Cassis - Université Claude Bernard Lyon 1
Contents
1. The FASTA files of the chromosomes of G Go must be placed inside the directory defined by the parameter lt dirGR gt lt dirGO gt Additionally the name of the FASTA file must have the following pattern chromosomename fasta For example if the chromosome has for name 1 the file must be named 1 fasta 10 2 3 Script output The script cassis pl writes all output results inside the directory lt outputdir gt This section describes each one of the items which are output by it 2 3 1 File NonRefinedBreakpoints txt This TSV file contains the results of the breakpoint identification process Each row contains the information related to a breakpoint which was found in the genome G The following columns can be found in this file Name Definition id Breakpoint identifier type Breakpoint type inter or intra sRgeneA Name of the gene block A in the genome Gp sRgeneB Name of the gene block B in the genome Gp sRchr Chromosome of the genome G where the sequence 5 is located sRstrandA Strand of the gene block A in the genome Gy sRstrandB Strand of the gene block B in the genome G sRinf Start position of S in the chromosome sRchr sRsup End position of S in the chromosome sRchr sOgeneA Name of the gene block A in the genome Go sOgeneB Name of the gene block Bo in the genome Go sOchrA Chromosome of the genome Go where the sequence Soa is located sOchrB Chromosome2. cl Chromosome of the genome G where gl is located infl Start position of the gene gl in the chromosome cl supl End position of the gene gl in the chromosome cl strandl Strand where the gene gl can be found 1 or 1 g2 Name of the gene in the genome Go c2 Chromosome of the genome G where g2 is located inf2 Start position of the gene g2 in the chromosome c2 sup2 End position of the gene g2 in the chromosome c2 strand2 Strand where the gene g2 can be found 1 or 1 The file must have just one2one orthologous genes In the case of duplicated genes the execution of the script is aborted Additionally every chromosome which appears in the column cl c2 must have a FASTA file in the directory lt dirGR gt lt dirGO gt 2 2 2 Table of one2one orthologous blocks The table of one2one orthologous synteny blocks is a TSV file Tab Separated Values file which has information about the pairs of one2one orthologous synteny blocks that were identified in the genomes G and Go Each line of this file contains the definition of one pair of orthologous synteny blocks This file must have just rows with values no header row is allowed and each row must have the following columns Name Definition id Name of the pair of orthologous synteny block cl Chromosome of the genome G where the block is located infl Start position of the block in the chromosome cl supl End position of the block in the chromosome cl
3. 15 Chapter 3 Package organisation 3 1 How is Cassis organised Cassis contains one main script called cassis pl and a set of auxiliary Perl and R scripts which are divided in two groups core and pipeline scripts The objective of this organisation is to offer a code modularity to advanced users who want to extend the package or adopt parameters which are different from the ones that are offered by default in Cassis Every Cassis script when called without parameters prints a help message which lists and explains the list of parameters that it must receive for performing its work 3 2 Core scripts The core set is composed of scripts which were designed to perform atomic tasks process a list of genes align a pair of sequences execute the segmentation of a breakpoint etc The following sections give a brief description on each core scripts 3 2 1 core alignSequences pl This script performs a LASTZ alignment between two DNA sequences It receives two FASTA files and a list of LASTZ parameters runs LASTZ and saves the result in the file specified by the parameter lt outputfile gt 3 2 2 core dotplotBreakpoint pl This script generates a dot plot graph for a given breakpoint It receives the table of non refined breakpoints see Section 2 3 1 the identifier of the desired breakpoint the results of the alignments S against S 4 and S against Sop the FASTA file of S and outputs an image file containing the dot plot of the
