Home
mRNAExpress mRNA Synthesis Kit User Manual
Contents
1. 6 Discard flow through and insert the filter back to the Collection Tube for the washing steps 7 Make sure that ethanol has been added to Washing Buffer before use Add 4 mL 100 ethanol to 1 mL 5x Washing Buffer 8 Apply 500 uL Washing Buffer 9 Centrifuge at 10 000 15 000x g 10 000 14 000 rpm for 1 min 10 Discard the Washing Buffer 11 Repeat steps 8 through 10 12 Centrifuge for another 10 30 sec to remove the remaining washing buffer 13 Place the Filter Cartridge to a new Collection Tube supplied 14 Add 50 uL Elution Buffer to the center of Filter Cartridge 15 Close the cap and incubate at 65 70 C for 5 10 min 16 Collect the eluted mRNA by centrifuging for 1 min at 10 000 15 000x g 10 000 14 000 rpm G Analysis of Transcription Products by Gel Electrophoresis and Quantitation by UV Light Absorbance The size of the mRNA products from mRNAExpress mRNA Synthesis Kit can be analyzed by running an aliquot of the reaction on formaldehyde agarose gel The concentration of the mRNA products can be determined by reading the As of a diluted aliquot Typically a 1 50 dilution will give an absorbance reading in the linear range of the spectrometer One Azgo unit corresponds to 40 g mL of mRNA Page 12 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 lll Sample results A Transfection of human foreskin fibroblasts with GFP and RFP mRNAExpress transcripts B Tran
2. PCR Product Spin column Po An purify mRNA w cDNA template Invitro Transcription T7_ S UTR YourmRNAGene _ 3UTRIpolyAl Cap Modified Nucleotides To 5 Cap mRNA AAAAAAAA Degrade cDNA template DNase amp Phosphatase and phosphatase mRNA Treatment a4 Spin Column Cleanup Transfect cells with RNAFection Measure Concentration Ready for Transfection Page 4 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 B otong into pMRNA mRNA Synthesis Vector Preparation of Linearized pMRNA Vector Complete linearization of the vector is critical to achieve successful cloning Incomplete linearization of the vector will result in high background We recommend digesting 2ug pPMRNA vector with EcoR1 and BamH1 in a 50ul reaction for 3 hours or even overnight Use QIAGEN s QlAquick Spin Gel Extraction kit for gel purification and elute the DNA with 30 ul dH2O Check the background of your vector by transforming 1pl 10 100ng linearized and purified vector into competent cells If the background is high continue digesting the remaining vector for a longer time after the addition of more restriction enzyme s A typical restriction digestion is shown below pMRNA vector dul 0 5p g 10X Buffer 4 5ul EcoR1 20U ul 0 5 BamH1 20U uI 0 5pl Nuclease free water 40ul Total 50ul 2 PCR amplification of target gene The pMRNA len
3. SSBI System Biosciences mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 User Manual Check Individual Components for Storage conditions A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 032312 contained in this user manual mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 Contents I Product Information ccccccccceceesseeeeeeeeteeeeeceeeeseaeeeeaeesneeeee 2 A Product DeSCription ec eeeeeeeeeeeeeeeeeeeeeeeeenaeeeeeeaeeeeeeaes 2 B Precautionary Notes 2000 0 ceeeeseeeeeneeeeeeeeneeeeeeaeeeeeenaeeeenea 2 C Kit Components 5 Standard Reactions cc cccceeees 3 D Additional Materials and Instruments Needed 4 3 ll Protocols auian aana iene eae le 4 A Flowchalti ccsncc acinar tadie i ii a a ed 4 B Cloning into pMRNA mRNA Synthesis Vector 5 C Tail PCR Purification of PCR product 9 D IN Vitro Transcription 00 0 eee eeeeeeeeeetee ee liiian 10 E DNase and PhosphataseTreatment ceeceeeeeeeeees 11 F RNA Purheaton eision e enia aiik 11 G Analysis of Transcription Products by Gel Electrophoresis and Quantitation by UV Light Absorbance sessseeeseeseeseee 12 III Sample resulltS wx is cal eee hie eee 13 IV Technical SUPPOM sera tiua h anaa ee htiastidhaseiedhsteeetene 14 V Licensing and Warranty c
4. action from ColdFusion Cloning kit Linearized vector Amp qul positive control 500bp PCR insert Tul positive control dH20 6ul 5x master mix 2ul total 10pl Negative Control Linearized pMRNA Iul vector 10 100ng ul 5x master mix 2ul total 10pl When using the Cold Fusion cloning kit for the first time we strongly recommend that you perform the positive and negative control reactions in parallel with your Cold Fusion cloning reaction The positive control 500bp PCR insert and linearized vector provided in the kit has already been purified There is no treatment needed prior to the cloning reaction Page 8 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 b Cold Fusion Reaction incubation 1 5 minutes at room temperature 2 10 minutes one ice c Transformation 1 Add 50uI competent cells to the cloning mixture 2 Incubate on ice for 20 minutes 3 Heat shock at 42 C for 50 seconds 4 Transfer on ice for 2 minutes 5 Add 250ul S O C medium or LB broth 6 Incubate at 37 C for an hour 7 Take 100ul culture spread on pre warmed 37C culture plate containing 50 ug ml ampicillin 8 Incubate the plate at 37 C 4 Identify clones with gene insert Randomly pick 4 or more well isolated colonies and grow each clone in 3ml LB Broth with ampicilliiC at 37 overnight with shaking Purify the constructs using a plasmid purificati
