Home

here

1. 43 Installation EE 1 LightScanner Instrument lt gt Primer Design Software Manual gt Rev 01 47 Index lt 48 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 011 iib LightScanner Idaho Technology Inc 390 Wakara Way Salt Lake City Utah 84108 USA 1 801 736 6354 www idahotech com
2. Wo oo en IX LunaProbes oo ooWo WWW mba 27 Alignment Definition of vii M Amplicon adjusting search regions 16 Amplicon size scanning 13 Minimum overlap 14 B P BLAST Primer concentratioONS 14 Cross complementarities 21 o viii S li t EMINENS 22 ka REA FU TET vili C GON IA vili Primer Tm Cross complementarities iii 21 Definition Fo vili Cross comp tool En ena 24 MINIMUM MAXIMUM o ek vii Primer Tm minimum and maximum 13 D Probe and primer compatibility 32 Data saving and exporting 20 0 DEIA AI 13 Designing a probe oooo Wo oom 29 iT dob o 39 Designing priMerS ooooooWo 27 R Region End user License Agreement for Software BE NM 11 EULA Xi eir 19 Exclusion buffer values for 14 Exons 9 KES gg an an 20 Seguence formats MPO 0 RR anal 23 Single amplicon Fixed oligos w wwamwmamanna Ix 24 Definition Of Woo Woman 10 G T Genotyping small amplicons 35 Technical Support iii Tools Menu MNT CREE E 24 H U Hardware requirements 1 UCSC genome browser
3. This is a primer design module that can be used for designing individual primer sets No assumptions are made about exon regions This module has all the functionality of the scanning primer design module in terms of sequence definitions single nucleotide polymorphisms SNP repeat regions etc and primer design constraints are identical to the scanning primer design module This module is tailored to design all of the scanning primers required to cover every exon of a given gene Exons are defined as regions of upper case letters Exon boundaries can be read directly from GenBank files or text files with the exons already converted to upper case Primers can be designed using common amplification conditions for every exon or the design conditions can be adjusted for each exon individually Primer sets are ranked and scored by individual pairs as well as by their compatibility with the entire group of primer set chosen to cover the entire gene Primer melting temperatures and reaction conditions are adjusted for the LCGreen family of double strand DNA binding dyes This parameter defines the length of the 5 exon intron boundary that is excluded from the search region No primers will be placed over this boundary allowing the scanning amplicon to include splice sites as well as the exonic region The default length of the 5 exclusion buffer is set to 5 bases however this value can be manually increased to suit user preferences Th
4. Cgat A AATUT saaggettet Lt gtgtgttt GATCATGATS TCTTGGCCAL GGOTTCAGGAG cutcagtca8s Jaga gtu tk amp cacctcttgta gtgggaaaa ttgagggtag gtetettjgot TTTCAAAGOA ATTTTATCCT ATCACACAAC ggctaccccrc tgeagagttg EEGC aaa aa 6 a amp attta atg caca gg amp ggm ctgcaattet AGAACCAGTC GAGAATECTS ATTTATTCTT cagttctgag geetcagagt attctacctc pacqcottge nyt gocast geagoTactTs ACCTTTCACT A ACGACGAGCT CTTACAGgtCA uagaumcttgrzt LATT AS AA tggasgarca Haa Preces Ti Har Peti T xzlusee B uter gtgtgtttgtcttttgct cacaggaggaagtgcc atiz actatttaaatcaccctttttttaaattacgtgcggaacgtttccgaagaaactcccatcgtgtcctccttcacggttatatcacacaaacagaaaacga 101 ctgcaattctgcagGTACTGGATCATGATGTTTCAAAGGAAGAACCAGTCACCTTTCACTTCTTGGCCAAATTTTATCCTGAGA A gacgttaagacgtcCATGACCTAGTACTACAAAGTTTCCTTCTTGGTCAGTGGAAAGTGAAGAACCGGTTTAAAATAGGACTCTT TGAAGAGGAGCT ACTTCTCCTCGA 201 GGTTCAGGAGATCACACAACATTTATTCTTCTTACAGgtacatcagtcaaggctaccccccagttctgagagaacttgcccaggagtggttgcagagttg CCAAGTCCTCTAGTGTGTTGTAAATAAGAAGAATGT catgtagtcagttc Isi IMsisieCICoLcaagactctcttgaacgggtcctcaccaacgtctcaac 301 gcctcagagttgaccacaaacacctttgtattgcaaaaatattctacctctggaaggtca cggagtctcaactggtgtttgtggaaacataacgtttttataagatggagaccttccagt Forward Primer CACAGGAGGAAGTGCCAATAT Bases per Line 100 Bn IV Show Positions 5 Position 3 Position Length Tm ES Ds us E px Si ci e 1 Reverse Primer GGGTAGCCTTGACTGATGTAC Complement Strand Oligos 3
5. Fit Position 1 mx o Lan sene wc 9s epa erai Length AdiEen Mme same Customizing Design Parameters for Individual Exons The design parameters for individual exons can be customized by selecting the individual exon tab at the top of the screen This will bring up a set of Experiment Settings functions that can be modi fied manually These include amplicon size primer melting temperature range primer size the size of the region bordering the exon where no primers should be placed exclusion buffers the required overlap between amplicons if the exon is broken into multiple amplicons and the composition of the Master Mix that is used Select the Search button to begin the primer search The software will discover primer sets within the search regions for each amplicon and rank them displaying them in descending order 14 LightScanner Instrument Primer Design Software Manual lt gt REV 01 CHAPTER 4 Designing Primer Sets Experiment Settings Min Amplicon Size a Mas Amplicon Size 350 Min Primer Tm 60 0 Max Primer Tm en o Min Primer Size UN Max Primer Size 0 F Exclusion Buffer E 3 Exclusion Buffer b Minimum Overlap ami Number Amplicon H Reaction Conditions s LightS canner Master Mix r Alternatively move to the Search Region tab Verify that the region is defined correctly and select the Search button or move directly to the Primer Sets tab of Primer Design Soltau 1 0 Set
6. ill Idaho Technology Inc Idaho Technology Inc www idahotech com This document is used solely for the purpose of LightScanner Instrument Operation This document shall not be used or disclosed in whole or in part for any other purpose 2005 2007 Idaho Technology Inc All rights reserved Part No LCSN PRT 0029 Rev01 11 07 LightScanner Primer Design Software Manual Information in this document is subject to change without notice No part of this document may be reproduced or transmitted in any form or by any means electronic or mechanical for any purpose without the express written permission of Idaho Technology Inc LightScanner and Call IT software modules 2005 2007 Idaho Technology Inc LCGreen LightScanner and Call IT are registered trademarks and HR 1 Hi Res Melting and LunaProbes are trademarks of Idaho Technology Inc LightCycler is a trademark owned by a member of the Roche Group Other marks are owned by their respective companies Patent Pending NOTE Complying with all applicable copyright laws is the responsibility of the user Please remember You must accept the End User License Agreement for Software EULA before you can use this product The software is licensed as a single product Its components and parts may not be separated for use at more than one working location If you do not accept the terms of the EULA you should promptly return the product for a refund Do not make illegal copies
7. For further details please refer to the EULA This product is for research use only Printed in the United States of America Reach Us On the Web Idaho Technology s Web site is http www idahotech com We strongly encourage users to visit our Web site for answers to freguently asked guestions updated information and additional insights into operating the LightScanner System Reach Us By E mail You may contact Idaho Technology by e mail The e mail should give us contact information such aS your phone number and address and whether you want us to send you e mail in response It should also include information such as the name of the product and the serial number If you have technical guestions want to schedule maintenance or repair or you need a return material authorization please send us an e mail at support idahotech com Customer Support If you want information about sales pricing or quotes or if you have questions about your order please send us an e mail at it idahotech com General Support Reach Us By Phone Technical support is available during the following times 8 a m to 5 p m Mountain Standard Time For technical support call 1 800 735 6544 Toll Free United States and Canada 801 736 6354 Utah 1 801 7 36 6354 International Reach Us By Fax _ To contact Idaho Technology by fax use the following numbers 1 801 588 0507 United States and Canada 1 801 588 0507 Internati
8. ctctgactta cggatcacga ecropetera gcctgtagtc ctgggaggeg ctgggegaca catagcttca ggetgggegt gtgggtggat gtgaaacccc aagttttgag atactaactt tatgaacttt ggtcaggaga ctaaaaaaat ccagctactt gagcttgcag gagcgagact gtttccttat ggcgctcatg cacctgaggt atctttacta Experiment Type Single Amplicon Primers Sequence Information Name SNP Deepika deSilva First Position f Last 1000 Length 1000 zac 43 8 641 cDNA Comments Access Author Position r 4nnotations Add Exon Add SNP Add Region Import Seguence Edit Amplicon 4 Doa cross complementarity check between your probe and primer set a Copy the probe seguence b Move to the Primer Sets tab select Cross Comps c On the Cross Comps screen select Add and paste your seguence into the Seguence text box d If your probe lies on the anti sense strand select the complement strand box in the Edit Seguence box e Select OK 5 All of the complementarities between the probe and the primers are now displayed in the Cross Complementarity window LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 33 CHAPTER 6 Designing LunaProbes 6 If your probe does not have any significant complementarities order your probe from your oligo house of choice Be sure to add a C3 block or a phosphate on the 3 end SNP LightScanner Primer Design Software 1 0 Beta 80
9. 2451 cmmgtttt t tagctmatmcmat mdr m ctgtEgLtrtg gtgcrmgmtt 51 LOOCTLOULTASNL ALDQJUACLO OAL 5521 cctagtammugma ttrtctcttagt 1 AaLOgATACLATL gcOLAaCOADAS3 1 ATI AA Sgtqostett 145751 ERcCAtcEkcC tt ctotttgtse EC T TJT TTET SG595TL453 035 z ct kep gtmmattttmaks teetgettac BE tttmnuntmttt mgmammmtgmatt i151 TgoLtAgc sg Saga taal BIDI tctttttmamugm gtgtgccact 151 STySALTTTT LTLTLLILIILTLITIT 1 mugxgtuc amp gt ggcmscmkmtct 8 mhisrannes Peimer l sige Saf han 1E Heja 19 GA Ds ppt crctgttttm mttgmetgctg a mtatgggttc tmtttttmct UCTLALTLLTA tttttttttt CAJgTJggrgcaAa mttctcctgc tctgcccmgc TIJ TAJAT tcrcamEgtg LLTACLTLTLTLCT tatngaesestt tag TLLTOLTOgLrrTT Li ache LDgccLcLLACc ccctgttccc mrItccrtamr Tgaa0TT ET tttgttro mamm tttmammcrImc AJTTLTLTALCA mttggttmct Jajar gag caggttraccm LLTOLLTLIgoca gogtamttgcm FETTEN EEk E mtmmatctttm ttmmgEmEttgt LTAGUJgAoALTATL tttttgagac AarcrLoagcrc cttagcctcm tmmtttttgt UWMuyrcrogarc ctoggugmattumc CARTET T A KUUA TA AA gtccmccctm Lao Cat TA cmntgmcttt UACOLLLAAGL cmccmgtttc mtEggm amp cE amp CIEtE CLTLLALTAAGLTA togtaemMgECHE acta toe Hag rtgagrrr tctugmmrctg OCLOUCTOCLTUT cagtctccac aAcAggoart gassgt etg Eut E TIE i taggatesttt utgttosagtg JJ 44414 mugmEgtctcmc ACLS aa Tt toguugtag tg mtttttmutm COLE geo oT Mela aa AAGTASLLOLLU rtgca amp mmmtt CT ha ha ba geaacarrrcco
10. Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 29 gt CHAPTER 6 Designing LunaProbes gt LightScanner Primer Design Software 1 0 Beta 80 File Sequence Settings Tools Help Design 1 Sequence Annotations Target Search Region Primer Sets tegagaccat acaaaaaatt gggaggctga tgagccgaga ccgtctcaaa gtaatatata ctataaaatg eetgtaatec cccggctaaa agccgggcgt ggcaggagaa tcccgccact aaaaaaaaaa ctacttagtt caaataacac cagcactttg acggtgaaac agtggeggge tggcgtgaac aMactccagc aagttggttt acactactta cteccatgag ggaggccgag ceegtetcta gcctgtagtc ctgggaggeg ctgggegaca cegattatac catagcttca ggetgggegt gtgggtggat ctaaaaaaat ccagctactt gagcttgcag gagcgagact catttactgg gtttccttat ggcgctcatg cacctgaggt Target Information SNP 172 fi XGC 140 9 Position hz cDNA Experiment Settings Min Amplicon Size 45 Max Amplicon Size fi 50 Min Primer Tm o o Max Primer Tm 60 0 Min Primer Size 17 Max Primer Size 30 Ca 5 Exclusion Buffer o 3 Exclusion Buffer Reaction Conditions LightScanner Master Mix v 5 Select Fixed Oligos 6 The Fixed Oligos screen will display L Fixed Oligos tcgagaccatcccggctaaaacggtgaaaccccgtctctactaaaaaaat agctctggtagggccgattttgccactttggggcagagatgattttttta acaaaaaattagccgggcgtagtggcgggcgcctgtagtcccagctactt tgttttttaatcggcccgcatcaccgcccgcggacatcagggtcgatgaa gygaggetgaggraggagaatggogtgaarcetgggaggeggagettgoag ccctccgactccgtcctct
11. LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 2 Starting the Software mhisrannes Frimer Preig Safa 7 1 fela 09 merca Vis spe LOLA CIA beo Tacbnckxgg ha Plphir Errei Aap Prog H pried bre oper phil Lew aed eel oral 35 estes neferi pre raproduelign cr distribution pi fi M p IPS Cr Wy pori en or hH nier Mlt bror SA anii orina rad RUE TRE Win and uil ba prapeculad be Hoa mares nm arj pools ure Pola 3 Select Open Analysis File from the Front Screen menus The Sequence screen displays From the Sequence menu select Import Sequence LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help Sequence Annotations Insert Replace Sequence Locked Experiment Type Scanning Primers iL r Sequence Information Name Access H Author deepika desilva First Position fi Last o Length GC Position fi cDNA Import or paste a seguence Comments r Annotations Add Egon Add SNP Add Region Search All 4 Find and select the desired file click Open LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 7 gt CHAPTER 2 Starting the Software Sequence Name Look in 5 LSPD test files f ex BE My Recent Document My Computer MCAD files NCBI Sequence Viewer v2 0 files slc2245 files tps3 homolog files Si VKORCI jason files 4 BRCA1
12. SOFTWARE OR ANY PART THEREOF 4 Limited Warranty THIS SOFTWARE IS PROVIDED BY IDAHO TECHNOLOGY INC AS IS AND ANY EXPRESS OR IMPLIED WARRANTIES INCLUDING BUT NOT LIMITED TO THE IMPLIED WARRANTIES OF MERCHANTABILITY NON INFRINGEMENT AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED IN NO EVENT SHALL IDAHO TECHNOLOGY INC BE LIABLE FOR ANY DIRECT INDIRECT INCIDENTAL SPECIAL EXEMPLARY OR CONSEQUENTIAL DAMAGES INCLUDING BUT NOT LIMITED TO PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES LOSS OF USE DATA OR PROFITS OR BUSINESS INTERRUPTION HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT STRICT LIABILITY OR TORT INCLUDING NEGLIGENCE OR OTHERWISE ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE 5 Termination Without prejudice to any other rights Idaho Technology may terminate this LICENSE if you fail to comply with the terms and conditions of this LICENSE In such an event you must destroy all copies of the SOFTWARE and all of its component parts For questions concerning this license or this limited warranty you may contact Idaho Technology by writing to LightScanner Software License Services Idaho Technology Inc 390 Wakara Way Salt Lake City UT 84108 USA Notices and Disclaimers Idaho Technology makes no warranty of any kind with regard to this material including but not limited to the implied warranties of merchantability and fitne
13. View Results for Individual Exons 9 6 06 6 0 6 0 9 0 0 9 9 O0 0 9 O0 0 9 O0 0 9 O0 GO 9 0 0 9 0 O 0 9 0 9 O0 9 06 O 9 O GO 9 0 O O 9 O9 0 9 O9 O0 9 O0 O 9 06 O 0 9 G0 9 9 O O 0 O0 O 0 6 O 0 0 O0 9 9 O0 GO 9 O O 0 0 0 O 0 9 O0 0 9 0 O 9 0 0 9 O O 0 0 O 0 9 0 9 9 O0 0 O 0 09 0 9 9 O 6 0 0 9 0 O 0 0 O 9 9 0 9 9 O9 0 9 9 9 0 9 09 0 0 6 9 Go to the individual exon tab and choose the Primer Sets sub tab The software searches for up to 1000 primer pairs for each exon and displays the top 5 unique selections under the individual exon tabs All primer pairs can be viewed by changing the display option under the Settings menu Top 50 Sets Show All Sets Limit Sets Select the check box next to a primer set to include that set in the final results Only one check box can be selected per exon LightScanner Primer Design Software 1 0 Beta 79 MEX File Sequence Settings Tools Help MCAD Exon 1 Exon 2 Exon3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11 Exon 12 Results Target Search Region Primer Sets 30 30 29 107 11194 8223 30 59 8426 ooa A Exon4 Ranki Score 3905 21 ttatgaccttacgtatactcattctttt Forward 5 Pos 3 Pos Length GC Tm Delta G Jagattatataatcaaactatctagatttca 8184 8223 30 26 7 539 188 Reverse tittettacteatatgeattecagtalt 8375 8348 28 286 597 184 The summary results data generated after a search ca
14. as exons opening exon tabs for each selection e Find opens a dialog box where a signature sequence can be entered The software will search the input sequence for this signature sequence LightScanner Primer Design Software 1 0 Beta 79 File Sequence Key Tools Help MCAD Exo Alignmet Grouo Settings Menu e Single Amplicon Primers Used to switch between design applications e Scanning Primers Used to switch between design applications Single Amplicon Primers w Scanning Primers Target Comments Set Comments Common Settings Default Settings Show Oligos Uppercase Forward Primer 121 545 152 171 205 312 3739 3768 220 323 8002 8031 182 313 8194 8223 195 353 8880 X 8303 Top 50 Sets 148 351 10158 10187 n 250 312 15338 15367 qu mones 188 378 21170 21192 4g Show All Sets 256 336 24744 24767 2338 T 187 348 25799 25826 5974 31 7383 Exon11 Amplicon 1 252 36 1 36421 36438 154 4385 Exon 11 Amplicon 2 250 352 36609 36631 5163 Exon 12 198 273 38020 38049 en 20 4 Exon 5 Exon amp Exon 7 Exon 8 Exon 9 Ext Set Comments Taraet Com 2 Name Lengh XGC 5 Pos 3 Pos Len Tm 59 4 59 9 60 0 59 9 60 5 53 8 04 3 60 1 60 1 60 1 59 5 59 6 59 5 e Sequence Target Comments This calls up a field that can be used to insert comments about the seguence or the analysis Comments will be saved with the file for future reference LightScanner Instrum
15. at least 3 base pairs from the end of the oligo 13 Select Show Fixed Oligos on Sequence LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 31 CHAPTER 6 Designing LunaProbes 14 Copy the probe seguence from the primer text box on the Fixed Oligos page Select OK E Fixed Oligos 1 tcgagaccatcccggctaaaacggtgaaaccccgtctctactaaaaaaat agctctggtagggccgattttgccactttggggcagagatgattttttta acaaaaaattagccgggcgtagtggcgggcgcctgtagtcccagctactt tgttttttaatcggcccgcatcaccgcccgcggacatcagggtcgatgaa gygaggetgaggraggagaatggegtgaacetgggaggeggagettgrag ccctcecgactccgtcectcttaccgcacttggaccctccgcctcgaacgtc tgagccgagatcc actcecagcctgggcgacagagcgagact actcggctctagggcggtgacfitgaggtcggacccgctgtctcgctctga ccgtctcaaaaaaaaaaaaaaagttggtttccgattataccatttactgg ggcagagtttttttttttttttcaaccaaaggctaatatggtaaatgacc gtaatatatactacttagttacactacttacatagcttcagtttccttat cattatatatgatgaatcaatgtgatgaatgtatcgaagtcaaaggaata ctataaaatgcaaataacacctcccatgagggctgggcotggcegctcatg gatattttacgtttattgtggagggtactcccgacccgcaccgcgagtac cetgtaatcccagcactttgggaggeccgaggtgygtggatcacctgaggt ggacattagggtcgtgaaaccctccggctccacccacctagtggactcca Bases per Line 50 ES IV Show Positions Forward Primer 5 Position 3 Position Length Tm legecactacactecage 164 180 17 66 0 sss e fee We es ee Reverse Primer 5 Position 3 Position Length Tm Naf SAG ow Allow Mismatched Oligos Clear All amplement Strand Oligos 3 to 5 Cancel ixed Oligos
16. fasta list2 shtml For GenBank files go to http www ncbi nim nih gov Genbank GenbankSearch html Launch the Software 1 Double click on the LightScanner icon on your desktop The Front Screen displays 2 The user has three options to select from 6 a Single Amplicon This is a primer design module that can be used for designing individual primer sets No assumptions are made about exon regions This module has all the func tionality of the Scanning Primers design module in terms of sequence definitions single nucleotide polymorphisms SNP repeat regions etc and primer design constraints are identical to the Scanning Primers design module Scanning Primers This module is tailored to design all of the scanning primers required to Cover every exon of a given gene Exons are defined as regions of upper case letters Exon boundaries can be read directly from GenBank files or text files with the exons already con verted to upper case Primers can be designed using common amplification conditions for every exon or the design conditions can be adjusted for each exon individually Primer sets are ranked and scored by individual pairs as well as by their compatibility with the entire group of primer set chosen to cover the entire gene Primer melting temperatures and reac tion conditions are adjusted for the LCGreen family of double strand DNA binding dyes Open Analysis File Open an existing file and work with the data
17. is able to read text files obtained from the UCSC Genome Browser with the exons converted to uppercase The following section is a brief guide to getting files of interest in this format Go to the UCSC genome browser home page at http genome ucsc edu 2 Go to Gene Sorter and type in the name of the gene of interest Human chrX 151 073 054 151 383 976 Gene Sorter v168 Microsoft Internet Explorer Ck File Edit View Favorites Tools Help Q Back ix E f P Search SE Favorites YA B amp v kas gt Address http fgenome ucsc edujcgi bin hgNear hgsid 98656970 amp 0rg Human amp db hg188 amp near search ucO03cgl 1 amp submit G0 218 amp near order expGnfAtlasz amp near count 50 v Go Links gt Google Glv v Go DD Ev v Bookmarksw Bi 111 blocked check Autolink 0 Autori ep Sendtov AA 9 settings Y ge v Search Web 4 Br y Gmail Dry yahoo v gautos G Games A Music EJ Answers WPersonals gt gt UCSC Human Gene Sorter genome Human v assembly search uc003cgl 1 sos Erena mcm P JE e 288 dE p 2 oe 2 a zm BLASTP 4 Hame VisiGene cag z 9 w Om n 2 2 E Value Genome Position Description En ana CLS FE 1 MLH 173835 III KAA BERT Ichr3 37 038 662 MutL protein homolog 1 2 SLC25446 419060 MEE IEEE Ichr5 110 114 519 solute Carmen family 25 me
18. mttrtrrtgrc trtgrrrmagr rggoncaggar trErmangkg LLAGLEGLOL CEECHUIMMHETTC tugagaHmqcu LELOLQgLLEL cumuncmumung cu rgear rrado rrEtgttrrr PASC REG Y Tote NANE r EttgttrammE grrrraraa mttggttmamrt gagarggagt rggttrcurrm Hcckrrramg KAA ea a tummtrtcttm rraBggatar tttttgagar anreracagon rtrugrctrm ESMEEEEEGE ggrorogaro rtgggattmr LEABBLELLLELA RBICCCCHHLCRHRM gtrrmrrrtm LEACLOBLEBA mrtgacttt AA Co Coat Caccagtttc DLELARLBA LA CRAAGAGE POO wd OT tgeEmengece amp gargagrrr trtgumurrtg rogorc gr Cagtctccgc tRHCHHHARARE Ema Exod Ee Expo Ew Exon Esma Exon dl Eon TI Eson12 BEBERE Sac anacaggnarr ganagtcmtu 11534344 RS CTTTTWATA tuaggakrtrt L tmtttmt tar mttmmmtmm g tatttttmrt ttmmmmtt gt atgttrm dtu 1 Egrrrenarr 101 rtgttmrttk g S078 88887 amp agngtrtrnur Ce tEgeagtegrtg mccctttmpgtm roennrngacaonrgo BEHEHECHQCHREL BBLABBCLULE rtgrmmmmtt LA YA KAA gaaocarrrcog tttrctmgmgt rLaaosanrans EEgktgrtgt 91 mrmtrmrrtt rtrtttk gtar mrtrrrtmmr atagacuctt aggrmagatat LA AAN AA LL COCR odad a TTGGATOAAG AAS AAA D1 ttcmmtmut tt mgamutgatt tttemaccuc eeeckeetoe st itcterctt 1 tgaragcasg L Eptttttmagm 1 ALgOALLLLE m agagtgcagt pabB gapnArt arartgtgrt L EOLOA EL c cccegagtt tarRgHgturH Peu Emwrinen Type Sanning Parka Segan arek Flores Han Arrzzrd MC OOM REGION 77352070 75011771 m Pesepak denies
19. on Sequence Note The sense primer was moved and the SNP of interest is in the center of the oligo 15 Go to the Sequence tab on the LSPD Software Screen your probe will be displayed Save this search by going to the file menu and selecting save or save as Determining Probe and Primer Compatibility 1 Maximize the previously saved amplicon document window that contains the primers that will be used with this probe 2 Select the Comments option located in the sequence information box on the right hand side of the page 32 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 6 Designing LunaProbes 3 Paste the probe seguence in the comments section of your amplicon document SNP LightScanner Primer Design Software 1 0 Beta 80 FR 2 is Toal re File SEQUENCE settings 10015 Help Seguence Annotations Target Search Region Inset Replace aaaagattat tttctctaga aactgttttc aaaagttggt tcgagaccat acaaaaaatt gggaggctga tgagccgaga ccgtctcaaa reseatatata ctataaaatg cctgtaatcc caggagtttg E NI Comments SNP caccactacactecd Sequence Locked tagtataata aaatttgaaa atatacatag ttecgggagg cecgyetaaa aaaaaaaaaa etacttagtt caaataacac cagcactttg agaccagcct AA 173 ALI Primer Sets attgagaaat ctcttaacaa caagttcaga ccgaggcagageag acggtgaaac agtggeggge gllactccagc acactactta cteccatgag ggaggecgag gaccaacatg tactgttaaa aacctgcata
