Home

Summary of the product lines

image

Contents

1. 03 hydrometry page 5 08 balances pages 10 11 13 spectrophotometry page22 23 A 0l glass 02 porcelain amp agate pages 2 3 page 4 04 thermometers 05 educational 06 Iabware 07 liquid handling page 6 purposes page 8 page 9 page 09 stirrer amp shaker 10 ovensa fl centrifuges 12 molecular biology pagel2 heating mantles page 14 17 pages 18 21 page 13 AUXILAB SPECIAL dal ee E The centrifugation AUXILAB SPECIAL Polymerase chain reaction PCR Sey histology 15 microscopes 16 pH meter a con 11 refractometers page 24 26 page 27 28 ductimeters page 31 32 microtomes pages 29 30 AUXILAB SPECIAL Sample processing auxilablaboratory supplies Glass is a transparent and inorganic material relatively inert and high thermal resistant being ideal for making most common use lab tools in any scientific field Our catalogue offers a wide variety of glass tools make of soda glass or borosilicate glass in addition to a wide range of volumetric material Present boron oxide in its composition which confers excellent che mical and physical properties It presents and extreme chemical re sistance with sustances like water saline solutions acids bases and organic solvents being attacked by hydrofluoric acid at high tempe Approximate chemical composition of borosilicate glass ratures by strong bases and concentrated phosphoric acid It pre Formula Name Weight sents a very low expansion coefficient
2. E An additional window that can be open or closed assures al ways an optimum illumination of the sample M A lateral thermometer allows to control the temperature at which measurements are taken 1 Carefully clean and dry the lid and the prism before measurement Put 1 2 drops of the sample on the prism close the lid and check that the sample is homogeneously spread between the lid and 2 Avoid the formation of air bubbles since this could affect the obtained result By moving slightly the lid the sample can be spread out 3 Hold the refractometer towards the light to see the scale by looking through the eyepiece 4 Turn the eyepiece to perfectly focus the scale The measurement value can be distinguished in the line that separates the light and dark regions 5 Carefully clean and dry the lid and the prism after each measurement to avoid the presence of re mains that could affect the subsequent measurements metal body conver ion Densidad Grado Baume Grado Brix Alcohol probable i 1010 0 0 chart wo o for 1020 2 82 TE e 1030 4 20 5 00 Imeasuring units 2 gt rs 1050 6 87 ene This useful chart will allow to convert 1060 8 16 BO results into different units of measure 1070 9 43 be 1080 10 68 18 3 1090 11 91 Die 1100 el IRE 1110 14 28 26 3 1120 15 46 29 0 1130 16 60 31 6 1140 17 76 Sul 1150 18 81 37 0 1160 19 90 207 1170 20 96 42 3 1180 2205 45 0 1190 PE AOS 47 6 1200 2
3. power supplies transilluminator E 1 Casting of the most adequate gel agarose or polyacrylamide with the adequate Schematic number of wells where samples to be analysed will be loaded 2 Preparation and loading of samples in the gel together with a molecular weight procedure of marker that will serve as reference 3 Electrophoresis by connecting the cell containing the gel to a power supply that electrophoresis generates an electric field at constant voltage or current through which molecules will run technique 4 Analysis of results visualization and subsequent processing of the gel transfer to a membrane purification of molecules etc They allow the incubation of samples under conditions of total and precise control of temperature being very useful for DNA analysis extraction of lipids and other cellular components denaturalization of proteins previous to electrophoresis etc Main features E All thermoblocks are supplied without metallic blocks allowing each user to make up the equipment according to its own necessi ties Metallic blocks are easily interchangeable and very simple to clean and sterilize E Large digital display that shows simultaneously the different pa rameters of the experiment programmed and real time incubation temperature and shaking speed depending on the model E Over heating protection device ensures safety and reliability HE Temperature can be calibrated according to user n
4. Conductivity factor cF Usual conductivity values of different types of water Tyne of water Conductivity Pure water 0 055 uS cm Distilled water 0 5 uS cm Spring water 1 0uS em Drinkable water 50 500 uS cm Sea water 52000 uS cm pH PPM temperature monitor Refractometers are easy and comfortable to use instruments that based on the measurement of the refractive index nD are very useful in different fields food and beverage industry enology cosmetics paints and petroleum derivates industry etc thanks to the direct and fast information they supply about the concentration of different substances alcohol sugar salts proteins etc present commonly in trans parent or translucent solutions Are precise optical instruments light and easy to handle that can be used at any place without especial previous knowledge Our wide range of hand refractometers covers a lot of applications since they are available in different measuring scales alcohol salinity Brix or nD It is worth pointing out Zuzi universal hand refractometers that of fers a broad range of applications thanks to their large measuring range m Two models available depending on the scale nD or Brix E A simple mechanism allows selecting the range of the scale to the prism work with E Made of aluminium they present a high durability and endu rance E Eyepiece with diopter adjustment to adapt to the different vision of each user
5. WI ATA E _ _ E ofessional biological microscopes Up right microscopes with high quality optics and the best ergonomics to make work easier and minimize fatigue after long periods of observation Main features M Binocular and trinocular models available with Siedentopf type head rotary and inclined to adapt to the natural position of the head and avoid uncomfortable and tiring postures Provided with interpupillary distance adjustment and diopter correction mM Control knobs located at a lower position and easily accessible to keep always arms leant on the table and adopt a relaxed position mM Inverted nosepiece that facilitates placing the objectives and leave more space to handle and change the sample m Double layer mechanical stage of equipped with a clamp to hold up to 2 slides and with scales along both axes for an easier localization of structures of interest E Kohler illumination system with field and aperture diaphragms for an optimal light intensity adjus tment m High power halogen lamp with intensity adjustment to adapt to any kind of sample mM Lamp placed in an accessible compartment to easily replace the bulb Binocular and trinocular profesional microscope serie 122 Trinocular profesional microscope serie 158 Zuzi offers these high resolution eyepiece video cameras that will turn any traditional microscope into an image digital system and that are ideal for microscopic applications that require high qua lity imag
6. m Coarse and fine focusing knobs placed at a low position for a more comfortable operation The right knob is provided with a ten Sion ring and the left knob with a focusing upper limit locking lever to avoid the samples hit accidentally the objectives Polarizing microscope model 501 Industrial type microscopes that assure an excellent quality of the images obtained and present a wide range of applications in meta llurgy mineralogy and materials science for studying minerals PCBs films liquid crystals micro electronics etc Main features E Up right or inverted microscopes with reflected and or trans mitted light depending on the model E Very robust instruments that guarantee a good stability and the absence of vibrations that could disturb observation MH Highly ergonomic with knobs at a lower position and Sieden topf type head to provide the user a comfortable and tension free Polarizing microscope model 146 P position mM Trinocular tube compatible with Zuzi eyepiece video cameras allowing capturing and recording the images obtained thus increa sing the equipment applications and turning them into complete and versatile microscopes MW They can also be used to study the optical properties of sam ples since they are equipped with an analyzer and a polarizer that can be rotated until polarizer and analyzer are orthogonally positio ned Both analyzer and polarizer can be removed from the light path when they are
7. that in aqueous solutions ranges from O to 14 pH of pure water is 7 and this value is taken as neutral pH for aqueous solutions solutions with higher pH values are basic solutions and with lower pH values are acid solu tions tant potential generated by the reference electrode Finally the elec tric voltage generated by the electrode is turned into pH units by the voltmeter Nahita pH meters offer a broad range of applications since they are available in laboratory or portable models that can be combined with different electrodes Soil pH and moisture meter Universal pH paper _ auxilablaboratory supplies conductivity Conductivity is the capacity of a solution to conduct the electric cu rrent It is related to the presence of salts in solution that dissociate generating positive and negative ions capable of transmitting the electric energy if the liquid is submitted to a electric field Conduc CONDUCTIVITY Conductivity can also be expressed as total dissolved so lids TDS giving an idea of the quantity of dissolved mat ter in the solution and is commonly used in the analisys of water for human consumption treatment of sewage waters and the preparation and control of nutritious so lution in hydroponic cultures Units of TDS are 1 PPM parts per million mg L 2 DDt parts per trillion g L 3 EC electric current conductimeters Nahita conductivity meters are equipments used for determining th
