Home

New

image

Contents

1. 168 www gelifesciences com bioprocess GrandStand pilot process systems The GrandStand pilot process system is a versatile cart mounted system intended for pilot through production scale biological separations from 50 to 10 000 liters It accommodates ultrafiltration and microfiltration hollow fiber cartridges or flat sheet cassettes The GrandStand system is capable of concentration and or diafiltration Feature rich basic system The basic GrandStand system consists of a heavy duty stainless steel frame positive displacement rotary lobe pump for gentle recirculation of biological solutions diaphragm type backpressure valve sanitary inlet and outlet pressure gauges and a cone bottom clean in place CIP tank A programmable AC inverter features a multitude of functions including the ability to set the pump acceleration time as well as to monitor pump speed A high pressure switch is incorporated for equipment and operator safety Robust streamlined design The GrandStand system s narrow profile allows it to fit through standard door openings for easy transport from the lab to the cold room to the manufacturing area Heavy duty swivel casters with a total locking feature provide mobility and stability The system is designed to interchange easily between process and cleaning cycles The modular design enhances the versatility of the GrandStand system to address changing needs associated with scal
2. Chromaflow Nozzle piping 400 1 2 8 1172 01 Chromaflow Packing station Pack 50 18 1163 74 Chromaflow Nozzle piping 400 3 4 18 1172 00 Chromaflow Packing station Pack 100 18 1162 08 Chromaflow Nozzle piping 400 1 18 1171 99 Chromaflow Packing station Pack 200 Custom order Chromaflow Nozzle piping 600 1 2 18 1172 06 Chromaflow Packing station Pack 400 Custom order Chromaflow Nozzle piping 600 3 4 18 1172 05 Chromaflow Nozzle piping 600 1 18 1172 04 Chromaflow Packing station selection guide Chromaflow Nozzle piping 800 1 2 18 1171 94 Chromaflow Nozzle piping 800 3 4 18 1171 93 Packing Station Min l min Max l min Chromaflow Nozzle piping 800 1 18 1171 92 Pack 50 10 3 Chromaflow Nozzle piping 1000 1 2 8 1172 09 Pack 100 30 109 Chromaflow Nozzle piping 1000 3 4 8 1172 08 Pack 200 60 200 Chromaflow Nozzle piping 1000 1 8 1172 07 Pack 400 100 400 Accessories for Chromaflow columns Accessory Code No Qty pack Material Valves 4 port 2 way i d 10 mm 25 mm TC 18 1012 56 1 SS 316L PTFE 4 port 4 way i d 10 mm 25 mm TC 18 1012 57 1 SS 316L PTFE 3 port 2 way i d 15 mm 25 mm TC 44 5499 90 1 SS 316L PTFE 4 port 4 way i d 20 mm 51 mm TC 44 2302 01 1 SS 316L PTFE 3 port 2 way i d 22 mm 51 mm TC 44 1583 01 1 SS 316L PTFE 3 port 2 way i d 35 mm 51 mm TC 44 5494 65 1 SS 316L PTFE Valve sealing washer fits 10 mm 2 and 4 way valves 18 1128 69 2 PTFE Tubing with sanitary fitting 25 mm TC i
3. Dorati L499 54 mm TC id 6 25 em TC Diomedo 34 30 Uo E 2h men TC Cede no 18 1013 80 Code no TE 1012 87 i i wane wW 5 4 i Si 27 i Comed Weli G 25 mm TC C d mo 18 1001 20 a a A l 3 20 3 e a 0 Q fe 5 Connector id G mmi 25 men TG c Case na 1HRS 0 fo i a i 3 1 inch 25 om PL Ib 2 L Literature Data File Code No INdEX Columns 70 200 series 18 1115 61 www gelifesciences com bioprocess 97 Chromatography columns 98 BPG columns BPG columns are glass columns designed for use in the production of biopharmaceuticals or any product made in a regulated or current Good Manufacturing Practice CGMP environment The columns are manufactured with materials carefully selected for their compatibility with the solvents most commonly used in biopharmaceutical manufacture All polymeric materials are approved according to USP Class VI tests for toxicity BPG range e Scalable from inner diameters of 100 mm to 450 mm and bed volumes from 2 to 121 liters Pressure rating up to 8 bar Proven hygienic design and easy cleaning in place For use with a variety of techniques and chromatographic media especially BioProcess Media Superdex Sepharose High Performance and Fast Flow and Sephacryl Proven distribution system Sanitary TC connections throughout Materials include electropolished stainless steel calibrated borosilicate glass EPDM and fluoroplas
4. Product Quantity Code No WAVE Mixer 20 50ET 1 28 4115 65 WAVE Mixer 20 50EHT 28 4115 67 WAVE Mixer 500 1000E 28 4115 69 WAVE Mixer 500 1000EH 28 4115 70 XKIT20 28 4115 73 XKIT20EH 28 4115 74 XKIT50 28 4115 76 XKIT50EH 28 4115 77 XKIT500 28 4115 78 XKITSOOEH 28 4115 79 XKIT1000 28 4115 80 XKITLOOOEH 28 4115 8 XLID 1 28 4115 7 pH probe 28 4116 7 RTD Probe insertion type temperature probe for use with M Bag 500 or M Bag 1000 only 1 28 4116 67 M Bag 20 MBO0020L10 01 M Bag 50 1 MBOO50L10 01 M Bag 500 MBO500L10 01 M Bag 1000 MB1000L10 01 1 Accommodates M Bag 20 I Accommodates M Bag 50 3 Accommodates M Bag 500 Accommodates M Bag 1000 5 Specially developed probes with a diameter lt 2 5 mm for easy insertion in to the M Bag Application guide WAVE Mixers Selection guide WAVE Mixers Mixer 20 50ET In process blending In process intermediates can be mixed and various ingredients can be added In process pooling In process samples collected during chromatography or other operations can be pooled together in a single bag and mixed to form a homogeneous intermediate for sampling and further processing Blending for sampling Mixing stored materials in bags in order to obtain a representative sample for stability and process optimization studies Mixing prior to fill Mixing stored or collected product prior to dispensing in to final vials bags or other containers Mix
5. Housing size 65 Code No Model No Membrane fiber Cartridge length Membrane area Ultrafiltration inner diameter NMWC mm cm in m ft 56 4104 75 UFP 3 C 65 3000 0 5 62 5 24 6 6 1 66 56 4104 76 UFP 3 E 65 3000 1 62 5 24 6 44 47 56 4104 77 UFP 5 C 65 5000 0 5 62 5 24 6 6 1 66 56 4104 78 UFP 5 E 65 5000 1 62 5 24 6 44 47 56 4104 79 UFP 10 C 65 10 000 0 5 62 5 24 6 44 47 56 4104 81 UFP 30 C 65 30 000 0 5 62 5 24 6 6 1 66 56 4104 82 UFP 30 E 65 30 000 1 62 5 24 6 44 47 56 4104 85 UFP 100 C 65 100 000 0 5 62 5 24 6 6 1 66 56 4104 86 UFP 100 E 65 100 000 1 62 5 24 6 44 47 56 4104 87 UFP 300 C 65 300 000 0 5 62 5 24 6 6 1 66 56 4104 88 UFP 300 E 65 300 000 1 62 5 24 6 44 47 56 4104 89 UFP 500 C 65 500 000 0 5 62 5 24 6 6 1 66 56 4104 90 UFP 500 E 65 500 000 1 62 5 24 6 44 47 Code No Model No Pore size Membranefiber Cartridge length Membrane area Microfiltration um inner diameter mm in m ft mm 56 4104 92 CFP 1 E 65 0 1 1 62 5 24 6 44 47 56 4104 93 CFP 2 E 65 0 2 1 62 5 24 6 44 47 56 4104 94 CFP 4 E 65 0 45 1 62 5 24 6 44 47 Add 4 25 in 10 8 cm for straight adaptors www gelifesciences com bioprocess 151 sjonpoid uono Filtration products Housing size 85 Code No Ultrafiltration 56 4104 95 56 4104 96 56 4104 97 56 4104 98 56 4104 99 56 4105 00 56 4105 01 56 4105 02 56 4105 05 56 4105 06 56 4105 08 56 4105 09 Model No FP 3 C 85 FP 3 E 85 F