20. select Import and then select the file type May import from European Molecular Biology Laboratory EMBL FASTA GenBank or regular text files Liphi amp canner Primer Design Software 1 0 Hera 73 una Sequence Annctstions inom Aapa Sequence Locked Import or paste a sequence Search All 2 Find and select the desired seguence click Open Seguence Name Look in e LSPD test files e et E MCAD files LZ NCBI Sequence Viewer v2 0 files Cjslc22A5 Files My Recent 3tp53 homolog files Documents WOnC1 jason files amp amp BRCA1 htm E BRCA1 txt E CA2RSHSS txt GADD45A sequence txt 4 amp MCAD htm 4 amp NCBI Sequence Viewer v2 O htm amp slc22a5 htm 2 tp53 homolog htm My Documents VKORC1_jason htm My Computer File name tec eA Files of type GenBank Fasta E mbl file mht htrl htm t v Cancel Exons will be highlighted and bases in exons will be converted to uppercase W Note The sequence must contain at least 200 bases of sequence upstream of the first exon and downstream of the last exon for the software to recognize these exons correctly lt 40 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 Select Search All to find scanning primers for all exons LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help 06 06 9 6 6 0
21. to 5 I Show Fixed Oligos on Sequence pm lm 5 Position 3 Position Length Tm Es far add Adil eal Allow Mismatched Oligos Clear All OK Cancel Select the Primer Sets tab The software will analyze your primer set Use the color of the score to determine whether you have an acceptable primer set green good yellow acceptable and red poor LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 17 CHAPTER 4 Designing Primer Sets LightScanner Primer Design Software 1 0 Beta 79 La sequence dettings Tock Help i sne Sequence Annotation Target Seuch Regen sen rs omme wasi nette o ete repite er Sasa tega s l bre Tenri dal pa Test tal Inf kana Gade mem 3rn 10 436 100 19 20 608 2 183 IT 34 6 N fees mE Seras 3731 Length AGC Tm esse pp fa ff 9 From the Primer Sets screen you may do a Cross Comps check and BLAST your primers lt 18 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 5 Results CHAPTER 5 RESULTS View Summary Results Select the top level Results tab to view a list of the highest scoring primer set for each exon A summary screen displays the best scoring primer for each amplicon in tabulated format The table shows the amplicon length GC content primer positions lengths and melting temperatures the recommended anne
22. to the SNP of interest 1 Launch LSPD software and select the Single Amplicon button on the front screen Go to Import Seguence and open the seguence file containing the SNP of interest including at least 100 bases upstream and downstream of the target SNP 2 Once the seguence has been imported highlight the target SNP in the Seguence tab and press Add SNP In the dialog box select the Target box and verify that the SNP status is Avoid Press OK ro 2 E3 LightScanner Primer Design Software 1 0 Beta 79 File Seguence Settings Tools Help Design 1 Seguence Annotations Inset Replace Sequence Locked 201 catcaccagg cttcattctc Add SNP Name Start Status attttetgtg tgccagtcag gtacagaaca agctaaaaat Avoid Description Text Color mm Background Color E DENT tgtctaagca agaaattgtg tgetggggac 051 tgccagcagc ggaagagatc cctgtgagtc agcagtcagc ccagctactc 101 cctacctaca tctgcactgc ctcccgtgac taattccttt agcagggcag Sequence Information 151 attagataaa gccaaatgaa tteetggete acccctcatt aaggagtcag taggagacaa 251 accttgttaa ttccctagaa tacattaag aggatagagt ggaatttttt Access 301 ttctctgcaa tcttgcattt ttttaatggc tetttttttt tttcctgata Aue deepika desiva 351 aaaacctttg gtaggtaggg aagttatgtt ttcaggggta aatgtgetac 401 ttttgtcttc taaattttgc tettttttga ctggtctagt caagtgacag T 451 cccgattatt ttgctactcc ttaaaagtac tattetgtet cttggagtat First Position 1 Las
23. tttctmgmagt LASS AALL AA ttgttg stgt Wugcmgatwt LAT bd D Etoattttoa ntttctm tt CAoRGAgAcATT mcmItgtgct TFTA AAT rtcccugmugtt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 3 Annotating Seguences CHAPTER 3 ANNOIATING SEQUENCES Defining Exons SNPs and Regions It is often useful to manually annotate a sequence with known single nucleotide polymorphisms SNPs regions or exons The primer design software can be directed to design primers that cover these annotated sites avoid them or ignore them All annotations will be saved with the file once the analysis is complete W 3 3 3 3 3 3 3 3 33 0595055 If you have imported a file with the exons in uppercase there is no need to manually define the exons If you have imported a normal text file and want to define the exons manually highlight the sequence in the window and select the Add Exon button A pre filled dialog box will open You have the option of renaming the exon and entering a description of the exon for record keeping An exon is automatically designated as a target to be covered by primers unless the Target box is manually unchecked Add Exon Exon 13 l Target i 118 Cancel End f e 481 Description Tes
24. 6 0 0 9 0 0 9 0 GO 9 0 O 0 9 GO 0 9 0 O 9 9 0 9 0 9 9 9 0 9 9 0 0 9 o o o e o o o e e o o e e o o c o c o Mg sos eceeseeoeseee ee eeee eee eee see APPENDIX A Quick Guide 06 9 6 09 6 9 9 0 9 O 0 0 06 9 9 O 0 9 0 O 0 9 9 9 0 0 9 09 0 9 09 6 9 6 e MCAD Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 Exon 11 Exon 12 Results Sequence Annotations Insert C Replace aaataggcgt gcagactaca aaacagtgat aatatatcaa tatttattac tgtttetett ctgttacttt tetgtcacca teacgtectg ggactacagg gagatggggt gtgatetgee cacegegect caagttttct actgtagttg teetgttaat cctagtaaga atgatactat tataaactta acatcacctt tgtgtgtttt ctag gtaattttaa tttaatattt tgatagcaag tetttttaga atgcattttt agagtgcagt ccegtgtattattgtecgag Ex Fark Some713 Fand Pos IP naa ie m EJ IV Sequence Locked gactgtattc gtttgttgat taaagcaaaa ttttcttatt taagta attaaataag tttaatatct tctttctttt ggatggagtg ggttcaagag tgcacaccac ttcatgatgt taccteggcc gaccatattg tactatacat gtgctagatt atgtactcat tttctcttgt gcctaacaaa cgtgectatt etetttgtac tactgettge agaaatgatt aagataatgt gtgtgecact tttttttttt gycacaatct caatcaggct cectgtttta attgatgctg ag atatgggtte tatttttact gcttatttta tttttttttt cagtggtgca attctcctgc tetgeecage tggccaggat tcccaaagtg ttacttttct tatagaaatt tagagaggca tttctgtttt taaacaaaag tgectettac cectgttecec actcccta
25. 909 30 60 5 aacaagagc 9074 9051 24 5968 7 ExonB 1 4779 148 Olaatgacttga 10158 10187 30 59 8 tgaaataaac 10305 10281 25 59 8 8 Exon7 1 3012 250 O aatcactaat 15338 15367 30 59 3 atacagaaa 15587 15559 29 59 2 9 Exon8 1 1490 188 gccgatatta 21170 21192 23 60 1 aataatatttg 21357 21334 24 801 10 Exon9 1 4858 255 D agtcatgaas 24744 24767 24 60 1 aagatcctat 24999 24970 30 596 11 Exon 10 1 2338 187 D attgtgtgtttt 25799 25826 28 60 1 ttacatttgaa 25985 25963 23 60 1 12 Exon11 31 7383 252 Oggcaacata 36421 36438 18 59 5 AATATCT 36672 36652 21 B 13 Exon 11 154 4365 250 O GGTTGAT 36609 36631 23 59 6 aatttctaaat 36858 36831 28 59 9 14 Exon12 1 5163 198 O actgtctaaa 38020 38049 30 59 5 tgaaacagic 38217 38196 22 593 15 16 17 18 AU M M 4 gt NAMCAD NA vc c n mpl f Ready NUM BLAST Searches To locate the position of the primers in the context of the entire sequence highlight the amplicon in the screen and click on the Alignment button MM Alignment Exon1 Rank1 Score 713 1 cggcgccggggaccgctgccaccccgcctagcgcagcgccccgtccttccgcagcccaaccgcctcttcccgcccecgccccatccecgcccacgggctceca gecgeggecectggogacggtggggeggategogtegoggggraggaaggegtegggttggeggagaagggeggggeggggtagggegggtgeregaggt gtgggegggaccagaggagteecgegtteggggagtatgtcaaggergtgakeeetee miste este ite LC C Crcraac crepcra caccegecetgytctcetcagggegcaagccectcatacagttecgycactggyrcacataataacaggetcacegycettgoecteggtt gtgagagggagceragcggtgeggtgg
26. Design Software Manual lt gt REV 01 CHAPTER 6 Designing LunaProbes CHAPTER 6 DESIGNING LUNAPROBES The LSPD Software may be used to design LunaProbes LunaProbes are unlabeled probes used in genotyping applications This chapter will explain how to design a probe in the same Tm range 60 65 C as your primers with minimal cross reactivity Design Your Primers Before you begin design your primers for your target 1 pr m oO TO LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 Open the Primer Design software and select Single Amplicon from the front screen Paste the sequence into the sequence window Define the SNP of interest by selecting Add SNP Be sure to have the SNP selected as the target Move to the Target tab Use the following experimental settings e Maximum amplicon size 250 bp e Primer Tm between 60 65 C e 15 bp exclusion buffer on both the 5 and 3 end LightScanner Primer Design Software 1 0 Beta 80 File Sequence Settings Tools Help Design 1 Sequence Annotations Target Search Region Primer Sets aaaagattat tttctctaga aactgttttc aaaagttggt tegagaccat acaaaaaatt gggaggetga tagtataata aaatttgaaa atatacatag ttcegggagg cccggetaaa ageegggegt ggcaggagaa attgagaaat ctcttaacaa caagttcaga cogaggcggg acggtgaaac agtggcgggc tggcgtgaac tgagcc EEE ilani PAN en Ur cegtctcaaa gtaatatata ctataaaatg cetgtaatec caggagtttg
27. Exem Comi 19 JraF rat rumes S Mirraeray RHA Str Structure Protein Structure BHA Desenpisons Pathways Otter Hames Model Infoematea uu Ll EEE al Linka to Tools amal Databases enost Sequence cte3 ITOITO HA mag differ from genome Protein 756 aa Gene Sorter Genome Browser Proteome Browser Miene Table Schema Allen Brian Atlas CGAP Basel Ester Gene ExonPaner Gene adi Genel year Gepis Tissue B Div acne i PED Frasen Laba Tapa PucMed Stanford SOURCE T Tree me I Cements amal Deseription Text from UniProt 5wdss Prot TrE MBL In MLE HUMAN DESCRIPTION DHA miscaich separ protem Mlh bul praten temoleg 1 ad patang Inrsired m NT ODE nA he BROA EU Un lem teen s LZ Ein 5 From the next page choose genomic Chr information Human Gene GADD45A uc001ddz 1 Description and Page Index Windows Internet Explorer e TE hitp figenome ucsc edujeg bryhgsene hosd 987270248db hgl Eh gone uc00 der 18h9g chrommehrihgg start 679234708hgg end 67926607 inks Seal gt coos Google Gr 000 RS v S 06 vr Bookmarks v P54 blocked AW Check NW Autotink To auon lap Sendtow 4 O settings v e Vk de Human Gene GADDASA uctO1dds 1 Description and Q D Ge en Oto Ed Sequence and Links to Tools and Databases en O O U TT ee rnb eel 67 923 471 67 926 607 JuRNA may differ from genome Protein 165 aa Comments an
28. File Sequence Settings Tools Help SNP Sequence Annotations Target Search Region Primer Sets Alignment Cross Comps BLAST Fixed Oligos Set Comments Target Comments Forward Primer i PCR Conditions Rank Score Length 2GC 5Pos 3 Pos Len Tm 5Pos 3 Pos Len Tm Tm Additive Gradient Comments 0000000000000 255 141 525 313 330 18 60 6 453 429 25 603 64 N 59 63 Bill Cross Complementarity SNP Rank1 Score 255 Clear All D 3 Alignments VZ Forward caggagaatggcgtgaac C Min Delta G Reverse tacccagtaaatggtataatcggaa Min Length 2 Alignments IV Multi Match IM Forward caggagaatggcgtgaac I Show Deka B IV Reverse tacccagtaaatggtataatcggaa Min 3 Length Edit Seguence x Min All Length Name Probe I Is Primer Complement Strand Sequence EE AA atgacccat cgccactgcactcca it SNP Ranki Score i Forward Cancel caggagaatggcgtgaac Jaja z caggagaatggc Reverse tacccagtaaatggtataatcggaa 453 Jaza os 36 0 603 178 34 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 7 Designing a Small Amplicon NN CHAPTER 7 DESIGNING A SMALL AMPLICON FOR GENOTYPING The LSPD Software can be used to design small amplicons for genotyping A small amplicon is a 50 70 bp region in which the primers are designed adjacent to a known SNP This section will enable you to define a SNP within your seguence and design primers adjacent