8. AGES aboratory Table compact and light models with a weighing range up to 3 Kg and readability up to 0 0001 g Series 9021 E Compact and robust design ideal for educational purposes E Tare calibration and piece counting functions EH Auto off function after 5 min of no use E Power supply by external adapter or batteries Series 91091 and 9192 Bubble level and screwed legs for a perfect levelling assuring reliable measurements Weighing in grams pounds carats and ounces among others with readability of 0 1 g series 5151 or 0 01 g series 5152 Piece counting tare and calibration functions x Large backlight LCD for easy reading A Series 5152 supplied with windbreak protection Power supply by external adapter or batteries Balance serie 5151 Balance serie 5152 with a detachable windbreak protection Series 9032 5033 and 5034 E High quality precision and reliability in measurements thanks E RS232 output for connecting to a computer or printer to an electromagnetic sensor E Bubble level and screwed legs for a perfect levelling assuring E Weighing in grams with readability of 0 01 g series 5032 reliable measurements 0 001 g series 5033 or 0 0001 g series 5034 E Series 5033 and 5034 with glass case with sliding doors to en E Piece counting and tare functions sure total precision in readings E Substrative tare in whole weighing range E Possibility of performing below weighings for density determina E Automa
9. a Tena equipment for acidity determination We offer a wide variety of material made of borosilicate glass that presents interchangeable conic ground joints for required mounting assemblies to carrying out numerous chemical reactions Ground joints are designed by two numbers that refer to the main diameter e piy se he Whi INES E E il in litil N N AANA AN AN AU A 0 AN Y Graduated measuring cylinders and class A volumetric flasks Soxhlet extractor and length of the joint In our catalogue you can find goods like flasks condensers or most common sizes of bent pieces 14 23 19 26 29 32 or 45 40 in adition to complete distillation equip ment for simple or fractional distillation Soxhlet extractors and semi micro equipments for making lots of mounting aseemblies _ auxilablaboratory supplies Several routine applications in a laboratory require the use of instruments and tools made of inert materials with special characteristics as good thermal resistance or a high hardness in these applications it is not possible to use glass products so it is necessary to use items made of other materials such as porcelain or agate porcelain Made by firing a mixture of natural minerals china clay quartz and feldspar laboratory porcelain is an impervious silicate material with a low thermal expansion coefficient and therefore a high resistance to thermal shock Moreover thanks to great m
10. absorption spectrum that can be represen ted graphically with the absorbance values in the ordinate axis and the wavelength values in the abscissas axis Spectrophotometers are equipments mainly used for qualitative and quantitative analysis of samples within the visible and ultraviolet spectrum range These equipments measure the light absorbed and transmitted by a certain compound to obtain the concentration value of this compound in the analyzed solution since there is a lineal re lation between absorbance and concentration Design optical accuracy and high quality of materials turn Zuzi spec trophotometers into adequate instruments for routine applications assays and analyses in research laboratories General features of Zuzi spectrophotometers m Large easy to read LCD display 128x64 bits that shows the ZUZI S models 4201 20 and 4201 50 Working modes different results as well as the concentration curves and their equa tions and the kinetics and scan curves in real time m High quality silicon photometric diode detector and 1200 lines mm grating ensure the high accuracy and precision E Memory to save data and curves in the software equipment E Precise wavelength setting by using the keyboard except model 4201 20 with manual adjustment E Halogen and deuterium lamps can be turned on off indepen dently to extend their lifetime UV Vis models E Sample compartment with external manual exchanger that can hold up to 4 cell
11. be used with each model Mm They can be used Professional series also includes Multichannel pipettes that noticeably facilitate liquid handling when working with microtiter plates in immunology biochemistry clinical diagnostic and food analysis They are especially adequate for dilution series and cleaning steps The part containing the tips can be rotated 360 so that user can work at the most comfortable angle Autoclavable pipettes fixed and variable volume Multichannel pipettes EGO S ries Especially useful for educational purposes they are available in fixed and adjustable volume models and present a high ease of use and durability at a really economic price E Two button operation is comfortable and requires only one a hand They present a button for aspirating and dispensing the vo lume and another button for tip ejection avoiding the manipula tion of the tip with the hand and possible contaminations E Each model is colour coded to easily identify the pipette and to indicate the type of tip that must be used with each model ECO series pipettes variable volume _ auxilablaboratory supplies Nahita electronic balances are made of high quality materials sturdy and with a quick start and stabilization offering accurate and reliable readings With several functions tare calibration piece counting percentage etc depending on the model they offer the best solution for any kind of application j
12. curve equation C keA b Two methods E Coefficient the value of the coefficients k and b of the equa tion are directly input through the keyboard E Standard curve up to 9 standard samples can be used to set the curve equation 3 Kinetics for time course scanning or reaction rate calcula tions The total time of the analysis and the time interval between one measurement and the next one can be set With the aim of meeting International regulation and standardization rules such as Good Laboratory Practices GLP or ISO 9000 9004 correct ope ration of spectrophotometers must be checked at certain time intervals This way verification of the proper working of spectrophotometers is an es sential component to guarantee the quality of any protocol and ensure ac curacy of results Zuzi secondary calibration standards will allow checking the accuracy of spectrophotometers measurements respecting to the absorbance in the visible range and wavelength in the visible and ultraviolet range POIT ni F a S t a Ana od el 4255 50 lometers Working modes 1 Basic absorbance and transmittance measurements at a cer tain wavelength and basic quantitative mode 2 Quantitative determination of the concentration of different samples by using linear quadratic or cubic equation curves Possi bility of inputting the value of coefficients or up to 10 standard sam ples can be used to set the curve equation 3 Wavelength scan scan sp
13. not being used Metallurgical microscope model 403 inverted Metallurgical microscope model 146M biological Metallurgical microscope model 101 Conductivity meters and pH meters are essential equipments in water analysis laboratories and in food industry In this section of our ca talogue it is possible to find from a simple pH tester or TDS meter that offer in situ fast results to the most precise and accurate laboratory equipments as well as a complete range of conductivity cells and pH electrodes pH is a very important factor in the behaviour of certain chemical biological or geological systems Thus there are concrete pH values for chemical reactions to be carried out successfully for the prolife ration of microorganisms and also for the development of cultures Moreover the pH value of practically all the things we use in our life has been determined at any moment tap water cosmetics foods medicines or even paper Determination of pH values is thus essen tial in any kind of industry as well as in medicine and biology being one the most common practices in laboratories Determination of pH is mostly performed in aqueous solutions and extracts but also in solid samples fruits or even in the human body skin pH In any case it is important to take into account that for a correct determination it is necessary a minimum of humidity in the sample to be analysed Nahita products for pH determinations ranges from t
14. of liquids denser than water it is made by the application of the following formula d 145 145 Be 3 Quevenne scale scale between 15 and 40 that correspond to density thousandths over the unit the number 32 of the lactometer in dicates a density of 1032 Kg m 4 Cartier scale arbitrary scale in which O Cartier correspond to pure water and 44 Cartier correspond to absolute ethanol hydrometry _ auxilablaboratory supplies Nahita thermometers are good quality and accurate instruments for measuring temperature a very important parameter in several proces ses in industry and science The temperature of certain solutions must be accurately controlled for several industrial and research procedures to be carried out suc cessfully For this purpose Nahita is provided with a wide range of solid stem or enclosed scale thermometers with excellent features E Red spirit avoids mercury contamination problem if thermome ter breaks E Brown external graduation resistant to physical and chemical agents in solid stem thermometers Em Models with yellow colour that offers and optimum contrast with the coloured spirit column and graduation for easily reading the me asured temperature E Glass ring at one end to hang the thermometer for a higher com fort in certain situations E Each thermometer is supplied in a protective plastic case Room temperature must be strictly controlled in food stores laboratories green
