NCode miRNA First-Strand cDNA Synthesis and qRT
Contents
1. A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Bentwich I Avniel A Karov Y Aharonov R Gilad S Barad O Barzilai A Einat P Einav U Meiri E Sharon E Spector Y and Bentwich Z 2005 Identification of hundreds of conserved and nonconserved human microRNAs Nature Genet 37 766 770 Chou Q Russell M Birch D Raymond J and Bloch W 1992 Prevention of pre PCR mis priming and primer dimerization improves low copy number amplifications Nucl Acids Res 20 1717 1723 Gerard G F D Alessio J M Kotewicz M L and Noon M C 1986 Influence on stability in Escherichia coli of the carboxy terminal structure of cloned Moloney murine leukemia virus reverse transcriptase DNA 5 271 279 Goff L A Yang M Bowers J Getts R C Padgett R W and Hart R P 2005 Rational probe optimization and enhanced detection strategy for microRNAs using microarrays RNA Biology 2 published online Imanishi T Itoh T Suzuki Y and O Donovan C 2004 Integrative annotation of 21 037 human genes validated by full length cDNA clones PLoS Biol 2 e162 Ishiguro T Saitoh J Yawata H Yamagishi H Iwasaki S and Mitoma Y 1995 Homogeneous quantitative assay of hepatitis C virus RNA by polymerase chain reaction in the presence of a fluorescent intercalater Anal Biochem 229 207 John B Enright2. UDG and stabilizers MicroRNAs miRNAs are a recently discovered class of small 19 23 nucleotide non coding RNA molecules They are cleaved from hairpin precursors and are believed play an important role in translation regulation of target mRNAs by binding to partially complementary sites in the 3 untranslated regions UTRs of the message Lim 2003 Several groups have hypothesized that there may be up to 20 000 non coding RNAs that contribute to eukaryotic complexity Bentwich et al 2005 Imanishi et al 2004 Okazaki et al 2002 Though hundreds of miRNAs have been discovered little is known about their cellular function They have been implicated in regulation of developmental timing and pattern formation Lagos Quintana et al 2001 restriction of differentiation potential Nakahara amp Carthew 2004 regulation of insulin secretion Stark et al 2003 and genomic rearrangements John et al 2004 Several unique physical attributes of miRNAs including their small size lack of poly adenylated tails and tendency to bind their mRNA targets with imperfect sequence homology have made them elusive and challenging to study In addition strong conservation between miRNA family members means that any detection technology must be able to distinguish between 22 base sequences that differ by only 1 2 nucleotides Recent advances in microarray and qPCR detection have enabled the use of these technologies for miRNA
3. Green qPCR 100 reactions 11733 038 SuperMix UDG 500 reactions 11733 046 SYBR GreenER qPCR SuperMix for ABI 100 reactions 11760 100 PRISM 500 reactions 11760 500 SYBR GreenER qPCR SuperMix for 100 reactions 11761 100 iCycler Instrument 500 reactions 11761 500 SYBR GreenER qPCR SuperMix Universal 100 reactions 11762 100 500 reactions 11762 500 RNaseOUT Recombinant Ribonuclease 5 000 units 10777 019 Inhibitor Fluorescein NIST Traceable Standard 50 uM 5x 1 mL F36915 Quant iT Ribogreen RNA Assay Kit 200 2 000 cuvette assays R 11490 RediPlate 96 Ribogreen RNA Quantitation 96 well plate R 32700 Kit 8 x 12 strip wells PureLink miRNA Isolation Kit 25 preps K1570 01 NCode miRNA Amplification System 20 reactions MIRAS 20 NCode miRNA Labeling System 20 labeling and MIRLS 20 hybridization reactions NCode Multi Species miRNA Microarray 5 slides MIRA2 05 V2 NCode Multi Species miRNA Microarray 10 pL MIRAC2 01 Control V2 NCode Multi Species miRNA Microarray 3 x 384 well plates MIRMPS2 01 Probe Set V2 500 pmol per well vi Introduction System Overview Workflow Overview The NCode miRNA First Strand cDNA Synthesis Kits and qRT PCR Kits provide qualified reagents for the polyadenylation of microRNAs miRNAs from total RNA and synthesis of first strand cDNA from the tailed miRNAs for use in real time quantitative PCR qPCR These kits have been optimized for the detection and
4. qPCR SuperMix Universal Note e Since PCR is a powerful technique capable of amplifying trace amounts of DNA all appropriate precautions should be taken to avoid cross contamination e For multiple reactions prepare a master mix of common components with a 10 overage for accurate pipetting add the appropriate volume to each tube or plate well and then add the unique reaction components e g template Preparation of a master mix is strongly recommended in qPCR to reduce pipetting errors Note the lower amount of ROX Reference Dye required for the Applied Biosystems 7500 Template Dilute the cDNA 1 10 as described on the next page and use Volume 5 pL of the dilution in a 50 uL qPCR i e 1 v v cDNA Note on The following cycling program recommends an annealing Annealing temperature of 57 C Raising the annealing temperature to Temperature 39 C may result in better discrimination of closely related miRNA sequences but with a slight loss in sensitivity DNA The hot start DNA polymerase used in SYBR GreenER Polymerase qPCR SuperMix is activated during the 10 minute incubation Activation at 95 C before PCR cycling Continued on next page 19 qPCR Using SYBR GreenER SuperMix continued qPCR Protocol 20 Follow the steps below to perform qPCR using SYBR GreenER qPCR SuperMix Universal Volumes for a single 50 uL reaction are listed Volumes can be scaled as needed e g scal
