Metagenomic Sample Analysis SOP
Contents
1. no adapters and the sequencing adapters are added during a second round of PCR Workflow for two step PCR amplification using 454 sequencin rimers DNA extraction PCR amplification using non barcoded primers without FLX adaptors postie PCR negative PCR Clean DNA preparation gel extraction phenol chloroform extraction QlAquick PCR Gel purification of desired band depending on the extent of the primer dimers Re amplification using Titanium Amplicon z Primers amp 10 cycle Retrofit PCR mE QlAquick PCR purification z PCR amplicon quantification Send for Pyrosequencing gel Bioanalyzer Universal PCR PRIMERS See Roche technical bulletin TCB No 005 2009 for list of bar codes MIDs Original PCR primer no adaptor 1392R acg ggc get gtg tRc 926wrF aaa ctY aaa Kga att gRc gg Original PCR primer with adaptor FLX Adapter bar code Primer 454T RL 5 CCATCTCATCCCTGCGTGTCTCCGAC TCAG ACGAGTGCGT acg ggc get gtg tRc 454T FB 5 CCTATCCCCTGTGTGCCTTGGCAGTC aaa ctY aaa Kga att gRc gg Updated PCR primer for Epsilon no adaptor 1392Re acg ggc ggt gWg tRC 926wFe aaa ctY aaa Kga atW gRc gg Updated PCR primer for Epsilon with adaptor FLX Adapter barcode Primer 454T RL 5 CCATCTCATCCCTGCGTGTCTCCGAC TCAG ACGAGTGCGT acg ggc ggt gWg tRC 454T FB 5 CCTATCCCCTGTGTGCCTTGGCAGTC aaa ctY aaa Kga atW gRc gg Procedure PCR amplification and barcoding e Establish unidirectional2. collection is to minimize contamination while maintaining the character of the indigenous microbial community and obtaining sufficient amounts of biomass The sample and resulting sequence data should be checked for contamination The sample procedure will be dependent on the nature of the natural environment Water Produced water Tailings pond water Pipeline water o Sample should be collected in sterile Nalgene bottles filled to the top to avoid air exposure When samples are processed immediately they can be stored in an anaerobic chamber containing 90 N2 and 10 CO2 Samples to be kept for later metagenomic analysis should be stored at 80 C Tailings ponds often yield around 100 ng per ml of sample while produced water yields are lower at around 5 ng per ml o Excess water from tailings samples are removed with centrifugation at 14 000 rpm o Produced water samples are filtered with a 0 2um filter o Oil can be removed from samples by a short centrifugation a 14 000 rpm l Drilling Cores Coal Oil Sands etc o Drilling cores should be rapidly frozen at the well site immediately following collection Cores should remain frozen when in transportation Samples should be stored at 80 C Core can be subdivided using a sterile rock saw Samples should be prepped for DNA extraction by aseptically removing the outside surfaces of the cores to eliminate drilling contamination leaving the interior of the core material for DNA analysis T
3. followed by centrifugation to remove proteins and cell membrane components collection of the aqueous DNA extract and several buffer exchange steps to wash and concentrate the extract Part III describes a method to check for the quality and presence of DNA in the extract and recommendations for both long and short term storage of the resulting samples The total time required for this protocol depends on the number of samples to be extracted It is recommended to work with less than 15 samples at one time to avoid confusion and cut down protocol time For 10 15 samples and assuming the proper centrifugation equipment is available this protocol should take about 8 hours with an additional overnight step to run an agarose gel to visualize and quantify the DNA extracts Make sure you have the hybridization ovens set to temperature at the outset of the process Protocol Part 1 Incubation 1 Thaw filters on 1ce 2 Add 100 ul lysozyme 125 mg in 1000 ul TE and 20uL RNase A 10 ug ml to each filter Reseal the top with Parafilm Incubate in a rotating incubator at 37 C for hour 3 Add 100ul Proteinase K and 100 ul 20 SDS to each filter Reseal using Parafilm Incubate at 55 C for 1 2 hours in a rotating incubator 4 Remove lysate from sterivex filter using a 5cc syringe into a 15 ml falcon tube Add 1 ml lysis buffer to rinse the fillter out Pool this with the lysate in the 15 ml tube Part II Extraction amp Centrifugation 5 Add a
