GenTarget`s EcoTMPlasmid DNA Miniprep Kit User Manual
Contents
1. Do not incubate plates longer than 16 hours At colony pick try to avoid the tiny satellite colonies Related Products Cat Product Name Amount Application DP 100 Eco Plasmid DNA 100 High pure Plamsid DNA isolation Miniprep Kit miniprep CC03 Eco E Coli expression 20 Competent cells for T7 vector protein CC03p Competent Cells rxn pack expression RM1000 Eco Expression 1000ml ea Auto induction High yield protein RichMedium expression medium EB S100 Eco Buster E Coli 100ml ea Protein extraction from cell pellets EB L100 protein extraction reagent PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for IC 1001 PCR cloning kit kit o Nami of N term His tagged PCR cloning kit with a built in mammalian expression vector with neomycin selection marker in provided cloning cells The vector containing an engineered super CMV promoter for high yield mammalian IC 1002 PCR cloning kit kit expression of N term His tagged protein Eco Cloning pEco ENTRY manual Page 6 of 7 www gentarget com GenTarget Inc Copyrights 2009 G 6640 Lusk Blvd Suite A107 San Diego CA 92121 ell arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com PCR cloning kit with a built in vector non T7 promoter based in provided cloning cells for E Coli expression of N term His tagged PCR cloning kit kit protein specially designed for toxic2. most case the pasted sequence is ATG to last codon Cloning site for pEco ENTRY vector AGTCTTAAGC TCGGGCCC TCAGAATTCG AGCCCGGG PCR Insert C NNNNNNNNNA G NNNNNNNNNT Fe corncerce T GATATCCCCT ee S CTATAGGGGA pEco ENTRY Vector puc19 ori attL1 569 668 GOI cloning ends 670 671 attL2 771 672 Kanamycin 941 1750 pUC19 ori 1871 2544 co Cloning pEco ENTRY manual Page 5 of 7 www gentarget com GenTarget Inc Copyrights 2009 Trouble shooting 6640 Lusk Blvd Suite A107 San Diego CA 92121 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Problems Solution No colony Be sure to set up a positive control transformation using provided positive PCR insert1 which should give you 10 100 colonies Spread all transformation mixture on plate Background Be sure to set up a background control plate in which no colonies PCR was added into cells it should generate 0 5 colonies or less than 10 compared to plates with insert Noticed in the absence of PCR insert cells forces vector self ligation resulted in a few background colonies Make sure that the PCR s template do not cause background colony If it does clean PCR products by gel isolation or treated by DPNI Plate less transformation mixture on plate Satellite Be sure to use right amount of antibiotics in LB plate and colonies make fresh LB plates if necessary
3. of PCR products making perfect Gateway Entry clones High efficient gt 90 positive rate and low background Works fine with any PCR products with or without a 3 end s A overhung the extra A overhang if exists will be removed in cloning step Good for different PCR sizes from 200bp to 6 kb Great for high through put cloning Protocol Outline Produce PCR products and clean them v Add 1 2ul of PCR product into provided Cloning cells Briefly mixing and immediately proceed to transformation Y Pick colonies save glycerol stocks and miniprep plasmids to verify the positive clones Eco Cloning pEco ENTRY manual Page 2 of 7 www gentarget com GenTarget Inc Copyrights 2009 G 6640 Lusk Blvd Suite A107 San Diego CA 92121 ell arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Detailed protocols 1 PCR primer design The PCR primers used for generating inserts for Eco Cloning must contains a 20 25bp homologous sequences corresponding to the built in vector Design your primer pair as follows Fwd 5 tttgtacaaaaaagcaggcacc 20bp of 5 end gene specific forward sequence Rev 5 tttgtacaagaaagctggett 20bp of 3 end gene specific reverse sequence Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example for PCR primer design To design the primer pair for the following gene s
4. G 6640 Lusk Blvd Suite A107 San Diego CA 92121 ell arde ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco ENTRY Eco PCR cloning Kit User Manual Cloning PCR products for making Gateway Entry clone Cat Contents Amounts Application pEco ENTRY vector 10 tubes x 50ul ea Make Gateway built in Eco Cloning for 10 rxn Entry clone IC 1005 cells without using BP Positive PCR insert 1 x 10ul ea clonase Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description Introduction GenTarget s proprietary fusion in vivo Patent pending Eco cloning technology is a revolutionized and the easiest PCR cloning method Simply amplifies your gene of interest with primer pair that flanked with short homologous arm to the expression vector ends then add lul of purified PCR into the engineered Ready to use Cloning cells and immediately proceed to transformed How it works Q gt Target PCR Add PCR to cells ee ap 1 amp _ Transformation Ste we oe In vivo cloning Oe Eco Cloning pEco ENTRY manual Page 1 of 7 www gentarget com GenTarget Inc Copyrights 2009 G 6640 Lusk Blvd Suite A107 San Diego CA 92121 ell arue
