pEF6/His A, B, and C - Thermo Fisher Scientific
Contents
1. 60 mm plate for each time point and allow cells to adhere overnight The next day substitute culture medium with medium containing varying concentrations of blasticidin e g 0 1 3 5 7 5 and 10 pg mL Replenish the selective medium every 3 4 days Cells sensitive to blasticidin will round up and detach from the plate Dead cells will accumulate in the medium Count the number of viable cells at regular intervals to determine the appropriate concentration of blasticidin that prevents growth Once the appropriate blasticidin concentration is determined generate a stable cell line with your construct Colonies can generally be identified in 7 to 10 days with complete selection and expansion in 2 weeks 1 Transfect your cells using the appropriate protocol for your cell line Include a sample of untransfected cells as a negative control After transfection wash the cells once with 1X PBS and add fresh medium to the cells 48 hours after transfection split the cells into fresh medium containing blasticidin at the appropriate concentration for your cell line Split the cells such that they are no more than 25 confluent Replenish selective medium every 34 days until blasticidin resistant colonies are detected Pick and expand colonies Continued on next page 11 Creating Stable Cell Lines Continued Preparing Cells for Use the procedure below to prepare cells for lysis prior to purifying your Lysis Ly2. B and C Continued Kozak Sequence for Mammalian Expression If you will be recombining your entry clone with a destination vector for mammalian expression your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G A NNATGG Multiple Cloning Site of pEF6 His A 1579 1659 1734 1800 1866 1929 Below is the multiple cloning site for pEF6 His A Restriction sites are labeled to indicate the cleavage site The boxed nucleotide indicates the variable region Note that there is a stop codon after the Xba I site The multiple cloning site has been confirmed by sequencing and functional testing The sequence may be downloaded from www invitrogen com or requested from Technical Support see page 18 For more information on the hEF 1a promoter see page 13 3 end of hEF 1a Intron 1 GTTTGGATCT TGGTTCATTC TCAAGCCTCA GACAGTGGTT CAAAGTTTTT TICTICCATT TCAGGTGTCG TGAGGAATTA 5 end of hEF 1a Exon 2 T7 promoter priming sit
3. Benefit Human elongation factor 1a hEF 1a Permits overexpression of your recombinant protein in a broad range of mammalian cell types Goldman promoter et al 1996 Mizushima and Nagata 1990 T7 promoter priming Allows for in vitro transcription in the sense site orientation and sequencing through the insert N terminal Permits purification of your recombinant protein on polyhistidine tag metal chelating resin such as ProBond Xpress epitope tag Allows for the detection of an 8 amino acid epitope Asp Leu Tyr Asp Asp Asp Asp Lys on the recombinant protein with the Anti Xpress Antibody Enterokinase cleavage site Allows for the removal of the N terminal polyhistidine tag from the recombinant protein using an enterokinase such as EKMax Enterokinase see page 17 Multiple cloning site in three reading frames Allows insertion of your gene and facilitates cloning in frame with the polyhistidine N terminal tag and TM the Xpress epitope BGH reverse priming site Permits sequencing through the insert Bovine growth hormone Efficient transcription termination and BGH polyadenylation polyadenylation of mRNA Goodwin and Rottman signal 1992 fl origin Allows for the rescue of single stranded DNA SV40 early promoter Allows efficient high level expression of the and origin blasticidin resistance gene and episomal replication in cells expressing SV40 la