5. quantification of miRNA from 10 ng to 2 5 ug of total RNA using a SYBR Green or SYBR GreenER detection platform Isolation of small RNAs is typically not required though it may enhance detection of some rare miRNAs SuperScript III Reverse Transcriptase RT in the cDNA synthesis reaction ensures high specificity and high yields of cDNA from small amounts of starting material Platinum SYBR Green qPCR SuperMix UDG included with catalog no MIRQ 100 ensures optimal qPCR performance using SYBR Green I dye with excellent sensitivity and a linear dose response over a wide range of target concentrations SYBR GreenER qPCR SuperMix Universal included with catalog no MIRQER 100 contains a novel fluorescent double stranded DNA dsDNA binding dye for both higher sensitivity and lower PCR inhibition than SYBR Green I dye It can be used on real time PCR instruments calibrated for SYBR Green I dye without any change of filters or settings Following isolation of total RNA all the miRNAs in the sample are polyadenlyated using poly A polymerase and ATP Following polyadenylation SuperScript III RT and a specially designed Universal RT Primer are used to synthesize cDNA from the tailed miRNA population The first strand cDNA is ready for analysis in qPCR using SYBR Green or SYBR GreenER detection reagents the Universal qPCR Primer provided in the kit and a forward primer designed by the user that targets
6. A J Aravin A Tuschl T Sander C and Marks D S 2004 Human MicroRNA Targets PLoS Biol 2 e363 Kotewicz M L D Alessio J M Driftmier K M Blodgett K P and Gerard G F 1985 Cloning and overexpression of Moloney murine leukemia virus reverse transcriptase in Escherichia coli Gene 35 249 258 Lagos Quintana M Rauhut R Lendeckel W and Tuschl T 2001 Identification of novel genes coding for small expressed RNAs Science 294 853 858 Lim L P Glasner M E Yekta S Burge C B Bartel D P 2003 Vertebrate microRNA Genes Science 299 1540 Lindahl T Ljungquist S Siegert W Nyberg B and Sperens B 1977 DNA N glycosidases properties of uracil DNA glycosidase from Escherichia coli J Biol Chem 252 3286 3294 Longo M Berninger M and Hartley J 1990 Use of uracil DNA glycosylase to control carry over contamination in polymerase chain reactions Gene 93 125 128 Continued on next page 25 References continued Nakahara K and Carthew R W 2004 Expanding roles for miRNAs and siRNAs in cell regulation Curr Opin Cell Biol 16 127 133 Okazaki Y Furuno M Kasukawa T and Adachi J 2002 Analysis of the mouse transcriptome based on functional annotation of 60 770 full length cDNAs Nature 420 563 573 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press
7. DNA Engine Opticon Opticon 2 and Chromo4 Real Time Detector e Cepheid SmartCycler Instrument Optimal cycling conditions will vary with different instruments For additional information visit www lifetechnologies com qpcr TM ROX Reference Dye can be included in the reaction to normalize the fluorescent reporter signal for instruments that are compatible with that option ROX Reference Dye is supplied with both Platinum SYBR Green qPCR SuperMix UDG and SYBR GreenER qPCR SuperMix Universal at a 25 uM concentration It is composed of a glycine conjugate of 5 carboxy X rhodamine succinimidyl ester in 20 mM Tris HCI pH 8 4 0 1 mM EDTA and 0 01 Tween 20 Use the following table to determine the amount of ROX Reference Dye to use with a particular instrument si Final Instrument d ROX P p Conc Applied Biosystems 7000 7300 7700 and 7900HT BOHE aM Applied Biosystems 7500 Agilent Mx3000 Mx3005P 0 1 pL 50 nM and Mx4000 To accurately pipet 0 1 uL per reaction we recommend diluting ROX Reference Dye 1 10 immediately before use and use 1 pL of the dilution Continued on next page 15 qPCR Guidelines and Recommendations continued Melting Curve Analysis Fluorescein 16 Melting curve analysis should always be performed after qPCR to identify the presence of primer dimers and analyze the specificity of the reaction Melting curve anal
8. miRNAs in miRBase Release 9 0 http microrna sanger ac uk for human mouse rat D melanogaster C elegans and Zebrafish The probes were designed using an algorithm that generates miRNA sequences with enhanced hybridization properties Goff et al 2005 Each slide comes blocked and ready to use The NCode Multi Species miRNA Microarray Probe Set V2 includes the probe sequences provided on the microarray listed above dried down in 384 well plates at 500 pmoles per well and ready for printing on standard DNA microarray surfaces The NCode Multi Species miRNA Microarray Control V2 is a synthetic 22 nucleotide miRNA sequence that has been designed and screened as a positive control for use with NCode system Continued on next page Introduction continued Materials The following materials are required for use with these kits Supplied by the User 10 ng to 2 5 ug of total RNA Forward PCR primer designed for the miRNA target of interest see page 3 for design guidelines 1 mM Tris pH 8 0 Microcentrifuge Heat block water bath and or thermal cycler RNase free pipette tips 1 5 mL RNase free microcentrifuge tubes Disposable gloves Ice Optional RNaseOUT Recombinant Ribonuclease Inhibitor for the negative RT control qPCR instrument Appropriate PCR plates tubes for instrument Additional materials required for catalog nos MIRC 10 or MIRC 50 qPCR reagents that include SYBR Green or SYB