15. of the technique has also permitted the use of samples of different nature such as RNA RT PCR the result of other PCR nested PCR a tis sue section or cells adhered on a slide in situ PCR DNA polymerase DNA polymerases are enzymes that can add free nucleotides to the 3 end of a nucleotide strand The most commonly used polymera ses in the PCR technique must have a special quality that is the en durance to high temperatures DNA denaturation is performed at 90 C That is why the development of the Taq polymerase isolated from the bacteria Thermophilus aquaticus whose habitat is the pro ximities of hot water springs with temperatures between 50 80 C Supposed a big progress in the technique The use of this enzyme allowed the automatization of the technique since it avoided the ne cessity of adding new polymerase after each cycle of denaturaliza tion Nowadays polymerases of different microorganisms are used as for example the Pfu polymerase isolated from the bacteria Pyrococ cus furiosus and even mixtures of several polymerases can be used The reaction mixture must also contain a reaction buffer that keeps the adequate pH for the action of polymerase and divalent cations that act as cofactors of the enzyme It is also necessary the presence of the 4 types of nucleotides since they are the essential substrate for the synthesis of new DNA Primers They are small synthetic molecules of about 20 nucleotides of length specifi
16. produced by the piston to dose small volume of liquid without contacting the tip of the pipette the liquid only comes in contact with the plastic disposable tip All automatic pipettes from our catalogue can be used with Digipette tips made of polypropylene and fully autoclavable sefil 1 Be careful not to exceed the upper and lower limits when adjusting the volume of the pipette since this produces the decalibration of the pipette and a lost of its accuracy and precision A TTR AS 2 The volume adjusting wheel always turns slightly and easily never force this wheel Available in fixed or adjustable volume models they are precise robust and totally ergonomic instruments E Made of high quality materials that assure a very good durability and resistance E Fully autoclavable ideal for laboratories of molecular biology cell cultures microbiology etc E Ergonomic and light to avoid fatigue after long periods of use lts special design allows operation with only one hand HE Two button operation one button for aspirating and dispensing the volume and another one for tip ejection Thus removing the tip with the hand is avoided preventing from possible contaminations E The volume adjustment knob presents a locking mechanism to assure a high precision only for adjustable volume pipettes mM Easy calibration following the instructions of the user s manual E Colour coded to easily identify the pipette and indicate the type of tip that must
17. risk To carry out diverses chemical reactions or basic lab operations is re quired a solid stable and long life support this way you can hold and assemble several instruments For this purpose Nahita offers a wide range of clamps two three and four prongs Mohr clamps Hoffman for burettes thermome ters etc supports tripods bossheads rods different sizes and mo dels of rings so we are abble to ensure that every customer will find what he needs Double and universal bosshead Tripod and retord stands Much of reagents used in laboratories are available as powder or granules so if it s necessary weight or decant them you should use a spatula Nahita offers a wide range of spatulas made of stainless steel and polypropylene with different sizes and models chattaway spatulas spoons double spoons groove spoons spoon flat spatu las spatulas with wooden handle etc Spatula and spoons and polipropylene spatula Brushes Glass labware requieres good and frecuently cleaning to avoid con rettes pipettes or bakers made of natural bristle so it s possible an taminations or mistakes in successive analysises Nahita offers a exhaustive and soft cleaning to avoid scratches wide range of brushes for washing tubes measuring cylinders bu _ auxilablaboratory supplies Daily lab work requires the constant use of automatic pipettes for dispensing small volumes of liquid Digipette pipettes use the air displa cement
18. technique the PCR product can be easily visualized by electrophoresis in agarose gels or can be hybridized with specific probes Southern blot making the appli cations of the technique really different and practically unlimited Among the most common applications the following can be poin ted out 1 Basic research nowadays it is impossible to think in a basic re search laboratory in which PCR is not used Among all its appli cations maybe the most known is the sequentiation of the genoma of different species including the human genoma 2 Medicine it allows a fast and reliable diagnostic of viral infec tions hepatitis B and C HIV human papillomavirus etc or he reditary diseases hemoglobinopathies haemophilia muscular dystrophy or cystic fibrosis 3 Forensic sciences or police investigations it allows determine the author of a crime through the analysis of corporal fluids or sam ples that contain DNA blood saliva hair nails etc the identi fications of bodies or the relationship between different people paternity tests 4 Paleonthology and archaeology it allows recovering the small quantities of DNA of the fossil remains to compare with alive or ganisms and thus establishing evolutive relations and philogenetic trees molecular bioloyy Specirophotomete Light is a radiant energy composed of Se onan radiations of different type ultraviolet visible infrared etc Each compound presents a characteristic
19. 4105 50 3 Are very accurate and precise instruments that allow analyzing liquid and also solid samples E Digital and analogical models available E Possibility to be joined to a circulation thermostat in order to obtain the thermostatization of samples MW Supplied with a test piece for verification and calibration of the equipment as well as with a tube of bromonaphtha lene for analizing solid samples E Illumination by incident or reflected light depending on the nature of sample E Automatic temperature compensation ATC depending on model mM Eyepiece with diopter adjustment garagens AUXILAB S L ES Laboratory supplies Pol gono Morea Norte Calle D N5 31191 Beriain navarra T 34 948 310 513
20. cal characteristics that turn it into a mineral specially suited for certain laboratory ap plications E High hardness 7 in Mohs scale which confers an extreme re sistance to abrasion avoiding sample contamination by particles de tached from the container E High density 2 6 g cm it means low porosity minimizing sample lost and reducing cross contamination between different Samples Hm High resistance to the action of chemical agents acids alkalis organic solvents etc except from the action of hydrofluoric acid and aqua regia That is why agate is mainly used for manufacturing mortars and jar and balls for ball mills aimed for preparing samples of high purity by mixing and grinding semi hard or hard substances MORTARS octagonal shaped and polished inside The pestle is also polished The measurement of liquid density is a widely used technique in pharmaceutics food and beverage industry enology petroleum derivated products etc The instruments used in these techniques are called hydrometers and provide fast results in a very easy way Made up of a ballast glass body and a graduated glass rod with a specific scale they are based on the Archimedes s principle it means they measure the volumetric mass of liquids depending on the floatability of a constant weight body immersed in that liquid For this pur pose they are introduced into the liquid whose density or mass needs to be measured once it is stable
21. cally designed to define the limits of the fragment of DNA that must be amplified Each primer is complementary to one of the DNA strands and serves as the starting point for the polyme rase to begin synthesizing new DNA Primers must be carefully de Signed to avoid the appearance of unspecific products PCR procedure The most common process of PCR consists of a sequence of 20 30 cycles after each one of which the new copies of DNA multiply ex ponentially Each cycle is divided into 3 steps at different tempera ture _ auxilablaboratory supplies 1 Denaturation it consists in separating the two strands of DNA by subjecting the sample to temperatures up to 95 C That way each single DNA strand is free to join the primers and the DNA polymerase PCR diagram 2 Annealing of primers each primer will join to its complementary sequence acting as limits of the DNA region to be amplified For Jo Denaturation this it is necessary to decrease temperature down to 50 60 C de pending on the composition of primers 3 Extension the DNA polymerase begins with the synthesis of new DNA adding nucleotides in 5 V3 direction and taking as starting Anneling point each one of the primers the newly synthesized strand will be gt complementary to the DNA template The optimum temperature for the extension phase depends on the polymerase used and is usually lo Extension 4 between 75 80 C The synthesis speed of DNA polymerase is about 1000
22. ding to OIML a series of classes of accuracy have been established each one of which pre with an unknown one The newest versions of sents a maximum permissible accuracy class error tolerance in mg mechanical balances use only one pan for the during manufacturing In our catalogue there are available weights of the unknown sample whose weight is measured by following accuracy classes E2 standard weights F1 and F2 high preci sliding weights along several calibrated sliding sion weights and M1 precision weights beams r Ti Y j j y E Useful economic and easy to use Compact and sturdy design with plastic lid that protects the sensor from hits and overloads and stainless steel weighing pan mM Touch screen operation backlight LCD for easy reading Weighing piece counting and tare functions One point calibration Auto shut off after 1 minute of no use to prolong battery life E a a E Low battery LO and overload O Ld indication Stirrers and shakers are essential equipments in sample dissolution homogenization and mixing processes commonly performed in labo ratories Very different types of stirrer can be found in our catalogue to perform several applications E Speed range from 100 to 2000 rpm E Analogic or digital regulation depending on the model E Available with and without heating models with heating present temperature adjustment in plate or in solution depending on the model E S