29. Homo sapiens die gi89161185 Comment Fess Sequence LOCK mc 905591 12502 bp Dra lirmmr COM 1D ADG 2006 DEFINITION Homo apite croot l rafaran s srsamtboly completa Jaa ROCESS ION Hc 550 REGIONS TIRSO TEITT TERS IDF FIC OO GT1 59161185 FP3JECT CarncomaProjact l155 TG Teu mepiare homen Hon rapiant Iubsryctas Materos Chordat amp e Crmnimtae artabrwtwe Eutalmscoatomnmi Harm lim Evutt rim Eugrcheontoglirax Frimstar Haplorrhini CTatwrrhini Hoainidee Toro 1 Ekren 1 to 18E05 iterations Huset Gece Sequencing Cet im Finixhirg tha ochrometic wo cf the hir ETTE 2 Fatura 4311 7011 2311 245 2004 1512211 GERE AMERBOIRTIOM FEFSEG Tawturasm on this majuma hera bean preduced for build JE weaerrzicon 2 of the CBI s geome mnrotmat icr zem dccummntmagticn On Ber 1 2008 this sequence version repleced gi 51511481 The WA mjuwa ix part cf the fourth release cf tha finimxhed howe rwefarmrcs Gece lt var mrmanbled from individual clone Jan by tha Humen Caroma Sequencing Conmorrtims in conmgultmaticrn with FBI rte Lcemticn gumlifiara 1 385907 Jorganimsme Hono apiece fmol typa gencmic MIA fb cre Tenan oon J ay p zz Flea aki LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 5 gt CHAPTER 2 Starting the Software Eb Edi Wes Fasos Tooke Heb Q O MAG De drm M LJ alie E tpe parene uar adle pi bird hape hed renere Fm p ra Eran m ur k p 1 Bc
30. aaaatacaaa tactccagaa tgcagtgagc agactgtctc tgaacttgac CEL REDE LE gtatcttgat aaaaaaaaaa ctacttagtt caaataacac cagcactttg agaccagcct aaattagcca gctgaggcatg tgacatcaca aaaaaaaaaa atatagtagg catttaggaa cttaatgtta aagttggttt acactactta ctcccatgag ggaggccgag gaccaacatg agcgtggtgg gagaatcacc ccactgetcet aaaaaaaagt cagagagcat gtgatctaaa tgtggactat tactgttaaa aacctgcata ctctgactta cggatcacga ceegtctcta gcctgtagtc ctgggaggeg ctggge ges ccgattatac catagcttca ggetgggegt gtgggtggat gtgaaacccc cgcgcaccta tgaacctggg ccagcctggg gtatttaaag tcagtaagtg aacagtattg tttaacttcc aagttttgag atactaactt tatgaacttt ggtcaggaga ctaaaaaaat ccagctactt gagcttgcag gagcgagact catttactgg gtttccttat ggcgctcatg cacctgaggt atetttaeta taatcccaac aggtggaggg caacagageg cacttagcag ttggcttgct ttagtaaatg cttttaaatg m Target Information Name SNP Position Position Comments Fixed Oligos ox Last 72 372 Lenath fi ABC 453 372 r Experiment Settings Min Amplicon Size Min Primer Tm Min Primer Size Reaction Conditions 5 Exclusion Buffer fi Minimum Overlap E LightScanner Master Mix Y M Amplicon Names SNP lt 27 gt CHAPTER 6 Designing LunaProbes 6 Search for primers by selecting the Search button 7 Choose the desired primer set from the list by highlighting and then select Fixed Oligos Sees LightScanner Primer Design So
31. aatgygagcagctactccttgaaatacttaa taaatggcgcccttagggtggaaaaaggtttcactggggcagagacacagtcttggtgccctttttctttttacctcgtcgatgaggaactttatgaatt tgtttaataagcttttcgttgtaacgtttccacgttgcttacgggaaaaaaaaaagtaaaaaaaaaacctgcagaattttatgtgaacttgtgtgtatat dmm DERAS A LAN ALA CL EM m m m meme mma m m ma mem m dm mea ma made do de aa aa de de de do mam de de de de de de de de de dm LAN ma made cade dm mm m dm mma mma de dm mr mm mm mm mmm Bases per Line 1100 IV Show Positions 3 To view primer cross complementarities select the Cross Comps button in the results summary 4 42 screen lli Cross Complementarity Exon 1 Rank 1 Kk Forward wv Reverse Forward Reverse cccgtatattattgtccgag caccacaatacccatattcca cccgtgtattattgtccgag caccacaatacccatgttcca Score 13 Clear All D 3 Alignments C Min Delta G Min Length 3 Alignments IV Multi Match 2 V Show Delta G Min 3 Lenath Min All Length If you are connected to the Internet BLAST the primer sequences directly by selecting the BLAST button to check the specificity of the design BLAST Exon 1 Forward Primer ccegtgtattattgtecgag Cancel Reverse Primer caccacaatacccatgtteca Database nr Select From nona Hank 1 Score 713 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 APPENDIX B UCSC Browser APPENDIX B GETTING ANNOTATED TEXT FILES FROM THE UCSC GENOME BROWSER The LSPD Software
32. ac tgaacttttg tttgttcaaa tttaaaccac ggttttatca attggttact gagatggagt cggttcacca ttctttgcaa ggtaattgca gctcaaaaaa aacaggcatt gaaagtcatg aattccttaa ataatcttta ttaaaattgt ttaaggatat tttttgagac atctcagctc cttagcctca taatttttgt ggtetegate ctgggattac taatttttta attttagcaa gtccacccta tactcattaa caatgacttt tacctttaat caccagtttc atagacactt ctttataata ecrectecte tgtaaagaca aaactaatca agatgagttt tctgaacctg ctegetetgt cagtcetcecgc taggatcttt atgttcagtg aggaaaaata agagtctcac attgcaacct tgagtagctg atttttagta tcttgacctc aggcgtgagc aataattctt ctgcaaaatt aatatgatca gaacatttcc tttctagagt taacaaataa ttgttgctgt aggcagatat tcttaaaata ctcattttca atttctactt caaagacatt acactgtgct tgctcaggct ctcecgagtt KISENA n x x HETHEET TER Sic Tm Deka 22 ZZZTZTZZTLLI za KKKRETRKEKE mum Experiment Type P Scanning Primers hegg EE MCAD INC 000001 REGION 75962870 76001771 deepika desilva First Position fi Last 28302 Length 38302 GC 336 fi cDNA fe 191 Comments Annotations Add Exon Add SNP Add Region Import Sequence Search All Name Access Author Position PEPEUSSEETESU ESSSSSERSSSSS 9 9 0 c 0 0 c c o 9 9 1 Aresults summary screen displays the best scoring primer for each amplicon in tabulated for mat All of this data can be exported in a spreadshe
33. aling temperature for the PCR adjusted for the presence of LCGreen dye rec ommendations for the use of additives usually dimethyl sulfoxide DMSO based on amplicon GC content and the recommended temperature gradient that should be run for PCR optimization e Primers displayed in green are good scoring primers orange indicates primers with moderately good scores and primers in red are considered poor scoring primers e Highlight a single primer set to view the set details The primer placements and amplicon size are displayed graphically on the lower part of the screen Details on primer sequence position and length GC content melting temperature and stability A G are displayed numerically below LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help MCAD Exoni Exon2 Exon3 Exon4 Exon5 Exon6 Exon Exon8 Exon9 Exon10 Exon11 Exon12 Results Alignment Cross Comps BLAST Set EE Target ERE 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon 7 Exon 8 Exon 9 Exon 10 31 7383 Exon 11 Amplicon 1 154 4365 Exon 11 Amplicon 2 Exon 12 38049 ZZZZZZEEELZELR Exon Ranki Score 713 Forward Pos 3 Pos Length GC Tm Delta G eccotatattattatcogag fs f 71 20 ja 0 s 4 16 3 Reverse eaccacastacccatatteca 272 252 21 47 5 601 176 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 19 gt CHAPTER 5 Results
34. aluate it for compatibility with LCGreen Plus dye and view the recommended PCR conditions Before you begin obtain the sequence for the amplicon of interest including sequence upstream and downstream as well as your primer set sequences 1 Open the Primer Design software and select Single Amplicon from the front screen Paste the sequence into the sequence window To access the Target Search Region and Primer Sets tabs required for analyzing your primers you must either define the amplicon by selecting the Define Amplicon button and selecting the bases that comprise your amplicon OR Select the Add SNP button and define an arbitrary base within the amplicon as a SNP W Note Define an amplicon by selecting the Define Amplicon button and highlighting the region of the amplicon in the sequence display box Define a SNP or a single base by selecting Add SNP Be sure to have the SNP selected as the target This will enable the Target Search Region and Primer Sets tabs 16 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 4 Designing Primer Sets Select the Target tab then select Fixed Oligos Highlight the forward and reverse primer seguences or type the seguences into the Forward and reverse primer text boxes The seguence will automatically be highlighted Li LighiSiunnar TED TE IET T 1 Eie Jopaco Songa lods br 0 Bata 19 Sequrce Amasra Target Seach Regon Pine Sets
35. c agctaaaaat Bracattaag ttttaatggc aagttatgtt tcttttttga ttaaaagtac aactgctgtg tcaaaactgt gtgaatgata tggttcagct aggtaattac tgtctaagca agcagtcagc taattccttt acccctcatt agaaattgtg aggatagagt tctttttttt ttcaggggta ctggtctagt tattetgtet cagctctcat tteactcagg ctctcatgca tgggttgcat ccttaacgct tgctggggac ccagctactc agcagggcag aaggagtcag taggagacaa gyaatttttt tttcctgata aatgtgctac caagtgacag cttggagtat ctcattgtgc tcagggtaac aaactgaaca gggttcagac tttgcaggga Target Information Name SNP Position ea Last 27i Length 1 Zac 35 6 2 cDNA Comments Fixed Oligos Position Experiment Settings Min Amplicon Size 45 Min Primer Tm 60 0 Min Primer Size 17 Max Amplicon Size 150 Max Primer Tm E 0 Max Primer Size 5 Exclusion Buffer 0 3 Exclusion Buffer Number Amplicons Minimum Overlap 5 Reaction Conditions LightScanner Master Mix Y m Amplicon Names SNP Select Search for primer sets Under the Primer Sets tab a list of the calculated primers will be displayed with a correspond ing rank and score Primers displayed in green are high scoring primer sets and most likely to be optimal in the defined range Small amplicon primers can be successful with a fragment size ranging from 40 150 bases however 50 70 base fragments are ideal for this application Try to select a primer set from the tabulated list with both high rank and scor
36. ce and any proprietary legends You may not copy the written materials 3 Restrictions on Use and Transfer You agree to secure and protect the SOFTWARE and any copies in a manner consistent with the maintenance of Idaho Technology s rights in the SOFTWARE and to take appropri ate action by instruction or agreement with other users who are permitted access to the SOFTWARE in order to fulfill your obligations under this LICENSE You may permanently transfer the SOFTWARE and accompanying written materials includ ing the most recent update and all prior versions provided 1 you retain no copies and 2 the transferee receives this Agreement AND agrees to be bound by its terms Such a transfer ter minates your license LightScanner Instrument gt Primer Design Software Manual Rev 01 xi gt You may not export or re export the SOFTWARE or any underlying information or technology except in full compliance with all United States and other applicable laws and regulations You may not rent lease or loan the SOFTWARE or otherwise transfer or assign the right to use the SOFTWARE except as stated in the preceding paragraph The SOFTWARE may contain trade secrets and in order to protect them you may not decompile reverse engineer disassemble or otherwise reduce the SOFTWARE to a human perceivable form in whole or in part YOU MAY NOT MODIFY ADAPT TRANSLATE RESELL FOR PROFIT DISTRIBUTE NETWORK OR CREATE DERIVATIVE WORKS BASED UPON THE
37. char Fie Door aaa rar kasran Ep d Go ha Google C sans im Ep vy onek Bi bodad SPF chei OG Aurlnk 3 Wr 2 wach c ER 44 gb Net Qoae aks Hoon ices Je Home Genomes Genome Browser Etat fables Gene Sorter PCH Sermon FAG Gili Sequence Near Criit Get Genomic Sequence Near Gene eden E yon wydd prefer to pet DAA for mare then coe Eesture of ilis track ata tme bry tte Table Eroen vg the output format aguere Sequence Retrieval Region Options L Preneren psmeam by 1000 bases ES UTR Eroni fl CDS Eroi 53 3 UTR Exon Enten L PewrsExm byr 1000 bases E Cie FAS LA record par gene Ore FASTA record per region exon iron etc vik I exira bases upstream 57 and emira dewasa 3 Ol Spt UTR and CD parte of m exon inte mpare FASTA records Hote a feature is close te the begimning or end of a chromesomt and upstreamldownstreum b ser are added they may be truncated mn order te mol steng pat He edge of ihe chromosome Sequence Formatting Options iz Ears m upper rase everyihmg else m lower case OD CDS m upper case ITE m lower cma t AI uppercase C AT lower cass Task cepere to lower case O to N smt The LSPD software is configured to read files from both sources Annotated GenBank files opened with the software are displayed with the exon regions highlighted on the screen automatically For EMBL files go to http www ebi ac uk embl For FASTA files go to http fasta bioch virginia edu fasta www2