6. 56 4106 34 GSMDAQENCLKIT GSMDAQPRESTRA GSMDAQTEMPKIT GSMDAQMFM550 GSMDAQMFM450 GSMDAQUV1KIT GSMDAQCONTRA GSMSIPCMPKIT SS 35STM SS 55STM3 SS 35SMO DP SS 55SMO DP SS 45MSM DP SS 65MSM DP SS 85MSM DP SS 85MSM EL DP GrandStand PLC Enclosure 0 150 psig Pressure Transmitter Temperature Transmitter GS 550 Magnetic Flow Meter GS 450 Magnetic Flow Meter 280 um UVSensor With Display Conductivity Sensor With Display GS HF SIP Manifold Kit Housing assembly for 35STM cartridges Housing assembly for 55STM cartridges Housing assembly for 35SMO cartridges Housing assembly for 55SMO cartridges Housing assembly for 45MSM cartridges Housing assembly for 65MSM cartridges Housing assembly for 85MSM cartridges y y y y y y y y Housing assembly for 85MSM cartridges Permeate Pump 28 4005 41 GSM450PERPRP GS 450 Permeate Pump Kit 28 4005 42 GSM550PERPRP GS 550 Permeate Pump Kit 28 4005 43 GSM550PERPRH GS 550 Add on Permeate Pump Head Service 44 8200 07 44 8200 07 GrandStand Module Assembly to System and IQ OQ 1GSMDAQENCLKIT is required to power any data acquisition module that is purchased Assembly of module kits is not available without IQ OQ service 3 Items are not included in modular accessory kits and must be purchased separately Includes one set of documentation Additional set of documents can be supplied at an aditional cost www gelifesciences com bioproc
7. Connector i d 6 mm i d 6 25mm TC PP Code no 18 0251 98 www gelifesciences com bioprocess 111 suwnjoo fiydp16ozowosiyy Chromatography columns 112 M6 Connector i d Connector i d Code No 19 7476 01 2 7mm M6 Code No 18 4652 01 1 8 mm M6 i i M6 a Connector i d 3 8 mm M6 Code No 18 1124 16 2 7 t6 6 20 E Connector i d 3 mm M6 Jaco 6 mm Code No 18 4603 89 M6 Connector SRTC 3 M6 M6 Code No 19 2144 01 NNN IW fond Mens Connector SRTC 2 M6 M6 Code No 19 2143 01 M6 www gelifesciences com bioprocess Manufacturing Solutions E Manufacturing Solutions is a new venture aimed at developing products and services that simplify the daily work in process development and manufacturing The first products from this venture are the Media Wand and Media Handling Unit devices that enable efficient and simple handling of large scale media volumes Media Wand Media Wand 50 and Media Wand 100 simplify a number of time consuming tasks such as e removal of supernatant from the shipping container e addition of buffer or WFI Water For Injection e generation of slurry e transfer of slurry from the shipping container In addition Media Wand and Media Handling Unit MHU eliminate the need for heavy lifting and shaking enabling faster handling of media volumes with reduced
8. Pack size Code No 25 ml 17 5432 01 200 ml 17 5432 02 1l 17 5432 03 5l 17 5432 04 Regulatory Support File 11 0029 23 Prepacked columns HiTrap Butyl HP 5x1 ml 28 4110 01 HiTrap Butyl HP 5x5 ml 28 4110 05 HiTrap HIC Selection Kit 7x1 ml 28 4110 07 Technical data Composition highly cross linked 6 agarose Particle size 34 um average d _ 50 vol Ligand n butyl 3 13 2 14 100 200 cm h 300 kPa BioPilot 60 600 column bed height 30 cm pH stability operational CIP stability short term Pressure flow spec Butyl Sepharose 6 Fast Flow See p 75 87 Pack size Code No 1l 17 5431 03 5 17 5431 04 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d val Coupling chemistry epoxy Ligand n butyl pH stability operational 3 13 CIP stability short term 2 14 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Pressure flow spec 214 www gelifesciences com bioprocess E Butyl Sepharose 4 Fast Flow See p 74 75 130 Pack size Code No 25ml 17 0980 10 200 ml 17 0980 01 500 ml 17 0980 02 5 17 0980 04 101 17 0980 05 Data File 18 1020 70 Regulatory Support File 11 0028 11 Prepacked columns HiTrap Butyl FF 5x1 ml 17 1357 01 HiTrap Butyl FF 5x5 ml 17 5197 01 HiTrap HIC Selection Kit 7x1 ml 28 4110 07 HiPrep 16 10 Butyl FF 20 ml 17 5096 01 HiScreen Butyl FF 4 7 ml 0 77 x 10 cm 28 9269 84 Technical data Compositi
9. 1 The packing device consists of PP lid a 380 mm glass tube flanged rods O rings in EPDM bed support adaptor bed support screws and nuts 2 The lid kit consists of PP lid O rings in EPDM bed support adaptor bed support screws and nuts The lid kit can be used together with the packing devices for BPG 100 140 and 200 columns on INdEX columns of the same size 325mm TC 451mm TC 52x 25mm 1x 51mm TC 6 Fits 2 way and 4 way valves 96 www4elifesciences com bioprocess Spare parts for INdEX columns INdEX 70 INdEX 100 INdEX140 INdEX 200 Qty pack Material Code No Code No Code No Code No Column tube 500 18 1114 14 18 1104 49 18 1114 12 18 1104 51 I Borosilicate glass Column tube 950 18 1114 15 18 1104 50 18 1114 13 18 1104 52 i Borosilicate glass Bed support adaptor 18 1114 24 18 0251 56 18 1112 99 18 0252 56 2 PP Bed support 23 um adaptor 18 1114 26 18 9251 01 18 1113 01 18 9253 01 2 PP Bed support 10 um adaptor 18 1114 28 18 0251 76 18 1113 03 18 0252 76 2 PA Bed support end piece 18 1114 25 18 0251 55 18 1112 98 18 0252 55 2 PP Bed support 23 um end piece 18 1114 27 18 9252 01 18 1113 00 18 9254 01 2 PP Bed support 10 um end piece 18 1114 29 18 0251 77 18 1113 02 18 0252 77 2 PA Material abbreviations EPDM ethylene propylene diene FPM fluorocarbon rubber PA polyamide PP polypropylene PTFE polytetrafluoroethene PVC polyvinyl chloride SS stainless steel
10. Fast Trak Courses help educate and Theory Setup and Operation of train your personnel in downstream the single use WAVE Bioreactor processing In addition to traditional A two day practical course providing hands on courses and laboratory theoretical and technical background exercises GE Healthcare now knowledge as well as hands on introduces online training experience on the operation and All course programs undergo optimum performance of the continuous improvement For WAVE Bioreactor and related WAVE example the MAB1 course now equipment includes extensive practical work and a new UNICORN class for AKTAcrossflow has been introduced gt gt For more information see page 201 SYS3 Successful completion of gt gt For the latest information about our a course includes formal Training online and standard courses visit Certification in the particular subject www gelifesciences com fasttrak Fast Trak services are available from GE Healthcare Fast Trak Centers in North America Europe and Asia Our latest addition strengthens our presence in the rapidly expanding Indian sub continent n New Fast Trak Center in India Fast Trak Center Bangalore India GE Healthcare Life Sciences John F Welch Technology Center 122 EPIP Whitefield Bangalore 560 066 India Email fasttrakindia ge com T 91 80 2527 9538 F 91 80 2526 8423 30 www gelifesciences com bioprocess Technical support online Users of