4. NH2 O Always wear gloves mask goggles and protective clothing e g a laboratory coat when handling blasticidin Weigh out blasticidin and prepare solutions in a hood Continued on next page Creating Stable Cell Lines Continued Preparing and Storing Stock Solutions Possible Sites for Linearization Blasticidin may be obtained from Invitrogen in 50 mg aliquots see page 17 for ordering information Blasticidin is soluble in water and is generally used to prepare stock solutions of 5 to 10 mg mL e Dissolve blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use see last point below and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 2 weeks at 4 C and 6 8 weeks at 20 C e The pH of the aqueous solution should not exceed 7 to prevent inactivation of blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and discard the unused portion To obtain stable transfectants you may choose to linearize your vector before transfection While linearizing your vector may not improve the efficiency of transfection it increases the likelihood that the vector will not integrate in a way that disrupts the gene of interest The table below lists unique sites that may be used to linearize your con
5. ProBond Purification System 6 purifications K850 01 ProBond Resin 50 mL R801 01 150 mL R801 15 For your convenience Invitrogen offers an extensive selection of restriction enzymes including the following e Sspl e Mlul e Scal Visit www invitrogen com for more details 17 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech supportQinvitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty 18 Material Safety Data She
6. AGGG GTCGGCAATT GAACCGGTGC CTAGAGAAGG TGGCGCGGGG 579 TAAACTGGGA AAGTGATGTC GTGTACTGGC TCCGCCTTTT TCCCGAGGGT GGGGGAGAAC TATA box Start of Transcription 639 CGTATATAAG TGCAGTAGTC GCCGTGAACG TTCTTTTTCG CAACGGGTTT GCCGCCAGAA P Exon I 5 end of Intron I 699 CACAGGTAAG TGCCGTGTGT GGTTCCCGCG GGCCTGGCCT CTTTACGGGT TATGGCCCTT 759 GCGTGCCTTG AATTACTTCC ACCTGGCTGC AGTACGTGAT TCTTGATCCC GAGCTTCGGG 819 TTGGAAGTGG GTGGGAGAGT TCGAGGCCTT GCGCTTAAGG AGCCCCTTCG CCTCGTGCTT 879 GAGTTGAGGC CTGGCCTGGG CGCTGGGGCC GCCGCGTGCG AATCTGGTGG CACCTTCGCG 939 CCTGTCTCGC TGCTTTCGAT AAGTCTCTAG CCATTTAAAA TTTTTGATGA CCTGCTGCGA 999 CGCTTTTTTT CTGGCAAGAT AGTCTTGTAA ATGCGGGCCA AGATCTGCAC ACTGGTATTT Sp 1 o 1059 CGGTTTTTGG GGCCGCGGGC_GGCGACGGGG CCCGTGCGTC CCAGCGCACA TGTTCGGCGA Sp 1 1119 GGCGGGGCCT GCGAGCGCGG CCACCGAGAA TCGGACGGGG GTAGTCTCAA GCTGGCCGGC Sp 1 Sp 1 1179 CTGCTCTGGT GCCTGGCCTC GCGCCGCCGT GTATEGCCCC GCCCHGGGCG GCAAGGCTGG 1239 CCCGGTCGGC ACCAGTTGCG TGAGCGGAAA GATGGCCGCT TCCCGGCCCT GCTGCAGGGA Sp I 1299 GCTCAAAATG GAGGACGCGG CGCTCGGGAG AGICGGGCGGG TGAGTCACCC ACACAAAGGA Ap 1 1359 AAAGGGCCTT TCCGTCCTCA GCCGTCGCTT CATGEGACTC CACGGAGTAC CGGGCGCCGT 1419 CCAGGCACCT CGATTAGTTC TCGAGCTTTT GGAGTACGTC GTCTTTAGGT TGGGGGGAGG 1479 GGTTTTATGC GATGGAGTTT CCCCACACTG AGTGGGTGGA GACTGAAGTT AGGCCAGCTT 1539 GGCACTTGAT GTAATTCTCC TTGGAATTTG CCCTTTTTGA GTTTGGATCT TGGTTCATTC 3 end of Intron 1 1599 TCAAGCCTCA GACAGTGGTT CAAAGTTTTT TTCTTCCATT TCAGGTGTCG TGA 5 end of Exon 2 13 pEF6 H
7. CC AGT GTG GTG GAA TTC TGC AGA TAT CCA GCA CAG TGG CGG CCG CTC Asp Asp Lys Val Pro Gly Ser Ser Val Val Glu Phe Cys Arg Tyr Pro Ala Gln Trp Arg Pro Leu el EKR ition sit S EK Cleavage site Xbal Pme BGH Reverse priming site 1 1866 GAG TCT AGA GGG CCC GTT TAA AC CCGCTGATCA GCCTCGACTG TGCCTTCTAG TIGCCAGCCA TCTGTTGTTT Glu Ser Arg Gly Pro Val BGH polyadenylation signal 1939 GCCCCTCCCC CGTGCCTTCC TTGACCCTGG AAGGTGCCAC TCCCACTGTC CTTTCCTAAT AAAATGAGGA AATTGCATCG 2019 CATTGTCTGA GTAGGTGTCA TTCTATTCTG GGGGGTGGGG TGGGGCAGGA CAGCAAGGGG GAGGATTGGG AAGACAATAG There are two BstX I sites in the multiple cloning site Continued on next page Cloning into pEF6 His A B and C Continued E coli Transform the ligation mixtures into a competent recA endA E coli strain e g Transformation TOP10F INVaF and select on LB plates containing 50 100 pg mL ampicillin or 50 pg mL blasticidin Select 10 20 clones and analyze for the presence and orientation of your insert i Sequence your construct with the T7 Forward and BGH Reverse primers see NS ad page 17 for ordering information to confirm that your gene is fused in frame E Je with the Xpress epitope and the N terminal polyhistidine tag Refer to the diagrams on pages 3 5 for the sequences and locations of the priming sites For your convenience Invitrogen offers a custom primer service For more information visit www invitrogen com or call Technical S