9. on our website Go to www lifetechnologies com support and search for the Certificate of Analysis by product lot number which is printed on the box Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support 23 Purchaser Notification Limited Use Label License No 358 Research Use Only 24 The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial applications of any kind including without limitation quality control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J
10. screening Continued on next page Introduction continued Other Products in the NCode System The NCode SYBR Green miRNA qRT PCR Kit and NCode miRNA First Strand cDNA Synthesis Kit were designed and developed in conjunction with the following Life Technologies products for ordering information see page vi The NCode miRNA Labeling System is a robust and efficient system for labeling and hybridizing miRNA to NCode microarrays for expression profiling analysis Using this kit you ligate a short highly specific tag sequence to each miRNA and then hybridize highly fluorescent Alexa Fluor dye molecules to the tagged miRNA The high specificity of the binding sequence and high fluorescence of the dye molecules ensure maximum signal and strong signal correlations The NCode miRNA Amplification System is a robust system for amplifying senseRNA molecules from minute quantities of miRNA The system provides consistent and accurate gt 1000 fold amplification while preserving the relative abundance of the miRNA sequences in the original sample allowing you to compare relative quantities across experiments The resulting amplified miRNA is in the sense orientation for direct compatibility with NCode microarray probe sequences The NCode Multi Species miRNA Microarray V2 consists of 5 Corning Epoxide Coated Glass Slides each printed with optimized probe sequences targeting all of the known mature
11. IM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF 26 Notes 27
12. Nase free microcentrifuge tube Component Amount Polyadenylated RNA from Step 4 page 10 4uL Annealing Buffer 1uL Universal RT Primer 25 uM 3uL Total volume Sul 2 Incubate the tube at 65 C for 5 minutes Place the tube on ice for 1 minute 4 Add the following to the tube for a final volume of 20 uL Component Amount 2X First Strand Reaction Mix 10 uL SuperScript III RT RNaseOUT Enzyme Mix 2 pL For negative RT controls use 1 uL of sterile distilled water and 1 pL of RNaseOUT Recombinant Ribonuclease Inhibitor instead of the Enzyme Mix Spin the tube briefly to collect the contents 6 Transfer the tube to a thermal cycler preheated to 50 C and incubate for 50 minutes 7 Incubate at 85 C for 5 minutes to stop the reaction Chill the reaction on ice Store aliquots at 20 C or proceed directly to qPCR 12 qPCR Guidelines and Recommendations Introduction This section provides guidelines and recommendations for qPCR using either Platinum SYBR Green qPCR SuperMix UDG or SYBR GreenER qPCR SuperMix Universal Required The following materials are provided in all kits Materials e Universal qPCR Primer The following materials are provided with MIRQ 100 e Platinum SYBR Green qPCR SuperMix UDG e ROX Reference Dye The following materials are provided with MIRQER 100 e SYBR GreenER qPCR SuperMix Universal e ROX Reference Dye The following materials are provided by t
13. Plainview New York Sharkey D J Scalice E R Christy K G Atwood S M and Daiss J L 1994 Antibodies as thermolabile switches high temperature triggering for the polymerase chain reaction Biotechnology 12 506 509 Stark A Brennecke J Russell R B and Cohen S M 2003 Identification of Drosophila MicroRNA Targets PLoS Biol 1 E60 Wittwer C T Herrmann M G Moss A A and Rasmussen R P 1997 Continuous fluorescence monitoring of rapid cycle DNA amplification BioTechniques 22 130 138 Xie X Lu J Kulbokas E J Golub T R Mootha V Lindblad Toh K Lander E S and Kellis M 2005 Systematic discovery of regulatory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 345 2012 Life Technologies Corporation All rights reserved The trademarks mentioned herein are the property of Life Technologies Corporation and or its affiliate s or their respective owners in the United States and other countries DNA Engine Opticon Opticon and iCycler are trademarks of Bio Rad Laboratories Inc RNAse AWAY is a registered trademark of Molecular Bio Products Inc Tween is a registered product of Uniquema Americas LLC Mx3000P and Mx3005P are trademarks of Agilent Technologies Inc Rotor Gene is a registered trademark of Qiagen GmbH SmartCycler is a registered trademark of Cepheid Corporation LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLA
14. R GreenER binding dyes see page vi Methods Isolating Total RNA Introduction Note about Isolating Small RNA Molecules General Handling of RNA High quality total RNA is essential for qRT PCR analysis In this step you obtain total RNA or isolate it from a sample Isolating small RNA molecules from total RNA prior to use of this kit is not required and may in fact limit the detection of some miRNAs in qRT PCR However for extremely low abundance miRNAs multiple total RNA samples 10 ug each may be pooled and the miRNA may be enriched from the pooled sample for detection in qRT PCR The PureLink miRNA Isolation Kit is available for this purpose see page vi When working with RNA e Use disposable individually wrapped sterile plasticware e Use aerosol resistant pipette tips for all procedures e Use only sterile new pipette tips and microcentrifuge tubes e Wear latex gloves while handling reagents and RNA samples to prevent RNase contamination from the surface of the skin e Use proper microbiological aseptic technique when working with RNA e Dedicate a separate set of pipettes buffers and enzymes for RNA work e Use RNase free microcentrifuge tubes If it is necessary to decontaminate untreated tubes soak the tubes overnight in a 0 01 v v aqueous solution of diethylpyrocarbonate DEPC rinse the tubes with sterile distilled water and autoclave the tubes You can use
15. RNase AWAY Reagent a non toxic solution available from Life Technologies to remove RNase contamination from surfaces For further information on controlling RNase contamination see Ausubel et al 1994 Sambrook et al 1989 Continued on next page Isolating Total RNA continued Isolating Total RNA Amount of Total RNA Required To isolate total RNA we recommend TRIzol Reagent Cat nos 15596 026 and 15596 018 Ordering information is provided on page vi The PureLink Micro to Midi Total RNA Purification System Cat no 12183 018 or PureLink 96 Total RNA Purification Kit Cat no 12173 011 may also be used Use 10 ng to 2 5 ug of total RNA depending on the abundance of your miRNA targets The optimal sample range is 100 ng to 1 ug of total RNA Poly A Tailing of miRNA Introduction Required Materials Important In this step you add a poly A tail to the miRNA in your total RNA sample The following materials are supplied in the NCode miRNA First Strand cDNA Synthesis Kit e 5X miRNA Reaction Buffer e 25mMMnCb e 10mM ATP e Poly A Polymerase PAP e DEPC treated water The following materials are supplied by the user e 10ng to 2 5 ug of total RNA e 1mM Tris pH 8 0 e Microcentrifuge e Heat block or water bath set at 37 C e RNase free pipette tips e 1 5 mL RNase free microcentrifuge tubes The following reaction uses the manganese chloride MnCl supplied i
16. TP from Step 1 1 uL Poly A Polymerase see Note above 0 5 pL DEPC treated water to 25 pL 3 Mix gently and centrifuge the tube briefly to collect the contents 4 Incubate the tube in a heat block or water bath at 37 C for 15 minutes After incubation proceed immediately to First Strand cDNA Synthesis next page 10 First Strand cDNA Synthesis Introduction In this step you reverse transcribe the polyadenylated miRNA to generate first strand cDNA Note The following reaction uses 4 uL of the 25 pL poly A tailing reaction from Step 4 previous page Each poly A tailing reaction provides enough polyadenylated miRNA for up to six cDNA synthesis reactions Required The following materials are supplied in the NCode miRNA Materials First Strand cDNA Synthesis Kit e Annealing Buffer e Universal RT Primer 25 uM e 2X First Strand Reaction Buffer e SuperScript III RT RNaseOUT Enzyme Mix The following materials are provided by the user e Thermal cycler or water bath preheated to 65 C e Microcentrifuge e Ice e 1 5 mL RNase free microcentrifuge tubes e RNase free pipette tips e Optional RNaseOUT Recombinant Ribonuclease Inhibitor for the negative RT control Continued on next page 11 First Strand cDNA Synthesis continued First Strand Use the following procedure to reverse transcribe the cDNA polyadenylated miRNA from Step 4 page 10 Synthesis 1 Add the following to an R
17. by fe technologies NCode miRNA First Strand cDNA Synthesis and qRT PCR Kits For polyadenylation and reverse transcription of miRNAs for use in two step quantitative RT PCR Catalog numbers MIRC 10 MIRC 50 MIRQ 100 and MIRQER 100 Revision date 19 April 2012 Publication Part number 25 0917 MAN0000563 o For Research Use Only Not for human or animal therapeutic or diagnostic use technologies ii Table of Contents Kit Contents and Storage cion is iv Accessory Products uni terere EE Hr rere vi Introduction Meth OG sf PC 7 Isolating Total RN iet netten ae 7 Poly A Tailing of miRNA esee nene nennen 9 First Strand cDNA Synthesis qPCR Guidelines and Recommendations qPCR Using SYBR Green SuperMix sse 17 qPCR Using SYBR GreenER SuperMix sse 19 Appendix Zee ee a ne E 21 Troubleshooting viii ida 21 Technical SuppoOtt eei etin EO RUE 23 Purchaser Notification esee entente nnne nnne nnne 24 References ccscescessessceseesscssccsscsscesscsscesecsscsscesscsscesscssceaecseessceasessceseeaeeesseaseseeaees 25 Kit Contents and Storage Shipping and Storage Kit components are shipped on dry ice and should be stored at 20 C except SYBR GreenER qPCR SuperMix Universal provided with MIRQER 100 which may be stored at either 4 C or 20 C Kit Configurations MIRC 10 and MIRC 50 The NCode miRNA First St