11. Product Quantity AXP Startup Accessory Kitt AXP Cell Preparation Device Docking Station Main 1 Docking Station Satellite AXP Device Stand 1 Counterweight Weight Kit 1 Processing Set 24 QC Bag Set 10 Battery Replacement Kit for AXP AXP Freezing Processing Bag Labels Weight Compensation Cap ABC Switch Box Oval Bucket Adapter 2 Wireless Barcode Scanner Code No 28 9137 65 28 4044 58 28 4044 59 28 4044 65 28 4044 66 28 4044 60 28 4044 62 28 4044 64 28 4044 72 28 4052 22 28 9079 20 28 4044 67 28 4044 68 28 4044 69 28 4044 70 1 Includes XpressTrak Software Device Stand Counterweight Weight Kit Wireless Barcode Scanner and Operator Manual 2 Includes Weight Compensation Cap Microcarrier cell culture Microcarrier selection guide Industrial scale cell culture using microcarriers has proven to be reliable and cost effective for the manufacture of both human and animal healthcare products including viral vaccines interferons and animal and human growth hormones Microcarrier technology can reduce culture medium and serum costs by over 50 decrease labor and lessen the risk of contamination Interest in microcarrier technology has grown today to include in vivo use in a number of therapeutic applications GE Healthcare supplies microcarriers for a wide range of applications for cell immobilization particularly in the area of eucaryotic cell culture Microcarriers can be used to
12. Ficoll Paque PREMIUM See p 181 Pack size Code No 6x100 ml 17 5442 02 6x500 ml 17 5442 03 Regulatory Support File 11 0029 36 Technical data Composition Solution containing Ficoll PM400 and sodium diatrizoate Density 1 077 0 001 g ml Ficoll Paque PREMIUM 1 084 See p 180 Pack size Code No 6x100 ml 17 5446 02 Regulatory Support File 11 0029 36 Technical data Composition Solution containing Ficoll PM400 and sodium diatrizoate Density 1 084 0 001 g ml GammaBind G Type 2 Pack size Code No 1g 17 0884 06 10g 17 0884 08 50g 17 0884 99 Gelatin Sepharose 4 Fast Flow See p 72 87 Pack size Code No 1l 17 0976 03 5il 17 0976 04 Regulatory Support File 11 0029 37 Technical data Composition highly cross linked 4 agarose Particle size 90 um average d CNBr bovine gelatin derivative sova Coupling chemistry Ligand 5 mg ml drained medium 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Ligand density Pressure flow spec www gelifesciences com bioprocess 221 jo6a7 pup saxapu Indexes and Legal Glutathione Sepharose 4 Fast Flow See p 72 IgSelect See p 72 87 Pack size Code No Pack size Code No 25 ml 17 5132 01 25ml 28 4113 01 100 ml 17 5132 02 200ml 28 4113 02 500 ml 17 5132 03 1L 28 4113 03 Data File 18 1136 89 Data File 28 9257 92 Prepacked columns Prepacked columns GSTPrep FF 16 10 17 5234 01 HiTrap 5x1 ml 28 4113 11
13. aromatic and thiophilic interactions offer the required selectivity see pages 76 79 GE Healthcare s line of multimodal chromatography media includes Capto MMC a weak multimodal cation exchanger offering e High capacity at high conductivity e High productivity e New selectivity Capto adhere a strong multimodal anion exchanger characterized by e High capacity and productivity e Removal of contaminants after a Protein A capture step e Allows for a two step purification process of monoclonal antibodies PlasmidSelect Xtra which combines an agarose base matrix technology with a multimodal ligand designed for selective separation between supercoiled plasmid DNA and open circular plasmid DNA PlasmidSelect Xtra allows plasmid DNA purification that is e Flexible e Easily scalable e Robust e Cost efficient PlasmidSelect Xtra forms the basis of a generic process for purifying supercoiled circular DNA suitable for bulk to clinical grade applications The process provides high capacity delivers high yields and can be scaled up to fulfill requirements for economical industrial manufacturing of plasmid DNA in highly regulated environments 24 www gelifesciences com bioprocess AxiChrom columns New AxiChrom columns simplify column handling procedures from process development to production Packing is facilitated by the Intelligent Packing methodology whereby optimal compression of the bed is achieved th
14. e KTAsystems UNICORN UniFlux e AxiChrom e Removal of bulk of process related impurities from clarified feed including host cell protein DNA viruses and endotoxins Purification 5 D 5 wn 3 e a e lon exchange chromatography e Multi modal e Hydrophobic interaction e ReadyToProcess e Capto e PreDictor e Sepharose Sephadex SOURCE e PlasmidSelect CDM e Kvick cassettes ULTA cartridges e KTAsystems UNICORN UniFlux e AxiChrom e Removal of remaining traces of process and product related impurities Polishing e lon exchange e Reversed phase e Hydrophobic interaction e Gel filtration e ReadyToProcess e Superdex prep grade e Sephacryl Sepharose SOURCE e UniFlux AKTAsystems e AxiChrom e Long term product stability Formulation e Ultrafiltration diafiltration e Kvick cassettes hollow fibers www gelifesciences com bioprocess Hulssadoidoig Product highlights ReadyToProcess Platform MabSelect media Capto media Chromatography media toolbox PreDictor 96 well filter plates HiScreen columns Multimodal Chromatography AxiChrom columns Media Wand KTAprocess system 18 20 Zl 22 23 23 24 25 25 26 KTAcrossflow system GrandStand pilot process systems ULTA Pure filters Label free interaction analysis Fast Trak BioPharma Services Technical support online System and column support Life Science Perform
15. 130 www gelifesciences com bioprocess Custom packed columns Custom products adapt the exact combination of media and column to solve specific purification problems With years of experience in chromatography and column packing you can rely on the Custom Products group to tailor a solution to fit your separation objectives and save you time The group works with you from the initial discussions right through to delivery establishing your needs and sorting through the choices e Each custom column is packed and tested under stringent ISO 9001 standards e A result of analysis and user instruction that describe the column performance is supplied with the column e Delivery time is between two and four weeks depending on media and column specifications GE Healthcare offers the largest selection of prepacked columns and bulk media available encompassing most liquid chromatography techniques However should you require a special configuration contact the Custom Products group through your local GE Healthcare office to discuss your ideas and receive a free quotation juawdojanap ssad0 d www gelifesciences com bioprocess 131 Process development Systems for method and process development AKTAexplorer AkKTAexplorer is designed for scouting development and optimization of methods for all chromatographic techniques Flexibility and high levels of automation in combination with reproducibility and reliable operation ma