23. e conductivity and are available as laboratory or portable models as well as small hand TDS meters ideal for fast in situ determinations Basically all of them are composed of a conductivity cell a tempe rature probe and a measuring device and are based on the applica tion of an alternating current between 2 electrodes and the determination of the electric resistance that the solution to be ana lized puts up to that current The conductivity of a solution is thus determined by a molecular mo vement and since temperature influences this movement it is ne cessary to rake this parameter into account when accurate conductivity measurements are needed With this purpose conduc tivity meters are equipped with a temperature probe and also there are available conductivity cells with its own temperature sensor j 7 i d i l i j A j i y y AM J P a j e z Pi G P Portable pH meter Laboratory pH meter tivity is thus a measure of the total ionic concentration of a solution and the most commonly used units are Siemens cm S cm and its submultiples mS cm uS em Main units for conductivity measures and total dissolved solids and their values respecting 1 mS cm Name Siemens cm 1mS cm 10 S em 1 mS cm 10 uS em 640 ppm 640 x 10 ppt as TOKE Abbreviation S cm miliSiemens cm mS cm microSiemens cm uS cm Parts per million ppm Parts per trillion ppt Electric current EC
24. e study of restriction fragments detection and se miquantification of proteins in cellular extracts etc A complete series of products to carry out the common electrophoresis techniques can be also found in our catalogue horizontal electrophoresis in agarose gels Electrophoresis in agarose gels is a routine procedure used for se parating identifying and purifying fragments of nucleic acids DNA and RNA It is an easy and fast technique that permits the identi fication of fragments that can not be separated by other methods and the visualization of the different bands obtained by using a tran silluminator Nahita horizontal electrophoresis cells are supplied complete with all the necessary accessories for casting and running the gels E Electrophoresis cell made of a unique seamless high quality acrylic material piece to avoid leakage and breakage lt presents 4 antiskid legs and 2 replaceable electrodes made of pure platinum and resistant to corrosion and high temperatures The lid has slots for heat dispersion and two fixed power leads with banana connec tor to be plugged to a power supply E Moulds for gel casting each model is supplied with a mould for casting gels of different size The moulds present lateral grooves to fit and hold up to 2 combs in parallel in case of analyzing a large amount of samples at the same time E Gel trays with integrated rule and dark band to facilitate well vi sualization and thus make sample load
25. each application centrifugation techniques The combination of the different types of centrifuges with both kind of rotors allow carrying out several centrifugation techniques Differential centrifugation Is the most common technique of centrifugation and is mostly used for sedimentation of cells or large precipitates and for partial purifi cation of cellular fractions The separation of particles is based on their different sizes and or density If the sample is centrifuged in soft conditions the larger or denser particles will precipitate When the supernatant of the first centrifugation is centrifuged again in con ditions of longer time and higher RCF the most dense particles pre sent will precipitate Thus by applying increasing conditions of centrifugation different density and or size cellular fractions will be Centrifuges obtained Centrifugation in a density gradient This is a more complex method that allows not only the separation of several or even all components of a sample but also make analy tical determinations The sample is placed on a fluid support solution of sucrose cesium chloride ficoll percoll whose density increases from the upper to the lower part During centrifugation each component will move until reaching a position in which its density is the same as that of the surrounding liquid and then will stop moving That way when centrifugation finishes a series of bands is obtained in which the clo
26. ecessities EH Acoustic signal at the end of the selected operation program thermoshaker molecular biology _ auxilablaboratory supplies AUXILAB SPECIAL POLYMERASE CHAIN REACTION PGR The polymerase chain reaction or PCR is a widely used technique that allows ob taining million of copies of a certain fragment of DNA Since its development by Kary Mullis in 1983 this technique has become essential in Molecular Biology and in those diagnostic processes based on the study of DNA Kary Mullis was awarded the Nobel Prize of Chemistry thanks to the great importance acquired by the PCR technique whose applications seem infinite and keep on continuously growing Structure of DNA To understand the foundations of the PCR technique it is necessary to know some basic notions about the structure of DNA This struc ture was described by James Watson and Francis Crick in 1953 as a double helix composed of two long strands of nucleotides Each nucleotide is made up of a sugar called deoxyribose a phosphate group and a nitrogenous base Bases that are found in DNA struc ture are 4 adenine A guanine G cytosine C and thymine T All along each strand nucleotides are joint one to each other by means of the phosphate group making up a phosphate deoxyribose backbone that winds around the outside of the helix The phosphate end of each nucleotide is called 5 while the deoxyribose end is the 3 In the double helix the two st
27. echanical strength it is practically resistant to any chemical influence That is why this material is especially adequate for manufacturing crucibles evapo rating dishes combustion boats and all a series of products aimed to be used as recipients for incineration or heating substances at high temperatures E Termal resistance it is due to its composition in aluminium sili cates which confers a great stability at high temperatures Glazed porcelain withstands temperatures up to 1050 C without breakage or deformations Non glazed porcelain withstands temperatures up to 1350 C m Chemical resistance it is due to its silicate nature Porcelain is resistant against any kind of acid with the exception of hydrofluoric acid The resistance against hot and highly concentrated alkalis al though is lower than that against acids is excellent and better than that of glass PORCELAIN 1 Avoid crashes between porcelain pieces since they could produce cracks invisible to the eye but that would produce breakages when using at high temperatures 2 Store in dry places In case of humidity absorption by porous material dry the porcelain items for several hours at 110 C 3 Avoid high thermal shocks either when increasing and decreasing temperature During cooling avoid the entrance of cool air and let the temperature go down to 200 C to take the pieces out from the oven agate Agate is a variety of quartz with a series of physi
28. eed high medium or low and in terval 0 1 0 2 0 5 1 2 or 5 nm can be selected Scan is per formed from high to low wavelength to minimize degradation of UV sensitive samples Post run processing includes curve tracking and peak picking spectrophotometry 4 Kinetics time course scanning and reaction rate calculations with possibility of programming the delay time total time up to 12 h and interval time 0 5 1 2 5 10 30 or 60 s Post run pro cessing includes curve tracking and selection of the region of the curve required for rate calculations 9 DNA Proteins nucleic acid concentration and purity calcu lations Absorbance ratios 260 nm 280 nm or 260nm 230nm with optional substractive absorbance at 320 nm 6 Multi wavelength measurement of multiple wavelengths up to 10 different wavelengths to analyze and determine the com position of mixtures _ auxilablaboratory supplies Microtome is a very precise instrument used to slice paraffin included tissues The obtained sections have a micrometer thickness and this facts allows its observations under the microscope There are several types of microtomes hand microtomes balance rotary sliding cryostat ultramicrotome etc but the most used is the rotary microtome Some of its advantages are high precision and the possibility of producing very thin serial sections thanks to the des multiplication process that changes a rotation movement into an advance
29. es in the field of medicine biology geology research or education They can be used with any type of microscope or stereomicroscope that uses standard eyepieces of 23 mm and 30 mm respectively to obtain images and videos of any kind of sample They are equipped with a uni que wire for power supply data transfer and camera control Especially suited for observation of samples under polarized light being very useful in petrography mineralogy or chemistry of mate rials as well as in histology and pathological anatomy for the ob servation of several birefringent structures crystalline structures pigments lipids amiloids etc For this they are provided with a polarizing filter placed under the stage that transmits light in N S direction and an analyzing filter placed over the stage that only transmits light in E W direction Main features E Polarizer graduated and rotary 360 placed under the conden ser and analyzer placed between the intermediate tube and the head with a rotation angle of 90 and Vernier graduation E Equipped with Bertrand lens for conoscopic observations and a spot to insert compensatory plates between the eyepieces and ob jectives Provided with mica 1 4 and gypsum 1 plates and quartz wedge m Rotary round stage with 160 mm diameter and graduation from O to 360 with Vernier for accurate determinations of the ro tation angle With fixing device to fix the stage at the desired posi tion