8. L 5 M NaCl 3 mL Nonidet P 40 1 mL 2 Bring the volume to 90 mL with deionized water and adjust the pH to 7 8 with HCL 3 Bring the volume to 100 mL Store at room temperature Note Protease inhibitors may be added at the following concentrations 1 mM PMSF 1 pg mL Pepstatin 1 ug mL Leupeptin Creating Stable Cell Lines Introduction Blasticidin Molecular Weight Formula and Structure Handling Blasticidin The pEF6 His vectors contain the blasticidin resistance gene for selection of stable cell lines using blasticidin Test the sensitivity of your mammalian host cell to blasticidin as natural resistance varies among cell lines General information and guidelines are provided below for your convenience Blasticidin S HCI is a nucleoside antibiotic isolated from Streptomyces griseochromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cells Takeuchi et al 1958 Yamaguchi et al 1965 Resistance is conferred by expression of either one of two blasticidin S deaminase genes bsd from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for blasticidin is C H2 N O5 HCL and the molecular weight is 458 9 The diagram below shows the structure of blasticidin NH2 SEN Ps HOOC O CH3 HCI a da al NH
9. LB agar plates After about 12 hours isolate colonies for downstream usage This will isolate your desired clones from potential background contaminants Transfection Introduction Plasmid Preparation Methods of Transfection Positive Control Assay for B galactosidase Activity Note Purification After confirming that your construct is in the correct orientation and fused in frame with the N terminal peptide transfect your cell line of choice Include the positive control vector and a mock transfection to evaluate your results Plasmid DNA for transfection into eukaryotic cells must be clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency Isolate DNA using the PureLink HiPure Miniprep Kit the PureLink HiPure Midiprep Kit see page 17 for ordering information or CsCl gradient centrifugation For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection Precisely follow the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Reference section page 21 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipi
10. cloning site has been confirmed by sequencing and functional testing The sequence may be downloaded from www invitrogen com or requested from Technical Support see page 18 For more information on the hEF 1a promoter see page 13 3 end of hEF 1a Intron 1 1579 GTTTGGATCT TGGTTCATTC TCAAGCCTCA GACAGTGGTT CAAAGTTTTT TTCTTCCATT TCAGGTGTCG TGAGGAATTA 5 end of hEF 1a Exon 2 T7 promoter priming site I 1 re AEE 1659 GCTTGGTACT AATACGACTC ACTATAGGGA GACCCAAGCT GGCTAGTTAA GCTTACC ATG GGG GGT TCT CAT CAT Met Gly Gly Ser His His Polyhistidine Region Xpress epitope 1 j 1734 CAT CAT CAT CAT GGT ATG GCT AGC ATG ACT GGT GGA CAG CAA ATG GGT CGG GAT CTG TAC GAC GAT His His His His Gly Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp718 I Kpn lBsu36 BamH I BstxI EcoRI EcoR V BstX Not I ZL 1 I I l I 1800 GAC GAT AAG GTA CCT AAG GAT CCA GTG TGG TGG AAT TCT GCA GAT ATC CAG CAC AGT GGC GGC CGC Asp Asp Lys Val Pro Lys Asp Pro Val Trp Trp Asn Ser Ala Asp Ile Gln His Ser Gly Gly Arg EK Recognition ste EK Recognition site EK Cleavage site Xba I Pme BGH Reverse priming site l l f 1 1866 TCG AGT CTA GAG GGC CCG TTT AAA CCC GCT GAT CAG CCT CGA CTG TGC CTT CTA GTT GCC AGC CAT Ser Ser Leu Glu Gly Pro Phe Lys Pro Ala Asp Gln Pro Arg Leu Cys Leu Leu Val Ala Ser His 1932 CTG TTG TTT GCC CCT CCC CCG TGC CTT CCT TGA CCCT GGAAGGTGCC ACTCCCACTG TCCTTTCCTA Leu Leu Phe Ala Pro Pro Pro Cys Leu P