4. mixing samples well before measuring e take more than 2 readings if the first 2 differ by gt 2 ng ul If all replicates are relatively close I average all readings If replicates are radically different e g possibly from a different sample altogether I omit the erroneous replicate 8 In 8 chain tubes or a 96 well plate dilute the purified PCR products with PCR grade water to the concentration of 30 ng ul or that of the most dilute sample in the sample set I use 25 ul final volumes 9 Run2 ul of each diluted PCR product on an agarose gel 10 Quantify diluted PCR products using Nanodrop 11 After filling out the appropriate documentation send the diluted PCR products for pyrotag sequencing Genomic DNA Extraction from Tailing Ponds Overview This protocol is a slight variation from methodology developed by Sangwon et al 2009 and tailored to suit the need of obtaining high molecular weight DNA from low biomass environmental samples such as tailing ponds The resulting DNA from this modified protocol has been shown to have a distribution of high molecular weight DNA essential for a construction of fosmid metagenomic library Part describes the cell lysis step and the isolation of genomic DNA from the environmental matrix and cell debris The cell lysis is achieved mainly through chemical lysis The genomic DNA is then isolated through chloroform isoamyl alcohol and buffer exchanged using low molecular cut off filter Mechanical ly
5. the sample 5 Incubate for 40 minutes at 65 C in a hybridization oven During the incubation gently invert the tubes every 10 min or continuously rotate the tubes at the lowest speed The heat helps weaken the cell membranes and aids in the cell lysis The slight agitation help ensures the tailing material is well in contact with the extraction buffer 6 Centrifuge at 1800 x g for 10 minutes using a swinging bucket rotor at 10 14 C JS 5 3 rotor from Beckman Coulter was used in this application 7 Transfer the supernatant into a pre chilled 50 ml Falcon tube containing 20 ml chloroform IAA 24 1 Avoid transferring the detergent precipitate and the tailings material Keep on ice When transferring the supernatant it is better to leave some behind to ensure clean DNA 8 Repeat the extraction process with another 15 ml of extraction buffer Incubate at 65 C as previously described but only for 10 minutes Centrifuge at 1800 x g for 10 minutes at 10 14 C Prior to the incubation mix the pelleted tailings material with an autoclaved spatula for a better mixing 9 Transfer the supernatant into the same tube as in step 7 10 Cap the tube firmly and invert the tube to mix several times This is performed to increase the efficiency of the extraction by increasing the surface contact between the aqueous layer and the organic layer 11 Place the tube over a bed of ice and gently shake the tube containing the supernatant chloroform IAA mix using a
6. Metagenomic Sample Analysis Standard Operating Procedures for fossil fuel environments HYDROCARBON METAGENOMICS Contents 1 2 3 5 6 A EEUU ERU PT 4 1 1 Metadata SNC 4 1 2 Sample Prdctionatiorisse eo treo uie az 4 Ns A AO 5 2 1 DNA Sample FractionatiOi asiatico 7 COMMUNITY Ana SIS an 8 3 1 PGR AMPINICICON a A date rcu cds bacs E Liu freed 8 Procedure PCR amplification and barcoding cccoocccnconocnnnonaconnnnnncnnnnnncnnnonaronnonanonnnnnnonnnonnrnnnonanonnos 9 Materials and Redgelts ssiaeutte ter cibi E aaa uieav ee ee LIUC dep edt ee 9 3 2 I65 DNA SeQUEFHCIDB A ds 11 3 3 Data Analvsis Vid PNOCN DOU sso d beoe ti de te e Nod dci 11 totatDNAJADSVSISS citu Ree enmmstuct ui tet tupEES iaa 12 4 1 Total DNA SECUENCIA ds 12 4 2 a A 12 4 3 ANNO ON AAA 12 4 4 DIAN ASS T RU mE 12 Daa SU OAS Se RM Lc 13 SN A oo o E ntt ELE East E senor 14 Typical Metagenomics Work Flow 1 Sample Collection 1 2 Sample Fractionation 2 DNA Extraction 3 165 Analysis 2 I IBS Amplification 3 2 Amplicon Sequencing 3 3 Clustering Annotation 3 3 Data Statistical Analysis 1 1 Metadata Collection Store some sample for later use Store some sample for later use 4 Total DNA Other Genomics PUEIA Analysis 4 1 DNA Sequencing 4 2 Binning amp Assembly 4 3 Annotation 4 4 Data Statistical Analysis 5 Data Storage 1 SAMPLE COLLECTION The goal of effective sample