30. formed at the same support minimizing gel manipulation and speeding up and ma king work easier Exclusive design of the gel casting device with a silicone base for a perfect sealing that avoids acrylamide leaks that constitute a toxic molecular biology cell for vertical electrophoresis risk for the user M Glass plates and notched glass plates with 1 mm or 1 5 mm thick fixed spacers for casting and running gels E Set of combs of 10 or 15 wells for 1 mm or 1 5 mm thick gels E Thicker glass plate for single gel electrophoresis Vertical electrophoresis is usually followed by electro blotting that consists in transferring macromolecules proteins or nucleic acids from the gel in which they are embedded to a membrane normally nitrocellulose membrane followed by detection methods for speci fic molecules Nahita transfer module is mainly used for transferring proteins from a polyacrylamide gel when carrying out the Western Blot WB technique and has the following features E Compatible with the external tank of vertical electrophoresis cell E Support with corrosion and high temperature resistant platinum electrodes 2 polycarbonate cassettes with pore plates that allow the si multaneous transfer of two gels and 4 fibre pads needed for the pro cess Cassettes and support are colour coded to ensure a proper orientation of the gel during transfer _ auxilablaboratory supplies power supplies LED white light board
31. h speed centrifuges max speed 2000 rpm especially designed for microhematocrit determination in blood samples E With fixed angle rotor for 24 capillary tubes of standard size 75 mm long E Analogical model 2900 and digital model 2924 models available E Robust design that assures the stability of the equipment while a safety switch prevents operation if the lid is open mM With transparent lid that allows observation of the rotor as it spins to alert of problems such as possible breakage of capillaries Analogic microhaematocrit centrifuge Digital microhaematocrit centrifuge A S am oT TL OT lan SA a PANTFITNNINAS DAD A nal E i o E E EA A GS Ed E i i EH Small foot print compact and actual design ideal for bench top uses E Fixed angle rotor with capacity for up to 24 Eppendorf like tubes depending on the model E Digital adjustment of speed and time of operation E Centrifugation speed can be set up to 16000 rpm depending on the model E Possibility of working during programmed periods of tima or in continuous mode Centrifuge for eppendorf tubes model Centrifuge for eppendorf tubes model Centrifuge for eppendorf tubes Minivite 2507 10 2624 _ auxilablaboratory supplies AS high speed centrifuges Multiple rotor high speed centrifuges Especially indicated for performing protocols that require low temperature centrifugations such as extraction and purifi cation of nucleic acids blood sample proces
32. he most basic pH paper to digital laboratory or portable pH meters for accurate determinations AJA EEE Tide pp o Y e E When a more accurate determination of pH value is required it is necessary to use a pH meter This equipment is basically composed of a combined electrode connected to a voltmeter The combined electrode is made up of two sensitive and reference electrodes the sensitive electrode provides an electric potential that depends di rectly on the pH of the solution and that is compared with the cons Portable pH meter H paper pn p p as phenolphthaleine methyl orange or neutral red are chemical compounds that acquire a certain colour depending on the pH pH paper is impregnated with a mixture of indicators and thus when comes into contact with the solution to be analyzed adopts a certain colour that compared with a colour scale supplied gives an approximate value of the pH of the solution The use of pH paper is thus a fast very simple and useful method in those applications where a high precision is not required Laboratory pH meter What is exactly ph pH makes reference to the number of hydrogen ions or protons H present in a solution However the concen tration of this ions in mol L H is too small and difficult to compare for most of solutions so it is expressed as a lo garithmic function called pH value E pH log H Thus pH has no units and is expressed only by a number
33. houses frid ges or even at home We also present a wide range of thermometers to control inside and out side temperature maximum and minimum temperature and even relative humidity ear ther mome ther Find also the most easy to use and accurate clinical thermo meters to measure corporal temperature From a single unbre akable and re usable liquid crystal Fever Scan to the most accurate instruments based on an infrared sensor that give re liable and precise results in a matter of seconds infrared thermome ther More than 250 different microscope slides of plant and animal tissues can be found in our catalogue ready for observation with light mi croscope All prepared slides are standard size 26x76 mm and are properly labelled for their identification Microscope slides are available separately or in didactic high quality sets allowing that will allow to encourage the analysis and observa tion capacity of students for diagnosis of microscopic images Each set is supplied in a plastic box to ensure the protection and durability of slides 1 Animal histology 24 slides of blood epithelial tissue connec tive tissue bone cartilage muscle and nerve tissue 2 Plant histology 24 slides of meristem parenchyma cho lenchyma sclerenchyma xylem phloem and protective tissues 3 Animal organography 25 slides of mammal skin digestive uri nary respiratory and reproductive apparatus lymphoid circ
34. ing easier E Set of double combs of different thickness and number of teeth To visualize the results of the electrophoresis it is also available the Nahita transilluminator E Equipped with 8 fluorescent tubes of 312 nm UV B and white light E Large UV filter E With observation chamber that act as a dark chamber to protect the user from the exposition to the hazardous UV radiation eliminate interferences and increase contrast cell for horizontal electrophoresis vertical electrophoresis in polyacrylamide gels PAGE and Western Blot Vertical electrophoresis is a technique that uses polyacrylamide gels PAGE for the separation of different molecules depending on their molecular weight and electrical charge Therefore it is a very useful technique in research laboratories for protein and nucleic acid analy sis since it allows separating and identifying the different compo nents of a cellular extract and combined with other techniques allows for example detecting molecular anomalies or analyzing chan ges in protein synthesis as a consequence of a certain treatment Nahita vertical electrophoresis cell presents two corrosion resistant platinum electrodes and is supplied with all the necessary elements to carry out casting and electrophoresis of 82x82 mm gels E External cell or tank made of a unique seamless high quality acrylic material piece to avoid leakage and breakage E Gel support gel casting and electrophoresis are per
35. ive agents as it might damage the surface In the procedure of immersion bath laboratory glass are submerged into a washing up liquid solution at room temperature for 20 or 30 minutes after this rinse with water and finally with distillated water It is recommended not exceed action time or increase temperature except in case of persistent impurity that is the reason it should be avoided long time of exhibition at higher temperatures than 70 C in alkaline element because this can destroy the graduations Volumetric glass referes to a serial of glass containers measured at a temperature of 20 C to contain very precise liquid volumens There are two tipes of calibration for volumetric glass it depends on the glass instrument Calibration to contain In contained quiantity of liquid corresponds exactly to the capacity indicated on the instrument e g volumetric flasks cylinders Calibration to deliver Ex delivered quiantity of liquid corresponds exactly to the capacity indicated on the instrument e g pipettes and burettes We offer different volumetric material like graduated flaks cylinders pipettes or burettes class A or B depending on their tolerance range or maximum error limit E Class A volume tolerances are within the limits defined by ISO and DIN m Class B volume tolerances are within twice the limits of class A defined by ISO and DIN Fractional distillation equipment and Garc
36. movement MbPbotome Hand microtome with glass stage and inner clip to fasten the inclusion it has a micrometric screw in the base that if you rotates it then inclusion that is in the inner cylinder goes up Moving the knife over the glass stage you can cut what stands out and you can make sections of approxi mately 20 microns ld Simple advance microtome These are very precise equipment designed to make thin and re producible cuts of paraffin included samples They have a sam ple holder with a precise orientation system to ensure accurate orientation of the samples surface regarding to the knife The knife of 12 cm is fixed and its angle can be modified the Sample advance can be adjustment to obtain thickness variables cuts with a minimum value of one micron histology Nahita micotomes is designed with the most advanced techno logy to slice paraffin included plant or animal tissues in histology routine applications in hospitals and research laboratories These microtomes have internal mechanical structure which provides great stability and assure reproducible and uniform cuts the knife s backward movement is quick and easy Allow 16 cm kni fes included and disposable blade holder showing the knife s in clination angle Head knife holder with easy orientation system with great cut area allows quick heads for cassettes Biology is a science plenty of images however most of the structures and interesting biol