16. 64 9 523 5890 F 64 9 522 7342 Toll free 0800 733 893 Email sales nz ge com Postal address PO Box 17122 Greenlane Auckland 1546 NEW ZEALAND Fast Trak services Global Fast Trak Email FastTrak ge com Website www gelifesciences com fasttrak Fast Trak Centers Europe GE Healthcare Europe GmbH Oskar Schlemmer Strasse 11 80807 M nchen Germany Email ftcourses europe ge com T 49 0 89 96 28 16 90 F 49 0 89 96 28 16 79 North America GE Healthcare Bio Sciences Corp 800 Centennial Avenue Piscataway NJ 08855 1327 USA Email FasttrakNA ge com T 1 732 457 8064 F 1 732 457 8246 Russi C I S an Federation and amp N I S GE Healthcare ZAO forme r Amersham Biosciences Leninsky prosp 113 1 office D401 D403 RF 117 198 MOSCOW MOCKBA Russia n Federation T 7 495 956 51 77 F 7 495 956 51 76 Email LSrus ge com Contact Moscow office for Armenia Azerbaidjan Belarus Georgia Kazakhstan Kirgyzstan Moldavia Mongolia Tadjikistan Turkmenistan amp Uzbekistan Singapore GE Healthcare Pte Ltd Singapore Branch Office 77 Science Park Drive CINTECH III 03 05 06 Singapore Science Park 1 SINGAPORE 118256 T 65 6773 7303 F 65 6773 7302 Email lifesciences sg ge com China GE Healthcare GE Ch ina Research and Development Center Co Ltd 1800 CaiLun Road Zhangj jiang High tech Park Pudong Shanghai 210203 China Email fa T 86 2
17. Cassette membranes No cassette holders 1 1 2 6 Min Max cassettes 1 5 Kvick Lab 1 10 Kvick Flow 2 20 Kvick Flow 6 60 Kvick Flow Min Max area ft 1 2 6 5 50 10 100 30 300 m 0 11 0 55 0 46 4 6 0 92 9 2 2 76 27 6 System specifications System size 10 30 120 400 Max recirculation flow rate 10 Ipm 4 bar 60 lpm 4 bar 120 Ipm 4 bar 400 Ipm 4 bar Min recirculation flow rate 0 5 Ipm 4 bar 3 lpm 4 bar 12 Ipm 4 bar 40 Ipm 4 bar Feed connection TC 3 4 ay 11 2 3 Retentate connection TC 3 4 ay 11 2 2 Permeate connection TC 3 8 1 2 3 4 1 Jacketed feed tank capacity liter 5 N A N A N A System dimensions W x L x H mm 1010 x 880 x 1770 880 x 1500 x 1800 880 x 1640 x 1840 890 x 1700 x 1800 Cassette membrane cart dimensions W x L x H mm N A N A N A 920 x 1410 x 1820 If a transfer or permeate control pump is used the system length will increase by up to 300 mm Utility requirements Compressed air Power requirements Pump hydraulic unit Control system hardware Materials of construction Wetted materials Frame 30 400 Ipm 10 Ipm 30 400 Ipm 10 Ipm 6 10 Barg 87 145 psig 0 12 10 SCFM Dry particle free non condensing 3 Phase 400 480 VAC 50 60 Hz 10A to 30A 1 Phase 110 230 VAC 50 60 Hz 16 10A 1 Phase 110 230 VAC 50 60 Hz 16A 316L NO8904 EN 1 4539 PTFE PFA Glass EPDM SiC PEEK Hastelloy C22 Polypropylene Pt cured Silicone Only on Hollow fiber system UV opti
18. Packing CIP valves M paes Additional valves are available for automation System of CIP and intelligent pump 1 packing of AxiChrom Pressure columns sensor p piltar Ainsensor Optional filter housing for particle or sterile filration Pumps Asecond pump Cond cell prev Outlets is available for gradient formation Air sensor Pressure sensor ts Sample pump A dedicated sample pump is available Flow meter Up to ten outlet valves OQ k Condcell uvcell iee Columns An additional branch of valves is available for connection of a second column UV cell Single or multiple wave length UV detector Fig 1 The liquid flow path Validatable control with UNICORN software UNICORN software is a single familiar interface for both chromatography and membrane separations that provides efficient control of process flexible method programming extensive data evaluation and powerful reporting functionality Improved and cost effective process security is now provided as a standard The system control unit CU 960 allows process operation even if communication with system computer and UNICORN is lost either physically or due to operating system faults For integration purposes UNICORN communicates with control systems within the plant via OLE for Process Control OPC OPC supports application area such as data access for real time values and security control t
19. Selection guide 74 IEX See lon exchange chromatography IEX Media Selection Kit 69 IgG Sepharose 6 Fast Flow 87 222 IgSelect 72 87 222 IMAC media 70 Chelating Sepharose Fast Flow 70 72 217 IMAC Sepharose 6 Fast Flow 70 72 223 Ni Sepharose 6 Fast Flow 70 72 225 INdEX columns 94 Installation Qualification IQ 198 lon exchange chromatography IEX 65 Selection guide 67 IQ See Installation Qualification 250 www gelifesciences com bioprocess K Kvick cassettes and holders See Cross flow filtration Kvick Flow cassettes Kvick Lab cassettes Kvick Lab cassette holder Kvick Lab packet Kvick Lab packet holder Kvick Lab SCU cassettes Kvick Lab systems Kvick Pilot and Process cassettes Kvick Start cassettes L Label free interaction analysis Biacore C Biacore G x P Services Biacore T100 Lentil Lectin Sepharose 4B Licensing information Life Science Performance Solutions Literature Application Notes Books Data Files Posters Technique handbooks Upstream and Downstream magazine 159 157 158 161 161 156 165 160 155 29 188 190 191 189 72 223 246 32 203 208 208 209 209 209 208 208 M MAb See Monoclonal antibodies MAB1 Fast Trak Course 201 MabSelect 20 71 72 223 MabSelect PreDictor 96 well filter plates 126 MabSelect Prepacked columns 127 128 MabSelect ReadyToProcess 61 MabSelect SuRe 20 22 71 72 78 224 MabSelect xtra 20 71 7
20. allel screening of chromatographic conditions Data generated using PreDictor plates show good correlation with data obtained in column chromatography making the plates an excellent tool for initial screening of process conditions that facilitate transfer to large scale www gelifesciences com bioprocess 13 i Bioprocessing 14 Other examples include our Capto and MabSelect media that are designed to meet the high volume throughput productivity requirements for high titer feed streams and offer high binding capacity for capture of target molecule These media are available in a range of formats from PreDictor plates to HiScreen and ReadyToProcess columns to bulk media providing the flexibility to suit your ap plication scale Our hardware platforms include AxiChrom columns AKTAexplorer AKTApilot and AKTAprocess chromatography systems as well as AKTAcrossflow and UniFlux filtration systems Controlled by UNICORN software these systems allow for true integration of steps with rapid method transfer and scale up scale down enabling process developers to get results quickly and simply Comprehensive and reliable support We aspire to be a trusted knowledgeable supplier and offer an array of specialized services and support for process development validation security of supply and compliance Our Fast Trak team provides education courses process development assistance and validation services Our Life Science Performance Solu