11. d mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cells use Lipofectamine 2000 Reagent available from Invitrogen see page 17 pEF6 His lacZ is provided as a positive control vector for mammalian transfection and expression see page 16 It may be used to optimize transfection conditions for your cell line The gene encoding B galactosidase is expressed in mammalian cells under the control of the hEF la promoter A successful transfection will result in P galactosidase expression that can be easily assayed You may assay for B galactosidase expression by activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers the P Gal Assay Kit and the B Gal Staining Kit see page 17 for ordering information for fast and easy detection of B galactosidase expression The N terminal peptide containing the Xpress epitope and the polyhistidine tag will add approximately 3 4 kDa to your protein You will need 5 x 10 to 1 x 107 of transfected cells for purification of your protein on a 2 mL ProBond column or other metal chelating column Refer to the manufacturer s instructions before attempting to purify your fusion protein To prepare cells for lysis see the protocol on page 12 Continued on next page Transfection Continued Detecting Fusi
12. e T 1 EEE GCTTGGTACT AATACGACTC ACTATAGGGA GACCCAAGCT GGCTAGTTAA GCTTACC ATG GGG GGT TCT CAT CAT Polyhistidine Region Met Gly Gly Ser His His Xpress epitope 1 ij CAT CAT CAT CAT GGT ATG GCT AGC ATG ACT GGT GGA CAG CAA ATG GGT CGG GAT CTG TAC GAC GAT His His His His Gly Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp7181 Kpnl BamH I BstX I EcoRI EcoR V BstX Not I Fae moter guld GAC GAT AAG GTA C I CH AGG ATC CAG TGT GGT GGA ATT CTG CAG ATA TCC AGC ACA GTG GCG GCC GCT Asp Asp Lys Val Pro Arg Ile Gln Cys Gly Gly Ile Leu Gln Ile Ser Ser Thr Val Ala Ala Ala S EK Recognition site Xba EK Cleavage site Pme BGH Reverse priming site I 1 CGA GTC TAG AGG GCC CGT TTA AAC CCG CTG ATC AGC CTC GAC TGT GCC TTC TAG TTGCCAGCC Arg Val Arg Ala Arg Leu Asn Pro Leu Ile Ser Leu Asp Cys Ala Phe BGH polyadenylation signal 71 ATCTGTTGTT TGCCCCTCCC CCGTGCCTTC CTTGACCCTG GAAGGTGCCA CTCCCACTGT CCTTTCCTAA TAAAATGAGG 2009 AAATTGCATC GCATTGTCTG AGTAGGTGTC ATTCTATTCT GGGGGGTGGG GTGGGGCAGG ACAGCAAGGG GGAGGATTGG There are two BstX I sites in the multiple cloning site Continued on next page Cloning into pEF6 His A B and C Continued Multiple Cloning Below is the multiple cloning site for pEF6 His B Restriction sites are labeled to Site of pEF6 His B indicate the cleavage site The boxed nucleotides indicate the variable region The multiple
13. ein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 2009 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 22 invitrogen Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech supporteinvitrogen com For country specific contact information visit our web site at www invitrogen com
14. ets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional ty
15. fusion bases 1839 4888 BGH reverse priming site bases 4966 4983 BGH polyadenylation sequence bases 4969 5196 f1 origin of replication bases 5242 5670 SV40 promoter and origin bases 5697 6006 EM 7 promoter bases 6054 6109 Blasticidin resistance gene ORF bases 6128 6526 SV40 polyadenylation sequence bases 6684 6814 pUC origin bases 7197 7870 Ambpicillin resistance gene ORF bases 8015 8875 complementary Accessory Products Additional Products Restriction Enzymes The following additional products may be used with the pEF6 His vectors For more information visit www invitrogen com or contact Technical Support see page 18 Item Quantity Cat no Electrocomp Kit TOP10F 2 x 20 reactions C665 11 6 x 20 reactions C665 24 One Shot TOP10F Chemically Competent 20 x 50 pL C3030 03 E coli One Shot INVaF Chemically Competent E coli 20 x 50 uL C2020 03 40 x 50 pL C2020 06 Ampicillin 200 mg 11593 027 Blasticidin 50 mg R210 01 Carbenicillin 58 10177 012 T7 promoter primer 2 ug N560 02 BGH Reverse primer 2 ug N575 02 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 Lipofectamine 2000 Reagent 1 5 mL 11668 019 B Gal Assay Kit 1 kit K1455 01 B Gal Staining Kit 1 kit K1465 01 Anti Xpress Antibody 50 uL R910 25 EKMax Enterokinase 250 units E180 01
16. iency Transformation of Mammalian Cells by Plasmid DNA Molec Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goldman L A Cutrone E C Kotenko S V Krause C D and Langer J A 1996 Modifications of Vectors pEF BOS pcDNA1 and pcDNA3 Result in Improved Convenience and Expression BioTechniques 21 1013 1015 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exper Cell Res 197 229 233 Kim D W Uetsuki T Kaziro Y Yamaguchi N and Sugano S 1990 Use of the Human Elongation Factor 1 Promoter as a Versatile and Efficient Expression System Gene 91 217 223 Kimura M Takatsuki A and Yamaguchi I 1994 Blasticidin S Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Ce