18. ed down to a 20 uL reaction volume for 384 well plates 1 Program the real time instrument as shown below The cycling program is designed for Applied Biosystems instruments It may also be used as a starting point for other real time instruments 50 C for 2 minutes UDG incubation 95 C for 10 minutes UDG inactivation and DNA polymerase activation 40 cycles of 95 C 15 seconds 57 C 60 seconds Melting curve analysis See instrument documentation See Note on Annealing Temperature previous page 2 Dilute the cDNA from Step 7 page 12 1 10 in DEPC treated water Use 5 uL of diluted cDNA per 50 uL reaction i e 1 v v cDNA 3 Add the following components to each DNase RNase free PCR tube or plate well Component Amount SYBR GreenER qPCR SuperMix 25 uL 1X final conc Forward primer 10 uM 1 pL 200 nM final conc Universal qPCR Primer 10 uM 1 uL 200 nM final conc ROX Reference Dye optional 1 uL 0 1 uL see page 15 Template diluted 1 10 Step 2 5uL 1 v v cDNA DEPC treated water to 50 uL 4 Caporseal the tube plate and gently mix Make sure that all components are at the bottom of the tube plate Centrifuge briefly if needed 5 Place reactions in a preheated real time instrument programmed as described on the previous page Run the program After cycling hold the reaction at 4 C until further analysis Analyze the cycle threshold Ct values slope of the standard curve Y interc
19. ept and correlation coefficient R for your qPCR experiments using the software provided with your instrument Appendix Troubleshooting Problem Possible Suggested Solution Cause Signals are present in no template controls and or multiple peaks are present in the melting curve graph Template or reagents are contaminated by nucleic acids DNA cDNA e Use melting curve analysis and or run the PCR products on a 4 agarose gel after the reaction to identify contaminants e Take standard precautions to avoid contamination when preparing your PCR reactions Ideally amplification reactions should be assembled in a DNA free environment We recommend using aerosol resistant barrier tips Primer dimers or other nonspecific products are e Primer contamination or degraded primers can lead to artifacts Check the purity of your primers by gel electrophoresis present Be sure to dilute the cDNA 1 10 in DEPC treated water before qPCR as specified in the protocol Use 5 uL of diluted cDNA per 50 uL reaction i e 1 v v cDNA e Increasing the annealing temperature in the qPCR may increase the specificity in the case of miRNA sequences that differ by only a few bases note that the sensitivity of the reaction may decrease No amplification There is no PCR Run the reaction on a gel to determine whether curve appears on product PCR worked Then proceed to the the qPCR graph troubleshooti
20. he unique reaction components e g template Preparation of a master mix is strongly recommended in qPCR to reduce pipetting errors e Note the lower amount of ROX Reference Dye required for the Applied Biosystems 7500 Template Dilute the cDNA 1 10 as described on the next page and use Dilution 5 pL of the dilution in a 50 uL qPCR i e 1 v v cDNA Note on The following cycling program recommends an annealing Annealing temperature of 60 C Raising the annealing temperature to Temperature 63 65 C may result in better discrimination of closely related miRNA sequences but with a slight loss in sensitivity Cycling The cycling program below is designed for Applied Program Biosystems real time instruments This program may also be used as a starting point for other real time instruments Standard Cycling Program for Fast Cycling Program for the Applied Applied Biosystems Instruments Biosystems 7500 in Fast Mode 50 C for 2 minutes UDG incubation Select Fast Mode on Thermal Profile tab 95 C for 2 minutes 50 C for 2 minutes UDG incubation 40 cycles of 95 C for 2 minutes 95 C 15 seconds 40 cycles of 60 C 30 seconds 60 seconds for 95 C 3 seconds the 7900HT 60 C 30 seconds Melting curve analysis See instrument documentation See Note on Annealing Temperature above Continued on next page 17 qPCR Using SYBR Green SuperMix continued qPCR Protocol 18 Follow the
21. he user e Forward PCR primer designed for miRNA of interest see next page for detailed design guidelines e qPCR instrument e Appropriate PCR plates tubes for instrument e RNase free pipette tips e cDNA from Step 7 page 12 Note Minimize exposure of ROX Reference Dye and the SYBR Green and SYBR GreenER SuperMixes to direct light Exposure to direct light for an extended period of time may result in loss of fluorescent signal intensity Ordering The NCode miRNA First Strand cDNA Synthesis Kits were qPCR designed and developed for use with SYBR Green and Reagents SYBR GreenER SuperMixes If you are using catalog nos Separately MIRC 10 or MIRC 50 you can order these SuperMixes separately See page vi for ordering information Continued on next page 13 qPCR Guidelines and Recommendations continued qPCR Primers Truncating the Forward Primer 14 Reverse primer The Universal qPCR Primer supplied with each kit is used as the reverse primer in qPCR It is supplied at 10 uM and used at a final concentration of 200 nM Forward primer The forward primer in qPCR is specific for the miRNA sequence of interest and must be ordered separately by the user As a starting point we recommend ordering a DNA oligo that is identical to the entire mature miRNA sequence Note that this is the complement of the reverse transcribed miRNA sequence from the cDNA synthesis reaction For example