21. and also for clinical and commercial production of human therapeutics Reduced cleaning and validation requirements make this an ideal system for cGMP applications Insect cell baculovirus The high oxygen supply capability of the WAVE Bioreactor makes it ideal for insect cell culture Cell densities over 9 x 10 cells ml are routinely achieved Baculovirus yields are higher than with conventional bioreactors The WAVE Bioreactor System is extremely easy to operate and inoculum scale up and infection can be done inside the bioreactor reducing the need for transfers Custom uses The WAVE Bioreactor has many other uses such as keeping in process inoculum pools agitated and aerated prior to use bead to bead transfer thawing and media mixing Custom Cellbags can be provided for the WAVE Bioreactor for any working volume between 100 ml and 500 1 Selection guide Instrumentation options Module Description CO Air Mix Plug in e Infrared CO sensor and aeration system provides a Controller continuous supply of CO conditioned air to the Cellbag Range 0 to 15 CO Dissolved Oxygen Optical Monitor Monitor with miniature fiber optic microprobes enabling real time measurement of dissolved oxygen High accuracy PMT optical detector with phase shift measurement Range 0 to 250 saturation with autozero Reusable DOOPT PROBE purchased separately 0 Air Mix Plug in Controller Provides continuous supply of O enriched g
22. e Improves efficiencies and enhances quality with Lean Six Sigma methods GE Management and Leadership Systems e GE best practices adapt to your organization to develop strong management and leadership systems e Innovative and sustainable model instills operational rigor focus and alignment with your strategic objectives Life Science Performance Solutions Our Life Science Performance Solutions offerings include both standard programs based on our proven methodologies as well as customized programs aimed at addressing specific organizational challenges and needs GE Healthcare Bioprocess Performance Solutions Fast Lean Flexible Leading the way in the hunt for efficiencu ond operational excellence 8 Lean Lean is a set of operational tools and concepts designed to rapidly improve processes by eliminating non value added steps In biopharmaceutical production the use of Lean methods such as Value Stream Mapping can enable a facility to view a process from the customer perspective Lean makes waste in the system clearly visible and forms the basis for an implementation plan Six Sigma Six Sigma is a rigorous statistical approach to problem solving It is designed to help organizations significantly reduce process variability and errors that can impact cost and quality Applied within biopharmaceutical production GE s approach to Six Sigma enables customers to clearly Define Measure An
23. pH stability operational 3 10 CIP stability short term 2 12 Pressure flow spec up to 500 cm h lt 200 kPa BPG 300 bed height 20 cm www gelifesciences com bioprocess 223 jo6a7 pup saxapu Indexes and Legal E MabSelect SuRe See p 71 72 78 E MabSelect Xtra See p 71 72 Pack size Code No Pack size Code No 25 ml 17 5438 01 25ml 17 5269 07 200 ml 17 5438 02 200ml 17 5269 02 1l 17 5438 03 1l 17 5269 03 5 17 5438 04 5l 17 5269 04 101 17 5438 05 101 17 5269 05 Data File 11 0011 65 60 17 5269 06 Regulatory Support File 11 0029 18 Data File 11 0011 57 Prepacked columns Regulatory Support File 11 0029 17 HiTrap MabSelect SuRe 5x1 ml 11 0034 93 Prepacked columns HiTrap MabSelect SuRe 1x5 ml 11 0034 94 HiTrap MabSelect Xtra 5x1 ml 28 4082 58 HiTrap MabSelect SuRe 5x5 ml 11 0034 95 HiTrap MabSelect Xtra 1x5 ml 28 4082 60 HiScreen MabSelect SuRe 4 7 ml 0 77 x 10 cm 28 9269 77 HiTrap MabSelect Xtra 5x5 ml 28 4082 61 96 well filter plates HiScreen MabSelect Xtra 4 7 ml 0 77 x 10 cm 28 9269 76 PreDictor MabSelect SuRe 6 ul 4 x 96 well plates 28 9258 23 Technical data PreDictor MabSelect SuRe 20 ul 4 x 96 well plates 28 9258 24 Composition highly cross linked agarose PreDictor MabSelect SuRe 50 ul 4 x 96 well plates 28 9258 25 Particle size d 75 um Technical data Ligand recombinant Protein A E coli Composition highly cross linked agarose Particle size d 85 um Ligand alkali stabilize
24. 2 c 3 7 Chromatography systems AKTAprocess Customized BioProcess Solutions UNICORN control 116 118 Chromatography systems AKTAprocess system AKTA platform enters production scale chromatography AkKTAprocess is an automated liquid chromatography system built for process scale up and large scale biopharmaceutical manufacturing The proven design has been verified during development and can be user configured to meet specific process demands It is the obvious choice of system to use when scaling up processes developed on smaller AkTAexplorer and AKTApilot systems e Versatile user configuration with UNICORN control e Post purchase configuration increasing usability and lifespan e Traceable USP Class VI materials e Full regulatory documentation and services e One inch tubing size now available Versatile user configuration AkTAprocess offers a versatile platform providing thousands of configuration possibilities The system is available in three flow rate ranges that extend up to 1800 h for large volume manufacturing The compact design with a built in computer allows the system to fit neatly into a plant AKTAprocess can be constructed in either electropolished stainless steel or polypropylene depending on your process conditions and plant requirements The systems can be configured to develop gradients at any flow rate with feedback loop technology This ensures thorough m
25. 3 Unit provided with casters gt gt Visit us on the web at www gelifesciences com wave www gelifesciences com readytoprocess 47 ssa00igo fippay ReadyToProcess Cellbag disposable bioreactors Manufactured from multilayered laminated clear plastic Cellbag disposable bioreactors are suitable for your specific cell culture process needs for research development or CGMP manufacturing operations Cellbag components are similar to those used for biological storage bags and meet USP Class VI specifications for plastics Validation data and Cellbag DMF are available to demonstrate biocompatibility However we recommend validation for specific applications such as e Monoclonal antibodies e Anchorage dependent cells e Virus production e Vaccine production e Insect cell Baculovirus gt gt Visit us on the web at www gelifesciences com wave Cellbags feature Presterile single use chambers for the non invasive mixing of fluids using a WAVE Bioreactor Designed to provide high mechanical strength and bio inert fluid contact Fluid contact layer is a medical grade low density polyethylene Outer non contact layer is made of low density polyethylene EVA or nylon EVOH copolymers All Cellbags have air inlet and outlet filters a needleless sampling port an Oxywell2 dissolved oxygen probe insertion port and a fill harvest port However Cellbags can be customized with optional fittings such as pH