17. invitrogen pEF6 His A B and C Catalog no V963 20 Rev date 28 October 2009 Manual part no 25 0240 MAN0000082 ii Table of Contents Contents and Storage aar een i ke headed friskere cheese an deel dy obese epee iv NTOAUGHON ai A AA AA Re 1 Product Overview ai eL Ad aaa ai a Iii enn 1 A O 2 Cloning into pEP6 His A Brand Chunasusesenssusteiiunisntontiehnnunkdenasuniiiniiugnnusknumun 2 TELAS CCOO stein NA LIST SES 7 Creating Stable Cell Mesias A eee anness 9 ord glen 13 Hum n EF la Promoters nmr A a idad iia 13 pEF6 His AB andEVecir Sicilia aa 14 PEES EIA AT 16 A A NO 17 Technical Supportissajnssaskturkiesnkre raise gell bean 18 Purchaser Notification ze nnee A SERGE bre a EEE 19 Retro desma iseen 21 ili Contents and Storage Shipping and pEF6 His vectors are shipped on wet ice Upon receipt store vectors at 20 C Storage Contents 20 ug each of pEF6 His A B and C are supplied at 0 5 ug uL in 10 mM Tris HCI 1 mM EDTA pH 8 0 in a total volume of 40 pL 20 ug of pEF6 His lacZ is supplied at 0 5 ug uL in 10 mM Tris HCI 1 mM EDTA pH 8 0 in a total volume of 40 pL Introduction Product Overview Description of the System Experimental Outline pEF6 His A B and C are 5 8 kb vectors designed for high level expression and purification of recombinant proteins in mammalian cell lines Refer to page 15 for specific features of the vectors that allow for purification and detection of e
18. is A B and C Vectors Map of pEF6 His The figure below summarizes the features of the pEF6 His vectors The 14 sequences for pEF6 His A B and C can be downloaded from www invitrogen com or requested from Technical Support see page 18 00 Xpress EK Recognition Mx ATG 6xHis Epitope Site z I Comments for pEF6 His C 5822 nucelotides Bsu36 I is unique to version B EF 1a promoter bases 474 1651 There is a stop codon T7 promoter priming site bases 1668 1687 following the Xba site ATG initiation codon bases 1716 1718 in version A Polyhistidine 6xHis region bases 1728 1745 Xpress epitope bases 1785 1808 t There is a stop codon Enterokinase recognition site bases 1794 1808 in the Pme site in Multiple cloning site bases 1808 1887 version C BGH reverse priming site bases 1900 1917 BGH polyadenylation sequence bases 1903 2130 f1 origin of replication bases 2176 2604 SV40 promoter and origin bases 2631 2939 EM 7 promoter bases 2986 3041 Blasticidin resistance gene ORF bases 3060 3458 SV40 polyadenylation sequence bases 3616 3746 pUC origin bases 4130 4803 Ampicillin resistance gene ORF bases 4948 5808 complementary Continued on next page pEF6 His A B and C Vectors Continued Features of pEF6 His pEF6 His A 5 823 bp pEF6 His B 5 824 bp and pEF6 His C 5 822 bp contain the following elements All features have been functionally tested Feature
19. is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept retu
20. lls Biochim Biophys ACTA 1219 653 659 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Mizushima 5 and Nagata 5 1990 pEF BOS a Powerful Mammalian Expression Vector Nucleic Acids Res 18 5322 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 Continued on next page 21 References Continued Uetsuki T Naito A Nagata S and Kaziro Y 1989 Isolation and Characterization of the Human Chromosomal Gene for Polypeptide Chain Elongation Factor 1 J Biol Chem 264 5791 5798 Wigler M Silverst
21. nt and the method of choice for large plasmids To propagate and maintain pEF6 His A B and C use the supplied 0 5 ug ul stock solution in TE pH 8 0 to transform a recA recombination deficient endA endonuclease A deficient E coli strain such as TOP10F INVaF or equivalent see page 17 for ordering information Select transformants on LB plates containing 50 100 pg mL ampicillin or 50 pg mL blasticidin Be sure to prepare a glycerol stock of each plasmid for long term storage see page 6 The pEF6 His vectors are fusion vectors To ensure proper expression of your recombinant protein you must clone your gene in frame