5. equence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgcttacctgttg ccaacattgeggccaacccgaattcttcccaatctttatcttggctgccagcgagatgtcctcaac aaggagctgatgcagcagaatgg gattggttatgtgttaaatgccagcaatacctgtccaaage ctgacttttta Its PCR primer for vector pEco ENTRY will be Fwd 5 tttgtacaaaaaagcaggcaccatggcctctgtgaaggaaaa Rev 5 tttgtacaagaaagctggettaaagtcagectttggacagg Note 1 Gentarget s different cloning kits share same PCR Insert For example the three Eco cloning cells Cat IC 1001 IC 1002 and IC 1003 can use the same PCR to make different expression clones And other three cloning cells Cat IC 1005 IC 1006 and IC 1007 can share the same PCR product for making different expression clones 2 Stop codon is optional to be included in PCR reverse primer Note To express C term tag protein do not include a stop codon So after this ENTR clone is swapped into DEST express vector the target will be expressed in frame with C term tag from that DEST vector 2 Target amplification by PCR Using any PCR amplification protocols that work for you to amply your targets To minimize the PCR errors we recommend using high fidelity DNA polymerase Using any PCR purification column to clean your PCR products If you do not obtain a single discrete band from your PCR you need gel purify your fragment Eco Cloning pEco ENTRY manual Page 3 of 7 www gentarget com GenTarget Inc Copyrights 2009 6640 Lusk Blvd S
6. gh through put cloning purpose we recommend simply add 1 2ul of PCR into cloning cells regardless of the PCR s concentration and sizes it will generate enough colonies 5 100 colonies in general for downstream works 4 Verification of positive clones Pick 3 5 colonies propagate in LB Kanamycin incubate at 370C overnight Isolate the plasmid DNAs using DNA miniprep kit such as Eco Plasmid DNA Miniprep Kit Cat DP 100 Confirm the positive by restriction digestion PCR inset can be cut out by BsrGI Run 1 2 agarose two bands 2 55 kb backbone the PCR insert or multiple bands when the sites exist within the PCR insert Final sequencing verification Use provided sequencing primer pair Note sequencing primer was provided as ready to use dilution use lul for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector Forward primer Reverse primer IC 1005 pEco ENTR IC 1005 fwd IC 1005 rev 5 gtaaaacgacggccag 5 taatacgactcactatagge Eco Cloning pEco ENTRY manual Page 4 of 7 www gentarget com GenTarget Inc Copyrights 2009 G 6640 Lusk Blvd Suite A107 San Diego CA 92121 ell arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Vector maps The figure below summarizes the vector map of pEco ENTRY The complete nucleotide sequence is available for downloading from our Website at RESOURCES page www gentarget com In
7. ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Gentarget s Eco PCR Cloning Kit utilizes an engineered E Coli strain with enhanced homologous recombination machinery for an Jn Vivo end homologous jointing reaction between PCR product and vector The vector was pre processed with the cloning cell using a proprietary protocol to obtain high cloning efficiency and low background It does not need any kinds of Jn Vitro tube reaction such as ligation Topo jointing or In fusion reaction and so on Let the E Coli do the job for you In Vivo pEco ENTRY cloning cells was built in with a Gateway fully compatible ENTRY clone vector PCR insert will be cloned to make the ENTRY clone that can be used to make any kinds of Gateway DEST clones via a LR reaction Note GenTarget provides Eco cloning cells for making DEST clones also without using LR clonase And the same PCR product is good for make either ENTRY clone or DEST clone Key Features 1 D3 D 99 The most cost effective and the easiest PCR cloning method simply add lul of PCR insert into provided cells for transformation regardless of the insert s size and concentration No need to buy Gateway vector The vector was built in with cloning cells No need to buy cloning competent cells The cloning cells is the competent cells No need to buy Gateway clonase There is no need for any enzymes or any tube reactions Precisely directional cloning
8. proteins IC 1003 PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term GST tagged Ic 1004 PCR cloning kit kit protein PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of C term His tagged S protein IC 1006 PCR cloning kit kit PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His tagged IC 1007 PCR cloning kit kit protein i References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Eco Cloning pEco ENTRY manual Page 7 of 7 www gentarget com GenTarget Inc Copyrights 2009
9. uite A107 San Diego CA 92121 el arde ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Important if your PCR template can generate background clones having Amp resistance you need treat your PCR product by DPNI or do gel purification of PCR product 3 Transformation Thaw Eco Cloning cells in ice water After completely thawed add 1 2ul purified PCR product from 20ng to 150ng into each vial of cells brief mixing by taping the tube with your finger For control vials add lul positive PCR insert provided as positive control and add 1ul water to a a negative control vial cells Put tubes back on ice and then proceed for heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250ul of SOC medium incubated at 37 C shaking for 1hr Plating take 50ul 200ul aliquot spread out on pre warmed LB agar plates containing 50ug ml Kanamycin And grow colonies at 37 C incubator for overnight Note usually in the absence of PCR insert cells force some background colonies the no insert negative control generates a few colonies But in the presence of PCR insert greater than 90 colonies are positive Colony number varies dependent the quality and quantity of PCR products The concentration of purified PCR product can be from 20ng ul to 150ng ul with sizes from 200bp to 10kb For the simplicity and hi
Download Pdf Manuals
Related Search