7. Per reaction Per 4 reactions 2 5 uM Forward primer 2 5 ul 10 ul 2 5 uM Reverse primer 2 5 ul 10 ul 5X KAPA2G buffer A 5 ul 20 ul with MgCl 5X KAPA Enhancer 1 5 ul 20 ul DMSO 1 25 ul 5 ul DNA polymerase 0 1 ul 0 4 ul dNTP mix 10mM each 0 5 ul 2 ul MgCl 25mM 2 ul 8 ul Sterile nuclease free water 5 15 ul 46 ul Total 24 5 ul 98 ul Vortex each master mix Dispense into 4 PCR tubes one of these will be the no template negative control Add 0 5 ul of the same template to each of the 3 other PCR tubes Place all tubes in the thermocycler and run the following program 1 cycle of 5 minutes denaturation at 95 C 10 cycles of 30seconds at 95 C 30 seconds at 60 C decreasing 0 5 C cycle and 30 seconds at 72 C 30 cycles of 30 seconds at 95 C 30 seconds at 55 C and 30 seconds at 72 C 1 cycle of 5 minutes at 72 C 5 Pool replicate template containing PCR tubes Run 4 ul each template containing and no template control reaction on an agarose gel 6 Provided bands are visible following agarose gel electrophoresis purify the template containing PCR reaction using the Qiagen QIA quick spin kit e Juse the following modifications to increase template yield Heat buffer EB to 65 C prior to elution elute PCR products in 30 ul buffer EB following application of buffer EB to the column let it sit for 2 min before centrifugation 7 Quantify purified PCR products using Nanodrop Perform at least 2 readings for each sample
8. acetate to a final concentration of 2 5M 360ul and gently mix Centrifuge at 13 000rpm for 5 minutes Remove the supernatant 580ul into a fresh 1 5ml eppendorff tube 10 Add 1 volume of 10096 isopropanol 11 Incubate at 20 C for at least 30 minutes 12 Centrifuge at 13 000rpm for 10 minutes 13 Remove supernatants and dry pellets 14 Resuspend in 40ul MilliQ water Procedure works well done in batches of 12 reactions capacity of the bead beater Total procedure up to incubation at 20 C takes approximately 45 minutes Extracts can be incubates at 20 C at least overnight indefinitely DNA EXTRACTION for HIGH MOLECULAR WEIGHT DNA USING 0 22 uM STERIVEX FILTERS Jody J Wright Elena Zaikova David A Walsh and Steven J Hallam Department of Microbiology Immunology University of British Columbia Corresponding author Steven J Hallam Keywords microbiology seawater DNA extraction Short Abstract We describe a method for extraction of high molecular weight genomic DNA from planktonic biomass concentrated on 0 22 um Sterivex filters Long Abstract This method is used to extract high molecular weight genomic DNA from planktonic biomass concentrated on 0 22 uM Sterivex filters that have been treated with storage lysis buffer and archived at 80 C The protocol begins with two one hour incubation steps to liberate DNA from cells and remove RNA Part II involves a series of Phenol Chloroform and Chloroform extractions
9. an enhance elimination of excessive debris from large samples or from cells with complex cell walls 6 Transfer supernatant to a clean 2 0 ml microcentrifuge tube Add 250 ul PPS Protein Precipitation Solution and mix by shaking the tube by hand 10 times 7 Centrifuge at 14 000 x g for 5 minutes to pellet precipitate Transfer supernatant to a clean 15 ml tube NOTE While a 2 0 ml microcentrifuge tube may be used at this step better mixing and DNA binding will occur in a larger tube 8 Resuspend Binding Matrix suspension and add 1 0 ml to supernatant in 15 ml tube 9 Place on rotator or invert by hand for 2 minutes to allow binding of DNA Place tube in a rack for 3 minutes to allow settling of silica matrix 10 Remove and discard 500 ul of supernatant being careful to avoid settled Binding Matrix 11 Resuspend Binding Matrix in the remaining amount of supernatant Transfer approximately 600 ul of the mixture to a SPIN Filter and centrifuge at 14 000 x g for 1 minute Empty the catch tube and add the remaining mixture to the SPIN Filter and centrifuge as before Empty the catch tube again 12 Add 500 ul prepared SEWS M and gently resuspend the pellet using the force of the liquid from the pipet tip NOTE Ensure that ethanol has been added to the Concentrated SEWS M 13 Centrifuge at 14 000 x g for 1 minute Empty the catch tube and replace 14 Without any addition of liquid centrifuge a second time at 14 000 x g for 2 minutes t
10. an overnight agarose gel 0 8 loading 1 2 lanes of 10 ul 1kb ladder and 3 lanes of 50ng ul AHindIII ladder 2ul Sul and 10ul to use as size and intensity standards Load 5 ul per lane of DNA extract sample Run gel at 15 volts for approximately 16 hours to and check image in UV gel dock for presence of DNA in extracts Representative Results When this protocol is done correctly you should see a gel image similar to Figure 1 Actual DNA concentration of extracts will vary depending on the source of the sample Discussion Depending on how many samples are to be processed this can be a time intensive procedure due to the two one hour incubation steps and the repeated washes and centrifugation steps It is best to plan a whole day for this procedure to leave plenty of time If there are problems getting the final extract volume in the Amicon tube to reduce down to 200 500ul try doing additional TE washes and centrifugations repeat step 9 until the appropriate volume 1s leftover Also if the extract smells acutely of chloroform it is best to do additional washes until the smell lessens to make sure all of the chloroform is removed Table of specific reagents and equipment Name of the reagent Company Catalogue number Comments optional Lysozyme Sigma L6876 5G Lysis Buffer NENNEN M sucrose 40 mM EDTA 50 mM Tris pH 8 3 20 SDS HEN EMEN EE Seesyringes fF o I5mlFalontubes o Incubator 37 C 4 55 C Beckman Centrif
