 11 Safety 1 15 Introduction 1 1 Two Kits Available Protocol for Two Kits Comparing the Two Kits BigDye Terminator Ready Reaction Kits 1 2 Introduction This protocol describes how to use the following kits ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 IMPORTANT The protocol is identical for both of the kits The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 contains the same components as the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit original kit However the ratio of dideoxy to deoxy terminators has been changed in the v2 0 kit The new formulation distributes more signal to the longer DNA fragments Reactions generated with the v2 0 kit show higher signal in longer fragments relative to shorter fragments Recommended Use of Version 2 Kit The v2 0 kit can be used in place of the original kit on all of the sequencing platforms see Instrument Platforms on page 1 7 but is primarily recommended for use with the ABI PRISM 3700 DNA Analyzer and the ABI PRISM 377 DNA Sequencer with 48 cm well to read
2. 0 8 pmol uL to 3 2 pmol uL then the volume of primers can be reduced from 4 uL to 1 uL Because less volume is used for the primers more volume can then be added for the template In this example the volume of DNA template could be increased from 8 pL to 11 yL 2 6 Preparing the Templates Performing Cycle Sequencing Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Sequencing Plasmids and PCR Products 3 2 Sequencing BAC DNA 3 5 Sequencing Bacterial Genomic DNA 3 7 Sequencing on the CATALYST 800 3 9 Sequencing on the ABI PRISM 877 ITC 3 10 Performing Cycle Sequencing 3 1 Sequencing Plasmids and PCR Products Overview This section describes how to prepare reactions and perform cycle sequencing on plasmids and PCR Products Sequencing IMPORTANT If you are sequencing plasmids and PCR products on the Plasmids on the B PRISM 3700 DNA Analyzer refer to the ABI PRISM 3700 DNA Analyzer 3700 Sequencing Chemistry Guide P N 4309125 for information about reaction set up and cycle sequencing Instruments The following thermal cyclers can be used with this protocol GeneAmp PCR Systems 9700 9600 and 2400 gt 9 9 ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation DNA Thermal Cycler 480 DNA Thermal Cycler TC1 Preparing the The type of tube required depends on the thermal cycler that you are Reactions using Ref
3. P N Primer Reactions Identification Kits for use on the 377 403051 21M13 100 Sequencer 403049 21 M13 5000 P N Kit Reactions 403052 M13 Reverse 100 4313682 Lane Guide 200 403050 M13 Reverse 5000 4313677 Lane Guide 1000 4339922A Protocol 4313679 Lane Guide 5000 4339918A Protocol BigDye Terminator Cycle Sequencing Kits with AmpliTaq DNA Polymerase FS ABI PRISM Matrix Standards P N Kit Reactions P N Kit Instrument 4303149 Ready Reaction 100 4305609 Matrix Standard Set 3700 4303150 Ready Reaction 1000 403047 dRhodamine Matrix 310 4303151 Ready Reaction 5000 Standards 4339923A Protocol B 403047 dRhodamine Matrix 377 373 Standards Headquarters 850 Lincoln Centre Drive Foster City CA 94404 USA Phone 1 650 638 5800 Toll Free 1 800 345 5224 Fax 1 650 638 5884 Worldwide Sales Offices Applied Biosystems vast distribution and service network composed of highly trained support and applications personnel reaches into 150 countries on six continents For international office locations please call our local office or refer to our web site at www appliedbiosystems com www appliedbiosystems com A Applied NB Biosystems Applera Corporation is committed to providing the world s leading technology and information for life Scientists Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses Printed in the US
4. Tape 439 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Purifying Extension Products 4 5 To precipitate in 96 Well MicroAmp Reaction Plates continued Step Action 6 Place the tray in a table top centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray If you are performing this procedure for electrophoresis on the 3700 DNA Analyzer a Rinse the pellet by adding 150 uL of 70 isopropanol to each well b Seal the plate with adhesive tape c Invert the plate a few times Place the inverted tray with the towel
5. to 6 00 p m Eastern Time All Other Products 5 30 a m to 5 00 p m Pacific Time In North America To contact Applied Biosystems Technical Support use the telephone or fax numbers given below To open a service call for other support needs or in case of an emergency dial 1 800 831 6844 and press 1 Product or Product Area Telephone Dial Fax Dial ABI PRISM 3700 DNA Analyzer 1 800 831 6844 then press 8 1 650 638 5981 DNA Synthesis 1 800 831 6844 then press 21 1 650 638 5981 Fluorescent DNA Sequencing 1 800 831 6844 then press 22 1 650 638 5981 Fluorescent Fragment Analysis includes GeneScan applications 1 800 831 6844 then press 23 1 650 638 5981 Integrated Thermal Cyclers ABI PRISM9877 and Catalyst 800 instruments 1 800 831 6844 then press 24 1 650 638 5981 ABI PRISM 3100 Genetic Analyzer 1 800 831 6844 then press 26 1 650 638 5981 Biolnformatics includes BioLIMS BioMerge and SQL GT applications 1 800 831 6844 then press 25 1 505 982 7690 Peptide Synthesis 433 and 43X Systems 1 800 831 6844 then press 31 1 650 638 5981 Protein Sequencing Procise Protein Sequencing Systems 1 800 831 6844 then press 32 1 650 638 5981 Product or Product Area Telephone Dial Fax Dial PCR and Sequence Detection 1 800 762 4001 then press 1
6. 00 0c eee eee 1 15 Ordering MSDSS 2 3 tease hase ERE EEG QURE EN RU PIE 1 15 Chemical Hazard Warning 00 cece eee eee nee 1 16 2 Preparing the Templates Chapter Summary oseon eas scale Meals Ae ae ee lg Re Se 2 1 In This hapltet i tht o at eme ae fcre rer cis 2 1 Control DNA Templates 0 eee ee e 2 2 Using Control DNA x cux sa geen ERI RR ER Ee ree des 2 2 Control DNA Sequence 0 0 eee ee eese 2 2 An Additional Control 0 0 00 0 senaren renren 2 2 Template Preparation Methods 0 0 0 eee ee eee eee 2 3 Single and Double Stranded Templates 2 3 BAC DNA Templates oeserte n ernie ROC alfa iw 2 3 PCR Temijpl tesz mae ute Ge nd eR a eee 2 4 Use of the Primer Island Transposition Kit 004 2 5 OVetVIeW seca gists toro a aise Male ER MORE UNCERT SA ers 2 5 About ransposons seen 2 5 Inserting Artificial Transposons 0 00 02 eee eee eee 2 5 Techniques oe cami ert e tt E avete a E Rea Mae 2 5 Template and Primer Quantities 0 0 2 eee eee ee ee 2 6 OVetVIe Weed ect wack Beare he se Soe RE ON a ke I s 2 6 Template Quantity s sse neni a eee eee 2 6 Template Volume 22s eco emeret a 2 6 3 Performing Cycle Sequencing Chapter SUMMAT Lun gla ve PO Rael weed RS IR EUR 3 1 In This Chapter cuneo dina eee Bhs Dees eet 3 1 Sequencing Plasmids and PCR Products 00 00 0000 3 2 OVErVIeW dedi Sst eo ER
7. PRISM 877 Integrated Thermal Cycler Profiles 4 Terminator Sequencing uses a reaction premix containing the sequencing primer or requires premixing template with primer in the sample tube Terminator Automix Sequencing combines reaction cocktail lacking primers water primer from one tube and template from another tube The profile is chosen on the Chemistry page of the Sequencing Notebook and can be edited to make custom profiles Refer to Chapter 4 Using the ABI PRISM 877 Software in the ABI PRISM 877 Integrated Thermal Cycler User s Manual P N 904414 Ethanol Ethanol precipitation can be chosen for dye terminator sequencing The Precipitation proportions of ethanol and precipitation additive are set for default reaction volumes These volumes can be changed especially if the reaction volume is modified After the program is completed proceed to Chapter 4 Purifying Extension Products On extended runs e g overnight we recommend withholding addition of ethanol until plate processing can be completed This delay can be programmed on the Chemistry page of the Sequencing Notebook 3 10 Performing Cycle Sequencing Purifying Extension Products Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Choosing a Method of Purification 4 2 Plate and Spin Column Purification 4 2 Isopropanol Precipitation 4 5 Ethanol Precipitation 4 9 Ethan
8. The v2 0 kit is very effective when following the extended read protocol described in Achieving Longer High Accuracy Reads on the 377 Sequencer P N 4315153 Both the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit and the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit v2 0 provide AmpliTaq9 DNA Polymerase FS BigDye terminators and all the required components for the sequencing reaction In the Ready Reaction format the dye terminators deoxynucleoside triphosphates AmpliTaq DNA Polymerase FS r Tth pyrophosphatase a component in AmpliTaq DNA Polymerase FS magnesium chloride and buffer are premixed into a single tube of Ready Reaction Mix and are ready to use These reagents are suitable for performing fluorescence based cycle sequencing reactions on single stranded or double stranded DNA templates on polymerase chain reaction PCR fragments and on large templates e g BAC clones Cycle Sequencing with AmpliTaq DNA Polymerase FS BigDye Terminators The dNTP mix includes dITP in place of dGTP to minimize band compressions The dNTP mix also uses dUTP in place of dTTP dUTP improves the incorporation of the T terminator and results in a better T pattern Both kit formulations contain the sequencing enzyme AmpliTaq DNA Polymerase FS This enzyme is a variant of Thermus aquaticus DNA polymerase that contains a point mutation in the active site This results in less discrimination agains