4. cannot have duplicated genes or blocks 2 When Cassis receives a list of pairs of one2one orthologous genes it performs a step of elimination of overlapping genes and a step of identification of synteny blocks before executing the breakpoint identification step 3 When Cassis receives a list of pairs of one2one orthologous synteny blocks it directly executes the breakpoint identification step Overlapping blocks are handled during the definition of the coordinates of the sequences S Soa and Sop If one of these sequences has length smaller than an arbitrary limit 50 kbp the breakpoint candidate is discarded 4 We strongly recommend the use of chromosome sequences which are previously submit ted to a repeat masking process The time required to perform the LASTZ alignments decreases significantly and the segmentation results are more sensitive in these condi tions 2 2 Input file formats This section describes the format of the files which are received as input by the script cassis pl 2 2 1 Table of one2one orthologous genes The table of one2one orthologous genes is a TSV file Tab Separated Values file which has information about the pairs of one2one orthologous genes of G and Go This file must have just rows with values no header row is allowed and each row must have the definition of one pair of orthologous genes which is defined by the following columns Name Definition gl Name of the gene in the genome G
5. visit http www perl org On the other hand R is not distributed in the basic installation of most Linux or Mac systems If your system does not have R access http www r project org and follow the download and installation instructions To install the package the user must obtain the file cassis zip see Section 1 2 2 and decompress it under the desired directory gt cp cassis zip lt directory gt gt cd lt directory gt gt unzip cassis zip where lt directory gt is the path for the desired directory Example usr local Af ter decompressing the file cassis zip a directory named cassis can be found inside of lt directory gt that contains all package files To finish the installation the user must download the source code of the program LASTZ It can be obtained on the CCGB Miller Lab website http www bx psu edu miller_lab The user must download the latest lt version gt of the source code decompress and compile it and copy the generated executable file to the directory lt directory gt cassis lastz gt tar xvzf lastz lt version gt tar gz gt cd lastz distrib lt version gt gt make gt cp src lastz lt directory gt cassis lastz By doing these steps the installation of Cassis is concluded and the package is ready to use See Chapter 2 for instructions on how to use the script cassis pl IGhostscript is required by the R command bitmap which is used to create png images 1 3 Ghosts
6. 3 3 Directory alignments 12 2 3 4 Directory dotplot s o raor dia i oe Ee den Ha A 12 2 3 5 Directory segmentation 13 2 3 6 File segmentation txt 13 3 Package organisation 16 3 1 How is Cassis organised aa 16 32 COTE SCL Pts en sick ie E Seas Dope teh ee A Mes him 16 3 2 1 core alignSequences pl 16 3 2 2 core dotplotBreakpoint pl 16 3 2 3 core extractBreakpointRegions pl 16 3 2 4 core getMaskedIntervals pl 17 3 2 5 core identifyBreakpoints pl 17 3 2 6 core segmentation pl 17 3 2 7 core verifyFASTAdirectory pl 17 3 2 8 core R breakpoints R 17 32 9 cor R dotplotiRs d Me eee un ep ee ee ee a we 17 3 2 10 core R overlappingGenes R 17 3 3 3 4 3 2 11 core R segmentation R 18 3 2 12 core R synteny k2 one2one R 18 Pipeline Scripts aea d acier Paule tie A ve Ce nan th ER dor e Brie pe 18 3 3 1 pipeline alignBreakpointRegions pl 18 3 3 2 pipeline breakpointSegmentation pl 18 3 3 3 pipeline createBreakpointFastas pl 19 3 3 4 pipeline dotplotBreakpointRegions pl 19 Other SEULS cabida a ae Ale Geils woe ee we UR ea a te L
7. ne 20 oA score utilzpm 4 404 242 ik ve ee Ae ire te Se S 20 a 4 2 icone R int erval s R oo o a He 20 3 43 Core R UTILYR ise ee A tad A Die REESE Lane 20 3 4 4 util createOne20neTable pl 20 3 4 5 util maskSequence pl 20 Chapter 1 First steps 1 1 Introduction The package Cassis implements methods for the precise detection of genomic rearrangement breakpoints which were described in Lemaitre et al 1 2 This document contains information about how to obtain install and run the package It also provides a description of the package organisation The code was written in Perl and R and is distributed under the GNU GPL License For more information read the COPYING file which is distributed with the package or access http www gnu org copyleft gpl html 1 2 Installation 1 2 1 System Requirements Cassis was implemented in Perl and R and tested under the Linux and Mac OS environ ments It has the following requirements e Linux or Mac OS e Perl eR Ghostscript e LASTZ 1 2 2 Obtaining the package The package can be downloaded at the site of the P le Bioinformatique Lyonnais PBIL http pbil univ 1lyon1 fr software Cassis 1 2 3 Installing the package Before installing the package the user must check if his system contains the installations of Perl and R Nowadays Perl is distributed together with most Linux or Mac systems If you need more information