5. by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2012 System Biosciences SBI All Rights Reserved 888 266 5066 Toll Free 650 968 2200 outside US Page 15
6. ccccceseeeeeeceeeeeeeeeeeeeneeeeeneeeaes 15 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Product Information Product Description The SBI mRNAExpress mRNA Synthesis Kit is designed for in vitro transcription of mRNAs to be used in transfection of mammalian cells oocyte micro injection in vitro translation and other applications This high yield kit can produce 20 40 ug of high quality MRNAs in a standard reaction The in vitro transcription reaction utilizes robust T7 RNA polymerase Anti reverse cap analog ARCA modified nucleotides 5 Methylcytidine 5 Triphosphate and Pseudouridine 5 Triphosphate and poly A tail are incorporated in the transcribed mRNAs to enhance the stability and to reduce the immune response of host cells DNase is provided to digest the DNA template and a phosphatase is provided to remove the 5 triphosphate at the end of the RNA to further reduce the innate immune response in mammalian cells This clean up system yields high recovery of mRNAs that are ready for downstream applications Precautionary Notes All components of SBI mRNAExpress mRNA Synthesis Kit are free of detectable RNase activity General precautions should be taken when handling mRNA to maintain its integrity 1 Wear gloves throughout the procedure to protect RNA samples from degradation by RNase 2 Use decontamination solutions such as RNaseZap Invitrogen to treat be
7. nch surfaces centrifuges and containers 3 Use commercially available RNase free pippet tips and other plastic ware Page 2 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 C Kit Components 5 Standard Reactions Size Components Storage 5 ug pMRNA Plasmid 20 C 10 uL Sequencing Primer Forward 20 C 10 uL Sequencing Primer Reverse 20 C 20 uL Tail PCR Primer Mix 20 C 50 uL Nuclease free Water any temp 20 uL 5xReaction Buffer 20 C 35 uL NTP Cap Mix 20 C 12 5 uL T7 RNA Polymerase Mix 20 C 5 uL RNase free DNase 20 C 25 uL 10xPhosphatase Buffer 20 C 10 uL RNase free Phosphatase 20 C 5 Collection Tubes with Filter Cartridges room temp 5 Collection Tubes room temp 2 mL Binding Buffer 4 C 1 mL Washing Buffer 5xconcentrate 4 C 1 mL Elution Buffer 4 C D Additional Materials and Instruments Needed e Table top centrifuge e PCR enzymes and buffers e Customer DNA template e Restriction Enzymes and Buffer e ColdFusion Cloning kit SBI e Phusion from NEB e PCR Purification kit Qiagen e Gel Extraction kits Qiagen e Materials and apparatus for DNA and RNA electrophoresis 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual ll Protocols A Flowchart Clone your mRNA into pMRNA mRNA Synthesis Vector Tail PCR Purification of
8. on kit Use a PCR or enzyme digestion method to check the positive clones containing gene inserts Confirm identity of the gene insert by sequence analysis of the construct using the sequencing primers provided in the kit The construct with correct insert sequence can be used as the template of the downstream Tail PCR C Tail PCR Purification of PCR product The template for in vitro transcription should be generated using a PCR reaction that adds a polyA tail to the end of the DNA template We recommend a typical setup with Phusion NEB shown below 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Component Amount 20 uL Reaction 5x Buffer 4 uL dNTP Mix 0 4 uL Tail PCR Primer Mix 2 ul Plasmid Template 10 50 ng Phusion DNA 0 2 uL Polymerase H20 to 20 uL A typical PCR program with Phusion is shown below Cycle s Temperature Time 1 98 C 30 min 30 98 C 30s 72 C 30 s kb 1 72 C 10 min Other high fidelity enzymes can also be used for the tail PCR reaction according to the manufacturer s instructions The PCR product can be purified using QlAquick PCR Purification Kit from QIAGEN D In vitro Transcription 1 Thaw the frozen reagents for IVT at room temperature 2 The 5xReaction Buffer and NTP Cap mix should be briefly vortexed before using 3 Spin down all reagents briefly before opening to