11. atrix DNA is purified from the supernatant with a silica based GENECLEAN procedure using SPIN filters Part Il describes the quality control step where the resulting DNA is assessed for its quantity quality and purity This would determine whether the DNA is appropriate for 454 pyrosequencing Kit Components and User Supplied Materials FastDNA SPIN Kit for Soil Components Lysing Matrix E 50x 2 0 ml tubes Sodium Phosphate Buffer 60 ml MT Buffer 8 ml PPS Solution 25 ml Binding Matrix 66 ml SPIN Modules 50 each Catch Tubes 50 each Concentrated SEWS M 2 ml DES 20ml BBS Gel Loading Dye 200 ul User manual 1 each MSDS 1 each Certificate of Analysis 1 each User Supplied Materials FastPrep Instrument Microcentrifuge that can freely spin 2 0 ml tubes Microcentrifuge tubes 2 0 ml and 1 5 ml Clean 15 ml tubes for DNA binding Rotator or low speed vortex Reference http images www mpbio com docs fastprep FastDNASpinKitforsoil pdf Part I DNA Extractio1 Add up to 500 mg of sample to a Lysing Matrix E tube If there is too much water in the sample it is possible to remove the supernatant with centrifugation which may lead increased DNA yields Add 978 ul Sodium Phosphate Buffer to sample in Lysing Matrix E tube Add 122 ul MT Buffer Homogenize in the FastPrep Instrument for 40 seconds at a speed setting of 6 0 Centrifuge at 14 000 x g for 5 10 minutes to pellet debris NOTE Extending centrifugation to 15 minutes c
12. f the elution buffer can vary depending on the amount of the PCR product obtained 6 Quantify each purified sample For additional details please refer QIAGEN QIAquick Spin Handbook March 2008 3 2 16S DNA SEQUENCING In order to obtain read lengths long enough to identify taxa to the genus level Roche s 454 flex titanium platform is used Additionally the length of the primers used in the PCR amplification are optimized for the 500 bp reads of the 454 flex 3 3 DATA ANALYSIS VIA PHOENIX II Once the 16S sequence data is available the data needs to go through quality control to eliminate the poor or chimeric sequences The quality controlled data is then aligned and clustered so diversity statistics and taxonomic identifications can be made The following figure demonstrates a typical analysis workflow 165 Sequence Data Assign OTU Reference sequence to 16S Database for Assignment There are several tools that can do this analysis These include Phoenix 2 htto hmp ucalgary ca phoenix and QIIME http giime org Remove Low Quality Sequences Generate OTUs amp Diversity statistics DELE AVI e IIo E Analysis Remove Chimeric Sequences Align amp Cluster 4 TOTAL DNA ANALYSIS Total DNA analysis avoids the PCR amplification stage and is sent directly for sequencing 4 1 ToTAL DNA SEQUENCING Currently two sequencing platforms are used for tota
13. flow of reagents e Clean work surfaces and tools with 70 ethanol before and after each use Materials and Reagents Starting materials Extracted DNA diluted to 10ng ul per sample Taq polymerase Amersham Pharmacia Biotech 27 0799 62 10x PCR buffer included BSA New England Biolab B9001S Nuclease Free Water 500mL Ambion 9930 10mM dNTP Mix 200ul 1ml MBI Fermentas R0191 R0192 100bp DNA ladder Plus 0 5ug ul 50ug MBI Fermentas SM0323 Minelute Gel Extraction Kit 50 250 Qiagen 28604 28606 TE Seakem GTG agarose Ethanol Equipment MJ Thermocycler 96 well alpha MJ Research ALS 1296 Microcentrifuge for 1 5 tubes ISC Bioscience C 1201 Microcentrifuge for 8 strip tubes ISC Bioscience C 1202 Vortex Genie ISC Bioscience S 7350 1 Pipettes P2 P10 P20 P200 P1000 Rainin RL 2 10 20 200 1000 0 2mL tube rack Fisher 05 541 55 8 tip multichannel pipettor Rainin L8 200 Disposables 8 strip tubes and caps 0 2mL ISC Bioscience T 3014 1 0 2 mL tubes with cap ISC Bioscience C 3328 1 Tips P2 P10 P20 Rainin RT L10F Tips P200 Rainin RT L200F Tips P1000 Rainin RT L1000F Tips P1000 Rainin RT L1000F 1 Prepare oligonucleotides 1 1 Order 454 primer sequences 16S sequences and barcodes a Scale oligos to 25nmole purified using standard desalting 1 2 Upon arrival briefly spin down tubes containing dried primers in a minicentrifuge as the contents may have become loose during shipment a Resuspend each prime