8. of the genome Go where the sequence Sop is located sOstrandA Strand of the gene block A in the genome Go sOstrandA Strand of the gene block Bo in the genome Go sOinfA Start position of Soa in the chromosome sOchrA sOAsupA End position of Soa in the chromosome sOchr A sOinfB Start position of Sog in the chromosome sOchrB sOsupB End position of Sop in the chromosome sOchrB bkpBegin Relative position of the start position of the breakpoint in the sequence S bkpEnd Relative position of the end position of the breakpoint in the sequence Sy status Breakpoint status Breakpoint type A breakpoint can be classified either as inter or as intra An inter breakpoint occurs when the sequences Soa and SoB which are orthologous to fragments on the sequence S are located in different chromosomes of the genome G interchromosomic On the other hand an intra breakpoint occurs when the sequences Soa and Sop are in the same chromosomes of the genome G intrachromosomic Breakpoint status The column status of the file NonRefinedBreakpoints txt can be filled with the following values Value Description 1 Valid breakpoint 2 The sequence S is smaller than the allowed limit 3 The sequence Soa is smaller than the allowed limit 4 The sequence Sog is smaller than the allowed limit 5 The sequences Soa and Sog are smaller than the allowed limit 6 The sequence S is bigger than the allowed l
9. segmentation pl and change the line in the beginning of the scripts my R_CMD R CMD BATCH no restore no save to my R_CMD R64 CMD BATCH no restore no save 20n Mac OS the Renviron file can be found at Library Frameworks R framework Versions Current Resources etc i386 Renviron for R 32 bits Library Frameworks R framework Versions Current Resources etc x86_64 Renviron for R 64 bits Chapter 2 How to use Cassis 2 1 The script cassis pl The package Cassis contains one main script called cassis pl This script coordinates the execution of the whole process of breakpoint identification and refinement This section describes how this script must be called by the user The script cassis pl has the following command line perl cassis pl options lt table gt lt type gt lt dirGR gt lt dirGO gt lt outputdir gt It has five mandatory parameters lt gt and a set of optional parameters 2 1 1 Mandatory parameters lt table gt Path for the file which contains the list of pairs of one2one orthologous genes or synteny blocks that can be found in the genomes G and Go For more information about the file format see Section 2 2 lt type gt This parameter must be set with one of these two possible values according to the type of input table e G Table of one2one orthologous genes e B Table of one2one orthologous synteny blocks lt dirGR gt Path for the directory which contains FASTA
10. specified breakpoint 3 2 3 core extractBreakpointRegions pl This script generates the FASTA files for the sequences Sp Soa and Sog It receives the table of non refined breakpoints see Section 2 3 1 the name of the chromosome that will be processed the FASTA file that has the chromosome sequence a flag that indicates the genome that owns the specified chromosome 1 for G and 2 for G and the path for the directory that will receive the new FASTA files 16 When the genome flag is set with the value 1 2 the chromosome and the related FASTA file must belong to Gr Go and the script will generate FASTA files of the sequences Sp Soa and Sop of the breakpoints which can be found in the specified chromosome 3 2 4 core getMaskedIntervals pl This script reads a FASTA file and outputs a file that has the list of masked intervals of the DNA sequence intervals which contain only N 3 2 5 core identifyBreakpoints pl This script performs the task of breakpoint detection by configuring an R script and calling R to execute it This script has many optional parameters and three mandatory parameters The script must receive a TSV file containing a list of pairs of orthologous genes or orthologous synteny blocks a flag that identifies the type of the input file G for genes and B for blocks and the name of the output file Note that the input TSV file must have the format described in Section 2 2 1 independently of the type of data gene