26. 9 in respect of any defect in the Products arising from specifications or materials supplied by the Buyer fair wear and tear wilful damage or negligence of the Buyer or its employees or agents abnormal working conditions at the Buyer s premises failure to follow GEHC s use restrictions or instructions whether oral or in writing misuse or alteration or repair of the Products without GEHC s approval or if the Buyer is in breach of its payment obligations under this Contract 10 2 Subject to any express obligation to indemnify neither party shall be liable for any indirect or consequential or punitive damages of any kind from any cause arising out of the sale installation use or inability to use any Product or Service including without limitation loss of profits goodwill or business interruption 10 3 The total liability of GEHC arising under or in connection with the Contract including for any breach of contractual obligations and or any misrepresentation misstatement or tortious act or omission including without limitation negligence and liability for infringement of any third party intellectual property rights shall be limited to damages in an amount equal to the amount paid to GEHC under the Contract 10 4 The exclusion of liability in these Terms and Conditions shall not apply in respect of death or personal injury caused by GEHC s negligence 11 Intellectual Property Rights 11 1 Where the Buyer supplies designs d
27. GSTrap FF 5x1 ml 17 5130 01 HiTrap 1x5 ml 28 4113 12 GSTrap FF 2x1 ml 17 5130 02 Technical data GSTrap FF 100x1 ml 17 5130 05 Composition highly crosslinked agarose GSTrap FF 1x5 ml 17 5131 01 Particle size 75 um average d g vo GSTrap FF 5x5 ml 17 5131 02 Ligand 14 kD recombinant protein produced in GSTrap FF 100x5 ml 17 5131 05 S cerevisiae Binds to Fc fragments of 7 i all human IgG subclasses GST MultiTrap FF 96 well prepacked plate 4 plates 28 4055 01 Technical data Composition highly cross linked 4 agarose Particle size 90 um average d va Ligand glutathione Ligand density 120 320 umol glutathione ml drained medium Coupling chemistry epoxy 10 mg recombinant GST ml medium protein dependent 3 12 base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm Special pack size delivered on specific customer order Binding capacity pH stability Pressure flow spec E Heparin Sepharose 6 Fast Flow See p 70 72 Pack size Code No 50 ml 17 0998 01 250 ml 17 0998 25 1l 17 0998 03 5 17 0998 04 Data File 18 1060 76 Regulatory Support File 11 0028 19 Prepacked columns HiPrep 16 10 Heparin FF 17 5189 01 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d Ligand heparin Ligand density 4 mg heparin ml drained medium reductive amination 4 12 4 13 base matrix 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm Coupling
28. STM housings and accessories Code No Model No Description 56 4106 27 SS 35STM Housing Assembly for 35STM cartridges 316L SS with 2 each gaskets and 2 each clamps 56 4106 28 SS 55STM Housing Assembly for 55STM cartridges 316L SS with 2 each gaskets and 2 each clamps 56 4106 75 G4S 0 5 in TC gasket silicone 56 4106 77 G12S 1 5 in TC gasket silicone 56 4106 81 G24S 3 in TC Schedule 5 pipe gasket silicone 56 4106 65 CL4 0 5 in quick disconnect clamp 304 SS 56 4106 69 CL12 1 5 in quick disconnect clamp 304 SS 56 4106 71 CL24 3 in Schedule 5 pipe clamp 304 SS 56 4106 90 KO2ORS STM cartridge O ring set 8 each silicone 56 4105 90 VPC4 0 5 in TC permeate condensate drain or vent valve 316L SS Technical specifications Cartridge housing assembly All housing assemblies are of 316L stain O ring material is silicone The retentate clamp configuration allowing for quick a It is recommended to steam the comple 30 minutes at 121 C to 123 C and at 1b delta P across the membrane during the clamp port is positioned on the low poin removal of concentrate less steel with sanitary construction The and permeate ports are 1 5 in sanitary nd easy connection to steam and process piping In operation the housing should be piped in a vertical orientation e element and housing assembly for arg 15 psig Steam should be delivered to both sides of the membrane to ensure full steam penetration and to minimize the ste
29. Sepharose 4B 233 Sepharose 4 Fast Flow 84 85 234 Sepharose 6B 233 Sepharose 6 Fast Flow 84 85 234 Sepharose Big Beads 75 Sepharose CL 2B 85 233 Sepharose CL 4B 234 Sepharose CL 6B 234 Sepharose Fast Flow 75 83 84 Sepharose High Performance 75 Service and support 196 Solid supports oligosynthesis 194 SOP See Standard Operating Procedures SOURCE 66 69 107 SOURCE 15ETH 234 SOURCE 151SO 234 SOURCE 15PHE 235 SOURCE 15Q 67 69 235 SOURCE 15RPC 81 235 SOURCE 15S 67 69 236 SOURCE 30Q 69 79 235 SOURCE 30RPC 81 236 SOURCE 30S 69 236 SP Sepharose Big Beads 68 130 236 SP Sepharose Fast Flow 69 130 237 SP Sepharose High Performance 69 130 237 SP Sepharose XL 69 130 237 Standard Operating Procedures SOPs 199 Start AXM and AXH cartridges 143 Steam in place hollow fiber cartridges 154 Sterile Tube Fuser 52 Superdex 30 prep grade 84 85 237 Superdex 75 prep grade 84 85 238 Superdex 200 prep grade 84 85 238 Supports oligonucleotide synthesis 194 SYS1 Fast Trak Course 201 SYS2 Fast Trak Course 201 SYS3 Fast Trak Course 201 Systems for chromatography 114 AKTAexplorer 132 AKTApilot 133 AKTAprocess 116 Customized BioProcess Solutions 118 Systems for membrane separations See Cross flow filtration Systems for method and process development AKTAexplorer 132 AKTApilot 133 System and column support 31 206 System control UNICORN 119 T Technic
30. liquid passes through the membrane filtrate Particulates and aggregates remain behind as filter cake reducing flow and or increasing pressure over time Cross flow filtration vs Normal flow filtration Both technologies purify bioprocess solutions by removing contaminates with a fixed porous medium yet each format has unique advantages Generally normal flow filters NFF are used where clarification and or bio burden reduction is desired in relatively low solid streams for protecting or enhancing downstream operations or when final polishing is required to achieve sterility Cross flow filters CFF are best suited for higher solids more viscous feed solutions and or where concentration or purification of cells or target species is desired The guide below provides further information Where functional needs overlap a GE Healthcare Filtration Specialist can help you find the optimum configuration for your specific operation Guide to selecting Normal flow or Cross flow filtration NFF CFF MF Range x x High solids handling x Concentration x Recirculation required x Air applications x Sterile applications x Validation guides x x SIP x x x suitable for use 1 some models available contact GE Healthcare www gelifesciences com bioprocess 139 syonpoud uo1 017 4 Filtration products Cross flow filtration GE Healthcare separation cassettes and cartridges are designed for cross flow tan