9. Y Wilson R K and Boeke J D 1997 A transposon based strategy for sequencing repetitive DNA in eukaryotic genomes Genome Res 7 551 563 Preparing the Templates 2 5 Template and Primer Quantities Overview f possible quantitate the amount of purified DNA by measuring the absorbance at 260 nm or by some other method Template Quantity The table below shows the amount of template to use in a cycle sequencing reaction Template Quantity PCR product 100 200 bp 1 3 ng 200 500 bp 3 10 ng 500 1000 bp 5 20 ng 1000 2000 bp 10 40 ng 22000 bp 40 100 ng Single stranded 50 100 ng Double stranded 200 500 ng Cosmid BAC 0 5 1 0 ug Bacterial genomic DNA 2 3 ug Note In general higher DNA quantities give higher signal intensities Note The template quantities stated above should work with all primers you may be able to use even less DNA especially when sequencing with the 21 M13 primer The amount of PCR product to use in sequencing will also depend on the length and purity of the PCR product Template Volume Cycle sequencing reactions are made up in a final volume of 20 pL The volume includes 8 uL for DNA template and 4 pL for primer If your DNA is not concentrated enough and you need to add more than 8 pL of DNA template then you can compensate for the additional volume by using a more concentrated solution of primer For example if your concentration of primers is increased from
10. a fixed angle rotor place the column in the same orientation as it was in for the first spin This is important because the surface of the gel will be at an angle in the column after the first spin 12 Discard the column The sample is in the sample collection tube 13 Dry the sample in a vacuum centrifuge for 10 15 minutes or until dry Do not overdry 4 4 Purifying Extension Products Isopropanol Precipitation Precipitating in 384 Well Plates Precipitating in 96 Well Plates IMPORTANT If you are precipitating in 384 well plates refer to the ABI PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for the procedure Note This procedure does not use salt To precipitate in 96 Well MicroAmp Reaction Plates Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube Add one of the following 80 pL of 75 isopropanol 20 pL of deionized water and 60 pL of 100 isopropanol The final isopropanol concentration should be 60 5 WARNING CHEMICAL HAZARD Isopropyl alcohol can be harmful if inhaled ingested or absorbed through the skin It can cause CNS depression and be irritating to the eyes skin and mucous membranes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Seal the tubes with strip caps or by applying a piece of 3M Scotch
11. fast gt 1 sec poor noisy data may result Introduction 1 7 Run Modules and You must use Filter Set E run modules and dye set primer mobility Dye Set Primer files on all instrument platforms except the ABI PRISM 373 DNA Mobility Files Sequencer Use Filter Set A on ABI PRISM 373 DNA Sequencers with the ABI PRISM BigDye Filter Wheel IMPORTANT Users of the ABI PRISM 3700 DNA Analyzer refer to the ABI PRISM 3700 DNA Analyzer User s Manual P N 4306152 for information on run modules and dye set primer mobility files 1 8 Introduction Run modules and dye set primer mobility files are included in the current versions of data collection software The run modules and dye set primer mobility files can be downloaded from the Internet www appliedbiosystems com techsupport If you do not have access to the Internet you can get the files from Applied Biosystems Technical Support or from your local field applications specialist call your local sales office for more information Run Modules Run modules are the same as for the dRhodamine terminators and BigDye primers Dye Set Primer Mobility Files You must install new dye set primer mobility files for the BigDye terminators original and version 2 kits Dye set primer file names for the dRhodamine terminators are similar to those for the BigDye terminators Their respective mobility files can be mistaken for each other easily If a mobility
12. for PCR 2 for the 7700 or 5700 6 for the 6700 or dial 1 800 831 6844 then press 5 1 240 453 4613 Voyager MALDI TOF Biospectrometry and Mariner ESI TOF Mass Spectrometry Workstations 1 800 899 5858 then press 13 1 508 383 7855 Biochromatography BioCAD Workstations and Poros Perfusion Chromatography Products 1 800 899 5858 then press 14 1 508 383 7855 Expedite Nucleic acid Synthesis Systems 1 800 899 5858 then press 15 1 508 383 7855 Peptide Synthesis Pioneer and 9050 Plus Peptide Synthesizers 1 800 899 5858 then press 15 1 508 383 7855 PNA Custom and Synthesis 1 800 899 5858 then press 15 1 508 383 7855 FMAT 8100 HTS System and Cytofluor 4000 Fluorescence Plate Reader 1 800 899 5858 then press 16 1 508 383 7855 Chemiluminescence Tropix 1 800 542 2369 U S only or 1 781 271 0045 1 781 275 8581 Applied Biosystems MDS Sciex 1 800 952 4716 1 650 638 6223 Technical Support B 3 Outside North America Region Telephone Dial Fax Dial Africa and the Middle East Africa English Speaking and West Asia Fairlands South Africa 27 11 478 0411 27 11 478 0349 South Africa Johannesburg 27 11 478 0411 27 11 478 0349 Middle Eastern Countries and North Africa Monza Italia 39 0 39 8389 481 39 0 39 8389 493 Eastern Asia China Ocea
13. for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as Applied Biosystems when used in conjunction with an Authorized Thermal Cycler or is available from Applied Biosystems Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 or Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda California 94501 ABI PRISM Applied Biosystems GeneScan and MicroAmp are registered trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries ABI BigDye CATALYST POP and POP 6 are trademarks of Applera Corporation or its subsidiaries in the U S and certain other countries AmpliTaq and GeneAmp are registered trademarks of Roche Molecular Systems Inc Centricon is a trademark of W R Grace and Co Centri Sep is a trademark of Princeton Separations Inc pGEM is a registered trademark of Promega Corporation All other trademarks are the sole property of their respective owners Applera Corporation is committed to providing the world s leading technology and information for life scientists Applera Corporation consists of the Applied Biosystems and Celera Genomics businesses Contents 1 Introduction Chapter Summary do enckee a eee Es eed Mese de Ris 1 1 In This Chapter oes t ere tret RE 1
14. plate Princeton Separations P N CS 961 Multiscreen 96 Well Filter Plates Millipore PIN MADYEKIT1 4 2 Purifying Extension Products Recommended Spin Columns Optimizing Spin Column Purification Quantum Prep SEQueaky Kleen 96 well Terminator Removal Kit Bio Rad 732 6260 Refer to the manufacturer s instructions procedures We recommend Centri Sep spin columns Princeton Separations P N CS 901 IMPORTANT For the BigDye terminators hydrate the column for 2 hours Tips for optimizing spin column purification Use one column for each sample Do not process more columns than you can handle conveniently at one time Load the sample in the center of the column bed Make sure that the sample does not touch the sides of the column and that the pipet tip does not touch the gel surface If samples are not properly loaded peaks from unincorporated dye terminators can result Spin the column at 325 730 x g for best results Use the following formula to calculate the best speed for your centrifuge g 11 18x rx rpm 1000 where g relative centrifugal force r radius of the rotor in cm rpm revolutions per minute Do not spin for more than 2 minutes Perform the entire procedure without interruption to ensure optimal results Do not allow the column to dry out Purifying Extension Products 4 3 Performing Spin To perform spin column purification Column Purification Step Action 1
15. repackage or further sublicense under such patent rights to use this reagent for DNA sequencing or fragment length analysis solely with an Applied Biosystems commercial automated sequencing machine or other authorized DNA sequencing machines that have been authorized for such use by Applied Biosystems or for manual DNA sequencing No license is hereby granted for use of this kit or the reagents therein in any other automated sequencing machine Such sublicense is granted solely for research or other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional license to practice the patented methodologies contact Amersham Life Science Inc Vice President Regulatory Affairs P O Box 22400 Cleveland Ohio 44122 Patents are pending in countries outside the United States Notice to Purchaser Limited License The purchase price of this product includes a limited nontransferable license under U S Patent 5 075 216 or its foreign counterparts owned by Roche Molecular Systems Inc and F Hoffmann La Roche Ltd Roche to use only this amount of the product for DNA Sequencing and related processes described in said patent solely for the research and development activities of the purchaser No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR process
16. the tray in a tabletop centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray Place the inverted tray with the towel into the table top centrifuge and spin at 700 x g for 1 minute Add 150 pL of 70 ethanol to each pellet 10 Cap or seal the tubes then invert the tray a few times to mix 11 Spin the tray for 10 minutes at maximum speed 12 Repeat steps 7 and 8 13 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 14 Purifying Extension Products Precipitating To precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 For each sequencing reaction prepare a 1 5 mL microcentrifuge tube containing the following 2 0 uL of 3 M sodium acetate NaOAc pH 4 6 50 uL of 95 ethanol EtOH Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove
17. you are using Refer to Thermal Cycling Tubes Required on page 1 14 To prepare the sequencing reaction Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 0 5 1 0 ug Primer 5 10 pmol Deionized water q s Total Volume 40 uL 2 Mix well and spin briefly Performing Cycle Sequencing 3 5 Performing Cycle To perform cycle sequencing on BAC DNA Sequencing Step Action 1 Place the tubes in a thermal cycler and set the volume to 30 pL 2 Heat the tubes at 95 C for 5 minutes 3 Repeat the following for 30 cycles Rapid thermal ramp to 95 C 95 C for 30 seconds Rapid thermal ramp to 50 55 C depending on template 50 55 C for 10 seconds Rapid thermal ramp to 60 C 60 C for 4 minutes 4 Rapid thermal ramp to 4 C and hold until ready to purify 5 Spin down the contents of the tubes in a microcentrifuge 6 Proceed to Chapter 4 Purifying Extension Products a Some laboratories have found that increasing the number of cycles gives better results b Rapid thermal ramp is 1 C sec 3 6 Performing Cycle Sequencing Sequencing Bacterial Genomic DNA Thermal Cyclers Sequencing Bacterial Genomic DNA on the 3700 Preparing Sequencing Reactions The following thermal cyc
18. 0 55 C depending on template 55 C for 20 seconds Rapid thermal ramp to 60 C 60 C for 4 minutes Rapid thermal ramp to 4 C and hold until ready to purify Spin down the contents of the tubes in a microcentrifuge Proceed to Chapter 4 Purifying Extension Products a Rapid thermal ramp is 1 C sec 3 8 Performing Cycle Sequencing Sequencing on the CATALYST 800 Overview Options for Sequencing Manual Ethanol Precipitation Required Templates that have been prepared as described in chapter 2 should be suitable for use on the CATALYST 800 Molecular Biology LabStation Follow the protocols in the Turbo Appendix of the CATALYST 800 Molecular Biology LabStation User s Manual P N 903939 to set up your reactions Terminator sequencing has two options Areaction premix containing the sequencing primer or premixing template with primer in the sample tube A reaction cocktail lacking primers water and primer from one tube combined with template from another tube Ethanol precipitation is not available for Terminator Sequencing protocols on the CATALYST 800 Molecular Biology LabStation Ethanol precipitation or spin column purification must be performed manually See Chapter 4 Purifying Extension Products Performing Cycle Sequencing 3 9 Sequencing on the ABI PRISM 877 ITC Predefined Predefined temperature profiles are provided for the following on the Temperature ABI
19. 1 Two Kits Available cei 23 dme Soares eu RR beh case DERE 1 2 Protocol for Two Kits see serros eee ee 1 2 Comparing the Two Kits 0 0 0 cece eee eee 1 2 BigDye Terminator Ready Reaction Kits 1 2 Cycle Sequencing with AmpliTaq DNA Polymerase FS 1 3 BigDye Terminators 0 0 0 0 eee eee eee eee ee 1 3 Comparing Peak Height Patterns 0 020 eee sees 1 4 Dye Spectra ceo aiid dea gi Raia m S be Bhat 1 6 Instrument Platforms and Required Software 000 1 7 Instrument Platforms 1 7 Thermal Cyclers 04 0 4 tegat rra Re e ed 1 7 Run Modules and Dye Set Primer Mobility Files 1 8 Instrument Matrix File Required 0 02 00 e eee eee 1 9 Reagents and Storage 0 0 eee eee ene 1 10 Available Kits reed eet es membr ee eS 1 10 Description of Reagents 2 0 0 0 eee eee eene 1 10 Storage and Use of the Kits 0 00 0 200008 1 10 Materials Supplied by the User 1 11 OVEeELVIEW zur te hg Sue E shee CER UC IU Rae ed chr eise tok uns 1 11 Materials for Cycle Sequencing 00 cece eee eee eee 1 11 Materials for Purifying Extension Products 1 12 Materials for Electrophoresis 00 0002 cece eee eee 1 13 Thermal Cycling Tubes Required 20 00 0000 c eee eee 1 14 Sally i a Ritual alten eet a bee LAG potrei siis e PONE MAR eas 1 15 Documentation User Attention Words
20. 415 5000 4314416 25 000 4314849 Description of A description of the kit components is listed below Reagents Storage and Use of the Kits 1 10 Introduction Terminator Ready Reaction Mix A Dye Terminator labeled with dichloro R6G C Dye Terminator labeled with dichloro ROX G Dye Terminator labeled with dichloro R110 T Dye Terminator labeled with dichloro TAMRA Deoxynucleoside triphosphates dATP dCTP dITP dUTP AmpliTag DNA Polymerase FS MgCl Tris HCl buffer pH 9 0 pGEM 3Zf double stranded DNA Control Template 0 2 ug uL 21 M13 Control Primer forward 0 8 pmol yL Store the kits at 15 to 25 C Before each use of either kit allow the frozen stocks to thaw at room temperature do not heat Whenever possible thawed materials should be kept on ice during use IMPORTANT Mix each stock thoroughly and then centrifuge briefly to collect all the liquid at the bottom of each tube Materials Supplied by the User Overview Materials for Cycle Sequencing IMPORTANT This section describes materials that are required for sample preparation Refer to the instrument s user manual for materials that are required for the operation of the instrument Topic See Page Materials for Cycle Sequencing 1 11 Materials for Purifying Extension Products 1 12 Materials for Electrophoresis 1 13 ABI Prism 3700 DNA Analyzer Material Supplier GeneAmp PCR Sy
21. A 09 2002 Part Number 4339923A an Applera business
22. AAAACGACGGCCAGT 21 M13 primer GAATTGTAAT GTACCCGGGG GCTTGAGTAT ATCATGGTCA CTCACAATTC GTAAAGCCTG AATTGCGTTG CTGTCGTGCC GGAGAGGCGG GCTCACTGAC GCGGTATCAG CAGAATCAGG AGGCCAGCAA CTGGCGTTTT ACAAAAATCG AGGACTATAA CTCGTGCGCT ACCTGTCCGC TCATAGCTCA GTTCGCTCCA AGCCCGACCG GTCCAACCCG GCCACTGGTA GTGCTACAGA CACTAGAAGG ACGACTCACT ATCCTCTAGA TCTATAGTGT TAGCTGTTTC CACACAACAT GGGTGCCTAA CGCTCACTGC AGCTGCATTA TTTGCGTATT TCGCTGCGCT CTCACTCAAA GGATAACGCA AAGGCCAGGA TCCATAGGCT ACGCTCAAGT AGATACCAGG CTCCTGTTCC CTTTCTCCCT CGCTGTAGGT AGCTGGGCTG CTGCGCCTTA GTAAGACACG ACAGGATTAG GTTCTTGAAG ACAGTATTTG ATAGGGCGAA GTCGACCTGC CACCTAAATA CTGTGTGAAA ACGAGCCGGA TGAGTGAGCT CCGCTTTCCA ATGAATCGGC GGGCGCTCTT CGGTCGTTCG GGCGGTAATA GGAAAGAACA ACCGTAAAAA CCGCCCCCCT CAGAGGTGGC CGTTTCCCCC GACCCTGCCG TCGGGAAGCG ATCTCAGTTC TGTGCACGAA TCCGGTAACT ACTTATCGCC CAGAGCGAGG TGGTGGCCTA GTATCTGCGC TTCGAGCTCG AGGCATGCAA GCTTGGCGTA TTGTTATCCG AGCATAAAGT AACTCACATT GTCGGGAAAC CAACGCGCGG CCGCTTCCTC GCTGCGGCGA CGGTTATCCA TGTGAGCAAA GGCCGCGTTG GACGAGCATC GAAACCCGAC TGGAAGCTCC CTTACCGGAT TGGCGCTTTC GGTGTAGGTC CCCCCCGTTC ATCGTCTTGA ACTGGCAGCA TATGTAGGCG ACTACGGCTA TCTGCTGAAG Control DNA Sequence A 1 40 80 120 160 200 240 320 360 400 440 480 520 560 600 640 680 720 760 800 840 880 920 960 1000 Technical Support Contacting Technical Support To Contact Technical Support by E Mail You
23. ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits Original and Version 2 0 Protocol ES 5 DP Smis O Copyright 2002 Applied Biosystems Printed in the U S A For Research Use Only Not for use in diagnostic procedures Notice to Purchaser Limited License A license under the process claims of U S Patents 5 332 666 and 5 821 058 or their foreign counterpart claims has an up front fee component and a running royalty component The purchase price of the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits Original and Version 2 0 includes limited non transferable rights under the running royalty component to use only this amount of the product to practice the DNA sequence and fragment analysis processes described in said patents when this product is used in conjunction with an Authorized DNA sequence analysis instrument whose use is covered under the up front fee component of these patents No other rights are granted expressly by implication or by estoppel or under any other patent rights owned or licensable by Applied Biosystems Further information relating to the purchase of licenses for DNA sequence and fragment analysis and other applications may be obtained by contacting the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City CA 94404 U S A Notice to Purchaser Limited License The purchase of the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kits Ori
24. Gently tap the column to cause the gel material to settle to the bottom of the column Remove the upper end cap and add 0 8 mL of deionized water Replace the upper end cap and vortex or invert the column a few times to mix the water and gel material Allow the gel to hydrate at room temperature for at least 2 hours Note Hydrated columns can be stored for a few days at 2 6 C Longer storage in water is not recommended Allow columns stored at 2 6 C to warm to room temperature before use Remove any air bubbles by inverting or tapping the column and allowing the gel to settle Remove the upper end cap first then remove the bottom cap Allow the column to drain completely by gravity Note If flow does not begin immediately apply gentle pressure to the column with a pipette bulb Insert the column into the wash tube provided Spin the column in a microcentrifuge at 730 x g for 2 minutes to remove the interstitial fluid Remove the column from the wash tube and insert it into a sample collection tube e g a 1 5 mL microcentrifuge tube 10 Remove the extension reaction mixture from its tube and load it carefully onto the center of the gel material Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 4 7 11 Spin the column in a microcentrifuge at 730 x g for 2 minutes Note If using a centrifuge with