14. he interior frozen core material is then ground with a mortar and pestle prior to DNA extraction The yield of core material is often less than 1 ng of DNA per g of core material Although freezing is ideal for metagenomics DNA analysis it is not appropriate for all downstream analysis such as culturing If other tests will be conducted on the core material some of the core material should be left unfrozen l Biofilms pipelines o Pipeline sections should be stored in the anaerobic hood 9096 N2 and 1096 CO2 until the pipeline biofilm can be scraped off The scrapings should be processed immediately or stored at 80 C Although the yield can vary widely based on the composition of the scrapings it can be as high as 500 ng per g 1 1 METADATA Effective sample collection also requires extensive metadata collection Items that should be recorded include Environmental conditions temperature depth and location Chemistry pH salinity etc and sampling methodology to name a few More information on metadata collection can be found at the Genomics Standards Consortium s Minimum Information about a Meta Genome Sequence MIMS website www gensc org 1 2 SAMPLE FRACTIONATION As long as sufficient material is obtained samples should be subdivided and some material stored at 80 C for later use or for different analyses 2 DNA EXTRACTION The optimal DNA extraction procedure will depend on the sample being processed For the major
15. ity of samples a bead mill homogenization with SDS Chloroform Treatment can be used for DNA extraction The protocol is listed below other protocols commonly used are listed in appendix 1 DNA extraction from tailings ponds using FastDNA spin kit for soil Overview The FastDNA SPIN Kit for Soil quickly and efficiently isolates PCR ready genomic DNA directly from soil type samples in less than 30 minutes Designed for use with the FastPrep Instruments from MP Biomedicals microbial cells within soil type samples are easily lysed within 40 seconds These benchtop devices use a unique optimized motion to homogenize samples by multidirectional simultaneous impaction with lysing matrix particles Part describes the cell lysis step and the isolation of genomic DNA from soil type samples Samples are placed into 2 0 ml tubes containing Lysing Matrix E a mixture of ceramic and silica particles designed to efficiently lyse all soil organisms including historically difficult sources such as eubacterial spores and endospores and gram positive bacteria Homogenization in the FastPrep Instrument with Lysing Matrix E takes place in the presence of MT Buffer and Sodium Phosphate Buffer reagents carefully developed to protect and solubilize nucleic acids and proteins upon cell lysis These reagents work together to allow extraction of genomic DNA with minimal RNA contamination Following lysis samples are centrifuged to pellet soil cell debris and lysing m
16. l DNA sequencing 1 Roche 454 flx the 800 bp reads provide more reliable annotation for unassembled metagenomes YVrunof 454 sequencing typically provides 800 000 reads 640 000 000 bps 2 Illumina HiSeq 2000 All though the reads from the HiSeq 2000 are much shorter 150 to 200 bps paired end runs are possible and the sequencing depth is much higher with 1 5 billion reads per 2 lanes 40 000 000 000 bps the greater coverage allows for the identification of rarer genes and species but it makes assembly and annotation more difficult 4 2 BINNING AND ASSEMBLY Binning and assembling large metagenomics datasets is complex and requires a dedicated and sophisticated computing systems However metagenomic datasets can be and are often analyzed without assembling the dataset Besides being computationally complex assembling the data can create chimeric sequencing Unassembled data gene centric analysis can be conducted using the IMG MER and MG Rast platforms described in 4 3 amp 4 4 The project s binning and assembly SOP is below Project SOP coming soon 4 3 ANNOTATION Project SOP coming soon Although Online tools like MG Rast http metagenomics anl gov and IMG MER https img jgi doe gov mer will not assemble metagenomics data for end users they will annotate your datasets Programs like MLTreeMap http www mltreemap org will use conserved genes provide taxonomic assignment to the microbes in the metagenome sa