31. production volumes l l ST microscope Scanning electron microscope Optical microscope Visible to naked eye lonic range Molecular range Macro molecular range Micro particle range Macro particle range Micrometers Log scale Angstrom units Log scale Approx molecular wt OkD 5 000kD F Retrovirus Pichia pastoris Relative size Adenovirus Mycobacterium Bacillus subtilis of biological Albumin protein Poxvirus Variola hed Polen materials _Brevundimonas dimunuta cee Rhinovirus i HIV Parainfluenza H E Coli I H Simian virus 40 H Saccharomyces cerevisiae H Chiamydia pneumoniae 4 H Parvovirus B19 4 Endotoxin pyrogen H SARS 4 H Streptococcus pneumoniae 4 Milled flour j i Suga E Latex emulsion J Beach sand Relative size f common Aqueous salts n Gelatin 6 materials Metalin Carbon black Paint pigment Colloidal silica A C fine test dust Atomic radius 4 Sunthetic kK Human hair ye C S Cross Flow Filtration CFF Normal Flow Filtration NFF Process for separation Reverse Osmosis RO Ultra Filtration UF Particle Filtration PF Nano Filtration NF Micro Filtration MF Note 1 micron 1x10 meters 4x10 inches 0 00004 inches 1 angstrom unit 107 meters 10 micrometers microns GE Healthcare s products span a wide range of filtration applications gt gt For t
32. pump or a chromatography system Capto Q Capto S Capto DEAE HiTrap Capto IEX Selection Kit Capto adhere and Capto MMC provides five different ion exchange designed for process development ligands based on Capto The HiTrap A convenient way of assessing IEX Selection Kit contains seven ion SOURCE 150 and SOURCE 15S media exchangers based on Sepharose Fast is to use an AKTAdesign system and Flow and Sepharose XL media RESOURCE or 4 6 100 PE AKTAdesign Capto Q Capto S Capto DEAE as prepacked columns well as Q and SP Sepharose High Performance are also available in prepacked HiTrap 1 ml and 5 ml 2 In addition to prepacked columns columns many of the media described in this section can be ordered as laboratory sized packs See A Z of media and chemicals www gelifesciences com bioprocess 67 Chromatography media Capto For high productivity capture and intermediate purification Capto is a new product line to meet large scale biopharma manufacturers demands for fast efficient and cost effective capture and intermediate purification It is based on a highly rigid agarose matrix produced with a manufacturing process that gives significantly improved pressure flow properties with maintained control over pore structure The rigid matrix enables high bed heights and purification of viscous samples at high flow rates Capto Q and Capto S are strong anion and cation exchangers and Capto DEAE is a weak anion exchanger all max
33. www gelifesciences com bioprocess 85 Chromatography media Custom Designed Media The Custom Design Media CDM group provides large scale operators with chromatography media designed for their specific purification tasks By tailoring a chromatography medium for your specific problem a CDM project aims to give you a more robust process and improved process economy The Custom Designed Media can be made on an exclusive basis but are often launched as a generally available product Currently available CDM media are listed on the opposite page Note Many CDM media have become standard products and are classed as BioProcess Media They are supported accordingly These media are described elsewhere in this catalog in the relevant technique sections Custom Designed Media projects A CDM project is run according to ISO 9001 routines and in collaboration with the customer often under a confidentiality agreement An experienced team works with you from the initial discussions right through to bulk delivery establishing your needs sorting through choices and producing and testing the finished product to meet your delivery schedules The final product is often a new combination of our existing base matrices and a ligand The ligand could be one of our own be available from an external supplier extracted from a ligand library or discovered by you Projects are carried out in three stages media definition media assurance a
34. 0 5 mm lumen 110 cm UFP 500 C H42LA 1 0 mm lumen 60 cm UFP 50 E H22LA 1 0 mm lumen 110 cm UFP 750 E H42LA 1 Quantity Code No 1 56 4100 96 56 4100 97 56 4100 98 56 4100 99 56 4101 03 56 4100 92 56 4101 08 56 4100 89 56 4101 15 56 4100 93 56 4101 10 56 4100 90 1 56 4101 06 56 4100 88 56 4101 17 56 4100 91 56 4101 19 This table shows examples of MidGee Hoop cartridges currently available For complete product lists and ordering information please contact your local GE Healthcare representative Technical specifications MidGee Hoop Cross Flow Cartridges Diameter Length nominal Endfitting connections Permeate connections Membrane area nominal Hold up volume nominal 60 cm model 110 cm model Materials of construction Hollow fibers Shell Luer Lok fittings Potting 0 3 cm 0 125 in 60 cm 23 6 in 110 cm 43 3 in Male Luer Lok Male Luer Lok 29 73 cm 4 5 11 3 in 0 5 to 1 0 ml each lumen and shell side 0 6 to 2 ml each lumen and shell side Polysulfone Polysulfone Polycarbonate Epoxy www gelifesciences com bioprocess 145 sjonpoid uoo Filtration products Xampler laboratory cartridges A sags i y i Xampler cartridges available for QuixStand and Kvick Lab benchtop systems can be manifolded together to achieve a wide range of process requirements Nominal flow path lengths of
35. 09 18 1031 20 BPG 200 18 1103 11 18 1103 12 18 1103 13 18 1031 20 BPG 300 18 1103 21 18 1103 22 18 1103 23 included 1000 mm BPG 450 18 1103 71 18 1103 72 18 1103 73 included Each column includes as standard 23 um polypropylene filter bed supports and polypropylene coarse bed supports 2 clamps 2 EPDM gaskets 2 blank caps and O rings in EPDM Column with packing extension Accessories for BPG columns Accessory BPG 100 BPG 140 BPG 200 BPG 300 BPG 450 Qty pk Material Air Trap Complete 18 1102 96 18 1102 97 8 1102 97 8 1102 98 18 1103 00 1 SS 316 Glass Top valve 18 1121 44 18 1121 44 8 1121 44 8 1121 44 18 1121 44 1 SS 316L EPDM Valves 4 port 2 way i d 6 mm 18 5757 01 18 5757 01 8 5757 01 1 SS 316L PTFE 4 port 2 way i d 10 mm 8 1012 56 18 1012 56 1 SS 316L PTFE 3 port 2 way i d 15 mm 44 5499 90 1 SS 316L PTFE 4 port 4 way i d 6 mm 18 5758 01 18 5758 01 8 5758 01 1 SS 316L PTFE 4 port 4 way i d 10 mm 8 1012 57 18 1012 57 1 SS 316L PTFE Valve sealing washer 18 1128 69 18 1128 69 8 1128 69 8 1128 69 18 1128 69 2 PTFE Pressure relief valve i d 6 mm 18 1105 36 18 1105 36 18 1105 36 8 1105 36 1 SS 316 FPM Safety valve 18 1035 80 18 1035 81 18 1035 81 8 1035 82 8 1103 65 1 SS 316 EPDM T junction 28 4057 65 28 4057 65 28 4057 65 28 4057 75 28 4057 75 1