25. RARE Eee tne mE dS 3 2 Sequencing Plasmids on the 3700 2 0 0 00 008 3 2 Instr mentss eue ofa Bean Sala Pl pe da er AR Nee a i hei 3 2 Cycle Sequencing on the GeneAmp 9700 9600 or 2400 3 3 Cycle Sequencing on the TC1 or DNA Thermal Cycler 480 3 3 Sequencing BAC DNA ce cece ee rh htt then 3 5 Thermal Cycler 23 6 naa sarc eL EESOLeU MESE I ini EE A s 3 5 Sequencing BAC DNA on the 3700 00 000005 3 5 Preparing Sequencing Reactions eee 3 5 Performing Cycle Sequencing eleeeeeee eee 3 6 Sequencing Bacterial Genomic DNA sleleeeeleee ee eee 3 7 Thermal Cyclers uo eb eR el e Ee Ra Ra gute e 3 7 Sequencing Bacterial Genomic DNA on the 3700 3 7 Preparing Sequencing Reactions ess 3 7 Cycle Sequencing oo meu Beate Ya Gdn ce wee 3 8 Sequencing on the CATALYST 800 00 0 0c eee eee 3 9 QVELVIEW wig Lees dee e en ERE EGG PEU ED PAS 3 9 Options for Sequencing 2 2 0 0 0 0 eee eee eee eee 3 9 Manual Ethanol Precipitation Required 0 3 9 Sequencing on the ABI PRISM 877 ITC 0 00 02 00000 3 10 Predefined Temperature Profiles 00000000 3 10 Ethanol Precipitation 0 0 00 cee eee eee eee 3 10 4 Purifying Extension Products Chapter Summary sie csi ck geek Re pep RR ee ue RR ree RC 4 1 In This Chapter 2 5 csi 3 24 ERAS ECRIRE ET EUST EUR HIERO 4 1 Ch
26. RNING CHEMICAL HAZARD Formamide is a known teratogen i e it can cause birth defects Wash thoroughly after handling formamide Wear appropriate protective eyewear clothing and gloves Obtain a copy of the MSDS from the manufacturer 2 Resuspend each sample pellet in loading buffer as follows Volume pL Volume pL Template 18 or 36 well 48 64 or 96 well PCR product 6 8 4 6 plasmid M13 BAC large 2 1 5 DNA 3 Vortex and spin the samples Heat the samples at 95 C for 2 minutes to denature Place on ice until ready to load 5 Load each sample into a separate lane of the gel as follows Volume pL Volume pL Template 18 or 36 well 48 64 or 96 well PCR product 0 75 1 5 0 5 1 0 plasmid M13 BAC large 2 48 well 1 5 DNA 64 well 1 5 96 well 1 0 1 5 Note If a weak signal is obtained on the ABI PRISM 377 with XL Upgrade rerun the samples using a CCD gain of 4 Refer to the ABI PRISM 377 DNA Sequencer XL Upgrade User s Manual P N 904412 for more information Sample Electrophoresis 5 5 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel Requirements Electrophoresis Collect BigDye terminator data with Filter Set A on the ABI PRISM 373 sequencer with BigDye Filter Wheel Data Analysis Data analysis requires a Filter Set A instrument matrix file made from the ABI PRISM dRhodamine matrix standards P N 4305080 and BigDye terminator mobility file Resuspending and To resuspend and load the sam
27. Sweden Stockholm 46 0 8 619 4400 46 0 8 619 4401 Switzerland Rotkreuz 41 0 41 799 7777 41 0 41 790 0676 The Netherlands Nieuwerkerk a d IJssel 31 0 180 331400 31 0 180 331409 United Kingdom 44 0 1925 825650 44 0 1925 282502 Warrington Cheshire All other countries not listed 44 0 1925 282481 44 0 1925 282509 Warrington UK Japan Japan Hacchobori Chuo Ku Tokyo 81 3 5566 6230 81 3 5566 6507 Latin America Del A Obregon Mexico 305 670 4350 305 670 4349 Technical Support B 5 To Reach Technical Support Through the Internet B 6 Technical Support We strongly encourage you to visit our Web site for answers to frequently asked questions and for more information about our products You can also order technical documents or an index of available documents and have them faxed or e mailed to you through our site The Applied Biosystems Web site address is http www appliedbiosystems com techsupp To submit technical questions from North America or Europe Step Action 1 Access the Applied Biosystems Technical Support Web site 2 Under the Troubleshooting heading click Support Request Forms then select the relevant support region for the product area of interest 3 Enter the requested information and your question in the displayed form then click Ask Us RIGHT NOW blue button with yellow text 4 Enter the requir
28. To This Chapter mo poeni ean Rm RR RECORD eas ese ertet 5 1 Electrophoresis on the ABI PRISM 3700 DNA Analyzer 5 2 OVEEVIEW neue oi ee eae ec Pine Asie mm 5 2 Electrophoresis on the ABI PRISM 310 Genetic Analyzer 5 2 Requirements e tisha eS CES e Lupa ghe diu AME 5 2 Resuspending the Samples 0 0 00 e eee eee eee 5 3 Electrophoresis on the ABI PRISM 377 Sequencers 5 4 Requirement 2 ta ae eise eR he ge Ede 5 4 Using the Lane Guide Kit 0 0 00 0 ee eee eee eee 5 4 Using Long Read Gel and Buffer Formulations 5 4 Resuspending and Loading the Samples 5 5 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel 5 6 Requirements 2 525 ctetu ect ae Rep a 5 6 Resuspending and Loading the Samples 5 6 Control DNA Sequence Control Sequence isst ub a tas eb ern peni d e gu A 1 Partial Sequence of pGEM 3Zf 0 00 0 eee eee eee A 1 B Technical Support Technical Support 25 5 eats send vere eee Re ie B 1 Contacting Technical Support 0 0 0 0 0 0 cece eee eee eee B 1 To Contact Technical Support by E Mail B 1 Hours for Telephone Technical Support B 1 To Contact Technical Support by Telephone or Fax B 2 To Reach Technical Support Through the Internet B 6 To Obtain Documents on Demand 0000 B 7
29. a Rapid thermal ramp is 1 C sec To sequence DNA on the TC1 or DNA Thermal Cycler 480 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 pL 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 30 seconds Rapid thermal ramp to 50 C 50 C for 15 seconds Rapid thermal ramp to 60 C 60 C for 4 minutes Rapid thermal ramp to 4 C and hold until ready to purify Spin down the contents of the tubes in a microcentrifuge Performing Cycle Sequencing 3 3 To sequence DNA on the TC1 or DNA Thermal Cycler 480 Step Action 5 Proceed to Chapter 4 Purifying Extension Products a Rapid thermal ramp is 1 C sec 3 4 Performing Cycle Sequencing Sequencing BAC DNA Thermal Cyclers Sequencing BAC DNA on the 3700 Preparing Sequencing Reactions The following thermal cyclers can be used with this protocol GeneAmp PCR Systems 9600 or 9700 in 9600 emulation mode ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation This protocol needs to be reoptimized for use on other thermal cyclers IMPORTANT If you are sequencing BAC DNA on the ABI PRISM 3700 DNA Analyzer refer to the ABI PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for information about reaction set up and cycle sequencing The type of tube required depends on the thermal cycler that
30. an 24 hours will increase the precipitation of unincorporated dye terminators 5 Place the tubes in a microcentrifuge and mark their orientations Spin the tubes for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Purifying Extension Products 4 7 To precipitate in microcentrifuge tubes continued Step Action 6 Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 pL of 7596 isopropanol to the tubes and vortex them briefly Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 5 minutes at maximum speed Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute 4 8 Purifying Extension Products Ethanol Precipitation Unincorporated Terminators Precipitating in 384 Well Plates Precipitating in 96 Well Plates With ethanol preci
31. can contact Applied Biosystems for technical support by telephone or fax by e mail or through the Internet You can order Applied Biosystems user documents MSDSs certificates of analysis and other related documents 24 hours a day In addition you can download documents in PDF format from the Applied Biosystems Web site please see the section To Obtain Documents on Demand following the telephone information below Contact technical support by e mail for help in the following product areas Product Area E mail address Genetic Analysis DNA Sequencing galab Q appliedbiosystems com Sequence Detection Systems and PCR pcrlab appliedbiosystems com Protein Sequencing Peptide and DNA Synthesis corelab appliedbiosystems com Biochromatography PerSeptive DNA PNA and Peptide Synthesis systems CytoFluor FMAT Voyager and Mariner Mass Spectrometers tsupport appliedbiosystems com LC MS Applied Biosystems MDS Sciex apisupport sciex com or api3 support sciex com Chemiluminescence Tropix tropix appliedbiosystems com Technical Support B 1 Hours for Telephone Technical Support To Contact Technical Support by Telephone or Fax B 2 Technical Support In the United States and Canada technical support is available at the following times Product Hours Chemiluminescence 8 30 a m to 5 30 p m Eastern Time Framingham support 8 00 a m
32. cover of this protocol booklet any other country For chemicals not manufactured or distributed by Applied Biosystems call the chemical manufacturer WARNING CHEMICAL HAZARD Some of the chemicals used with Applied Biosystems instruments are potentially hazardous and can cause injury illness or death Read and understand the material safety data sheets MSDSs provided by the chemical s manufacturer before you store handle or work with any chemicals or hazardous materials Minimize contact with and inhalation of chemicals Wear appropriate personal protective equipment when handling chemicals e g safety glasses gloves or clothing Consult the listing in the MSDS Do not leave chemical containers open Use only with adequate ventilation Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended on the MSDS Comply with all local state provincial or national laws and regulations related to chemical storage handling and disposal Preparing the Templates Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Control DNA Templates 2 2 Template Preparation Methods 2 3 Single and Double Stranded Templates 2 3 BAC DNA Templates 2 3 PCR Templates 2 4 Use of the Primer Island Transposition Kit 2 5 Template and Primer Quantities 2 6 Prepar