11. Cassis Detection of genomic rearrangement breakpoints User manual Christian Baudet and Claire Lemaitre Equipe BAMBOO INRIA Grenoble Rh ne Alpes Laboratoire de Biom trie et Biologie volutive UMR 5558 CNRS Universit Claude Bernard Lyon 1 F 69100 Villeurbanne France version 1 1 25 02 2013 Contents 1 First steps 3 LL troduction sus Lee de one MO dut MED A de A DR en n a eo ad Cr 3 12 Unstallation Actas ts dos Goes oe fans DE ee RL dans der 4 1 2 1 System Requirements 4 1 2 2 Obtaining the package 4 1 2 3 Installing the package 4 163 oGhostseript cts eae eS uate es ee ee Bed eye Pda a a de 5 141592 Or OA DItS at a a A M ce MAMA nus 5 2 How to use Cassis 6 2 Th script cassis pl us BOL ARR Le ala ln de 4 Gi ead ees 6 2 1 1 Mandatory parameters 6 2 1 2 Optional parameters 6 2 1 3 Important observations 8 2 2 Input file formats 2s dus shen ha Pa ee ee Dae ee Gob Boal eS 9 2 2 1 Table of one2one orthologous genes 9 2 2 2 Table of one2one orthologous blocks 9 22 0 PASTA HIS i o ee ke gcd ged SR A eg Se 9 2 3 SSeript Output Gy EL 8 ek ae A a oH ee te eae EE es A 11 2 3 1 File NonRefinedBreakpoints txt 11 2 32 Directory fasta a he sm As SS ue dope Ghat Gh M dus 12 2
12. c2 Chromosome of the genome G where the block is located inf2 Start position of the block in the chromosome c2 sup2 End position of the block in the chromosome c2 strand If this column is set with the value 1 the synteny blocks of the genomes G and Go are on the same strand Otherwise 1 the synteny blocks are on different strands The file must have just one2one orthologous synteny blocks In the case of duplicated genes the execution of the script is aborted Additionally every chromosome which appears in the column cl c2 must have a FASTA file into the directory lt dirGR gt lt dirGO gt 2 2 3 FASTA files Each chromosome of the genomes G and Go must have a FASTA file with just one DNA sequence This sequence must represent the complete sequence of the chromosome The first line of the FASTA file must have a header starting with the symbol gt and the remaining lines must contain the DNA sequence Example gt 17 dna_rm chromosome chromosome GRCh37 17 1 81195210 1 AAGCTTCTCACCCTGTTCCTGCATAGATAATTGCATGACAATTGCCTTGTCCCTGCTGAA TGTGNNNNNNNNNNNNNNNNNNNNNACCCACGACCAACTCCCTGGGCCTGGCACCAGGGA GCTTAACAAAC INNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNI NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNTCTGCCCAGTTCCTCTCCAGAAAGGCTGCATGGTTGACACACA GTGNNNNNNNNA INNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNI INNNNNNNNNNNNNNNNNNNNNAAAATTGTGACTTTCATGGCATA
13. cript To create png images dotplot and segmentation plot of the breakpoints Cassis uses the R command bitmap This command requires that the software gs Ghostscript is installed in your computer Additionaly R should be able to see this command Usually R searches for the software gs in the locations which are listed in the environment variable PATH Thus you can add the directory where the software gs is located to your PATH environment variable Alternatively you can configure R by updating its Renviron configuration file and add the following line R_GSCMD RGSCMD PATH_GS gs where PATH_GS is the directory where the software gs is located usr local bin for example To verify if R is properly configured open R in the console terminal of you Linux or Mac OS and type the following commands y sample 500 bitmap teste png type png16m height 8 width 7 res 100 plot 1 500 y t p col blue pch 20 dev off If the file teste png is created and contains a plot R is properly configured 1 4 32 or 64 bits By default Cassis uses the command R CMD BATCH Thus the architecture 32 or 64 bits is associated with the default installation of R in your system In Mac OS R is installed in 32 and 64 bits version By default Cassis uses the 32 bits version If you desire to use the 64 bits version you must edit the following files e core dotplotBreakpoint pl e core identifyBreakpoints pl e core
14. d have respectively the values 100000 50000 and 120000 it means that the sequence S starts at the position 100000 and that the breakpoint starts at the position 150000 and ends at the position 220000 of the chromosome sRchr 2 3 2 Directory fasta The directory fasta contains the FASTA files of the sequences Sp Soa and Sop for each valid breakpoint status 1 in the file NonRefinedBreakpoints txt Each file is named with the following name pattern Breakpoint ID S X fasta where ID is the number that identifies the breakpoint and X is one of the letters A B or R which are related respectively with the sequences S 4 Sog and Sr 2 3 3 Directory alignments The directory alignments contains the results of the alignments S against Soa and Sr against Sog for each valid breakpoint status 1 in the file NonRefinedBreakpoints txt Each file is named with the following name pattern Breakpoint ID S X lastz where ID is the number that identifies the breakpoint and X is one of the letters A or B which are related respectively with the alignments S against Soa and S against Sop 2 3 4 Directory dotplot After performing the alignments S against Soa and S against Sog the script generates for verification purposes dot plot graphs with the obtained hits These graphs are written inside of the directory dotplot and have the following name pattern 12 Breakpoint_ ID png where ID is the number that identi