with the ATG at base pairs 1716 1718 This will create a fusion with the N terminal polyhistidine tag Xpress epitope and the enterokinase cleavage site The vector is supplied in three reading frames to facilitate cloning See the diagrams on pages 3 5 to develop a cloning strategy If you wish to clone as close as possible to the enterokinase cleavage site follow the guidelines below e Digest pEF6 His A B or C with Kpn I e Create blunt ends with T4 DNA polymerase and dNTPs See Ausubel et al 1994 for a detailed protocol e Clone your blunt ended insert in frame with the lysine codon AAG of the enterokinase recognition sequence Following enterokinase cleavage no vector encoded amino acid residues will be present in your protein Continued on next page Cloning into pEF6 His A
22. on Proteins Cell Lysis Buffer The Anti Xpress Antibody is available from Invitrogen and can be used to detect expression of your fusion protein from pEF6 His see page 17 To detect the fusion protein by western blot prepare a cell lysate from transfected cells We recommend that you perform a time course to optimize expression of the fusion protein e g 24 48 72 hours etc after transfection To lyse cells 1 Wash cell monolayers 10 cells once with phosphate buffered saline PBS 2 Scrape cells into 1 mL PBS and pellet the cells at 1 500 x g for 5 minutes 3 Resuspend in 50 pL Cell Lysis Buffer see below or other suitable lysis buffer 4 Incubate cell suspension at 37 C for 10 minutes to lyse the cells 5 Centrifuge at 10 000 x g for 10 minutes to pellet nuclei and transfer the post nuclear lysate to a new tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 6 Add SDS PAGE sample buffer to a final concentration of 1X and boil the sample for 5 minutes 7 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your fusion protein 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 Prepare the solution from the following common stock solutions For 100 mL combine Stock Solution Volume 1 M Tris base 5 m
23. pographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Containing Sequences Coding for Histidine Hexamer The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer
24. rge T antigen EM 7 promoter Allows for the expression of the blasticidin resistance gene in E coli Blasticidin resistance gene bsd Selection of transformants in E coli and stable transfectants in mammalian cells Kimura et al 1994 SV40 polyadenylation Efficient transcription termination and signal polyadenylation of mRNA pUC origin High copy number replication and growth in E coli Ampicillin resistance gene P lactamase Selection of transformants in E coli 15 pEF6 His lacZ Description pEF6 His lacZ is a 8 889 bp control vector containing the gene for B galactosidase pcDNA6 His lacZ was digested with Sca I and Kpn I to remove the CMV promoter A 2 1 kb Sca I Kpn I fragment containing the EF 1a promoter was ligated into pcDNA6 His lacZ to create pEF6 His lacZ Map of Control The figure below summarizes the features of the pEF6 His lacZ vector The Vector 16 sequence for pEF6 His lacZ can be downloaded from www invitrogen com or requested from Technical Support see page 18 A Xpress EK Recognition ATG 6xHis Epitope Site pEF6 His lacZ Comments for pEF6 His lacZ 8889 nucelotides EF 1a promoter bases 471 1653 T7 promoter priming site bases 1670 1689 ATG initiation codon bases 1718 1720 Polyhistidine 6xHis region bases 1730 1747 Xpress epitope bases 1787 1810 Enterokinase recognition site bases 1796 1810 lacZ portion of
25. rn of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 or outlicensing lifetech com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Continued on next page 19 Purchaser Notification Continued Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker 20 Blasticidin and the blasticidin resistance gene bsd are sold under patent license and may be used for research purposes only Inquiries for commercial use should be directed to Kaken Pharmaceutical Company Ltd Bunkyo Green Court Center Office Building 19 20 FI 28 8 Honkomagome 2 chome Bunkyo ku Tokyo 113 8650 Japan Tel 81 3 5977 5008 Fax 81 3 5977 5008 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Chen C and Okayama H 1987 High Effic