38. d Description Text from UniProt Swiss Prot TrEMBL ID GA45A HUMAN DESCRIPTION Growth arrest and DNA damage inducible protein GADD45 alpha DNA damage inducible transcript 1 DDIT1 FUNCTION Binds to prokferating cell nuclear antigen Might affect PCNA interaction with some CDK cell division protein kinase complexes stimulates DNA excision repair in vitro and inhibits entry of cells into S SUBUNIT Interacts with GADD45GIP1 INDUCTION By UV radiation X rays growth arrest and alkylating agents The induction is mediate by some kinase s other than PKC DISEASE Induction of GADD45 in ataxia telangiectasia cells is abnormal SIMILARITY Belongs to the GADD45 family Microarray Expression Data Expression ratio colors red high green low 4 GNF Expression Atlas 2 Data from U133A and GNF1H Chips 39192 jans I LJowadns Jop Gd Wa do wa 2 This will take you to a page where you can select how you export the gene sequence for exam ple Exons in upper case Promoter Upstream 200 bp Downstream 200 bp etc For the Light Scanner software to find primers for the last exon you must have at least 200 base pairs down stream of the exon in your text file Selecting submit will bring up the desired sequence with the exons displayed in upper case 44 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 APPENDIX B UCSC Browser Be EE Wee Fpedes Tor Hen G O dz s D rm c a MU E ETE G i
39. d on the ends of the amplicons e Forward and Reverse primer concentrations The primer Tm calculations are influenced by the concentration of primers used in the reaction Enter known primer concentrations or use the defaults in the software Recommended primer concentration ranges are between 0 2 and 0 4 uM When using common design parameters for all exons the next step is to select the Search All button This will activate a primer search for every exon with no further user input required MIETLTLTETUUTENEMEUUC UEMESTRBIEET 19 Be Sequence Settings Took Heb MCAD Es Bonz egunen irisi r h Cegama Lotad sEtcegttcC 1 saasraggogt 1701 HgHrcagurctmurmu 751 BEC GE gut 1 SAC EC ACD oe I tcaecgtcecetg L ggarctmrugu L gagecggggr 1 gtgatrtgrre 101 parogpogenr casgettece L artgtagttg i ErgErs0nar 701 tatasactta L ua Ia ae L rgagtamttr gccmttgtag gaorgrareo gettegteget CESEG CORE EEEGORCAGE KATTGTETTI ELLAAGALOK Erctttctttk ggearcggeagrg Hugttcmagag CgCacaccar rr argargr tarrtrggrrc padatan raectnsrerst gtgrtagatt BLULBcLpAar AA LA LA Ge Dre rEgtgrctmtt n npgaranon tartgrttgr angaraargt gtgtgrcmrt LELLLELLEE Hgrmramtrct 3454414444 ru umgauaumgtm ac caBroagger Errtgttrtrm BREQEEGcCEg FAATTAA tgytagetg LL LGL GES ggctuattgrcm BEL CRRE EE r i ICA sy FAATTAAK CATOGOCCAI verk KUTA ETLTG ASA gtatgggttr portat ee ob EEEEEEEEEE angcggrcgoa
40. e 29 eS ce 5 Be Segunda Gee Took Help MCen E amp bonz Esma Exod Ew Euan En T bong Eon B Denig E T1 Emon12 Pesos Tage Seach Angan Pras Sats Feste Sint ft sn ET End imes Eni 1613 Emi 1 was zd uu Ma was 1367 Optional Select Show Sequence to show the entire length of the sequence on the chart with all exons indicated The button label will change to Show Near Exon or Target Selecting this button again will redisplay the area near the current exon LightScanner Instrument lt gt Primer Design Software Manual gt REV 01 155 CHAPTER 4 Designing Primer Sets LigheScasaer Primer Design Soma Ee Barns getngr Tob Heb Moen E amp n 1 Bon Esma Exo Een Ewent En T Ex Esma Eco Ee 11 Exc Res Tapi Seach Fimgien First Sat To adjust the search regions for an amplicon activate the search region tab and then 1 Drag the pink and blue bars left or right to move the search regions 2 Drag the boundaries of the bars to widen or narrow the regions 3 Edit the Start and End fields below the chart to change the region boundaries After adjusting the boundaries select Search or select the Primer Sets tab The software will dis cover primer sets within the search regions for each amplicon and rank them displaying them in descending order Evaluating Your Existing Primer Sets Using the LSPD Software If you already have a primer set s for your target you may ev
41. e that falls within the 50 70 base fragment size EES LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help Design 1 Sequence Annotations Target Search Region Primer Sets OMS BLAST Fixed Oligos Set Amolicon Forward Primer Feverse Primer PCR Conditions Bank Sese Long Pasi 3 Pos Len Tmj s Pos 3Pos Len In Im Addo Gradient Comments 206 54 3 3 22 2 299 113 363 i 273 25 518 132 386 166 83 273 25 604 7 310 227 252 5 273 25 Set Comments Target Comments Alignment gagacaaaccttgttaattccct atgtaattctcctatctcaccttaaa SNP Rank4 Score 241 Forward 3 Pos Length GC Tm Delta G gagacaaacctigttaattecet pa 266 23 3 9 1 6 0 2 122 Reverse aaattccactctatcctcttaatata 237 272 26 308 538 H 7 0 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 7 Designing a Small Amplicon 6 If the software does not return primers for amplicons in the desired size range return to the Search Region window and reduce the search regions to approximately 30 50 bases on either side of the SNP Select Search LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help SNP Sequence Annotations Target Search Region Primer Sets Position 561 400 Nucleotide Position Search Region Start 301 End 329 7 Highlight optimal primer set and
42. ed can be selected using the pull down menu Use the Select From pull down menu to choose the organism against which the sequence is queried Selecting Okay sends the request to the NCBI BLAST web site When the request has been received your internet browser opens to the NCBI BLAST home page The page displays results when the search is complete LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 5 Results Import Current Selection will bring up the BLAST dialog box with the selected primers entered into the Forward and Reverse Primer Seguence fields Search All Performs the same function as the button on the Seguence tab By selecting Search All the software will discover all primers for the annotated exons e Search Current is active if a single exon tab is activated Primers will be selected for the selected exon e Search Selected Will bring up a dialog box with a list of all the exons that were discovered within the sequence with a check box next to each exon The user has the option of selecting specific exons by using the check boxes next to the name of the exon limiting the searches to only the selected exons e Annotations users can access the same functions as described in Chapter 3 Defining Exons SNPs and Regions LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 255 CHAPTER 5 Results lt 26 gt LightScanner Instrument lt gt Primer
43. enes Et bea F check CN Mutolink CEDE se Sand toe T i stra denye e i NG GR anh ee pe a E Genoees Genome Browser Bir hiz Gene Sorter POH SETT Toni Sequence Near Cose Get Genomic Sequence Near Gene Mote X you would prefer to get DNA Tor more than one beabure of this track at a tome try the Table Dreserer wang the output format sequence Sequence Eetrieval Region Options S FromscenTpnream by eun bases ETE 2 5 UTR Exons e CDS Exons 2 3 UTR Eroni f Introns 181 Ce FASTA record par gene One FASTA record per regjen jeron iiron etc wath mira bases upstream 31 and 0 Jerira downstream 37 Ol Spit UTR and COS parte of m exon into mpane FASTA record Hote a feature is close te the begining ov end nf a chromiesomt and upstream downstream baser ace added they may be truncated an order be area exiendng part the edge of the chromosome Sequence Formatting Options 2 Exons tn upper case everyihing else in lower ca CDS m upper case UTE m lower com X All upper case CAN aa Obs repasts Odo l ver case to N 7 Save the file as a text txt file that can be opened with the primer design software LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 45 gt APPENDIX B UCSC Browser lt 46 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 Index INDEX A L Additives
44. ent gt Primer Design Software Manual REV 01 23 CHAPTER 5 Results Common Target Settings These are the default settings used for primer design in either the Scanning Primer mode Common settings or the Single Amplicon mode Target settings The settings can be modified by the user and saved as the defaults Show Oligos Uppercase Normally the bases within an exon are displayed in upper case and the bases in introns are displayed in lower case letters All of the oligonucleotide primers can be displayed in upper case regardless of location by choosing this option Top 50 Sets Shows the top 50 primers selected by the software Some of these primer sets may have the forward or reverse primers in common and are thus considered to not be unique all primers are ranked by score Limit Sets Shows the top 5 unique primer sets found by the software These sets should have no primers in common and will be ranked by score Show All Sets Shows up to 1000 sets of primers selected by the software including the low est ranked sets tScanner Primer Design Software 1 0 Beta 79 quence Settings Tools Help 1 Exon 1 Exc by ee Lena pan aa wan Est Alignment i an Cross Comp Tool ELEN Cross Comp Tool Import Current Selection Show Alignment of Current Selection BLAST BLAST Import Current Selection Search All Search Current Search Selected Annotations k 25799 383 Exon 11 Amplic
45. equence window the data is pre entered in the dialog box You have the option of renaming the SNP choosing whether the SNP should be covered avoid ed or ignored or entering a description of the SNP for record keeping Add SNP Cancel Status Avoid Description Test Color DEN Background Color E Data lt 10 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 3 Annotating Seguences Defining Regions 1 In the seguence window highlight the region of interest and select Add Region or select the Add Region button in the Annotations sub tab 2 The data from the highlighted region is pre entered in the dialog box You have the option of renaming the region or choosing whether the region should be covered avoided or ignored A description of the region can be entered for record keeping Add Region Mame Region Target Start f e1 131 End f fe 131 Status Avoid Description Text Color E Background Color E betast 3 Repeat steps above as needed to define additional exons SNPs and regions Inserting Text in a Sequence 1 View the sequence of choice If the Sequence locked option is checked uncheck it and select the Insert option 2 Place the cursor at the location where the new sequence information is to be inserted and either type the new characters or paste a copied sequence Replacing a Single Sequence Character 1 View the seq
46. er the same amplification conditions in order to cover a large exon The position of a set of primers within the sequence context relative to the region the primers are designed to amplify LightScanner Instrument gt Primer Design Software Manual Rev 01 Function Cross complementarity Delta G Fiked Oligos Additives LightScanner Instrument Description The inter or intra molecular interactions of oligos within a given primer set Additional oligos e g probes can be added to the analysis if nec essary The thermodynamic stability of the inter and or intra molecular interac tions between a set of oligonucleotides User defined oligo seguences that can be scored by the software to determine their suitability for PCR Chemical additives such as dimethyl sulfoxide DMSO or Betaine that are routinely included in PCR reactions to lower the melting temperature of the double stranded DNA in the reaction Additives are recommended for high resolution melting with LCGreen dye when amplicons have a GC content greater than 65 Primer Design Software Manual Rev 01 ix gt x LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 01 Intended Use The LSPD software enables users to design primer sets for mutation scanning and discovery using the LightScanner instrument The primary application is for designing primers that amplify every exon of a given gene specifically for high res