9. prevent loss or contamination around the rim of the tube 4 Assemble IVT reaction at room temperature Add the reagents in the order specified The following is recommended for one 20 uL reaction Page 10 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 Amount Component 7 uL NTP Cap Mix 4uL 5xReaction Buffer 1 ug Template DNA 2 5 uL T7 RNA Polymerase Mix to 20 uL Nuclease free Water 20 uL Total volume 5 Mix thoroughly by pipetting the mixture up and down or flicking the tube gently Spin down the mixture briefly with a microcentrifuge 6 Incubate at 42 C for 2 hours Optional Additional incubation may increase the yield with lower amounts of DNA template E DNase and PhosphataseTreatment 1 Adjust the IVT reaction to 24 uL with RNase free water 2 Add 3 uL of 10xPhosphatase Buffer to the reaction 3 Add 1 uL of RNase free DNase and 2 uL Phosphatase and mix 4 Incubate for 30 min at 37 C F RNA Purification 1 Bring the sample volume to 100 uL with Elution Buffer Mix gently by pipetting 2 Add 350 uL Binding Buffer Mix gently by pipetting 3 Add 250 uL 100 ethanol to sample Mix gently by pipetting 4 Pipet the RNA mixture 650 uL onto a Collection Tube with Filter Cartridge 5 Centrifuge at 10 000 15 000xg 10 000 14 000 rpm for 1 min 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual
10. sfection of human foreskin fibroblasts with MyoD mRNAExpress transcript After 3 days transdifferentiation cells were immunostained with Desmin myogenic marker for myotube formation and imaged for nuclei with DAPI 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual IV Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com System Biosciences SBI 265 North Whisman Road Mountain View CA 94043 Page 14 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 V Licensing and Warranty Use of the mRNAExpress in vitro Transcription Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used
11. tivector does not contain an ATG initiation codon or a stop codon TAA TAG TGA If the DNA fragment to be cloned does not have a start or stop codon please incorporate the ATG and stop codon in the 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual insert We also recommend including a Kozak sequence i e GCCACC before the ATG for optimal translation To successfully clone any DNA fragment into the linearized pMRNA vector we recommend using SBI s Cold Fusion cloning kit Using Cold Fusion cloning kit PCR primers must be designed to have about 14 bases of homology with the end of the linearized vector Thus a primer will consist of a 14 base vector homology sequence at the 5 end and restriction site in the middle and the gene specific sequence at the 3 end The guidelines for primer design are shown in the graph below 14bp Vector sequence C EcoRI Kozak sequence ATG 18bp gene specific sequence Fwd primer 5 GAAGAAATATAAG Ag aaticGCCACCAT GxxxxxxXxXxxXxXXxXxXXXxX 3 Rev primer 5 CCGCAGAAGGCAGCggatccCTAXxxxxxXxXxXXxXXXXXXXX 3 d4bpVector sequence BEINN stop codon 18bp gene specific sequence Example To clone the copGFP open reading frame into pMRNA vector the primers are as follows atggagagcgacgagagcggcctgcccgccatggagatcgagtgcc gcatcaccggcaccctgaacggcgtggagttcgagctggtggecegc 8agagegcaccc agcacgcc
12. ttcaagacccccatcgccttcgccagatcccgcgctcagt cgtccaattctgccgtggacggcaccgccggacccggctccaccggat ctcgctag Fwd primer GAAGAAATATAAGAgaattc GCCACCATGgagagcgacgagagcgg Rev primer CCGCAGAAGGCAGCggatccCTAgcgagatccggtggage The PCR fragments can be generated by Taq DNA polymerase or other high fidelity DNA polymerase The melting temperature Tm should be calculated based on the 3 gene specific end of the primer NOT the entire primer Primers and primer dimmers produced in PCR reactions are inhibitory to the Cold Fusion cloning reaction If the Page 6 ver 1 032312 www systembio com mRNAExpress mRNA Synthesis Kit Cat MR KIT 1 PCR produces a single specific band from an agarose gel the PCR product can be purified by simply using a PCR purification kit If the PCR produces multiple bands the specific DNA band desired should be purified by a gel purification kit to remove non specific DNA bands and avoid false positive clone 3 Set up Cold Fusion reaction Set up the following reaction in a 1 5 ml sterile reaction tube by mixing the following reagents gently and then spin down briefly to collect the reagents at the bottom of the tube a Cloning reaction Linearized pMRNA Iul vector 10 100ng ul Purified PCR product 1pl 20 200ng tl 5x master mix 2ul total 10ul 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Positive control re
Download Pdf Manuals
Related Search
Related Contents
"取扱説明書" LEDsライナーK_取説 Model (1) Copyright © All rights reserved.
Failed to retrieve file