26. ro BGH polyadenylation signal 1 1999 ATAAAATGAG GAAATTGCAT CGCATTGTCT GAGTAGGTGT CATTCTATTC TGGGGGGTGG GGTGGGGCAG GACAGCAAGG 2079 GGGAGGATTG GGAAGACAAT AGCAGGCATG CTGGGGATGC GGTGGGCTCT ATGGCTTCTG AGGCGGAAAG AACCAGCTGG There are two BstX I sites in the multiple cloning site Continued on next page Cloning into pEF6 His A B and C Continued Multiple Cloning Below is the multiple cloning site for pEF6 His C Restriction sites are labeled to Site of pEF6 His C indicate the cleavage site Note that there is a stop codon within the Pme I site The multiple cloning site has been confirmed by sequencing and functional testing The sequence may be downloaded from www invitrogen com or requested from Technical Support see page 18 For more information on the hEF 1a promoter see page 13 3 end of hEF 1a Intron 1 1579 GTTTGGATCT TGGTTCATTC TCAAGCCTCA GACAGTGGTT CAAAGTTTTT TTCTTCCATT TCAGGTGTCG TGAGGAATTA 5 end of hEF 1a Exon 2 T7 promoter priming site r 1 1659 GCTTGGTACT AATACGACTC ACTATAGGGA GACCCAAGCT GGCTAGTTAA GCTTACC ATG GGG GGT TCT CAT CAT Met Gly Gly Ser His His Polyhistidine Region Xpress epitope 1 I 1734 CAT CAT CAT CAT GGT ATG GCT AGC ATG ACT GGT GGA CAG CAA ATG GGT CGG GAT CTG TAC GAC GAT His His His His Gly Met Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp7181 Kpn I BamH I BstX I EcoRI EcoR V BstX Not I l l 1800 GAC GAT AAG GTA CCA GGA T
27. sing Cells 12 TM protein on ProBond You will need 5 x 106 to 1 x 107 cells for purification of TM TM your protein on a 2 mL ProBond column see the ProBond Protein Purification manual 1 2 3 Seed cells in five T 75 flasks or 2 to 3 T 175 flasks Grow the cells in selective medium until they are 80 90 confluent Harvest the cells by treating with trypsin EDTA for 2 to 5 minutes or by scraping the cells in PBS Inactivate the trypsin by diluting with fresh medium if necessary and transfer the cells to a sterile microcentrifuge tube Centrifuge the cells at 250 x g for 5 minutes Resuspend the cell pellet in PBS Centrifuge the cells at 250 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 70 C until needed If you are using ProBond resin refer to the ProBond Protein Purification manual for details about sample preparation for chromatography If you are using another metal chelating resin refer to the manufacturer s instructions for recommendations on sample preparation Human EF 1a Promoter Description Appendix The diagram below shows the features of the hEF 1a promoter used in the pEF6 His vectors Mizushima and Nagata 1990 Features are marked as per Uetsuki et al 1989 5 end of human EF la promoter 459 AAGGAGTGGG AATTGGCTCC GGTGCCCGTC AGTGGGCAGA GCGCACATCG CCCACAGTCC 519 CCGAGAAGTT GGGGGG
28. struct prior to transformation Other restriction sites are possible Note that the cleavage site is indicated for versions A B and C of pEF6 His Be sure that your insert does not contain the restriction enzyme site you wish to use to linearize your vector Enzyme Restriction Site bp Location Supplier A B C Ssp I 4 Upstream of hEF 1a promoter Invitrogen Aat I 122 Upstream of hEF 1a promoter Many Mlu I 351 Upstream of hEF 1a promoter Invitrogen Bst11071 3751 A 3752 B 3750 C End of SV40 poly A Roche Sap I 4014 A 4015 B 4013 C Backbone New England Biolabs Eam1105 I 5023 A 5024 B 5022 C Ampicillin gene Roche Fsp I 5245 A 5246 B 5244 C Ampicillin gene New England Biolabs Sca I 5503 A 5504 B 5502 C Ampicillin gene Invitrogen see page 17 for ordering information 10 Continued on next page Creating Stable Cell Lines Continued Selection in Mammalian Cell Lines Selecting Stable Integrants To generate a stable cell line expressing your protein you need to determine the minimum concentration of blasticidin required to kill your untransfected host cell line Typically concentrations between 2 and 10 ug mL blasticidin are sufficient to kill the untransfected host cell line Test a range of concentrations see below to determine the minimum concentration necessary for your cell line 1 Seed cells 2 x 10 cells