15. erlappingGenes R The method of synteny blocks definition requires a list of non overlapping pairs of one2one orthologous genes This R file has functions that process the original table and output a new table that has no occurrences of overlapping gene 17 The method looks for the order and direction of the overlapping genes in each genome If the overlapping genes are in the same order and have the same direction in both genomes G and Go they can be merged to represent a single gene Otherwise they are discarded This script is used by the Perl script core identifyBreakpoints pl Section 3 2 5 3 2 11 core R segmentation R This R file contains functions that perform the segmentation of a breakpoint The functions calculate the new coordinates of the breakpoint do a statistical test to validate the results and plot a graphical representation of the segmentation curve This script is used by the Perl script core segmentation pl Section 3 2 6 3 2 12 core R synteny k2 one2one R Before identifying the breakpoints Cassis processes the list of pairs of one2one orthologous genes to identify synteny blocks This R file contains functions which perform this task This script is used by the Perl script core identifyBreakpoints pl Section 3 2 5 3 3 Pipeline scripts The pipeline scripts were developed to control the processing of various sets of information alignment of the sequences of all breakpoints segmentation of all breakpoint
16. fies the breakpoint Figure 2 2 shows an example of a dot plot graph 2 3 5 Directory segmentation The directory segmentation contains the result of the segmentation process for each valid breakpoint status 1 in the file NonRefinedBreakpoints txt For each breakpoint the segmentation process outputs a TSV file containing information on the refined breakpoint it has the same format as the file segmentation txt described in Section 2 3 6 If the segmentation could be calculated the breakpoint also has an image file with the graph representation of the segmentation These files have the following name pattern Breakpoint_ 1D txt TSV file and Breakpoint_ ID png image file where ID is the number that identifies the breakpoint Figure 2 3 shows an example of a segmentation graph 2 3 6 File segmentation txt The file segmentation txt contains the final results of the process of breakpoint identifi cation and refinement for all breakpoints It is a TSV file which has the coordinates of all breakpoints before and after the segmentation It has the following columns Name Definition id Breakpoint identifier chr Chromosome where the breakpoint is located on the genome Gr oldBegin Start position of the breakpoint in the sequence of the chromosome chr before the segmentation process oldEnd Start position of the breakpoint in the sequence of the chromosome chr before the segmentation process oldLength Length of t
17. files that have the complete DNA sequences of the chromosomes of the genome Gr See Section 2 2 for more information lt dirGO gt Path for the directory which contains FASTA files that have the complete DNA sequences of the chromosomes of the genome Go See Section 2 2 for more information lt outputdir gt Path for the directory where the script will write all results of the process of breakpoint identification and refinement See Section 2 3 for more information 2 1 2 Optional parameters lastzlevel N This optional parameter offers to the user the possibility of choosing between three different sets of configuration parameters for the alignments of the se quences Sy Soa and Sog There are three possible values for this parameter e N 1 Configuration for alignment of closely related species It is based on the parameters that were defined for the alignments between Homo sapiens and Macaca mulatta e N 2 Default configuration It is based on the parameters that were defined for the alignments between Homo sapiens and Mus musculus e N 3 Configuration for alignment of distantly related species It is based on the parameters that were defined for the alignments between Homo sapiens and Gallus gallus max length sr N It defines the maximum length for the sequence Sp The value of N must be an integer bigger than zero If the length of S is bigger than N the breakpoint receives status 6 see Section 2 3 1 and i