22. n the First Strand cDNA Synthesis Kit not the magnesium chloride MgCl supplied with Platinum SYBR Green qPCR SuperMix UDG included with cat no MIRO 100 Be careful to select the vial of MnCl for use in the following reaction Continued on next page Poly A Tailing of miRNA continued Note Each reaction requires 0 5 uL of Poly A Polymerase To avoid pipetting 0 5 uL of enzyme do one of the following e For multiple reactions prepare a master mix of all components except RNA including the equivalent of 0 5 uL of enzyme per reaction e Fora single reaction dilute the Poly A Polymerase 1 1 with DEPC treated water Dilute 1 uL of Poly A Polymerase with 1 uL of DEPC treated water and use 1 pL of the dilution per reaction Poly A Use the following procedure to add poly A tails to the total Tailing RNA Procedure 1 Based on the quantity of total RNA dilute a volume of 10 mM ATP in 1 mM Tris pH 8 0 according to the following formula ATP dilution factor 5000 ng of total RNA Example If you are starting with 100 ng of total RNA the ATP dilution factor is 5000 100 ng 50 Dilute the ATP 1 50 by adding 1 uL of 10 mM ATP to 49 pL of 1 mM Tris pH 8 0 2 Addthe following at room temperature to the tube of total RNA For multiple reactions prepare a master mix of common components to enable accurate pipetting Component Volume RNA xuL 5X miRNA Reaction Buffer 5 ph 25 mM MnCl gt 2 5 pL Diluted A
23. ng steps below No PCR product is The protocol was Verify that all steps have been followed and the evident either in not followed correct reagents dilutions volumes and cycling the qPCR graph or correctly parameters have been used on a gel Template contains inhibitors nucleases or proteases or has otherwise been degraded Purify or re purify your template Primer design is suboptimal Verify your primer selection We recommend using validated pre designed primers or design primers using dedicated software programs or primer databases Continued on next page 21 Troubleshooting continued Problem Possible Suggested Solution Cause PCR product is qPCR instrument Confirm that you are using the correct instrument evident in the gel settings are settings dye selection reference dye filters but not on the incorrect acquisition points etc qPCR graph Problems with See your instrument manual for tips and your specific troubleshooting qPCR instrument PCR efficiency is Template contains Purify or re purify your template Inhibitors in above 110 inhibitors the template may result in changes in PCR nucleases or efficiency between dilutions proteases or has otherwise been degraded Nonspecific e Use melting curve analysis if possible and or products may be run the PCR products on a 4 agarose gel amplified after the reaction to identify contaminants e Increasing
24. note the following primer design for the miRNA hsa miR 124a miRNA sequence uuaaggcacgcggugaaugcca Primer sequence ttaaggcacgcggtgaatgcca In most cases using an oligo that is identical to the entire mature miRNA is optimal In some cases truncating the primer sequence may be necessary see below Visit www lifetechnologies com oligos to order the miRNA specific forward primer from Life Technologies A final primer concentration of 200 nM is effective for most reactions We have seen optimal results with primers that have a melting temperature Tm of 55 68 C For some GC rich miRNA sequences it may be necessary to design a forward primer that is truncated by 3 4 bases on the 3 end to reduce the Tm If you detect a higher than average amount of primer dimers in your qPCR or if the miRNA sequence is GC rich try designing a truncated forward primer Continued on next page qPCR Guidelines and Recommendations continued Instrument Settings ROX Reference Dye Platinum SYBR Green qPCR SuperMix UDG and SYBR GreenER qPCR SuperMix Universal can be used with a variety of real time instruments including but not limited to e Applied Biosystems 7000 7700 and 7900HT e Applied Biosystems 7300 and 7500 Real Time PCR Systems e Applied Biosystems GeneAmp 5700 e Bio Rad iCycler Instrument e Agilent Mx3000P Mx3005P and Mx4000 e Qiagen Research Rotor Gene System e Bio Rad