33. d appropriate plates and tubes for each Applied Biosystems Part Thermal Cycler Plate or Tube Number GeneAmp PCR MicroAmp 384 Well Reaction Plate 4305505 System 9700 MicroAmp 96 Well Reaction Plate N801 0560 MicroAmp Reaction Tubes 0 2 yL N801 0533 GeneAmp PCR MicroAmp 96 Well Reaction Plate N801 0560 System 9600 MicroAmp Reaction Tubes 0 2 jL N801 0533 MicroAmp Caps 12 or 8 strip N801 0534 N801 0535 GeneAmp PCR MicroAmp Reaction Tubes 0 2 yL N801 0533 System 2400 MicroAmp Caps 12 or 8 strip N801 0534 N801 0535 DNA Thermal GeneAmp Thin Walled Reaction N801 0537 Cycler 4808 Tubes 0 5 mL GeneAmp Thin Walled Reaction N801 0737 Tubes with Flat Cap DNA Thermal GeneAmp Thin Walled Reaction N801 0537 Cycler TC1 Tubes 0 5 mL a These thermal cyclers require mineral oil that can be obtained from Applied Biosystems P N 0186 2302 1 14 Introduction Safety Documentation User Attention Words Ordering MSDSs Five user attention words appear in the text of all Applied Biosystems user documentation Each word implies a particular level of observation or action as follows Note This word is used to call attention to information IMPORTANT This word calls attention to information that is necessary for correct use of the kit or instrument CAUTION This word informs the user that damage to the instrument could occur if the user does not comply with the info
34. ed information in the next form if you have not already done so then click Ask Us RIGHT NOW You will receive an e mail reply to your question from one of our technical experts within 24 to 48 hours To Obtain Free 24 hour access to Applied Biosystems technical documents Documents on including MSDSs is available by fax or e mail or by download from our Demand Web site To order documents Then by index number a Access the Applied Biosystems Technical Support Web site at http Avww appliedbiosystems com techsupp b Click the Index link for the document type you want then find the document you want and record the index number c Use the index number when requesting documents following the procedures below by phone for fax delivery a From the U S or Canada call 1 800 487 6809 or from outside the U S and Canada call 1 858 712 0317 b Follow the voice instructions to order the documents you want Note There is a limit of five documents per request through the Internet for fax or e mail delivery a Access the Applied Biosystems Technical Support Web site at http Awww appliedbiosystems com techsupp b Under Resource Libraries click the type of document you want c Enter or select the requested information in the displayed form then click Search d In the displayed search results select a check box for the method of delivery for each document that matc
35. er to Thermal Cycling Tubes Required on page 1 14 To prepare the reaction mixtures Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 8 0 uL Template Single stranded DNA 50 100 ng Double stranded DNA 200 500 ng PCR product DNA See table in Template Quantity on page 2 6 Primer 3 2 pmol Deionized water q s Total Volume 20 uL Mix well and spin briefly 3 2 Performing Cycle Sequencing To prepare the reaction mixtures continued Step Action 3 If using the DNA Thermal Cycler TC1 or DNA Thermal Cycler 480 overlay reaction mixture with 40 pL of light mineral oil Cycle Sequencing To sequence DNA on the GeneAmp PCR System 9700 9600 or 2400 on the GeneAmp 9700 9600 or 2400 Cycle Sequencing on the TC1 or DNA Thermal Cycler 480 Step Action 1 Place the tubes in a thermal cycler and set the volume to 20 uL 2 Repeat the following for 25 cycles Rapid thermal ramp to 96 C 96 C for 10 seconds Rapid thermal ramp to 50 C 50 C for 5 seconds Rapid thermal ramp to 60 C 60 C for 4 minutes 3 Rapid thermal ramp to 4 C and hold until ready to purify 4 Spin down the contents of the tubes in a microcentrifuge 5 Proceed to Chapter 4 Purifying Extension Products
36. es for 20 minutes at maximum speed IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Carefully aspirate the supernatants with a separate pipette tip for each sample and discard Pellets may or may not be visible IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Add 250 pL of 70 ethanol to the tubes and vortex them briefly Purifying Extension Products 4 11 4 12 To precipitate in microcentrifuge tubes continued Step Action 8 Place the tubes in the microcentrifuge in the same orientation as in step 5 and spin for 10 minutes at maximum speed Aspirate the supernatants carefully as in step 6 Dry the samples in a vacuum centrifuge for 10 15 minutes or to dryness Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute Purifying Extension Products Ethanol Sodium Acetate Precipitation Procedure Not for 3700 DNA Analyzer Precipitating in 96 Well Plates IMPORTANT This procedure is not recommended for use on the ABI PRISM 3700 DNA Analyzer IMPORTANT Use non denatured 95 ethanol rather than absolute 100 ethanol Absolute ethanol absorbs wa
37. file for the wrong sequencing chemistry is used some bases will be miscalled This is because in the dRhodamine chemistry C is labeled with dTAMRA and T is labeled with dROX whereas in the BigDye terminator chemistry C is labeled with dROX BigDye and T is labeled with dTAMRA BigDye In addition there are differences in the mobility shifts of dRhodamine terminators and BigDye Terminators Instrument Data analysis requires a Filter Set E instrument matrix file Matrix File IMPORTANT Users of the ABI PRISM 3700 DNA Analyzer refer to the Required 4p Prism 3700 DNA Analyzer User s Manual P N 4306152 for information on instrument matrix files For the ABI PRISM 310 377 and 373 with BigDye Filter Wheel Instrument matrix files are the same for dRhodamine terminator chemistry and Big Dye terminator chemistries original and version 2 Instrument matrix files are made using the ABI PRISM dRhodamine matrix standards P N 403047 Refer to the Automated DNA Sequencing Chemistry Guide P N 4305080 www appliedbiosystems com techsupport for information on creating instrument files Introduction 1 9 Reagents and Storage Available Kits The following kits are available Number of Kit Reactions Part Number ABI PRISM BigDye Terminator Cycle 100 4303149 Sequencing Ready Reaction Kit 1000 4303150 5000 4303151 ABI PRISM BigDye Terminator Cycle 100 4314414 Sequencing Ready Reaction Kit v2 0 1000 4314
38. ginal and Version 2 0 includes a limited nontransferable non exclusive license without the right to resell repackage or sublicense under the process claims of one or more of U S Patents 5 800 996 5 863 727 and 5 945 526 and corresponding foreign patent claims and patent applications to use this product solely with an Applied Biosystems commercial automated DNA sequencing machine or other authorized automated DNA sequencing machines that have been authorized under these patents by Applied Biosystems No license is hereby granted for the use of this kit or the reagents therein in any other automated sequencing machine Such license is granted solely for research and other uses that are not unlawful No other license is granted expressly impliedly or by estoppel For information concerning the availability of additional licenses to practice the patented methodologies contact Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 U S A Patents are pending in countries outside the United States Notice to Purchaser About Limited License This kit reagent is sold pursuant to a limited sublicense from Amersham International plc under one or more U S Patent Nos 5 498 523 4 994 372 U S Patent Application Serial Nos 08 324437 08 337615 and corresponding foreign patents and patent applications The purchase of this kit reagent includes a limited non exclusive sublicense without the right to resell
39. hes your criteria then click Deliver Selected Documents Now or click the PDF icon for the document to download it immediately e Fill in the information form if you have not previously done so then click Deliver Selected Documents Now to submit your order Note There is a limit of five documents per request for fax delivery but no limit on the number of documents you can order for e mail delivery Technical Support B 7 ABI PRISM DNA Sequencing Kits and Related Products To order ABI PRISM DNA Sequencing Kits please contact Applied Biosystems see Appendix B Technical Support All reagents are quality controlled in stable formulations All the kits listed below include protocols Protocols can also be ordered separately dRhodamine Terminator Cycle Sequencing Kits with AmpliTaq9 DNA Polymerase FS P N Kit Reactions 403044 Ready Reaction 100 403045 Ready Reaction 1000 4303143 Ready Reaction 5000 43399214 Protocol BigDye Primer Cycle Sequencing Ready Reaction Kits with AmpliTaq DNA Polymerase FS BigDye Terminator Cycle Sequencing Ready Reaction Kits v2 0 with AmpliTaq DNA Polymerase FS P N Kit Reactions 4314414 Ready Reaction 100 4314415 Ready Reaction 1000 4314416 Ready Reaction 5000 4314849 Ready Reaction 25 000 4339923A Protocol ABI PRISM Lane Guide Lane
40. il tape Press the foil onto the tubes to prevent any leakage 4 Invert the tray a few times to mix Purifying Extension Products 4 9 To precipitate in 96 well MicroAmp plates continued Step Action 5 Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Place the tray in a tabletop centrifuge with tube tray adaptor and spin it at the maximum speed which must be 21400 x g but 3000 x g 1400 2000 x g 45 minutes 2000 3000 x g 30 minutes Note A MicroAmp tube in a MicroAmp Tray can withstand 3000 x g for 30 minutes IMPORTANT Proceed to the next step immediately If not possible then spin the tubes for 2 minutes more immediately before performing the next step Without disturbing the precipitates remove the adhesive tape and discard the supernatant by inverting the tray onto a paper towel folded to the size of the tray If you are performing this procedure for electrophoresis on the 3700 DNA Analyzer a Rinse the pellet by adding 150 pL of 70 ethanol to each well b Seal the plate with adhesive tape c Invert the plate a few times Place the inverted tray with the towel into the tabletop centrifuge and spin at 700 x g fo