29. the correct restriction pattern and use sequencing to confirm that your gene is cloned in frame with the N terminal peptide Transfect your construct into the cell line of choice using your own method of transfection Generate a stable cell line if desired Test expression of your recombinant gene by western blot analysis or other functional assay For ordering information about an antibody against the TM Xpress epitope see page 17 To purify your recombinant protein you may use a metal chelating resin such as ProBond ProBond resin is available separately see page 17 for ordering information Methods Cloning into pEF6 His A B and C Before Starting General Molecular Biology Techniques Transformation Method Maintaining pEF6 His Note Diagrams are provided on pages 3 5 to help you ligate your gene of interest in frame with the N terminal peptide General considerations for ligation and transformation are listed below For help with DNA ligations E coli transformations restriction enzyme analysis purification of single stranded DNA DNA sequencing and DNA biochemistry see Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 See References page 21 You may use any method of your choice for transformation Chemical transformation is the most convenient for most researchers Electroporation is the most efficie
30. upport see page 18 Primer Sequence T7 Forward 5 TAATACGACTCACTATAGGG 3 BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 Preparing a After identifying the correct clone purify the colony and make a glycerol stock Glycerol Stock for long term storage It is also a good idea to keep a DNA stock of your plasmid at 20 C 1 Streak the original colony on an LB plate containing 50 ug mL ampicillin or 50 pg mL blasticidin Incubate the plate at 37 C overnight 2 Isolate a single colony and inoculate into 1 2 mL of LB containing 50 pg mL ampicillin or 50 ug mL blasticidin 3 Grow the culture to mid log phase ODsoo 0 5 0 7 Mix 0 85 mL of culture with 0 15 mL of sterile glycerol and transfer to a cryovial 5 Store at 80 C Applying Selective Take some if not all of the following precautions to prevent your clone from Pressure being overrun by background contaminants e Use carbenicillin instead of ampicillin Carbenicillin is more stable than ampicillin and allows for a longer period of selective pressure e Increase the antibiotic concentration More antibiotic means that your clones will not be overwhelmed by B lactamase buildup e Periodically refresh plate media If you suspect that tubes plates may be beginning to fail spin them down remove the old media and replenish the wells with fresh LB media plus glycerol and antibiotic Streak clones on selective preferably carbenicillin
31. xpressed proteins High level stable and transient expression can be carried out in most mammalian cells The vectors contain the following elements The human elongation factor 1 a hEF 1a subunit promoter provides high level expression in a wide range of mammalian cells Kim et al 1990 Mizushima and Nagata 1990 Uetsuki et al 1989 See page 13 for more information Three reading frames to facilitate in frame cloning with an N terminal tag encoding the Xpress epitope and a polyhistidine 6xHis metal binding tag Blasticidin resistance gene bsd for selection of stable cell lines Kimura et al 1994 Episomal replication in cell lines that are latently infected with SV40 or that express the SV40 large T antigen e g COS7 The control plasmid pEF6 His lacZ is included for use as a positive control for transfection expression and detection in the cell line of choice Use the following outline to clone and express your gene of interest in pEF6 His Consult the multiple cloning sites depicted on pages 3 5 to determine which vector A B or C should be used to clone your gene in frame with TM the N terminal Xpress epitope and polyhistidine tag Ligate your insert into the appropriate vector and transform into E coli Select transformants with 50 to 100 ug mL ampicillin or 50 pg mL blasticidin Analyze your transformants for the presence of insert by restriction digestion Select a transformant with
Download Pdf Manuals
Related Search