47. et format for data archiving or can be saved as a primer design file spd file that can be re opened in the software LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 41 APPENDIX A Ouick Guide 2 To locate the position of the primers in the context of the entire seguence highlight the amplicon in the scre en and select the Alignment button E Alignment Exon 1 Rank1 Score 713 601 cggcgccggggaccgctgccacccecgcctagcgcagcgcccecgtccttcecgcagcccaaccgcctcttcccgcceccegceccecatcccegcccacgggctceca gecgoggereotggogacrggtggggeggategogtegeggggraggaaggegtegggttggeggagaagggeggggeggggtagggegggtgeregaggt gtgggegggarcagaggagteeegegtteggggagtatgteaaggecgt gass miss meets gg co OGaacgggai cacccgccctggtctcectcagggcgcaagcccctcatacagttccggcactgggcacataataacaggctcaccggccttgccctcoggtt sgtgagagggagcccagcggtgcggtogggctggaacatgggtattgtggtgtcggagcagggggccctyggccaaaaat pbecetegqgtegecacg ecacccc Gemeente ee mag ecetegtececegqgacceeggttttta aggtgegqgcceqqgaggagt gggaagtegggetgaggaaggqagecagectaggqggeececcaacctgetttcacgectectaccaccggacggaacgtagec tccacgccggccctcctcacccttcagcccgactccttcctceggtceggatccecgggggttggacgaaagtgcggaggatggtogcectgccttgcatcgg tagcgtttcattttccgtatcctcccgtcaggcgaccccgttatagcecggcatcctctctttagaatatcgtttttctttctctggtaaaccctccaaat atcgcaaagtaaaaggcataggagggcagtccgctggggcaatatcggccgtaggagagaaatcttatagcaaaaagaaagagaccatttgggaggttta atttaccgcgggaatcccacctttttccaaagtgaccccgtctctgtgtcagaaccacgggaaaaagaaa
48. ftware 1 0 Beta 80 File Sequence Settings Tools Help Design 1 Sequence Annotations Target SearchRegion Primer Sets Cross Comps BLAST Fixed Oligos Set Comments Target Comments Re Primer PCR Conditions Score Length XGC 5 Pos Tm 5 Pos 3 Pos Len Tm Tm Additive Gradient Comments 4 525313 53 5 N 1 j 64 2 15 64 3 281 44 2 337 454 313 141 ode ccc RN EIS aaggctaatatggtaaatgacccat SNP Ranki Score 255 Forward 5 Pos 3 Pos Length GC Tm Delta G ca99agaatggegtgsae 31 3 330 h 8 55 5 605 1 5 1 Reverse tacccagtaaatggtataatcggaa 453 423 25 30 60 3 178 8 Return to the sequence tab the primers will be highlighted in blue in the sequence window LightScanner Primer Design Software 1 0 Beta 80 File Sequence Settings Tools Help KEk SNP Sequence Annotations Target Search Region Primer Sets C Replace Sequence Locked aaaagattat tttctctaga aactgttttc aaaagttggt tegagaccat acaaaaaatt gggaggetga tgagccgaga ccgtctcaaa EM atatata ctataaaatg cetgtaatcc caggagtttg aaaatacaaa tactccagaa tgcagtgagc agactgtctc tgaacttgac CCcCttttttt gtatettgat tagtataata aaatttgaaa atatacatag ttccgggagg cccecggctaaa agccgggcgt tcccgccact aaaaaaaaaa ctacttagtt caaataacac cagcactttg agaccagcct aaattagcca getgaggrag tgacatcaca aaaaaaaaaa atatagtagg catttaggaa cttaatgtta attgagaaat ctcttaacaa caagttcaga cegaggegg
49. g acggtgaaac agtggeggge gilactccagc aagttggt m acactactta eteccatgag ggaggecgag gaccaacatg agcgtggtgg gagaatcacc ccactgctct aaaaaaaagt cagagagcat gtgatctaaa tgtggactat tactgttaaa aacctgcata ctetgactta cggatcacga cecgtetcta gcctgtagtc ctgggaggcg ctgggegaca cogattatadc catagcttca ggetgggegt gtgggtggat gtgaaacccc cgcgcaccta tgaacctggg ccagccetggg gtatttaaag tcagtaagtg aacagtattg tttaacttcc aagttttgag atactaactt tatgaacttt ggtcaggaga Ctaaaaaaat ccagctactt gagcttgcag gagcgagact gtttccttat ggcgctcatg cacetgaggt atetttacta taatcccaac aggtggaggg caacagageg cacttagcag ttggcttgct ttagtaaatg cttttaaatg Experiment Type 4 Single Amplicon Primers Sequence Information Name SNP Access H Author Deepika des ilva First Position Poo Last fon Length 1000 zat 438 Position pz cDNA Comments Annotations Add Exon Add SNP Add Region Edit Amplicon e Select the amplicon sequence as well as some sequence surrounding the amplicon and copy the seguence lt 28 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 6 Designing LunaProbes 9 Save the file by going to the File menu and selecting Save or Save As We will call this docu ment the amplicon document 10 Minimize the amplicon document Design Your Probe 1 Open a new LSPD Software window and choose the Single Amplicon module Paste your frag
50. ggetggaacatgggtattgtggtgteggagragggggeretgggrraaaaat gtoceotogggtegerarcgorarctet sees pekes tett s ee madgtotogtoocoogggaccoggttttta aggtgcggccgggaggagtgggaagtcgggctgaggaaggagccagcctaggggcccccaacctgctttcacgcctcctaccaccggacggaacgtagcc tecacgecgycectectcaccettrcagcecgactcottoctoggteggatcccegggggttggacgaaagtgeggaggatggtggectgecttgrategy tagcgtttcattttccgtatcctcccgtcaggcgaccccgttatagccggcatcctctctttagaatatcgtttttctttctctggtaaaccctccaaat atcgcaaagtaaaaggcataggagggcagtccgctggggcaatatcggccgtaggagagaaatcttatagcaaaaagaaagagaccatttgggaggttta atttaccgcgggaatcccacctttttccaaagtgaccccgtcetcetgtgtcagaaccacgggaaaaagaaaaatgygagcagctactccttgaaatacttaa taaatggcgcccttagggtggaaaaaggtttcactggggcagagacacagtcettggtgcccetttttctttttacctcgtcegatgaggaactttatgaatt 601 tgtttaataagcttttcgttgtaacgtttccacgttgcttacgggaaaaaaaaaagtaaaaaaaaaacctgycagaattttatgtgaacttgtgtgtatat dm m m m m dm LA dm m mr ms m m RAN m ms ma m dm dm man m m RA mur ma ms ms m mn ms marina ima ima de de de de de de de do do LA de de de de de de de de de LA LL LL m m ms ms dm m m m m dm dm mr m m ma m ma m m m dmm Rm Bases per Line 100 IV Show Positions p Ell iyi gt To view primer cross complementarities click on the Cross Comps button LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 21 gt CHAPTER 5 Results Ell Cross Complementarity Exon 1 Rank 1 Score 713 Clear All 3 Alignments iw Forward cccgtatattattgteegag Mi
51. htm C42R5H55 ext E GADD454 sequence Ext MCAD Atm 4 NCBI Sequence Viewer vz O htm 4 slcz2A5 htm tps3 homolog htm amp vKORCI jason htm File name x Fag Files of type GenB ank Fasta E mbl file mht html htm ty vw Cancel The sequence will appear in the display window The software reads the exon annotations imported from GenBank htm files finds the exons automatically converts them to uppercase and highlights the exons on the screen for easy viewing The software recognizes any uppercase letters as exons so text files imported from the UCSC Genome Browser with exons annotated in uppercase will also be read correctly Note The sequence must contain at least 200 bases of sequence upstream of the first exon and downstream of the last exon in order for the software to recognize these exons correctly L Dia agerem Settings Tuch Hap MCAD font Een Bend Eem Em Ex E Ban Ex Exon Ex iD Exontt Eni Basis S qessor rnotsters u o a 4651 SSC aol gacrgra rrc ETOI g agmEctkcm gtttgttaoast 7 21 amp ENIEQgtgat lela NN 437i 4aLatalaad TELTALLALT tangis 1 tmtttmtta amp c mttmkEtHERN 4151 TgrLtTOLTCLL LLTAATATCOT 2101 ctgttmcttt tctttctttt 6151 TLOTQgLOACOA Fat gaged E201 tcacutcctg gugttcamgag E251 Pa bei Ten La Tele ang le TA Ta IT ro gJagatryygyt TLOSTJST YT E151 gtugatctgcc ta amp cctcuaggcc si CACOUOgTOT JASGAT AT Bi
52. imer Design Software Manual lt gt REV 01 CHAPTER 2 Starting the Software ii li E CHAPTER 2 SIARIING THE PRIMER DESIGN SOFIWARE The LSPD software enables users to design primer sets for mutation scanning and discovery using the LightScanner instrument The primary application is for designing primers that amplify every exon of a given gene specifically for high resolution melting A secondary application is the more tra ditional primer design workflow for the design of single amplicons Import Sequence Formats Before you launch the software you will want to create sequence files for import The LSPD software will allow you to import sequence from the following formats European Molecular Biology Laboratory EMBL FASTA GenBank or regular text files When designing amplicons that cover all exons in a given gene the most important thing is to cor rectly identify the boundaries of each exon Two common ways of obtaining this information is either through annotated GenBank files http www ncbi nlm nih gov sites entrez or through the University of California Santa Cruz UCSC Genome browser http genome ucsc edu ah HO Sequeace Yew EFE I Ee EX Wew Faste To Hap i Q WG Sao from O 2 3 LJ dens WA C pecunmnir and Satire kwapa cashuafowaktopi SPC tani hari Acan tra f ge inks Google C Tab ET Y honras Ehi beda oske viss oo N Genge wiseacvweh sc He e D Gone Brera c d eos Dros cw E DE HC 600001 Riots
53. is parameter defines the length of the 3 exon intron boundary that is excluded from the search region No primers will be placed over this boundary allowing the scanning amplicon to include splice sites as well as the exonic region The default length of the 5 exclusion buffer is set to 5 bases however this value can be manually increased to suit user preferences Primer Design Software Manual Rev 01 vii gt Function Minimum Overlap Primer Tm Minimum Maximum Primer Tm Primer Score Primer Rank Primer Sets Primer Groups Alignment lt vili gt Description For high resolution mutation scanning it is desirable to keep amplicon sizes below 400 base pairs The software will automatically divided large exons into multiple amplicons in order to obtain the optimal amplicon length The minimum overlap parameter defines the length of double coverage from adjacent amplicons when an exon is broken up into mul tiple fragments The default value for this parameter is set to 5 bases because empirical evidence has shown that mutations that are 3 5 bases away from the 3 end of a primer can still be detected by high resolution melting This is the predicted melting temperature Tm of the primer The func tional Tm of an oligonucleotide may be increased by as much as 5 10 C in the presence of LCGreen dye It should be noted however that this is a theoretical value and an annealing temperature gradient PCR experiment
54. is strongly recommended to determine empirically the optimum annealing temperature for each primer set The software allows users to specify a Tm range when selecting primer pairs The recommended Tm range is usually about 5 C example 60 65 C The software will search for the best primer sets within this range while always matching the Tm of the forward and reverse primers within each set This allows for maximum flexibility in design while still maintain ing stringency We do not recommend using a Tm range of 2 5 C when searching for primers due to the overwhelming number of primers that will be generated The software scores each primer set against a hard coded set of design filters Scoring is based on penalties with a perfect score no penalties equal to zero Scores with 2 4 digits are coded green good scores with 5 digits are scored orange moderately good and scores with more than 5 digits are coded red avoid if possible Primer sets with the lowest score fewest penalties are ranked the high est Primer sets are displayed by rank in the summary results table Primer sets consist of a single forward and reverse primer Set scores and rank reflect the compatibility between the two primers that comprise a single amplicon Primer groups consist of multiple primer sets that are needed to cover a large exon or region Compatibility scores and rank for primer groups help the user decide what primer sets can be used und