41. ing the Templates 2 1 Control DNA Templates Using Control DNA Control DNA Sequence An Additional Control Include a control DNA template as one of the templates in a set of sequencing reactions The results from the control can help determine whether failed reactions are the result of poor template quality or sequencing reaction failure We recommend M13mp18 as a single stranded control and pGEM 3Zf as a double stranded control All Applied Biosystems DNA sequencing kits provide pGEM control DNA All dye terminator cycle sequencing kits include a 21 M13 control primer The partial sequence of pGEM 3Zf from the 21 M13 forward primer followed by the ensuing 1000 bases is shown in Appendix A Control DNA Sequence The BigDye Terminator Cycle Sequencing Standard P N 4304154 provides an additional control to help in troubleshooting electrophoresis runs This standard contains lyophilized sequencing reactions that require only resuspension and denaturation before use 2 2 Preparing the Templates Template Preparation Methods Single and Double Stranded Templates BAC DNA Templates Refer to the Automated DNA Sequencing Chemistry Guide P N 4305080 www appliedbiosystems com techsupport for information on preparing single and double stranded templates With larger DNA targets such as bacterial artificial chromosomes BACs the quality of DNA template is important to the success of the sequencing react
42. into the table top centrifuge and spin at 700 x g for 1 minute 10 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 6 Purifying Extension Products Precipitating in To precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube To remove reactions run on the TC1 or DNA Thermal Cycler 480 Place the pipette tip into the bottom of the reaction and carefully remove the reaction from the oil Oil Reaction IMPORTANT Transfer as little oil as possible 2 Add one of the following 80 pL of 75 isopropanol 20 pL of deionized water and 60 pL of 100 isopropanol The final isopropanol concentration should be 60 5 WARNING CHEMICAL HAZARD Isopropyl alcohol can be harmful if inhaled ingested or absorbed through the skin It can cause CNS depression and be irritating to the eyes skin and mucous membranes Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Close the tubes and vortex briefly Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer th
43. ion Two methods have given good sequencing results Alkaline lysis Cesium chloride CsCl banding Internet Addresses for BAC DNA Protocols For other BAC DNA preparation protocols refer to the following Internet addresses Centre National de S quengage CNS or G noscope http www cns fr externe arabidopsis protoBAC html University of Oklahoma Advanced Center for Genome Technology http www genome ou edu DblAcetateProcV3 html Washington Univ School of Medicine Genome Sequencing Center http genome wustl edu gsc Protocols BAC shtml Commercial Kits Commercial kits are also available for BAC DNA preparation QIAGEN tip 100 QIAGEN P N 10043 25 reactions 10045 100 reactions QIAGEN tip 500 QIAGEN P N 10063 25 reactions 10065 100 reactions 1 Marra M Weinstock L A and Mardis E R 1996 End sequence determination from large insert cloning using energy transfer fluorescent primers Genomic Methods 6 1118 1122 Preparing the Templates 2 3 PCR Templates Cycle sequencing provides the most reproducible results for sequencing PCR templates Although PCR fragments can be difficult to denature with traditional sequencing methods cycle sequencing provides several chances to denature and extend the template which ensures adequate signal in the sequencing reaction Importance of Purifying Product For optimum results purify the PCR product before sequencing In general any method that
44. lers can be used with this protocol This protocol needs to be reoptimized for use on other thermal cyclers GeneAmp PCR Systems 9600 or 9700 in 9600 emulation mode ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation IMPORTANT If you are sequencing bacterial genomic DNA on the ABI PRISM 3700 DNA Analyzer refer to the AB PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for information about reaction set up and cycle sequencing The type of tube required depends on the thermal cycler that you are using Refer to Thermal Cycling Tubes Required on page 1 14 To prepare the sequencing reactions for bacterial genomic DNA Step Action 1 For each reaction add the following reagents to a separate tube Reagent Quantity Terminator Ready Reaction Mix 16 uL DNA Template 2 3 ug Primer 6 13 pmol Deionized water q s Total Volume 40 uL a Shearing the DNA by passing it seven times through a 21 gauge 1 inch long needle can improve signals 2 Mix well and spin briefly Performing Cycle Sequencing 3 7 Cycle Sequencing To perform cycle sequencing Step Action 1 Place the tubes in a thermal cycler and set the volume to 40 uL 2 Heat the tubes at 95 C for 5 minutes 3 Repeat the following for 45 cycles Rapid thermal ramp to 95 C 95 C for 30 seconds Rapid thermal ramp to 5
45. nia Australia Scoresby Victoria 61 3 9730 8600 61 3 9730 8799 China Beijing 86 10 64106608 86 10 64106617 Hong Kong 852 2756 6928 852 2756 6968 Korea Seoul 82 2 593 6470 6471 82 2 593 6472 Malaysia Petaling Jaya 60 3 758 8268 60 3 754 9043 Singapore 65 896 2168 65 896 2147 Taiwan Taipei Hsien 886 2 2358 2838 886 2 2358 2839 Thailand Bangkok 66 2 719 6405 66 2 319 9788 Europe Austria Wien 43 0 1 867 35 750 43 0 1 867 35 75 11 Belgium 32 0 2 712 5555 32 0 2 712 5516 Czech Republic and Slovakia Praha 420 2 61 222 164 420 2 61 222 168 Denmark Naerum 45 45 58 60 00 45 45 58 60 01 Finland Espoo 358 0 9 251 24 250 358 0 9 251 24 243 France Paris 33 0 1 69 59 85 85 33 0 1 69 59 85 00 Germany Weiterstadt 49 0 6150 101 0 49 0 6150 101 101 Hungary Budapest 36 0 1 270 8398 36 0 1 270 8288 Italy Milano 39 0 39 83891 39 0 39 838 9492 Norway Oslo 47 23 12 06 05 47 23 12 05 75 Poland Lithuania Latvia 48 22 866 40 10 48 22 866 40 20 and Estonia Warszawa Portugal Lisboa 351 0 22 605 33 14 351 0 22 605 33 15 Russia Moskva 7 095 935 8888 7 095 564 8787 Region Telephone Dial Fax Dial South East Europe Zagreb Croatia 385 1 34 91 927 385 1 34 91 840 Spain Tres Cantos 34 0 91 806 1210 34 0 91 806 1206
46. of inserting themselves or copies of themselves into the genome Transposons encode the proteins that facilitate their insertion into the target DNA This property of transposons can be exploited to place unique primer binding sites randomly throughout any large segment of DNA These primer sites may be used subsequently as templates for PCR and or sequencing reactions Transposon insertion is an alternative to subcloning or primer walking when sequencing a large cloned DNA region 3 The Primer Island Transposition Kit provides reagents for generating artificial transposon insertions into target DNA in vitro The artificial transposon contains the PI and PI priming sites The Primer Island reagents are combined with a target DNA of choice and used to transform Escherichia coli To identify the E coli carrying the transposon the transformed bacteria are plated on Luria Bertani LB agar plates containing carbenicillin and trimethoprim antibiotics Each carbenicillin and trimethoprim resistant colony has integrated a copy of the transposon into the target DNA Follow the Primer Island Transposition Kit Protocol P N 402920 for transposon insertion and template preparation 2 Devine S E and Boeke J D 1994 Efficient integration of artificial transposons into plasmid targets in vitro a useful tool for DNA mapping sequencing and functional analysis Nucleic Acids Res 22 3765 3772 3 Devine S E Chissoe S L Eby
47. ol Sodium Acetate Precipitation 4 13 Purifying Extension Products 4 1 Choosing a Method of Purification Purpose Spin Column vs Precipitation Unincorporated dye terminators must be completely removed before the samples can be analyzed by electrophoresis Excess dye terminators in sequencing reactions obscure data in the early part of the sequence and can interfere with base calling Use the method that works best for your particular application Precipitation methods are cheaper and faster but they remove less of the unincorporated dye labeled terminators that can obscure data at the beginning of the sequence The plate column and spin column procedures remove more terminators but are more costly and take time to perform Plate and Spin Column Purification Overview Recommended 384 Well Plate Columns Recommended 96 Well Plate Columns This section describes the recommended plate and spin columns for purifying extension products For large scale procedures you can use the following commercially available 384 well reaction plate Arraylt Telechem P N DTC 384 100 384 System I Edge Biosystems P N 95674 Refer to the manufacturer s instructions for procedures For large scale procedures you can use the following commercially available 96 well purification plates 96 Well Spin Columns Gel Filtration Kit Edge Biosystems P N 94880 Arraylt Telechem P N DTC 96 100 Centri Sep 96