17. large wells and add a 100bp ladder Run gel at 120V until band size is easily visible 30 40 minutes Image gel using dark reader settings on Fluor S multi imager Purify amplification PCR product by QlAquick PCR Purification QIAGEN other similar kit a Add 1 250 volume of pH indicator to Buffer PB depending on the amount to be used e g 16 ul pH indicator I to 4 ml Buffer PB Yellow color of Buffer PBI indicates pH lt 7 5 b Next add 5 volumes of Buffer PBI to 1 volume of the PCR sample and mix e g add 500 ul of Buffer PBI to 100 ul PCR sample c Ifthe color of the mixture is pale orange or violet add 10 ul of 3 M sodium acetate pH 5 0 need to be prepared not included in the kit and mix The color of the mixture will turn to yellow Place a QlAquick spin column in a provided 2 ml collection tube To bind DNA apply the sample to the QlAquick column and centrifuge for 30 60 s Discard flow through Place the QlAquick column back into the same tube To wash add 750 ul Buffer PE to the QlAquick spin column and centrifuge for 30 60 s E rum y ro g h Discard flow through and place the QlAquick column back in the same tube Centrifuge the column for an additional 1 min i Place QlAquick column in a clean 1 5 ml microcentrifuge tube j To elute DNA add 30 ul 50 ul Buffer EB 10 mM Tris Cl pH 8 5 or water pH 7 0 8 5 to the center of the OlAquick membrane and centrifuge the column for 1 min Addition o
18. mple 4 4 DATA ANALYSIS Both MG Rast and IMG MER provide a wide range of tools for metagenome data analysis and comparison tools 5 DATA STORAGE Although raw data should be stored on site and remotely backed up online databases like the NCBI s SRA will accept both 16S amplicon data and total DNA metagenomes datasets Additionally both MG rast and IMG MER will store the quality controlled and annotate reads from metagenome samples 6 APPENDIX 1 Alternative DNA extraction protocols DNA extraction using chloroform isopropanol and bead beating Materials Solutions all sterile filtered o 50mM phosphate buffer pH 7 0 o lysis buffer 10 SDS 100mM NaCl 500mM Tris pH 8 0 o 24 1 chloroform isoamyl alcohol make reasonably fresh o 7M ammonium acetate o 100 isopropanol o MilliQ filtered water Equipment o 1 5ml eppendorff tubes o 2mlscrew cap tubes containing 0 5g ea of 0 5 and 10 micron diameter zirconium beads o pipettes and tips o bead beater o microcentrifuge Method 1 2 3 4 5 6 7 8 9 Notes In a 2ml screw cap tube containing 0 5g ea of 0 5 and 10 micron diameter zirconium beads add 300ul 50mM phosphate buffer pH 7 0 Add a healthy loop full of cells Add 300yl lysis buffer and 300yl 24 1 chloroform isoamyl alcohol Shake on a bead beater for 40 seconds at 5000rpm Centrifuge at 13 000rpm for 5 minutes Remove the supernatant 650ul into a fresh 1 5ml eppendorff tube Add 7M ammonium
19. n equal volume about 3ml of Phenol Chloroform IAA 25 24 1 pH 8 0 to the lysate tube Vortex for 10 seconds Spin at 2500 g for 5 minutes or until aqueous layer 1s clear use the J S 5 3 rotor using the 50 ml falcon tubes in which the filter was stored as an adapter Transfer aqueous layer into a new 15 ml falcon tube 6 Add an equal volume approx 3mL of Chloroform IAA 24 1 to the tube containing the aqueous layer Vortex for 10 seconds Spin at 2500 g for 5 minutes or until aqueous layer is clear with no debris Transfer aqueous layer into a new labeled falcon tube Add 1ml of TE buffer pH 8 0 to this tube T Transfer contents of the falcon tube for step 6 to an Amicon Ultra centrifuge tube Spin at 3500 g for 10 minutes Check to make sure there is less than 1ml liquid left in Amicon at the end of this if not fill up with TE and spin again Remove filtrate to another falcon tube and save in fridge until DNA has been recovered on gel 8 Add 2 ml TE buffer to Amicon and spin at 3500 g for 6 minutes Remove filtrate 9 Repeat 8 twice more total of 3 washes with 2 ml TE For the last wash spin until 200 500 ul remain in Amicon Note the final volume and transfer to a labeled 1 5 ul eppendorf tube Part III Storage amp Confirmation of DNA Presence 10 A Aliquot 7Oul from final volume into a 1 5ul eppendorf tube to use as working stock and place in 20 C freezer Place the rest of the DNA into 80 C freezer 11 Setup
20. ntrifuge with 16000 g Coulter capacity Centrifuge rotor JS5 3 Beckman 368690 For 1800 3000 g Coulter Hybridization oven Fisher 13 247 10 65 C It can be replaced with Scientific water bath Rocking plate VWR Rocking Platform Model 200 1 5 ml tube Eppendorf 0030 125 150 1 per sample 50 ml disposable tube Corning 430290 3 per sample Graduated glass cylinder It can be replaced with glass pipette Pipettes and filtered tips 20 ml 200 ml 1ml 5 ml Spatula 1 per sample autoclaved Chloroform isoamyl alcohol 24 1 Fluka UN1888 20 ml per sample Denaturing solution Guanidine isothiocyanate Trizma base Ethylenediaminetetraacetic acid disodium salt dihydrate Mercaptoethanol Extraction buffer Sodium phosphate dibasic Sodium phosphate monobasic Sodium Chloride Hexadecyltrimethylammonium bromide Quant iT PicoGreen dsDNA Reagent and Kit Spectrophotometer CHEF Mapper XA Pulse Field Electrophoresis System Reference Promega Sigma Sigma Sigma Sigma Sigma Sigma Sigma Invitrogen Thermo Scientific Bio Rad 3 ml per sample V2791 T1503 E5134 M3148 30 ml per sample S3264 S3139 S3014 H6269 P758 Nanodrop 170 3670 to 170 3673 Hurt A H et al Simultaneous Recovery of RNA and DNA from soils and sediments AEM 67 10 4495 4503 2001 Lee S Hallam S J Extraction of High Molecular Weight Genomic DNA from Soils and Sediments http www jove com details