18. he breakpoint sequence before the segmentation process newBegin Start position of the breakpoint in the sequence of the chromosome chr after the segmentation process newEnd Start position of the breakpoint in the sequence of the chromosome chr after the segmentation process newLength Length of the breakpoint sequence after the segmentation process status Breakpoint status Refined breakpoint status The column status of the file segmentation txt can be filled with the following values Value Segmentation Description 1 YES Segmentation passed through the statistical test 0 YES Segmentation did not pass through the statistical test 1 NO Alignments S against Soa and S against Sog showed no hits 2 NO Sequence S is smaller than the allowed limit 3 NO Sequence Soa is smaller than the allowed limit 4 NO Sequence Sop is smaller than the allowed limit 5 NO Sequences Soa and Sog are smaller than the allowed limit 6 NO Sequence S is bigger than the allowed limit 7 NO R aborted out of memory 13 Breakpoint 17 SA SB SA and SB 6e 05 8e 05 1e 06 4e 05 2e 05 0e 00 De 00 2e 05 4e 05 6e 05 8e 05 SR Figure 2 2 Example of a dot plot graph The red green marks identify the hits of the alignment S against Soa Sog The vertical blue lines indicate the location of the start and end positions of the breakpoint region The light yellow regions re
19. imit 11 When the script processes pairs of orthologous synteny blocks it imposes a minimum length of 50 bkp for the length of the sequences S Soa and Sog The script verifies this limit after extending the sequences it adds 50 bkp on each side of the sequence This verification is performed to eliminate breakpoints whose flanking synteny blocks overlap too much When the script processes pairs of orthologous genes it only requires that the sequences Sr Soa and Sop are non empty The default configuration of the script determines a maximum length of 1 Gbp for the sequence Sp It is a value big enough to avoid discarding any breakpoint However if an advanced user wishes filtering big sequences he can edit the script and change this value to fit his needs Relative position in the sequence S While defining S for each breakpoint Cassis considers the extended version of this se quence If we are working with orthologous genes the extended sequence S includes the genes A and B which are at the boundaries of the breakpoint In the case of synteny blocks the extended version of S includes fragments with an arbitrary length of 50 kbp on each side of the breakpoint The columns bkpBegin and bkpEnd refer to the start and end positions of the breakpoint inside of the sequence S The values of these columns are defined in relation to the value of the column sRinf For example if the columns sRinf bkpBegin and bkpEn
20. ns a set of functions that perform operations with intervals and is used by other R scripts 3 4 3 core R util R This is a R script which contains a set of auxiliary functions that is used by other R scripts 3 4 4 util createOne20neTable pl This script receives data obtained from the Biomart Ensembl and creates a table of one2one orthologous genes 3 4 5 util maskSequence pl This script performs the repeat masking of a FASTA file by calling RepeatMasker with the appropriated parameters 3 20 Bibliography 1 C Lemaitre R arrangements chromosomiques dans les g nomes de mammif res caract risation des points de cassure PhD thesis Universit Claude Bernard Lyon 1 Novembre 2008 In French 2 C Lemaitre E Tannier C Gautier and M F Sagot Precise detection of rearrangement breakpoints in mammalian chromosomes BMC Bioinformatics 9 286 June 2008 15 pages 3 A F A Smit R Hubley and P Green Repeatmasker 2009 http www repeatmasker org 21