25. orescent dsDNA binding dye Continued on next page Introduction continued Forward Primer Design for qPCR SuperScript Ill RT Platinum SYBR Green qPCR SuperMix UDG The forward primer in qPCR is specific for the miRNA sequence of interest and must be ordered separately by the user As a starting point we recommend ordering a DNA oligo that is identical to the entire mature miRNA sequence Note that this is the complement of the reverse transcribed miRNA sequence from the cDNA synthesis reaction For example note the following primer design for the miRNA hsa miR 124a miRNA sequence uuaaggcacgcggugaaugcca Primer sequence ttaaggcacgcggtgaatgcca In most cases using an oligo that is identical to the entire mature miRNA is optimal In some cases truncating the primer sequence may be necessary see page 14 Note that the Universal qPCR Primer supplied with each kit is used as the reverse primer in qPCR Visit www lifetechnologies com oligos to order the miRNA specific forward primer from Life Technologies SuperScript III Reverse Transcriptase is an engineered version of M MLV RT with reduced RNase H activity and increased thermal stability Gerard et al 1986 Kotewicz et al 1985 The enzyme can be used to synthesize first strand cDNA at temperatures up to 55 C providing increased specificity higher yields of cDNA and more full length product than other reverse transcriptase
26. qPCR SuperMix UDG 2 x 1 25 mL 50 mM Magnesium Chloride MgCl 1mL 20X UltraPure BSA Bovine Serum Albumin 300 pL ROX Reference Dye 100 pL MIRQER 100 includes the components provided with MIRC 10 plus the following Component Amount SYBR GreenER qPCR SuperMix Universal 2 x 1 25 mL ROX Reference Dye 100 pL Minimize exposure of SYBR Green and SYBR GreenER reagents and ROX Reference Dye to direct light to avoid loss of fluorescent signal intensity Each polyadenylation reaction provides enough tailed RNA for six cDNA synthesis reactions and each cDNA synthesis reaction provides enough cDNA for multiple qPCR reactions For Research Use Only Not intended for any human or animal diagnostic or therapeutic uses Accessory Products Additional The NCode system is an integrated miRNA expression Products profiling system that includes miRNA isolation amplification purification quantification labeling and array hybridization components Additional products are available separately from Life Technologies Ordering information is provided below For more information visit our website at www lifetechnologies com or contact Technical Support page 23 Product Size Cat no TRIzol Reagent 100 mL 15596 026 200 mL 15596 018 RNase AWAY Reagent 250 mL 10328 011 Custom Primers visit www lifetechnologies com oligos Platinum SYBR
27. rand cDNA Synthesis Kits include components for polyadenylation and cDNA synthesis plus the Universal qPCR Primer Other qPCR reagents must be ordered separately MIRQ 100 The NCode SYBR Green miRNA qRT PCR Kit includes the components provided with MIRC 10 plus Platinum SYBR Green qPCR SuperMix UDG MIROER 100 The NCode SYBR GreenER miRNA qRT PCR Kit includes the components provided with MIRC 10 plus SYBR GreenER qPCR SuperMix Universal Number of Reactions Cat no Polyadenylation cDNA Synthesis qPCR MIRC 10 10 20 MIRC 50 50 100 MIRO 100 10 20 100 MIROER 100 10 20 100 NCode miRNA First Strand cDNA Synthesis Kits The following reagents and amounts are provided Component MIRC 10 MIRC 50 5X miRNA Reaction Buffer 50 pL 250 pL 25 mM MnCl 50 uL 250 uL 10 mM ATP 10 uL 250 uL Poly A Polymerase 8 pL 40 pL Annealing Buffer 20 pL 100 pL SuperScript III RT RNaseOut Enzyme Mix 40 pL 200 pL 2X First Strand Reaction Buffer includes MgCl and dNTPs 200 pL 1mL Universal RT Primer 25 uM 60 pL 300 uL Universal qPCR Primer 10 uM 250uL 125mL DEPC treated water 2mL 2x2mL iv Continued on next page Kit Contents and Storage continued Platinum SYBR Green qPCR SuperMix UDG SYBR GreenER qPCR SuperMix Universal Important Note Product Use MIRO 100 includes the components provided with MIRC 10 plus the following Component Amount Platinum SYBR Green
28. s Platinum SYBR Green qPCR SuperMix UDG is a reaction mix containing all components except primers for the amplification and detection of DNA in qPCR Ishiguro et al 1995 Wittwer et al 1997 It combines the hot start technology of Platinum Taq DNA polymerase with integrated UDG carryover prevention and SYBR Green I fluorescent dye The SuperMix is supplied at a 2X concentration and contains Platinum Tag DNA polymerase SYBR Green I dye MgCl dNTPs with dUTP instead of dTTP uracil DNA glycosylase UDG and stabilizers See the insert provided with Platinum SYBR Green qPCR SuperMix UDG for more details Continued on next page 3 Introduction continued SYBR GreenER qPCR SuperMix Universal MicroRNAs SYBR GreenER qPCR SuperMix Universal is a ready to use cocktail containing all components except primers and template for the amplification and detection of DNA in qPCR It combines a chemically modified hot start version of Tag DNA polymerase with integrated uracil DNA glycosylase UDG carryover prevention technology and a novel fluorescent dye to deliver excellent sensitivity in the quantification of target sequences with a linear dose response over a wide range of target concentrations SYBR GreenER qPCR SuperMix Universal is supplied at a 2X concentration and contains hot start Tag DNA polymerase SYBR GreenER fluorescent dye MgCb dNTPs with dUTP instead of dTTP