55. l lt gt REV 01 lt 1 gt CHAPTER 1 Installing the Software 3 The License Agreement window is displayed After reviewing the agreement select Yes to con firm and move to the next window Selecting No will terminate the install process InstallShield Wizard License Agreement Please read the following license agreement carefully Press the PAGE DOWN key to see the rest of the agreement IDAHO TECHNOLOGY INC END USER SOFTWARE LICENSE AGREEMENT This End User License Agreement this License is legal agreement between the person corporation business limited lability company or other entity which owns or operates the computer on which this Software iz installed run ar executed as well as each individual employee agent or other personnel using this Software each a User and Idaho Technology Inc ITI 1 Certain Definitions Do you accept all the terms of the preceding License Agreement If you choose No the setup will close To install LightScanner Primer Design v 1 0 B 78 vau must accept this agreement 4 The Choose Destination Location window opens Select a location for the software by using the Browse button or leave on the default C Program Files ldaho Tech Select Next to con tinue InstallShield Wizard Choose Destination Location Select folder where Setup will install files Setup will install LightS canner Primer Design v 1 0 8 79 in the following folder To install to this fo
56. l variant under the probe is the equivalent of a double mismatch This makes it very easy to identify novel variants and differentiate them from the SNP of interest 8 To determine if your probe should be on the sense or antisense strand choose the mismatch that is the most destabilizing For base pair neutral mutations either strand will work See stabil ity ranking below General Ranking of Base Pair Stability Stable G C gt A T gt G T gt G A gt T T gt G G gt A A gt C C gt C TsC A Unstable 9 Using the example above if the probe is designed to the variant sense strand the probe wild type duplex will harbor a T G mismatch If the probe is designed to the variant antisense strand the probe wild type duplex will harbor a C A mismatch Since a T G mismatch is more stabilizing than C A see chart above you would choose the antisense strand for the probe This will give you the biggest Tm separation between the genotypes in the actual experiment 10 If you choose the antisense strand for your probe highlighting this region will display the sequence in the Reverse Primer text box A probe designed to the sense strand will be dis played in the Forward Primer text box 11 Use the lt gt keys after the oligo box to get required length and Tm Recommended length is 20 30 base pairs and recommended Tm is 60 65 C 12 Check the Tm You may increase or decrease the oligo length to achieve the recommended Tm Make sure the SNP is
57. lder click Next To install to different folder click Browse and select another folder Destination Folder EM AldahoTechiLightScanner Primer Design browse Cancel lt 2 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 1 Installing the Software 5 The Select Program Folder window will open The Desktop icon allows you to start the applica tion by double clicking an icon on your desktop and is useful for freguent users The Program menu icon will appear in the Start gt All Programs menu Click Next to continue InstallShield Wizard Select Program Folder Please select a program folder Setup will add program icons to the Program Folder listed below You may type a new folder name or select ane from the existing folders list Click Mestto continue at ta Program Folders Lights canner Primer Design Administrative Tools Adobe Broadcom LA Registration Dell QuickSet Dell Wireless eT rust InoculatelT Games Install hield Cancel 6 The InstallShield Wizard Complete window opens Select Finish to close the wizard InstallShield Wizard InstallShield Wizard Complete Setup has finished installing LightS canner Primer Design v 1 0 5 79 on your computer LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 3 gt CHAPTER 1 Installing the Software lt 4 gt LightScanner Instrument lt gt Pr
58. mber 46 d 3 supT 6H 35303 ME NN IEEE chr14 20 905 870 chromatin specific transcription elongation 4 MRPL22 17392 MN SURE IRE chr5 154 313 781 mitochondrial ribosomal protein L22 isoform a 5 IMRPLAS wa Hm HN NNNM Ichr17 33 719 572 mitochondrial ribosomal protein L45 3 Click on the description box 4 Find the Page Index box and select Sequence LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 43 APPENDIX B UCSC Browser J Hustan Gene ML ATEH Ical 1 Oei Him ani Pepe beder imn ag pugne Fie EX view Favorites Tod Hen Goo Q i ig o sm frame O 2 3 Bel biken i b ter ura adde ihrer m hg qanm Ke Lh changam ha gg tar Oe bahan TE l ge o Google C edi p Ep Vy onae fr boder Shake Sh Aunik m Tiam 0 Dai ute xv viste D D d Linc Queer c gras c ees gt Jo use ap Ed Mee Genomes Genome Browser piat abses Gene Sorter PL Human Gene MLHI ract scgl Deseriprion amil Page Index Drerrnpmee hel prcten hemokg Bodo Semar NDA 00249 Thi gene wes identlied aa locus frequentdiv mutated in hereditary nonpelypead colon cancer EEHP CX Tris human lemolz MEE cok DMA mismatch repair gene mil persistent with the charactenstic aberstions n mirrosabalite sequences EER phenotype Bunda HHPOG Alternaterely spliced transeret variants encodzg different s foens have been descnbed but ther foll leneth natures have not been determine d Band Genome Stee 5725 Fres Cmmi 7 Cede
59. ment into the new document LightScanner Primer Design Software 1 0 Beta 80 File Sequence Settings Tools Help Design 1 Sequence Annotations Insert C Replace Sequence Locked gt Experiment Type tcgagaccat cccggctaaa acggtgaaac ceegteteta ctaaaaaaat Single Amplicon Primers acaaaaaatt ageegggegt agtggeggge geetgtagte ccagctactt gggaggetga ggcaggagaa tggcgtgaac ctgggaggcg gagcttgcag Sequence Information tgagccgaga tcccgccact gMactccage ctgggegaca gagcgagact ccgtctcaaa aaaaaaaaaa aagttggttt ccgattatac catttactgg Name gtaatatata ctacttagtt acactactta catagcttca gtttccttat Access ctataaaatg caaataacac ctcccatgag ggetgggegt ggegetcatg Author Deepika daSilva cctgtaatcc cagcactttg ggaggeegag gtgggtggat cacetgaggt First Position 1 Last 400 Lenath 400 GC 508 Position 172 cDNA Comments Add SNP Name SNP v Target r Annotations Add Exon Add SNP Add Region Start 172 AddSNP Add Region Status Cover Y UR Import Sequence Description Avoid Cover Text Color DEM Background Color i Detaut Define Amplicon 2 In the Sequence tab highlight the SNP or mutation of interest select Add SNP In the dialog box select the Target box and change Description to Cover Select OK The LSPD Software window will display a SNP tab 3 Select Target tab to view target information 4 Under Experiment Settings change 5 and 3 exclusion buffers to 0 LightScanner
60. n Delta G jw Reverse caccacaatacccatgtteca ly Min Length 3 Alignment Iw Multi Match 5 M Forward ccogigtattattgtccgag w Show Delta G M Reverse caccacaatacccatgitcca 2 iv 3 pas 5 Min 3 Length Min All Length If you are connected to the Internet BLAST the primer sequences directly by clicking on the BLAST button to check the specificity of the design BLAST Exon 1 Ranki Score 713 Forward Primer jecegtgtattattgtccgag a Cance Reverse Primer caecacaatacccatgtteca Database nr Select Fram Hone lt 22 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 Menu Options Seguence Menu LN LightScanner Primer Design Sc Settings Tools Help MI Import Sequence Exon 3 Export b c m Exons To Uppercase Find Find Mext qu ac tz EET art rat ti vrat r e Import Sequence allows users to open a file for analysis CHAPTER 5 Results e Export lf you are in the sequence input screen you can export the sequence in FASTA format Alternatively if you are in the Results tab you can export all the primer selection information in CSV format that can be opened in a spreadsheet program such as Excel e Exons to Uppercase if you are in the sequence input screen and the sequence is annotated with the exons in uppercase this function will automatically highlight the uppercase characters in green and mark them
61. n be exported in a spreadsheet format for data archiving or can be stored as a primer design file spd file that can be accessed through the software lt 20 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 5 Results To export data use the Export to CSV option from the Seguence menu and give the saved file a name The file can then be opened in MS Excel LightScanner Primer Design Software 1 0 Be File KAA Settings Tools Help Import Seguence Export Fasta Exons To Uppercase iD ee Ambiguous Bases pr adan F KJ Microsoft Excel MCAD csv BIK Bj File Edit View Insert Format Tools Data TlAnalyst Window Help Type aquestionforhelp X Wl OeRMAR GAY Gm amp Co amp r Hil ki G BEES s 5 SRG tata BOS pp ga WA Reply with Changes End Review q M 4 Exor Find Find Next N41 M fe TA ee 0 E F e H 4 K Ll M NEMM O P 1 Name Rank Score Amplicon GC Forward SiS Pos 3 Pos Length Tm Reverse SiS Pos 3 Pos Length Tm 2 Exon1 1 713 121 cecgtgtatt 152 171 20 59 4 caccacaat 272 252 21 60 1 3 Exon2 1 2828 205 Oicagtagtcte 3739 3 68 30 59 9 aaagcttcat 3943 3914 30 589 4 Exon3 1 6002 220 tttccttgttat 8002 8031 30 BD aaatecaga 8221 8192 30 60 1 5 Exon 4 1 3905 182 O agattatgtas 6194 8223 30 59 9 tittettactes 8375 8348 2 897 6 ExonS 1 602 195 D ctattgtgatg 8880 8
62. olution melting A secondary application is the more traditional primer design workflow for the design of single amplicons End user License Agreement for Software This End User License Agreement is a legal agreement between you either an individual or an entity and Idaho Technology Inc Idaho Technology the manufacturer of the LightScanner system If you do not agree to the terms of this Agreement you may not install use or copy the SOFTWARE contained in this product and you must promptly contact Idaho Technology for instructions on return of the entire LightScanner System and SOFTWARE for a refund 1 Ownership of the Software This SOFTWARE and the accompanying written materials are owned by Idaho Technology and are protected by United States copyright laws and international copyright treaties as well as other intellectual property laws and treaties The SOFTWARE is licensed not sold 2 Grant of License Idaho Technology grants to you a LICENSE to install and use the SOFTWARE on one or more computers provided that all users are at a single working location Use of the SOFTWARE at multiple working locations will require a separate License for Multi site Use from Idaho Technology for each additional working location You may not copy the SOFTWARE onto a portable diskette or storage device except for one copy of the SOFTWARE in machine readable form solely for backup purposes provided you reproduce Idaho Technology s copyright noti
63. on 1 252 361 35421 154 4365 Exon 11 Amplicon 2 250 352 36609 5163 Exon 12 198 273 38020 Tools Menu 24 Fixed Oligos The user has the option of manually entering primer sequences and allowing the design program to score the results This can be useful when deciding whether to use available primers or embark on a redesign The fixed oligo feature can also be accessed from every Exon tab at the top right hand side of the Target subtab Cross Comp Tool When a primer set is highlighted in the Results tab the Cross comp tool can be used to examine the complementarities between the oligos including self complementar ity Cross comp scores are part of the overall scoring of the primer set and can be a useful clue as to why a primer set has scored poorly Users have the option of modifying the default param eters used for scoring including the minimum acceptable length of any complementarities at the 3 end and also across the length of the primer as well as the acceptable A G A useful feature of the Cross comp tool is the ability to include an additional oligo for example a probe to check for interference The software will return any complementarity between the additional oligo and the primers as well as the stability A G of the interactions if any BLAST This will open a window that can be used to manually enter sequences for a Forward and Reverse Primer The various NCBI Databases against which the sequences will be queri