37. n process with different reagents formaldehyde parafor maldehyde Bouin s solution etc that allows a good preservation of morphology and structural characteristics of the different tissues The process of chemical fixation can be done by immersion in which the sample is submerged into the fixating liquid or by perfusion that uses the bloodstream to make the fixating solution reach all the or gans paraffin embedding To observe tissues with light microscope it is necessary to obtain very thin sections so as light beam can pass through allowing a good visualization of the different structures of that tissue The fixa tion process hardens slightly the tissue but it is not enough to slice it so next step in sample processing is paraffin embedding Paraffin is an hydrophobic wax however tissues contain large amounts of water so to let the paraffin go straight up to the last cell of the tissue this needs to be dehydrated Dehydration process con sists in making samples conveniently identified inside the embed ding cassettes pass through increasing degree alcohols 70 80 90 96 100 and finally to a liquid that is miscible with pa raffin e g xylene benzene or toluene The last step is performed in a bath of liquid paraffin heated over its melting point so as it can enter inside the sample paraffin embbeding At his moment each water molecule in the tissue has been remo ved and replaced with paraffin Ho
38. nucleotides min at optimum temperature o gt The equipments used to carry out the PCR technique are called ther mal cyclers and allow programming the number of cycles as well as time and temperature of each step Nahita thermal cyclers are pro vided with Peltier technology that allows heating and cooling the re 4 action tubes by simply changing the electric current They are also e equipped with a thermostatized lid to avoid water condensation in the lid of the reaction tubes that would result in a concentration of the reagents modifying the optimum conditions to perform the re action A very important point to be taken into account is that the duration and temperature of each one of the steps depend on several factors such as size of the region to be amplified composition of primers or type of polymerase used It is thus necessary to make several tests to establish the best conditions for the reaction and this optimization process is frequently a really laborious work Thermal cyclers with gradient were developed with the aim of faci litating this process In this equipments each column of reaction tubes can be programmed at a different temperature so several con ditions can be studied in a single test thus speeding up the optimi zation of the technique Exponential amplification of product thelial cyclers y DO O cm gt r gt Jo O gt applications art from being a fast and easy
39. ogical events are out of the resolution power of the human eye That is why the study of several aspects of this science requires the use of the microscope an instrument that magnifies the image so as it can be easily observed by the human eye The microscope is definitely an indispensable tool in several fields of science his tology zoology botanic mineralogy microbiology genetics etc It is important to take into account that the different samples must be especifically processed to be observed Ander the microscope This processing can be very simple such as the preparation of mi nerals or insects or very laborious like the processing that must be carry out with animal and plant tissues There are three mainly used tissue processing systems E Freezing in liquid N and sectioning with cryostat the main ad vantage of this technique Is that sections are obtained immediately and the antigenicity of the tissues is preserved however morpho logy is lost and sections are quite thick 10 30 um and very diffi cult to handle It is used when fast results are needed as for example in the diagnosis of biopsies E Paraffin embedding and sectioning with microtome this is the most widely used technique for the observation of tissues with light microscope The structure and antigenicity of tissues Is well preser ved and the obtained sections are around 5 10 um thick mM Resin embedding and sectioning with ultramicrotome it Is mostly used for
40. ontrol for the isolation and purification of several ma cromolecules proteins DNA RNA cells or cell fractions etc e centrifugation types of centrifuges The RCF xg is specific for each centrifuge at a certain speed of ro tation so it is necessary to know the RCF value to be applied to samples and chose the most adequate type of centrifuge for each ap plication Depending on the acceleration forces it means the RCF applied to samples centrifuges are classified into E Centrifuges from low g up to approximately 3000 xg They are very useful for pelleting big particles such as cells blood analysis removing bacteria from culture solutions etc or precipitates of in soluble salts E High speed centrifuges range from 2000 xg to 20000 xg Use ful for separating cellular fractions E Ultracentrifuges range from 15000 xg to 600000 xg For analy tical determinations obtention of data about sedimentation proper ties and isolation of particles with low sedimentation coefficients microsomas virases macromolecules The maximum radius distance between the rotating axis and the bottom of the tube is also a determining factor in the calculation of RCF and Is specific for each rotor rotating device in which samples are placed There are different types of rotors E Fixed angle rotor tubes are placed in holes inside solid rotors that way when the rotor spins tubes stay always at the same angle respecting to the
41. ost frequent temperature of use that allows a more precise temperature control inside the equipment E Furnace painted steel external surface resistant to corrosive en vironments and easy to clean stainless steel inner chamber E Especially designed to allow visualization of samples ovens pre sent a door with a glass window and incubators are provided with an inner glass door that avoids variation of the temperature in the inner chamber E All models are supplied with two shelves that can be placed at different heights Trays and guides are available separately to make up the equipment according to user necessities E Timer and acoustic signal at the end of the programmed wor king period of time Possibility of operation in continuous mode E Acoustic signal in case of deviation from the programmed tem perature of operation m Very easy to use and compact design aimed to heat samples and solutions in chemical procedures such as distillation digestion evaporation extraction and boiling E Thermically isolated inner vessel with mineral fibre and heating elements made of chromium nickel that allow reaching temperatures up to 370 C E They adapt perfectly to the shape of the flasks getting a higher output mM Temperature electronic regulation for a fast and homogeneous heating Themostatic baths Analogic and digital water baths for heating samples up to 100 C Digital oil baths for heating samples up to 200 C Features m Wi
42. ouble safety switch mechanical lock to avoid operation if the lid is open The lid is also provided with a strong suspension me chanism that avoids it to close accidentally ROLOrS Capacity Speed Eppendorf like tubes x 0 2 mL 18000 rpm Eppendorf like tubes x 0 5 mL 18000 rpm Eppendorf like tubes x 2 mL 14000 rpm 12 tubes x 5 mL 12x75 mm 14000 rpm 12 tubes of 10 mL 16x100 mm 12000 rpm 36 capillary tubes 12000 rpm Multi rotor centrifuge model 2718 The main objective of Molecular Biology is the study and understanding of the biological behaviour of macromolecules DNA RNA pro teins and all those cellular processes that contribute to an efficient transmission of the genetic information and its expression in the new living beings The study of these processes requires the use of accurate and sophisticated equipments to make the most of the analysis performed and assure the obtaining of reliable results Nahita in its eagerness to adapt to customers necessities has recently included in its catalogue a series of equipments aimed to Molecular Biology purposes Dr LA MIT HA a A ARA GT ae Y a a a AD a MESA AN aii A i wane L J a rt h gt x i A E a Ma 3 A f i 1 B j o A Yo F F j A RL Be v o w j q y h A A 7 De y o gt Electrophoresis is a relatively easy technique used for the analysis of products of PCR th
43. pates and include real size skeleton vertebral co lumn pelvis and cranium models to orgo cal al an organs Human anatomy and physiology are very complex and specialized The different organs of the human body are organized in systems and apparatus perfectly coordinated to carry out all the physiologi cal functions required for life Torso head and organs kidney brain stomach etc models are especially designed to understand this human anatomy ETTE WMA tir 1 i a 4 4 TED Y ea Mi Eo material for educational purposes Hardness resistance and long life are features of our lab instrumental made with materials like stainless steel nickel plated steel chro mium plated steel and aluminium Nahita offer includes all those indispensable lab materials in chemical laboratory chemist or biology from clamps rings or bossheads for making lab assemblies required to carry out several chemical reactions to burners magnetic stirrer bars spatulas clamps or brushes for cleaning diverses kinds of tubes Different kinds of containers like bakers crucibles evaporating or crystallizing dishes have to be heated to high temperatures to carry out diverses experimental protocols Our lab material catalogue offers many models of clamps for test tube crucibles or evaporating dishes that they will let you manipu late those warmed containers or with dangerous products strongly and without personal