29. steps below to perform qPCR using Platinum SYBR Green qPCR SuperMix UDG Volumes for a single 50 uL reaction are listed Volumes can be scaled as needed e g scaled down to a 20 uL reaction volume for 384 well plates 1 Dilute the cDNA from Step 7 page 12 1 10 in DEPC treated water Use 5 uL of diluted cDNA per 50 uL reaction i e 1 v v cDNA 2 Addthe following components to each DNase RNase free PCR tube or plate well Component Amount Platinum SYBR Green qPCR SuperMix UDG 25 uL 1X final conc Forward primer 10 uM 1 pL 200 nM final conc Universal qPCR Primer 10 uM 1 pL 200 nM final conc ROX Reference Dye optional 1 nL 0 1 uL see page 15 Template diluted 1 10 Step 1 5 pL 1 v v cDNA DEPC treated water to 50 uL 3 Cap or seal the tube plate and gently mix Make sure that all components are at the bottom of the tube plate Centrifuge briefly if needed 4 Place reactions in a preheated real time instrument programmed as described on the previous page Run the program After cycling hold the reaction at 4 C until further analysis Analyze the cycle threshold Ct values slope of the standard curve Y intercept and correlation coefficient R for your qPCR experiments using the software provided with your instrument qPCR Using SYBR GreenER SuperMix Introduction This section provides a general protocol for qPCR on Applied Biosystems real time instruments using SYBR GreenER
30. the annealing temperature in the qPCR may increase the specificity in the case of miRNA sequences that differ by only a few bases note that the sensitivity of the reaction may decrease PCR efficiency is The PCR Verify that the reagents you are using have not below 90 conditions are been freeze thawed multiple times and have not suboptimal remained at room temperature for too long Verify that the amount of primers you are using is correct 22 Technical Support Obtaining Support Safety Data Sheets SDS Certificate of Analysis Limited Product Warranty For the latest services and support information for all locations go to www lifetechnologies com At the website you can e Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities e Search through frequently asked questions FAQs e Submit a question directly to Technical Support techsupport lifetech com e Search for user documents SDSs vector maps and sequences application notes formulations handbooks certificates of analysis citations and other product support documents e Obtain information about customer training e Download software updates and patches Safety Data Sheets SDSs are available at www lifetechnologies com support The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available
31. the specific miRNA sequence of interest see page 3 for design guidelines Continued on next page Introduction continued Worktlow SR RA Diagram Polyadenylation reaction 5 O3 Poly A tail First strand cDNA synthesis with SuperScript III RT and Universal RT Primer 5 II 0203 3 M CF First strand cDNA Universal RT Primer qPCR using an miRNA specific forward primer and the Universal qPCR Primer miRNA specific Primer n o 3 11111111105 RL Universal qPCR Primer Data analysis Advantages The NCode kits have the following advantages of the Kit e Starting material can range from 10 ng to 2 5 ug of total RNA enrichment of miRNAs is typically not required e No proprietary primers or primer probe assays required for qPCR you can design your own primers for any miRNA sequence from any species e Can discriminate between miRNAs that differ by a single nucleotide for profiling closely related templates e Catalog nos MIRC 10 and MIRC 50 The Universal qPCR Primer included in the kit gives you the flexibility to order your qPCR detection reagents separately e Catalog no MIRO 100 Platinum SYBR Green qPCR SuperMix UDG included in the kit ensures high sensitivity and performance in qPCR using SYBR Green I fluorescent dye Catalog no MIRQER 100 SYBR GreenER qPCR SuperMix Universal included in the kit ensures optimal sensitivity and performance in qPCR using a novel flu
32. ysis can identify primer dimers by their lower annealing temperature compared to that of the amplicon The presence of primer dimers decreases PCR efficiency and obscures analysis and determination of cycle thresholds For more information visit www lifetechnologies com qpcr The Bio Rad iCycler requires the use of fluorescein as a reference dye to normalize the fluorescent reporter signal with SYBR Green and SYBR GreenER SuperMixes Fluorescein NIST Traceable Standard is available from Life Technologies as a 50 uM solution see page vi If you are ordering a SYBR GreenER SuperMix as a separate component you can order SYBR GreenER qPCR SuperMix for iCycler instrument which includes fluorescein in the mix see page vi We recommend using a final concentration of 50 nM as a general starting point in qPCR Optimal results may require a titration between 10 and 100 nM qPCR Using SYBR Green SuperMix Introduction This section provides a general protocol for qPCR on Applied Biosystems real time instruments using Platinum SYBR Green qPCR SuperMix UDG Note e Since PCR is a powerful technique capable of amplifying trace amounts of DNA all appropriate precautions should be taken to avoid cross contamination e For multiple reactions prepare a master mix of common components with a 10 overage for accurate pipetting add the appropriate volume to each tube or plate well and then add t
Download Pdf Manuals
Related Search