48. olymer Rapid DT POP6 BD Set Any Primer Sequencing Filter Set E Instrument Matrix File Data analysis requires Filter Set E instrument matrix file made from the ABI PRISM dRhodamine matrix standards P N 4305080 See the Automated DNA Sequencing Chemistry Guide P N 4305080 www appliedbiosystems com techsupport for more information 5 2 Sample Electrophoresis Resuspending the To resuspend the samples Samples Step Action 1 Resuspend each sample pellet in 12 25 pL of Template Suppression reagent TSR supplied with the polymer Vortex and spin the samples Heat the samples at 95 C for 2 minutes then chill on ice Vortex and spin the samples again Place on ice until ready to use c1 P OIN Refer to the ABI PRISM 310 Genetic Analyzer User s Manual P N 903565 for guidelines on loading the samples Note Although freezing is not recommended on a routine basis you can keep samples prepared in TSR frozen for several weeks before running on the ABI PRISM 310 Genetic Analyzer with no detectable loss in resolution or base calling Sample Electrophoresis 5 3 Electrophoresis on the ABI PRISM 377 Sequencers Requirements Electrophoresis and data analysis of samples require the following Filter Set E Run Modules Configuration Run Module 36 cm wtr 1200 scans hr any comb Seq Run 36E 1200 36 cm wtr 2400 scans hr any comb Seq Run 36E 2400 48 cm wtr 1200 scans h
49. oosing a Method of Purification 20 0 cee ee eee eee eee 4 2 PULPOSE ss von S aise act oet eae ae SEMEN THE RE Cale ee 4 2 Spin Column vs Precipitation 0 0 cee eee eee eee 4 2 Plate and Spin Column Purification 0 0 0 0 cece eee eee eee eee 4 2 Ku EET 4 2 Recommended 384 Well Plate Columns uses 4 2 Recommended 96 Well Plate Columns eeesess 4 2 Recommended Spin Columns lsleee eese eee 4 3 Optimizing Spin Column Purification 00 0 4 3 Performing Spin Column Purification 0004 4 4 Isopropanol Precipitation 0 0 eee e 4 5 Precipitating in 384 Well Plates lees eere 4 5 Precipitating in 96 Well Plates sese eese 4 5 Precipitating in Microcentrifuge Tubes 4 7 Ethanol Precipitation 0 0 0 2 eee eee ee eee 4 9 Unincorporated Terminators 00 0 eee eee eee 4 9 Precipitating in 384 Well Plates lesser 4 9 Precipitating in 96 Well Plates 0 0 00 000000005 4 9 Precipitating in Microcentrifuge Tubes 4 11 Ethanol Sodium Acetate Precipitation 000000005 4 13 Procedure Not for 3700 DNA Analyzer lesse 4 13 Precipitating in 96 Well Plates 4 13 Precipitating Microcentrifuge Tubes 004 4 15 Sample Electrophoresis Chapter Summaty etg ig heise Wis RUE AEN NUR dali 5 1
50. pitation traces of unincorporated terminators may be seen at the beginning of the sequence data up to base 40 but this is usually minimal Some loss in the recovery of the smallest fragments may also be observed IMPORTANT If you are precipitating in 384 well plates refer to the ABI PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 for the procedure IMPORTANT Where 95 ethanol is recommended in precipitation protocols purchase non denatured ethanol at this concentration rather than absolute 10096 ethanol Absolute ethanol absorbs water from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols To precipitate in 96 well MicroAmp plates Step Action 1 Remove the MicroAmp plate from the thermal cycler Remove the caps from each tube 2 Add the following 16 pL of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 3 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves 3 Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 439 adhesive backed aluminum fo
51. ples Loading the Samples Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio 5 parts deionized formamide to 1 part EDTA with blue dextran Deionized formamide 25 mM EDTA pH 8 0 with blue dextran 50 mg mL WARNING CHEMICAL HAZARD Formamide is a known teratogen i e it can cause birth defects Wash thoroughly after handling formamide Wear appropriate protective eyewear clothing and gloves Obtain a copy of the MSDS from the manufacturer 2 Resuspend each sample pellet in loading buffer as follows Volume pL 18 or 24 320r36 Template well well 48 well 64 well PCR product 3 4 3 4 4 4 plasmid M13 BAC large 3 3 2 2 DNA 3 Vortex and spin the samples 4 Heat the samples at 95 C for 2 minutes to denature Place on ice until ready to load 5 6 Sample Electrophoresis To resuspend and load the samples continued Step Action 5 Load each sample into a separate lane of the gel as follows Volume pL 18 or 24 320r 36 Template well well 48 well 64 well PCR product 3 4 3 4 2 4 2 4 plasmid M13 BAC large 3 3 2 2 DNA Sample Electrophoresis 5 7 Control DNA Sequence Control Sequence Partial Sequence The pGEM 3Zf sequence below is the the sequence of the 21 M13 of pGEM 3Zf forward primer followed by the ensuing 1000 bases TGT
52. r any comb Seq Run 48E 1200 a Any plate check and prerun modules can be used with the ABI Prism 377 DNA Sequencer Dye Set Primer Mobility File DT BD Set Any Primer The dye set primer file can be used with 5 and 5 5 Long Ranger gels and 4 and 4 25 polyacrylamide gels 19 1 acrylamide bis Filter Set E Instrument Matrix File Data analysis requires Filter Set E instrument matrix file made from the ABI PRISM dRhodamine matrix standards P N 4305080 See the Automated DNA Sequencing Chemistry Guide P N 4305080 www appliedbiosystems com techsupport for more information Using the Lane To resuspend and load samples using the ABI PRISM Lane Guide Lane Guide Kit ldentification Kit refer to the kit s protocol P N 4313804 Using Long Read For longer sequencing read lengths follow the gel and buffer Gel and Buffer formulations described in the user bulletin entitled Achieving Longer Formulations High Accuracy Reads on the 377 Sequencer P N 4315153 5 4 Sample Electrophoresis Resuspending and Note You can use any plate check and prerun modules Loading the Samples To resuspend and load the samples Step Action 1 Prepare a loading buffer by combining the following in a 5 1 ratio 5 parts deionized formamide to 1 part EDTA with blue dextran Deionized formamide 25mM EDTA pH 8 0 with blue dextran 50 mg mL WA
53. r 1 minute 10 Remove the tray and discard the paper towel Note Pellets may or may not be visible Vacuum drying of the samples is not necessary 4 10 Purifying Extension Products Precipitating in To precipitate in microcentrifuge tubes Microcentrifuge Tubes Step Action 1 Pipet the entire contents of each extension reaction into a 1 5 mL microcentrifuge tube Note Ifthe TC1 or DNA Thermal Cycler 480 was used for thermal cycling remove the reactions from the tubes as shown in step 1 on page 4 7 Add the following 16 uL of deionized water 64 uL of non denatured 95 ethanol The final ethanol concentration should be 60 x 3 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Close the tubes and vortex briefly Leave the tubes at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Place the tubes in a microcentrifuge and mark their orientations Spin the tub
54. r Purification Spin column Centri Sep 1 mL 32 columns 100 columns Ethanol EtOH non denatured 9596 Isopropanol 100 anhydrous 75 Isopropanol 9 9 9 Ethanol non denatured and 95 Sodium acetate NaOAc 3 M pH 4 6 See page 4 2 Applied Biosystems P N 401763 P N 401762 MLS MLS MLS MLS and Applied Biosystems P N 400320 Aluminum foil tape adhesive backed 3M Scotch Tape P N 439 a Contact 3M in the USA at 800 364 3577 for your local 3M representative Use of other tapes may result in leakage or contamination of the sample Materials for Electrophoresis ABI Prism 3700 DNA Analyzer Material Supplier Choose one of the following Deionized water MLS 2 Pyrrolidinone MLS Hi Di Formamide 25 mL bottle Applied Biosystems P N 4311320 Matrix Standard Set DS 01 dROX dTAMRA dR6G dR110 Applied Biosystems P N 4305609 ABI PRISM 310 Genetic Analyzer Formamide MLS EDTA MLS ABI PRISM dRhodamine Matrix Standards Kit Applied Biosystems P N 403047 ABI PRISM 377 or 373 with BigDye Filter Wheel Formamide MLS EDTA MLS 25 mM EDTA with 50 mg mL blue dextran Applied Biosystems P N 402055 ABI PRISM dRhodamine Matrix Standards Kit Applied Biosystems P N 403047 Introduction 1 13 Thermal Cycling The table below shows several thermal cyclers along with the Tubes Require
55. r until dry Do not over dry Alternatively place the tubes with the lids open in a heat block or thermal cycler at 90 C for 1 minute Purifying Extension Products 4 15 Sample Electrophoresis Chapter Summary In This Chapter The following topics are covered in this chapter Topic See Page Electrophoresis on the ABI PRISM 3700 DNA Analyzer 5 2 Electrophoresis on the ABI PRISM 310 Genetic Analyzer 5 2 Electrophoresis on the ABI PRISM 377 Sequencers 5 4 Electrophoresis on the ABI PRISM 373 with BigDye Filter Wheel 5 6 Sample Electrophoresis 5 1 Electrophoresis on the ABI PRISM 3700 DNA Analyzer Overview For information on how to perform sample electrophoresis on the ABI PRISM 3700 DNA Analyzer refer to the following manuals ABI PRISM 3700 DNA Analyzer Sequencing Chemistry Guide P N 4309125 ABI PRISM 3700 DNA Analyzer User s Manual P N 4306152 Electrophoresis on the ABI PRISM 310 Genetic Analyzer Requirements Electrophoresis and data analysis of samples requires the following Filter Set E Run Modules Configuration Run Module POP 6 polymer 1 mL syringe Seq POP6 1 mL E 61 cm 50 pm i d capillary POP 6 polymer Rapid Sequencing Seq POP6 1 mL Rapid E 1 mL syringe 47 cm 50 um i d capillary Dye Set Primer Mobility Files Instrument Dye Set Primer File ABI PRISM 310 POP 6 polymer DT POP6 BD Set Any Primer ABI PRISM 310 POP 6 p
56. rated into cycle sequencing products Introduction 1 3 The BigDye terminators are labeled with the following dRhodamine acceptor dyes Color of Raw Data on Color of Raw Data Acceptor ABI Prism 3700 or 310 on ABI PRISM 377 Terminator Dye Electropherograms or 373 Gel Image A dR6G Green Green C dROX Red Red G dR110 Blue Blue T dTAMRA Black Yellow Comparing Peak Data generated with dRhodamine dye terminators or BigDye Height Patterns terminators gives more even peak height patterns than data generated with rhodamine dye terminators In particular the weak G after A pattern characteristic of the rhodamine dye terminators is greatly reduced Figure 1 1 through Figure 1 4 on page 1 5 FI6RRTCGG UCRRCGUGCGGbG HG6R6GCGGTTTGBCGTRTT6GGCGUCTCT 300 310 320 330 340 E a pN Figure 1 1 Region of pGEM 3Zf sequenced with rhodamine dye terminators 1 4 Introduction GAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTC 300 310 320 330 34t Figure 1 2 Region of pGEM 3Zf sequenced with dRhodamine terminators TGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGC GOTCT 300 310 320 330 340 Figure 1 3 Region of pGEM 32Zf sequenced with BigDye terminators ATGAATCGGCCAACGCGCGGEGGAGAGGCGEGTTIGCGTATTGEGECBECTCT 300 310 320 330 340 IM o TN MM i Figure 1 4 Region of pGEM 3Zf sequenced with BigDye terminators v2 0 Introduction 1 5 Dye Spectra 1 6 Introd