21. o dry the matrix of residual wash solution Discard the catch tube and replace with a new clean catch tube 15 Air dry the SPIN Filter for 5 minutes at room temperature 16 Gently resuspend Binding Matrix above the SPIN filter in 50 100 ul of DES DNase Pyrogen Free Water NOTE To avoid over dilution of the purified DNA use the smallest amount of DES required to resuspend Binding Matrix pellet NOTE Yields may be increased by incubation for 5 minutes at 55 C in a heat block or water bath 17 Centrifuge at 14 000 x g for 1 minute to bring eluted DNA into the clean catch tube Discard the SPIN filter DNA is now ready for PCR and other downstream applications Store at 20 C for extended periods or 4 C until use U Ae UUN Part Il Quality Control TIM 1 Quantify the DNA concentration via Quant iT fluorometer 2 Ensure DNA can be amplified with PCR primers 2 1 DNA SAMPLE FRACTIONATION DNA should be subdivided so some DNA can be stored frozen at 80 C for later use 3 COMMUNITY ANALYSIS 3 1 PCR AMPLIFICATION Either primers that universally amplify the 16S gene can be used or primers targeting specific organisms or functional genes can be used It is important to know the limitations biases of the primers you are using Since the PCR primers with barcodes and sequencing FLX adapters are quite long 40 nt PCR amplification is performed in two stages Fist the DNA is amplified with only the universal primers
22. php id 1569 doi 10 3791 1569 J Vis Exp 33 2009
23. r in TE to a stock concentration of 100uM 2 Prepare PCR cocktail 2 1 For each sample to be amplified prepare mix listed below To prevent depletion of mix due to pipeting error add 3 additional reactions to your total 2 2 2 3 2 4 2 5 3 4 2 a The following is a list of reagents added per reaction PCR master mix should be prepared as follows 13 9 uL water 2 0 uL 10x PCR buffer 0 4 uL 10mM dNTPs 0 6 uL 10mg ml BSA 1 0ul 1uM Forward primer 0 1 uL Taq Vortex to mix spin down Dispense 18ul aliquots of the master mix into 0 2mL microtubes Add the following in triplicate tubes wells 1ul of the 1uM Reverse primer 1ul 10ng ul DNA Vortex to mix spin down cap Enter the following PCR program into Thermal cycler See Thermal cycler manual for instructions on entering new PCR programs 95C 3 min 25 cycles of 95C 30s 55C 45s 72C 90s 72C 10min 4C eo second round of amplification with adapters only uses 10 cycles Confirm successful amplification by running reactions out on a 196 agarose gel Preparing Agarose Gel and run buffer a Make a 1 096 GTG SeaKem agarose TAE mini gel b Stir 200ml 1X TAE with 2 0g agarose and microwave until completely melted stir on stirplate until slightly warm then add 10ul EtBr c Pour 1X TAE buffer to fill line of gel tank Running Agarose Gel Submerge solidified gel in TAE run buffer in tank and remove comb Add 5 6ul of 5X loading dye to each sample vortex to mix Load Samples in
24. rocking platform at low setting 1 2 out of 10 for 10 minutes The agitation would provide constant mixing of the two phases further increasing the efficiency of the extraction The low temperature would precipitate the detergent used and make it easier to be extracted by the organic phase 12 Centrifuge at 1800 x g for 20 minutes at 10 14 C The spin would partition the phase and concentrating the cell debris in the interphase 13 Transfer the aqueous phase top to a new 50 ml Falcon tube The organic extraction can be repeated to ensure clean DNA However multiple round of organic extraction would lower the final DNA yield When transferring the supernatant it is better to leave some behind to ensure clean DNA Make sure that the newly transferred aqueous phase is chloroform free Residual chloroform would interfere with downstream steps 14 Concentrate the aqueous phase using 10 kDa centrifugal filter unit ie Amicon filter In this application Amicon 15 with 10 kDa cut off was used The spin time would vary across different sample from 10 to 20 minutes with a full load The flow through can be saved until the concentrate has been confirmed to contain DNA The spin was done using the JS 5 3 swinging bucket rotor at 3000 xg for 15 minutes 15 Buffer exchange the concentrate using 1x Tris EDTA buffer via diafiltration top up the filter by topping up the filter and diluting the concentrate 1000x Buffer exchange is done to dilute