21. o the sequences Sp Soa and Sog see Figure 2 1 This parameter is valid only when the input table contains orthologous genes and its default value is T extend_ab_by_adding gene T F It determines if the breakpoint identification method must T or must not F add the first or last genes of the synteny blocks C and D to the sequences S 4 and Sog see Figure 2 1 This parameter is valid only when the input table contains orthologous genes and its default value is T extend by adding fragment N It determines the length of the fragments that must be added to the extremities of Soa and Sog in order to simulate the inclusion of the first last genes of the synteny blocks A Br Aj and Bo The value of N must be an integer bigger than or equal to zero This parameter is valid only when the input table contains orthologous synteny blocks and its default value is 50000 extend_ab_by_adding fragment N It determines the length of the fragments that must be added to the extremities of Soa and Sog in order to simulate the inclusion of the first last genes of the synteny blocks Co and Do The value of N must be an integer bigger than or equal to zero This parameter is valid only when the input table contains orthologous synteny blocks and its default value is 50000 2 1 3 Important observations Some important observations about the input parameters 1 The list of pairs of one2one orthologous genes or oneZone orthologous synteny blocks
22. present the masked regions of the sequence S and the horizontal pink turquoise line indicates the end of the sequence Soa Sop 14 Breakpoint 17 chr 1 Breakpoint 17 chr 1 left 0 21 right 0 183 left 0 986 right 0 982 begin 576717 end 589654 begin 122815 end 124277 Cumulated score 40000 60000 80000 100000 120000 Cumulated Score 40000 60000 80000 100000 120000 20000 20000 De 00 4e 05 8e 05 o 50000 100000 150000 Position on SR Position on SR Figure 2 3 Representation of the segmentation of a breakpoint The score of a position on sequence S is equal to i 1 if the position is covered by a hit from S against Soa alignment and no hit from S against Sog alignment ii 1 in the reverse situation and iii O if it is covered by no hit or by hits from both alignments The black curve represents the cumulated sum of the scores of all positions along the sequence S The red green bars on the bottom of the graph identify the hits of the alignment S against Soa SoB The vertical blue lines indicate the location of the start and end positions of the non refined breakpoint The vertical red green line represents the start end position of the refined breakpoint The graph which appears on the left side shows the segmentation curve over the sequence Sr The other graph exhibits the segmentation curve over the sequence S which is built by removing all positions on the sequence S that are covered by no hit
23. s etc They make use of the core scripts to execute their tasks 3 3 1 pipeline alignBreakpointRegions pl This script executes the alignments S against Soa and S against Sog for a set of breakpoints It receives a directory where it can find the FASTA files of the breakpoint sequences a directory where it will write the alignment results and the LASTZ parameters to perform the alignment The script expects that the FASTA files have names which respect the following name pattern Breakpoint ID S X fasta where ID is the number that identifies the breakpoint and X is one of the letters A B or R which are related respectively with the sequences SoA Sog and S If one of the sequences Sr Soa or Sop has a missing FASTA file the script ignores the corresponding breakpoint The alignment results are written inside of the specified directory and have the following name pattern Breakpoint_ ID _S X lastz where ID is the number that identifies the breakpoint and X is one of the letters A or B which are related respectively with the alignments S against Soa and S against Sop 3 3 2 pipeline breakpointSegmentation pl This script executes the segmentation of a set of breakpoints It receives a table of non refined breakpoints see Section 2 3 1 a directory where it can access the FASTA files of the sequences a directory where it can find the results of the alignments S against SoA and S against Sog and a directory to
24. s or blocks By setting the optional parameters the user can configure the process of breakpoint identification with values different from the default ones For example the user can decide if the sequences S Soa and Sog must be extended or not choose the maximum length of the sequences etc 3 2 6 core segmentation pl This script executes the segmentation of a single breakpoint by configuring an R script and calling R to execute it The script receives the table of non refined breakpoints see Section 2 3 1 the identifier of the desired breakpoint the results of the alignments S against Soa and S against Sop the FASTA file of the sequence S and the names of two output files one for the table of results and another for the image file 3 2 7 core verifyFASTAdirectory pl This script reads a given directory to identify all FASTA files and verifies if they are in the correct format just one sequence per file After reading the directory the script will produce a TSV file that maps for each file the length of the sequence which it contains 3 2 8 core R breakpoints R This R file contains functions which are developed to execute the step of breakpoint identi fication It is used by the Perl script core identifyBreakpoints pl Section 3 2 5 3 2 9 core R dotplot R This R file contains functions which build a dot plot for a given breakpoint It is used by the Perl script core dotplotBreakpoint pl Section 3 2 2 3 2 10 core R ov