44. rands run parallel but in opposite directions it means one strand runs in 3 gt 5 direction and the other one in 5 53 direction so nucleotide strands are antiparallel On the other side both strands of nucleotides stay joint thanks to the formation of hydrogen bonds between the bases that are disposed perpendicular to the axis of the helix The union between bases is strictly complementary so as A only joins T and vice versa by two hydrogen bonds and C only joins G and vice versa by three hydro gen bonds This implies that the sequence of bases of one strand au tomatically determines the sequence of the other strand The structure of a certain fragment of DNA is defined by the order or sequence of the bases in the nucleotide strand e g ATCGGGTT CACATGCAATATCCGGACTTG lying in this sequence the genetic in formation of DNA components of the PCR The PCR is a relatively easy technique in which the different com ponents of the reaction are mixed up together in small tubes that will be subjected to different temperature cycles DNA template It is the sample of DNA that contains the sequence or region to be amplified The PCR can be carried out from a very small sample of DNA and even theoretically a unique copy of the fragment to be amplified would be enough to obtain results The fragment of DNA to be amplified can be a part of complex mix molecular biology tures such as for example total nuclear DNA The evolution
45. rotation axis There is a special type of fixed angle rotor the vertical rotor in which tubes are placed parallel to the ro tation axis Fixed angle rotors are mainly used for precipitation of big or very dense particles such as bacterias cells yeasts and for the isopicnic separation of macromolecules such as nucleic acids The advantage of this type of rotors Is that they usually allow a fas ter se dimentation of substances and since all their components are sta tic the risk of mechanical failures is decreased THEORETICAL FOUNDATIONS RCE The Relative Centrifugal Force R C F is the required force to separate particles It is given as some value times that of gravity g The R C F is calculated with the following formula FCR 1 118 10 r n 1 118 10 is a constant r radius the horizontal distance in centimetres from the rotation axis to the bottom of the sample tube n rotation speed expressed in revolutions per mi nute r p m Rotation axis Twisting radius E Swing out rotor tubes are placed in oscillating buckets that stay in a vertical position at rest When the rotor spins the buckets that contain the tubes acquire an horizontal position perpendicular to the rotation axis This type of rotor is useful to separate particles in a density gradient and its main advantage is the versatility since buc kets can be taken out a unique rotor can be used with buckets for different type of tubes depending on
46. s of 10 mm path length E Application software based on Windows that provides a com plete control of the spectrophotometer functions from a computer MH Pre aligned design of the deuterium and halogen lamp to faci litate replacement 1 Basic absorbance and transmittance measurements at a certain wavelength 2 Quantitative determination of the concentration of different samples from a curve equation C k A Two methods E Coefficient the value of the coefficient k of the equation is directly input through the keyboard M Standard curve one standard sample can be used to set the curve equation spectrophotometer model 4201 50 onal AAAA Sa Er Working modes 1 Basic absorbance and transmittance measurements at a cer tain wavelength 2 Quantitative determination of the concentration of different samples from a curve equation C k A b Two methods E Coefficient the value of the coefficients k and b of the equa tion are directly input through the keyboard Hm Standard curve up to 9 standard samples can be used to set the curve equation spectrophotometry spectrophotometer model 4201 20 spectrophotometer model 4211 20 and 4211 50 d BA MT Min j ni in J 0 E h S MW T in om be model PETTY Working modes 1 Basic absorbance and transmittance measurements at a cer tain wavelength 2 Quantitative determination of the concentration of different samples from a
47. sest to the bottom of the tube will contain the particles with higher density Nahita centrifuges are very different covering a wide range of applications in different fields peny Fixe anule rotor Ml Available in analogical or digital models and different E Easy to use compact and robust design capacities E For centrifugation speeds up to 6000 rpm depending on the model E Possibility of programming time of operation or work on continuous mode E Maintenance free brushless models available Digital angular centrifuge Analogic angular centrifuge gentritugos wing out rotor Ml High versatility of use thanks to the different adapters supplied with the swing out rotor E Digital adjustment E Centrifugation speed up to 5000 rpm depending on the model E Possibility of programming time of operation or work on continuous mode E Safety system that avoids centrifugation if the lid is open centrifuges Digital angular centrifuge Medibas centrifuge marasmo A a PANTFITIIMARS Mr l 1 VU Irm E Small footprint that makes them ideal for quick transport between countertops and for short term cold room uses E Extremely quiet and stable they start operation in a matter of se conds E Supplied with rotor and adapters necessary to be used with 2 1 5 0 5 and 0 2 mL and for strips of 8 tubes of 0 2 mL depending on model d J EA RS E eee MARE CENUHUUCS o icrohaematocrit E Hig
48. sing or PCR sample preparation Capacity for 16 Eppendorf like tubes of 2 1 5 0 5 or 0 2 mL Possibility of centrifugation tubes of 5 mL 12x75 mm with an additional rotor Displays for visualization of temperature speed and operation remaining time Speed can be set in rpm or RCF which saves the time of performing tedious calculations Pre cooling at 3000 6000 rpm that allows a faster temperature fall Temperature control even when the centrifuge is not in use and efficient refrigeration at low temperatures Use CFC free refrigerant R134a Timer up to 99 min and continuous mode operation It is also provided with a separate button for adjustable speed short spins Pause function to stop a centrifugation protocol Acoustic signal at the end of operation Protection mechanism so as the centrifuge will not operate if the lid is open Refrigerated centrifuge model 2816 1 High performance centrifuge that can be configured according to user s necessities thanks to the different rotors that can be used Robust and low noise design with and easy to use control panel with displays for visualization of speed and remaining time of operation Possibility of adjusting speed as rpm or as RCF avoiding additional calculations Memory to save up to 12 different centrifugation protocols thus saving time in daily lab work Automatic detection of the rotor and setting of the upper limits of centrifugation speed avoiding mistakes and increasing safety D
49. so it resists temperature Si02 Silice 80 4 changes and high heats maximum 500 C for short periods of time B203 Boron oxide 13 Therefore borosilicate glass IS ideal in every applications that re Na20 K20 Sodium potassium oxide 4 2 quiered very good chemical resistance a high thermal resistance Al203 Aluminum oxide 2 4 temperature changes in adition to high mechanical stability In our borosilicate glass offer you can find bakers funnels ISO bottles and all kind of flasks Erlenmeyer filtering spherical and distilling flasks Distilling flask and Erlenmeyer flasks Crystallizing dishes with spout and Petri dishes It presents good chemical and physical properties being suitable for Offer a wide range of crystallizing dishes funnels different tipes of those products that normally have only to resist chemical efforts for bottles staining jars desiccators and several sizes and capacities a short period of time and they don t have to bear thermal loads We mortars Mortar and Hellendhal jar Wide neck bottles and dropping bottles with glass tube _ auxilablaboratory supplies Laboratory glassware can be cleaned manually in a immersion bath or automatically in a laboratory dishwasher Before using we recommend rinse laboratory glassware to remove transport dirtiness A universally known method is wash with a soaked washing up liquid scourer or a sponge Laboratory glassware must not be treated with abras
50. studying the ultrastructure since it is very well pre served The sections obtained can be 1 3 um thick for light mi croscopy or 50 100 nm thick for electronic microscopy All those products needed for paraffin embedding and later sectio ning with microtome can be found in our catalogue From embed ding cassettes base moulds slides and cover slides or several Staining jars to the most sophisticated paraffin embedding unit and different models of microtomes To understand better the use of these instruments the different steps of sample processing are ex plained below fixation of tissues Tissue samples can be obtained by several methods such puncture biopsy necropsy etc In any case the separation of a tissue from the rest of the organism automatically implies the lost of the blood sup port this results in a series of metabolic events the autolysis whose consequence is the cellular destruction To avoid this from happen and preserve the tissues in a state similar to the alive state they must be immediately fixed once they are obtained The process of fi xation assures the following effects Mm t stops the enzymatic autolysis and bacterial putrefaction E It gives chemical stability to the tissue M It increases the hardness of the tissue to make it easier to han dle E It increases permeability of tissues to facilitate the subsequent Staining Tissues that will be embedded in parafin are subjected to a chemi cal fixatio