57. removes dNTPs and primers should work We recommend Centricon 100 columns P N N930 2119 The protocol for using these columns is provided in Purifying PCR Fragments Purifying PCR Fragments To purify PCR fragments by ultrafiltration Step Action 1 Assemble the Centricon 100 column according to the manufacturer s recommendations Load 2 mL deionized water onto the column Add the entire sample to the column Spin the column at 3000 x g in a fixed angle centrifuge for 10 minutes Note The manufacturer recommends a maximum speed of 1000 x g but 3000 x g has worked well in Applied Biosystems laboratories If you are following the manufacturer s guidelines increase the time to compensate 5 Remove the waste receptacle and attach the collection vial Invert the column and spin it at 270 x g for 2 minutes to collect the sample This should yield approximately 40 60 uL of sample 7 Add deionized water to bring the purified PCR fragments to the original volume 2 4 Preparing the Templates Use of the Primer Island Transposition Kit Overview About Transposons Inserting Artificial Transposons Technique BigDye terminators are also suitable for sequencing plasmid templates generated using the Primer Island Transposition Kit P N 402984 This kit uses transposons to insert primer binding sites into cloned DNA Transposons are mobile genetic elements regions of DNA capable
58. rmation It also indicates a potentially hazardous situation that could result in minor or moderate injury to the user WARNING This word informs the user that serious physical injury or illness to the user or other persons could occur if these required precautions are not taken DANGER Indicates an imminently hazardous situation that if not avoided will result in death or serious injury You can order free additional copies of MSDSs for chemicals manufactured or distributed by Applied Biosystems using the contact information below To order MSDSs Then Over the Internet Use www appliedbiosystems com techsupport a Select MSDS Search button b Enter keywords or partial words or a part number or the MSDSs Documents on Demand index number c Select Search d Select the Adobe Acrobat symbol to view print or download the document or check the box of the desired document and delivery method fax or e mail By automated Use To Obtain Documents on Demand on page B 7 telephone service from any country By telephone in the Dial 1 800 327 3002 then press 1 United States Introduction 1 15 Chemical Hazard Warning 1 16 Introduction To order MSDSs Then bu ue from If you want ordering Then dial 1 800 668 6913 instructions in and English Press 1 then 2 then 1 again French Press 2 then 2 then 1 By telephone from See the back
59. stems 9700 or 9600 Applied Biosystems Thermal cycling tubes see page 1 14 Applied Biosystems ABI PRISM 310 Genetic Analyzer Thermal Cycler see page 1 7 Applied Biosystems Thermal cycling tubes see page 1 14 Applied Biosystems ABI PRISM 377 or 373 with BigDye Filter Wheel Thermal Cycler see 1 7 Applied Biosystems Thermal cycling tubes see page 1 14 Applied Biosystems Introduction 1 11 Materials for Purifying Extension Products 1 12 Introduction ABI Prism 3700 DNA Analyzer Material Supplier Choose one of the following 384 Well Plate Columns for Purification See page 4 2 96 Well Plate Columns for Purification See page 4 2 Ethanol EtOH non denatured 9596 MLS lIsopropanol 100 anhydrous MLS Aluminum foil tape adhesive backed 3M Scotch Tape P N 439 ABI PRISM 310 Genetic Analyzer Choose one of the following Spin column Centri Sep 1 mL 32 columns 100 columns Ethanol EtOH non denatured 9596 Isopropanol 100 anhydrous 75 Isopropanol 9 9 9 Ethanol non denatured and 95 Sodium acetate NaOAc 3 M pH 4 6 Applied Biosystems P N 401763 P N 401762 MLS MLS MLS MLS and Applied Biosystems P N 400320 Aluminum foil tape adhesive backed 3M Scotch Tape P N 439 a ABI PRISM 377 or 373 with BigDye Filter Wheel Choose one of the following 96 Well Plate Columns fo
60. t dideoxynucleotides This enzyme also has a second mutation in the amino terminal domain that virtually eliminates the 5 3 nuclease activity of AmpliTaq DNA Polymerase The enzyme has been formulated with a thermally stable inorganic pyrophosphatase to eliminate problems associated with pyrophosphorolysis Cycle sequencing protocols that rely on the use of AmpliTaq DNA Polymerase FS offer the following advantages over traditional sequencing methods Less hands on operation No alkaline denaturation step required for double stranded DNA Same protocol for both single and double stranded templates Less starting template needed 9 9 9 More reproducible results Applied Biosystems has developed a set of dye terminators labeled with novel high sensitivity dyes The dye structures contain a fluorescein donor dye e g 6 carboxyfluorescein 6 FAM linked to a dichlororhodamine dRhodamine acceptor dye The excitation maximum of each dye label is that of the fluorescein donor and the emission spectrum is that of the dRhodamine acceptor See Dye Spectra on page 1 6 The donor dye is optimized to absorb the excitation energy of the argon ion laser in the Applied Biosystems DNA sequencing instruments The linker affords extremely efficient energy transfer quantum efficiency nearly 1 0 i e 100 between the donor and acceptor dyes The BigDye terminators are 2 3 times brighter than the rhodamine dye terminators when incorpo
61. ter from the atmosphere gradually decreasing its concentration This can lead to inaccurate final concentrations of ethanol which can affect some protocols To precipitate in 96 well MicroAmp trays Step Action 1 Remove the MicroAmp Tray from the thermal cycler Remove the caps from each tube Add the following 2 0 uL of 3 M sodium acetate NaOAc pH 4 6 50 pL of 95 ethanol EtOH The final ethanol concentration should be 65 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Seal the tubes with strip caps or by applying a piece of 3M Scotch Tape 425 3 adhesive backed aluminum foil tape Press the foil onto the tubes to prevent any leakage Invert the tray a few times to mix Leave the tray at room temperature for 15 minutes to precipitate the extension products Note Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Purifying Extension Products 4 13 To precipitate in 96 well MicroAmp trays continued Step Action 6 Place
62. the reactions from the tubes as shown in step 1 on page 4 7 WARNING CHEMICAL HAZARD Ethanol is a flammable chemical and is irritating to the skin eyes respiratory system It can cause nerve and liver damage CNS depression nausea vomiting and headache Always work in a fume hood Obtain a copy of the MSDS from the manufacturer Wear appropriate protective eyewear clothing and gloves Pipet the entire contents of each extension reaction into a tube of sodium acetate ethanol mixture Mix thoroughly Vortex the tubes and leave at room temperature for 15 minutes to precipitate the extension products Precipitation times shorter than 15 minutes will result in the loss of very short extension products Precipitation times longer than 24 hours will increase the precipitation of unincorporated dye terminators Spin the tubes in a microcentrifuge for 20 min at maximum speed Carefully aspirate the supernatant with a pipette tip and discard IMPORTANT The supernatants must be removed completely as unincorporated dye terminators are dissolved in them The more residual supernatant left in the tubes the more unincorporated dye terminators will remain in the samples Rinse the pellet with 250 uL of 70 ethanol Vortex briefly Spin for 5 minutes in a microcentrifuge at maximum speed Again carefully aspirate the supernatant and discard Dry the pellet in a vacuum centrifuge for 10 15 minutes o
63. uction The normalized emission spectra of the dRhodamine dyes in the BigDye terminators are shown below dR110 dR6G dTAMRA dROX Fluorescence 500 550 600 650 700 Wavelength nm Instrument Platforms and Required Software Instrument The ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Platforms Kits are for use with the following instruments Thermal Cyclers ABI PRISM 3700 DNA Analyzer ABI PRISM 310 Genetic Analyzer ABI PRISM 377 DNA Sequencers ABI PRISM 377 ABI PRISM 377 18 ABI PRISM 377 with XL Upgrade ABI PRISM 377 with 96 Lane Upgrade ABI PRISM 373 DNA Sequencers with BigDye Filter Wheel ABI PRISM 373 ABI PRISM 378 with XL Upgrade These kits are designed for use with ABI PRISM 373 DNA Sequencers and ABI PRISM 373 DNA Sequencers with XL Upgrade on which the ABI PRISM BigDye Filter Wheel has been installed Refer to the ABI PRISM BigDye Filter Wheel User Bulletin P N 4304367 for more information This protocol has been optimized for all Applied Biosystems thermal cyclers including 9 9 9 GeneAmp PCR Systems 9700 9600 and 2400 ABI PRISM 877 Integrated Thermal Cycler CATALYST 800 Molecular Biology LabStation DNA Thermal Cycler 480 DNA Thermal Cycler TC1 If you use a thermal cycler not manufactured by Applied Biosystems you may need to optimize thermal cycling conditions Ramping time is very important If the thermal ramping time is too

ABI Big Dye

Contents

Download Pdf Manuals

Related Search

Related Contents