25. s the breakpoint and X is one of the letters A B or R which are related respectively with the sequences SoA Sog and Sp 3 3 4 pipeline dotplotBreakpointRegions pl This script produces dot plot graphs for a set of breakpoints It receives a table of non refined breakpoints see Section 2 3 1 a directory where it can access the FASTA files of the sequences a directory where it can find the results of the alignments S against SoA and S against Sog and a directory to write the output results The script expects that the FASTA files of the sequences S have names which respect the following name pattern Breakpoint ID SR fasta and that the LASTZ alignment files have the following name pattern Breakpoint_ ID _S X lastz where ID is the number that identifies the breakpoint and X is one of the letters A or B which are related respectively with the alignments S against Soa and S against Sop The script generates for each breakpoint an image file which contains the dot plot graph The files are written on the specified output directory and have the following pattern Breakpoint_ ID png where ID is the number that identifies the breakpoint 19 3 4 Other stuffs The package Cassis also contains some auxiliary or utility scripts 3 4 1 core util pm This is a Perl module which contains a set of auxiliary functions that is used by other Perl scripts 3 4 2 core R intervals R This is a R script which contai
26. t is not processed by the segmentation step The default value for this parameter is 1000000000 max length sab N It defines the maximum length for the sequences Soa and Sog The value of N must be an integer bigger than zero If Soa or Sog has length bigger than N its length is reduced to N bp The default value for this parameter is 3000000 minimum length N It defines the minimum length for the sequences Sp Soa and Sop The value of N must be an integer bigger than zero If S Soa or Sop have lengths smaller than N the breakpoint receives status 2 3 4 or 5 see Section 2 3 1 and it is not processed by the segmentation step The default value for this parameter is 1 when the input table contains orthologous genes and 50000 when it contains orthologous synteny blocks extend before T F It determines if the breakpoint identification method must verify the minimum sequence length before F or after T applying the sequence extension adding genes or fragments to the sequences S Soa and Sog The default value for this parameter is T extended sequence Sr sequence Sr Ao A Co sequence SoA extended sequence SoA sequence SoB y Bo extended sequence SoB i Figure 2 1 Breakpoint schema extend by_adding gene T F It determines if the breakpoint identification method must T or must not F add the first or last genes of the synteny blocks Ar Br Ao and Bo t
27. write the output results 18 The script expects that the FASTA files of the sequences S have names which respect the following name pattern Breakpoint ID SR fasta and that the LASTZ alignment files have the following name pattern Breakpoint ID S X lastz where ID is the number that identifies the breakpoint and X is one of the letters A or B which are related respectively with the alignments S against Soa and S against Sop The script generates for each breakpoint a TSV file with the segmentation results see Section 2 3 6 and an image file which contains the graphical representation of the segmenta tion The files are written on the specified output directory and have the following pattern Breakpoint_ ID txt TSV file and Breakpoint_ ID png image file where ID is the number that identifies the breakpoint 3 3 3 pipeline createBreakpointFastas pl This script creates FASTA files for a set of breakpoints It receives a table of non re fined breakpoints see Section 2 3 1 two TSV files which were produced by the script core verifyFASTAdirectory pl see Section 3 2 7 containing information about the chro mosomes of the genomes G and G and the path for an output directory The script writes inside the output directory the FASTA files of the sequences Sp SoA and Sog for all valid breakpoints These files have the following name pattern Breakpoint ID SR fasta where ID is the number that identifie
Download Pdf Manuals
Related Search