25. sis and aggressive vorterxing are avoided in this procedure This in combination with guanidine isothiocyanate and hexadecyltrimethylammonium bromide CTAB helps preserve the integrity of the high molecular weight genomic DNA Part II describes the quality control step where the resulting DNA is assessed for its quantity quality and purity This would determine whether the DNA is appropriate for fosmid library construction Part DNA Extraction Time required 6 hours Before you start the extraction pre chill 50 ml tubes containing 20 ml chloroform isoamyl alcohol 24 1 on ice Set the oven to 65 C to pre heat Check CTAB solution if it is crystallized warm to 65 C to melt the crystals Complete the denaturing solution and extraction buffer by adding the last ingredients just before you start the extraction see the recipe 1 Prepare the denaturing solution and extraction buffer Keep the denaturing solution on ice and the extraction buffer at 65 C hybridization oven 2 Aliquot 6 g of the tailing ponds material into 50 ml Falcon tube 3 Add 3 ml of the denaturing solution 1 ml per 2 g of material 4 Shake the extraction buffer before use Add 15 ml of the extraction buffer Shake briefly to mix Store the remainder of the extraction buffer at 65 C Shaking the extraction buffer ensures homogeneity of the solution Shaking the sample provides a minimum mechanical lysis and ensures most of the material is well permiated throughout
26. the high salinity extraction buffer with storage buffer 16 Transfer the concentrate into a microcentrifuge tube and note the volume Part Il Quality Control 1 Quantify the DNA concentration via Quant iT fluorometer 2 Check for amplifiability through PCR reaction 3 Run pulse field gel electrophoresis to check for the fragment distribution For Fosmid DNA library construction the median size of the DNA should be equal to or exceed 36 kb Supplementary Material Denaturing solution 4 M Guanidine isothiocyanate 10 mM Tris HCl pH 7 0 1 mM EDTA 0 596 2 mercaptoethanol Note The denaturing solution is water based Autoclave the solution excluding 2 mercaptoethanol and keep it at 4 C The 2 mercaptoethanol is added just before use If possible use fresh denaturing solution for the extraction and the solution should not be stored for more than a week Extraction Buffer 100 mM Sodium phosphate buffer pH 7 0 100 mM Tris HCl pH 7 0 100 mM EDTA pH 8 0 1 5 M NaCI 196 Hexadecyltrimethylammonium bromide CTAB 296 SDS Note The extraction buffer is water based Autoclave and store the three solutions salt buffer solution CTAB and SDS stock separately These solutions can be kept at room temperature Combine the three components just before use The precipitated detergent can be re solubilized by heating them at 65 C Equipment or Reagent Company Catalogue Number Comments Centrifuge Beckman 369003 Any ce
27. uge o Amicon Ultra centrifuge Fisher UFC801096 fuss O FESTA EE o 25 24 1 A A Pa TEbuffenpH amp O 1 5ul eppendorf tubes Figures DNA Hindlll Depth 1000 2000 2log hina 0007 DAC U nd ng ng ng Figure 1 0 8 agarose gel electrophoresis image of high molecular weight DNA collected from four depths in the subarctic Pacific Ocean in duplicate stained with the intercalating agent ethidium bromine 10 mg ml Gel was run at 15V for 16hrs in 1X TAE gel running buffer Sample bands are of good quality showing little evidence of mechanical shearing shows single bands or smears as opposed to multiple bands although the 10m extracts retain some RNA carry over see smear in the 0 5 to 2 0 Kb rage 168 rDNA Pyrotag Sequencing Protocol using KAPA2G Robust HotStart DNA Polymerase Carmen Li University of Alberta Materials Method 1 2 gt 3 4 2 5 uM stocks of primers made up with sterile filtered nuclease free water DMSO KAPA2G Robust HotStart DNA polymerase 5 U ul 5X KAPA2G Buffer A included with KAPA2G Taq Polymerase 5X KAPA Enhancer 1 included with KAPA2G Taq Polymerase 25mM MgCl included with KAPA2G Tag Polymerase dNTP mix 10 mM each included with KAPA2G Taq Polymerase Sterile nuclease free water Ambion A thermocycler For each unique barcode 1 e each different sample add the following components together in an eppendorf tube to form a master mix
Download Pdf Manuals
Related Search