51. th thermical isolation between the chamber and the external case thus permitting a better performance as well as saving energy and a better temperature homogeneization Ml Digital models with a new regulator for a more accurate tempe rature control Acoustic signal in case of deviation from the pro cd y i Nahita thermostatic digital baths ovens amp heating mantles Series 636 natural convection incubators especially aimed for in cubating microorganisms or cell cultures in microbiology laborato ries grammed temperature of operation E Stainless steel inner tank made up of a unique piece without wel dings The depth of the tank allows a better immersion of samples E Provided with drainage hose for easily emptying the tank M Supplied with lid with several holes depending on the model and concentric rings to adapt to different type of flasks The use of the lid avoids evaporation Nahita Thermostatic digital oil baths Centrifuges are instruments in which samples are subjected to high forces to produce in a short period of time the sedimentation of parti cles with a density higher than the surrrounding medium That way an homogeneus solution finally is separated into two fractions the su pernatant liquid the homogeneus fraction that is not sedimented and the pellet that rests at the bottom of the tube Centrifuges are thus essential equipments in laboratories of medicine biology biochemistry or quality c
52. they point in which the solution touches the rod scale will mark the result Depending on the scale of the glass rod hydrometers can measure the density of a solution the dissolved sugar concentration or the per centage of alcohol in volume Nahita is provided with a wide range of hydrometers graduated in dif ferent scales for the different applications in which they can be used and that are called with a specific name depending on the scale they present m Hydrometers graduated in density scale Kg m E Saccharometers graduated in Brix scale Bx for measuring the sugar content of a solution mM Baum hydrometers graduated in Baum scale Be for mea suring the concentration of solutions E Mustimeters graduated in estimated alcohol degrees vol they give an idea of the degree of alcohol that will acquire the wine prepared from those musts E Alcoholometers graduated in alcohol content scale vol for measuring the degree of alcohol of spirits E Quevenne lactometers graduated in Quevenne scale for measu ring the density of milk E Liquid hydrometers wide variety of hydrometers with specific scales for several types of liquids such as lye syrup honey etc 1 Brix scale 1 degree Brix Bx corresponds to a solution with 1 g of sucrose per 100 g of solution 1 in mass 2 Baume scale 1 degree Baum corresponds to 25 g of sugar in 1 L of water 3 Baum degrees into density units in the case
53. tic calibration with external weight tions and the analysis of magnetic samples that can not be placed inside the balance Balance serie 5032 Balance serie 5033 with a detachable windbreak protection With a weighing range up to 300Kg they are especially designed for industrial applications that require very high capacities such as sen ding reception welghing checkings quality control etc Series 9098 Series 5050 E Transportable balances prepared for field determinations Counting balances for quantitative control applications E Highest protection against humidity dust and the aggressive in Simultaneous display of the weighing value the unit weight of dustrial activities each piece and the number of pieces E Steel platform with rubber protection and a control with LCD With tare function screen E Case for transport included gt gt a gt gt gt f f y y MEN o A a J e Mechanical balances also available in our cata logue are mainly used for educational purposes with the aim of understanding the weighing basis the most used operation in laboratory practices The traditional two pan design is based on the comparison of a known weight Are used with mechanical balances and more frequently for adjustment and verification of electronic balances The International Organization of Legal Metrology OIML has exactly defined the metrological requirements that verification weights must fulfil worldwide Thus accor
54. tirrable volume from 1 L to 4 L depending on the model m Models with up to 4 stirring positions available Magnetic stirrer without heating Analogical and digital magnetic stirrer with heating mechanical m Rod stirrers for stirring solids in suspension and medium and low viscosity liquids E Vortex mixers ideal for mixing solutions contained in test or Eppendorf like tubes thanks to their vibratory movement m Orbital shakers provided with a wide platform for stirring very different recipients such as Erlenmeyer flasks test tubes beakers microtiter plates trays etc E Roll and tilt stirrer especially aimed for mixing blood samples viscous substances and liquid solid suspensions where minimum aeration is required E Oscillating stirrer Provided with an oscillating platform adequate for hematologic samples Orbital stirrer Hod stirrer stirrer amp shakers Thermostatization Heating equipments in the laboratory Heating equipments are essential in the laboratory for incubating samples at a certain temperature or for carrying out some chemical re actions Nahita ovens and incubators Temperature accurate control Series 631 natural convection drying ovens Series 632 forced air drying ovens for a better and faster tempera ture homogeneization in the inner chamber Common features E New digital regulator for a more accurate temperature control With auto adjustment function to adjust the equipment to the m
55. trast between the different structures and the su histology rrounding tissue making them clearly visible and differentiable Stai ning techniques use several dyes that are usually aqueous solutions To make possible the staining of sections is therefore necessary to remove all the paraffin from tissues and then rehydrate them in a re verse process than that of embedding step There are numerous staining techniques and a lot of them are used to stain specifically some types of tissues or structures trichromic stainings for connective tissue silver staining for nerve tissue PAS staining for mucopolysaccharides or fast green safranin staining for plant tissues However the most commonly used staining technique for animal tissues and that Is routine technique in several laborato ries Is hematoxylin eosin staining It is composed by two different dyes hematoxylin a basic dye that stains acid structures like the ce lular nucleus and eosin an acid dye that stains basic structures like the cytoplasm Finally once the tissue Is properly stained a permanent mounting media and a glass cover slide is put on the section making the slide be perfectly preserved for several years INCTOS CORES 2 Zuzi microscopes meet the highest features and some ergonomic and sturdiness characteristics that make them especially suitable for daily work in research laboratories guarantying years of good operation and excellent image quality
56. ulatory nervous system and special sense organs 4 Plant organography 25 slides of gymnosperm and angiosperm monocot and dicot stems roots leaves and reproductive organs 9 Animal and plant reproduction 24 slides of gametogenesis and early phases of frog embrionary development and sexual repro duction of gymnosperms and angiosperms Frog ovary 6 Life cycles 14 slides of liverwort moss and fern life cycles 1 Genetics 5 slides of human and polytenic chromosomes animal and vegetal mitosis and meiosis 8 Microorganisms 13 slides of examples of prokaryotic orga nisms fungi and unicellular animals and algae 9 Insect anatomy 24 slides of types of insect wings legs anten nae mouth and eyes 10 Zoology 40 slides of representative examples of animal king dom phylums protozoa cnidaria plathelmints molluscs annelids arthropods and cephalocordata Gossypium Our range of material for educational purposes also includes a group of PVC models for studying and understanding the human anatomy and also the morphology of some animals and plant tissues tuman antomical The human skeleton is made up of 206 bones that apart from pro tecting the internal organs and supporting and giving shape to the body also provide a framework where muscles attach and act to make movement possible Nahita skeleton models are aimed to study and understand the morphology localization and joint in which each bone partici
57. wever to slice the tissue this must be included inside a paraffin block To get these blocks tissues are put into square base moulds that are filled with paraffin by using a paraffin dispensing unit when the paraffin gets cold it acquires solid consistency and thus the block with the sample inside is hard enough to be sliced Parafin dispensing unit naraffin embbeding accesories Cold plate for paraffin dispensing unit sectioning with microtome When samples are embedded in paraffin slices are made by using the microtome that allows obtaining 5 10 um thick sections For this purpose the paraffin block is placed on the clamp of the micro tome properly oriented The slice thickness is selected by the user and by means of a rotary manual handwheel the block is moved up wards and downwards When the block goes down it is sliced by a steel blade obtaining a section of the thickness specified then the block goes up and down again advancing some microns at the same time and making a new slice The obtained sections are carried to a bath with warm water where are properly stretched From this bath each section is picked up on a glass slide and put on a heating plate to let it dry and adhere to the slide staining Tissues are transparent so there is no contrast between the different structures and between these and the surrounding tissue To solve this problem several staining techniques were developed to allow increasing the con

Download Pdf Manuals

image

Related Search

Related Contents

TALON Rail User Manual    NEXT UPS Systems SYNCRO+ 600  Severin AS 3952  国産車適合表  USER GUIDE  耐衝撃ドーム型防犯カメラ 取扱説明書    

Copyright © All rights reserved.
Failed to retrieve file