64. onal LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 01 lt iii gt iv LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 01 CONTENTS Customer and Technical Support oo Woo oom ili WI I EE T vii Intended Use and License Agreement xi Chapter l Installing the Software ai Hardware Requirements oo oom 1 Installation Instructions Mc 1 Chapter 2 Starting the Primer Design Software momod Import Sequence Formats oom 5 Launch the Software iiio esses ruunt tton na circu n mzaa u nanunua nunua kx CUOR RAN UTE EVER RA C E NE 6 Chapter 3 Annotating Sequences woman Defining Exons SNPs and Regions eere eee 9 Defining ah EXON REE EE ENE ET 9 BLE Tale 6 SI NDI EEE EEE 10 Defining apt mmm 11 Inserting Text in a Sequence oooo W 0 WWW oo W mmk 11 Replacing a Single Sequence Character oooWooo Woo Wo Wan 11 Chapter 4 Designing Primer Sets sssini 13 Using Common Design Parameters oo oom 13 Customizing Design Parameters for Individual EXONS 14 Evaluating Your Existing Primer Sets Using the LSPD Software 16 Chapter or Kei View Summary Results oo mom 19 View Results Tor Individual EXONS w o o o oooooooooooo omooo o wmoo mooco mommoo momowmibimiih
65. s bima 20 Saving and Exporting Data TE na oa Sasa nunua 20 BLAST Series P 21 Checking Sequence Alignment c oo mna 21 Checking Cross Complementarities oooooooW oom Wa 21 need NN 22 Menu Op COINS Jaa maan 23 Sequence MENU TK 23 Seng GENE NE ST 23 Tools Menu EEE EE nw eae so ws EE 24 LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 01 lt V gt Chapter 6 Designing LunaProbes oom om oom 27 Design Your Primers ie bibi 27 Design Your PN ER 29 Determining Probe and Primer Compatibility 32 Chapter 7 Designing a Small Amplicon for Genotyping woo 35 Appendix A Quick Guide to Using the LightScanner Primer Design NE nn 39 Step 1 Launch He SOM Wall isis etim adit eta aa a UM Iq me Baca iba Ud Bean d sa 39 Step 2 Import a Gene Sequence Woo oo o o W o ooooWoo an daa ann daa aa uus 40 Step 3 Search for Primer Sets Using Common Design Parameters 41 Step 4 View and Export Results eese nnnm erem nnn oo 41 Appendix B Getting Annotated Text Files from the UCSC Genome BO WS obi 43 vi LightScanner Instrument lt gt Primer Design Software Manual lt gt Rev 01 Function Single Amplicon Scanning Primers 5 Exclusion Buffer 3 Exclusion Buffer LightScanner Instrument Description
66. select Cross Comps to check cross complementarities If con nected to the Internet BLAST primer sequences to check the design specificity 8 If primers do not display any significant cross complementarities and are specific to the target region primers can be ordered LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 37 gt CHAPTER 7 Designing a Small Amplicon 38 gt LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 APPENDIX A Ouick Guide APPENDIX A QUICK GUIDE TO USING THE LIGHTSCANNER PRIMER DESIGN SOFIWARE The LSPD software enables users to design primer sets that amplify small segments of large regions of interest These primer sets can be added to the users gene files The primers designed will only be used for scanning analysis LIgniScanner An Primer pint Enn Versione T4 B TO GEO karo Tinned ony irs east paten Tes ome ge program tf probed fr one pm gre n da vtero d t me LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 39 gt APPENDIX A Ouick Guide e o o o c dio c c o o co c c c o c cM o co c o co o o co o o co o o o o o o o o o o c o o c o o dic c o o o e o o o e o o6 e o 0 o o 0o 0 9 96 GO 09 0 9 9 O0 0 0 O 0 9 0 9 9 O 6 0 0 9 0 9 9 0 O 9 0 O 0 0 O 0 9 0 O 9 O 0 0 O0 0 0 GO 9 0 O O 0 O0 0 9 9 0 9 0 O 9 09 O 0 9 0 9 9 O0 O 0 9 0 0 06 O 9 0 6 9 6 6 1 From the Sequence menu
67. ss for a particular purpose Idaho Technology shall not be liable for errors contained herein or for incidental consequential damages in connection with the furnishing performance or use of this material Xii gt LightScanner Instrument gt Primer Design Software Manual Rev 01 CHAPTER 1 Installing the Software CHAPTER 1 INSTALLING THE SOFIWARE Hardware Requirements Operating system Windows XP Windows 2000 CPU 80 GB or greater RAM 512 MB or greater Display 1024 x 768 or 1280 x 1024 Connections Network card Optional Internet access will be required to perform BLAST searches Installation Instructions The LightScanner Primer Design LSPD software is automatically installed on the computer that is used to run the LightScanner instrument Users may install the application on independent comput ers that meet the minimum requirements if desired using the installation disk 1 Insert the LSPD software CD into the CD ROM drive of the computer 2 The installation wizard will display a welcome window and guide you through the installation process Select Next to move to the next window InstallShield Wizard Welcome to the InstallShield Wizard for LightS canner Primer Design v 1 0 6 79 The Install5 hield amp Wizard wall install Lights canner Primer Design v 1 0 5 79 on your computer To continue click Mest i Cancel LightScanner Instrument lt gt Primer Design Software Manua
68. t 750 Length 750 ALIM 41 3 501 ggttgatggc aattccagtt aactgetgtg cagctetcat eteattgtge 551 acacagcatg gaaatctttc tcaaaactgt ttcactcagg tcagggtaac Position zi cDNA 601 aagtttggta gagcaaaccg gtgaatgata ctctcatgca aaactgaaca 651 gatatgcaaa catatgtatg tggttcagct tgggttgcat gggttcagac PORE 701 tttgcaatgt gtagtttaat aggtaattac ccttaacgct tttgcaggga E3 Cancel LightScanner Instrument gt Primer Design Software Manual lt gt REV 01 Experiment Type Single Amplicon Primers Name Add Exon Add SNP Add Region Annotations it lt 35 gt CHAPTER 7 Designing a Small Amplicon 3 Select the Target tab that appears and refer to the Experiment Settings at the right hand side of the screen Verify that the Min and Max Amplicon Sizes range from 45 150 and change both the 5 and 3 exclusion buffers to 0 4 D lt 36 gt Seles LightScanner Primer Design Software 1 0 Beta 79 File Sequence Settings Tools Help Design 1 Sequence Da Region Primer Sets catcaccagg tgccagcagc cctacctaca attagataaa etteattetr accttgttaa ttctctgcaa 1 aaaacctttg ttttgtette 451 cecgattatt ggttgatggc acacagcatg aagtttggta gatatgcaaa tttgcaatgt attttetgtg ggaagagatc tctgcactgc gccaaatgaa tgccagtcag ttccctagaa tcttgcattt gtaggtaggg taaattttge ttgctactcc aattccagtt gaaatctttc gagcaaaccg catatgtatg gtagtttaat gtacagaaca cctgtgagtc ctcccgtgac ttcctggct
69. t Color DEN Background Color E Defaut LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 lt 9 gt CHAPTER 3 Annotating Seguences Alternatively 1 Select the Annotations sub tab and then select Add Exon The Edit Exon dialog box opens 2 Enter the information to define the exon name and location or leave default name click OK LightScanner Primer Design Software 1 0 Beta 79 Hok File Seguence Settings Tools Help MCAD Exon1 Exon2 Exon3 Exon4 Exon5 Exon6 Exon Exon8 Exon9 Exon10 Exon11 Exon12 Results Sequence Annotations Add SNP Add Region Edit Selected Delete Selected Delete All Default Colors Exon Exon 1 192 221 cl c 30 Ignore Target Exon Exon 2 3805 3892 Ji c 118 Ignore Target Exon Exon 3 8048 8145 c119 c 216 Ignore Target Exon Exon 4 8257 8325 c 217 c 285 lgnore Target Exon Exon 5 8332 9032 c 287 c 387 01 Ignore Target Exon Exon 6 10195 10275 c 388 c 468 Ignore Target Exon Exon 7 15384 15514 c 463 c 599 Ignore Target Exon Exon 8 21210 21318 c 600 c 708 Ignore Target Exon Exon 9 24823 24963 c 703 c 849 Ignore Target Exon Exon 10 25855 25850 c 850 c 945 Ignore Target Exon Exon 11 36526 36774 c 946 c 1194 Ignore Target Exon Exon 12 38096 38157 c 1195 c 1266 Ignore Target 1 Highlight the SNP in the sequence window and select the Add SNP button or select Add SNP from the annotations sub tab 2 If the SNP was highlighted in the s
70. taccgcacttggaccctcecgcctcgaacgtc tgagccgagatcc actecagcctgggcgacagagcgagact actcggctctagggcggtgacfitgaggtcggacccgctgtctcgctctga ccgtctcaaaaaaaaaaaaaaagttggtttccgattataccatttactgg ggcagagtttttttttttttttcaaccaaaggctaatatggtaaatgacc gtaatatatactacttagttacactacttacatagcttcagtttccttat cattatatatgatgaatcaatgtgatgaatgtatcgaagtcaaaggaata ctataaaatgraaataacacctcccatgagggctgggegtggegctcatg gatattttacgtttattgtggagggtactcccgacccgcaccgcgagtac cctgtaatcccagcactttgggaggccgaggtgggtggatcacctgaggt ggacattagggtcgtgaaaccctccggctccacccacctagtggactcca Bases per Line 50 t Ik Show Positions 5 Position 3 Position Length Tm e fe 7 feo 5 Position 3 Position Length Tm ae M AA Farward Primer egceactacactecage Reverse Prime ear 24 zb Allow Mismatched Oligos Complement Strand Oligos 3 to 5 Clear Clear All teen Ik Show Fixed Oligos on Sequence 30 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 6 Designing LunaProbes 7 Highlight the region over the SNP We recommend designing the probe to match the variant sequence For example if a base change is C gt T with the T allele being the variant design the probe to the sequence containing the T base This will result in a perfect match between the probe and the variant template T A giving the highest Tm melt The advantage of doing this is that the wild type now behaves like a single base mismatch and any nove
71. uence of choice If the Sequence locked option is checked uncheck it and select the Replace option 2 Place the cursor to the left of the character to be replaced and type in a new character LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 11 CHAPTER 3 Annotating Seguences 12 LightScanner Instrument lt gt Primer Design Software Manual lt gt REV 01 CHAPTER 4 Designing Primer Sets CHAPTER 4 DESIGNING PRIMER SETS Once the sequence is imported into the software and the exons are coded each exon will be as signed a tab at the top of the screen A common set of design parameters will be used to design primers for every exon Exons that are larger that the recommended size for scanning amplicons will be broken up into two or more fragments for optimum results The Search All button will find scan ning primers for all exons with no further user input required Using Common Design Parameters Default settings are used to design primers for every exon The default settings can be accessed through the Settings Menu The user can also define common scanning settings by selecting Common Scanning Settings from the Settings menu The user can modify the common settings by typing directly into the fields These modified settings will be saved and used in all future analyses Common Scanning Settings Experiment Settings Reaction Conditions Min Amplicon Size 7 Max Amplicon Size i
72. w Min Primer Tm k v Max Primer Tm I Min Primer Size Max Primer Size 5 Exclusion Buffer 3 Exclusion Buffer v Minimum Overlap iw Forward Primer Conc uM 03 vw Reverse Primer Conc pM 03 The settings options are as follows e Minimum and maximum amplicon size Recommended amplicon sizes for scanning are be tween 100 and 400 base pairs e Minimum and maximum primer Tm A primer melting temperature Tm range can be used for optimal primer selection This increases the possibilities for primer selection while still retain LightScanner Instrument lt gt Primer Design Software Manual gt REV 01 13 CHAPTER 4 Designing Primer Sets ing stringency Individual primers in assigned pairs will always be matched for Im but multiple primer pairs will be generated that have Tm that fall within the defined range e b5 and 3 exclusion buffer This is the number of nucleotides on either side of the exon boundary excluded from the analysis The default value is 5 however in some cases users may increase the value to avoid placing primers over exon intron boundaries of interest e Minimum overlap For large exons the primer design software will generate more than one amplicon to cover the entire region of interest The minimum overlap value indicates the num ber of overlapping bases that will be covered by adjacent amplicons A minimum of 1 base is required to avoid missing polymorphisms that may be foun

here

Contents

Download Pdf Manuals

Related Search

Related Contents