36. 1 50 umol 250 umol 9 mmol 4 30 mmol OligoProcess 50 500 100 1000 mmol or higher All scale examples used Primer Support 200 loaded at 200 umol g except the lower range in which custom Primer Support 40s was used with AKTA oligopilot plus 10 Longer oligos might require a lower loading and thus the corresponding scale is affected AKTA oligopilot plus AKTA oligopilot plus is a flexible fully automated DNA RNA oligonucleotide synthesizer for use in research process development and production This compact pump driven system meets the needs of new synthesis chemistries like RNAi and enables cost efficient high quality synthesis AKTA oligopilot plus employs flow through reactor technology and features column re circulation an important factor when performing RNA synthesis It is available in two configurations AKTA oligopilot plus 10 for synthesis in the 1 to 50 umol range and AKTA oligopilot plus 100 for the range 50 umol to 9 mmol 192 www gelifesciences com oligo The system is compatible with a range of column reactors small scale cassettes and pre packed disposable Oligosynt columns For larger scale synthesis the adjustable FineLINE 35 oligo column has been specifically developed to allow synthesis at scales from 250 umol to 3 8 mmol Adjustable Column 200 ml enables 9 mmol synthesis AKTA oligopilot plus is controlled via an external computer using UNICORN software specially designed for produc
37. 1 EPDM O ring 91 67 x 3 53 18 1103 91 2 EPDM O ring 91 67 x 3 53 18 1105 49 1 PFR O ring 187 3 x 6 99 18 1106 26 i EPDM O ring 187 3 x 6 99 18 1106 29 1 PFR Piston seal 18 1039 56 18 1106 28 1 EPDM Piston seal 18 1149 99 2 EPDM O ring 350 x 5 18 1153 72 l EPDM O ring 350 x 5 18 1153 76 1 PFR O ring 15 2 x 3 5 18 1153 74 2 EPDM O ring 15 2 x 3 5 18 1153 78 2 PFR O ring 55 35 x 3 53 18 1153 73 i EPDM O ring 55 35 x 3 53 18 1153 77 1 PFR O ring 329 5 x 6 99 18 1153 75 1 EPDM O ring 329 5 x 6 99 18 1153 79 i PFR Piston seal 18 1149 99 2 EPDM Material abbreviations EPDM ethylene propylene diene ETFE ethylene tetrafluoroethylene FP fluoroplastic PEEK polyetheretherketone PFR perfluor rubber PP polypropylene PTFE polytetrafluoroethene PVC polyvinyl chloride SS stainless steel When ordering piston seals for pre 2007 FineLINE columns please contact your GE Healthcare sales representative for the correct code number Photo Courtesy of Avecia UK www gelifesciences com bioprocess Literature Data File Code No FineLINE Pilot 35 Column 18 1104 95 FineLINE 70 70L 100 100L 200 200L 18 1130 00 Application Note Scaling up high performance chromatography on SOURCE media and FineLINE columns 18 1117 49 Documentation to support validation available on request Contact your local GE Healthcare office A guide to plastic connectors for process scale columns Connector i d 25 mm 50 mm
38. 100 C 9A P 100 E 9A P 300 C 9A FP 300 E 9A P 500 C 9A P 500 E 9A FP 750 E 9A Pore size NMWC 1000 3000 3000 5000 5000 10 000 10 000 30 000 30 000 50 000 50 000 100 000 100 000 300 000 300 000 500 000 500 000 750 000 1000 3000 3000 5000 5000 10 000 10 000 30 000 30 000 50 000 50 000 100 000 100 000 300 000 300 000 500 000 500 000 750 000 3000 10 000 30 000 50 000 100 000 100 000 300 000 300 000 500 000 500 000 750 000 1000 3000 3000 5000 5000 10 000 10 000 30 000 30 000 50 000 50 000 100 000 100 000 300 000 300 000 500 000 500 000 750 000 Fiber ID mm 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 0 5 Membrane area m 0 20 0 20 0 12 0 20 0 12 0 20 0 12 0 20 0 12 0 20 0 12 0 20 0 12 0 20 0 12 0 20 0 84 0 84 115 0 84 115 0 84 115 0 84 1 15 0 84 1 15 0 84 1 15 0 84 0 84 ft 2 2 a BS Decks w INS SINS EN Ee e rWPEWEWN ew 2 N 12 5 125 9 12 5 9 12 5 9 12 5 9 12 5 9 125 9 125 9 125 9 9 Nominal flowpath length cm 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 30 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 30 30 30 30 30 30 30 30 30 30 30 6
39. 15 Force Majeure 15 1 GEHC shall not be liable in respect of the non performance of any of its obligations to the extent such performance is prevented by any circumstances beyond its reasonable control including but not limited to strikes lock outs or labour disputes of any kind whether relating to its own employees or others fire flood explosion natural catastrophe military operations blockade sabotage revolution riot civil commotion war or civil war acts or threats of terrorism plant breakdown computer or other equipment failure and inability to obtain equipment 15 2 If an event of force majeure exceeds one 1 month GEHC may cancel the Contract without liability 16 Software License Unless a separate software license agreement has been concluded concerning the Software the Buyer is hereby granted a non exclusive license to use the Software solely in object code format and solely for its own internal business purposes subject to the terms contained herein The Buyer shall not i use the Software for purposes other than those for which it was designed ii use the Software in connection with other manufacturers products unless such connectivity is authorized in the Product documentation iii grant assign transfer or otherwise make available to third parties any right whatsoever in the Software iv disclose to third parties any information contained in the Software v copy or reproduce the Software except
40. 15 12 5 60 56 4110 88 RTPUFP 750 E 9 750 000 1 0 84 9 60 Ordering information ReadyToProcess Hollow Fiber microfiltration cartridges Code Number Model Number Pore Size um Fiber ID mm Membrane Surface Area Nominal Flowpath m ft Length cm 56 4110 33 RTPCFP 1 E 3M 0 1 1 0 011 0 12 30 56 4110 34 RTPCFP 2 E 3M 0 2 1 0 011 0 12 30 56 4110 35 RTPCFP 4 E 3M 0 45 0 011 0 12 30 56 4110 36 RTPCFP 6 D 3M 0 65 0 75 0 012 0 13 30 56 4110 44 RTPCFP 1 E 3X2M 0 1 1 0 023 0 24 60 56 4110 45 RTPCFP 2 E 3X2M 0 2 1 0 023 0 24 60 56 4110 46 RTPCFP 4 E 3X2M 0 45 0 023 0 24 60 56 4110 47 RTPCFP 6 D 3X2M 0 65 0 75 0 027 0 29 60 56 4110 48 RTPCFP 1 E 4M 0 1 1 0 042 0 45 30 56 4110 49 RTPCFP 2 E 4M 0 2 1 0 042 0 45 30 56 4110 50 RTPCFP 4 E 4M 0 45 0 042 0 45 30 56 4110 51 RTPCFP 6 D 4M 0 65 0 75 0 046 0 50 30 56 4110 59 RTPCFP 1 E 4X2M 0 1 1 0 085 0 9 60 56 4110 60 RTPCFP 2 E 4X2M 0 2 1 0 085 0 9 60 56 4110 61 RTPCFP 4 E 4X2M 0 45 1 0 085 0 9 60 56 4110 62 RTPCFP 6 D 4X2M 0 65 0 75 0 095 1 02 60 56 4110 63 RTPCFP 1 E 5 0 1 0 12 13 30 56 4110 64 RTPCFP 2 E 5 0 2 1 0 12 La 30 56 4110 65 RTPCFP 4 E 5 0 45 1 0 12 13 30 56 4110 66 RTPCFP 6 D 5 0 65 0 75 0 16 1 7 30 56 4110 74 RTPCFP 1 E 6 0 1 0 28 3 60 56 4110 75 RTPCFP 2 E 6 0 2 1 0 28 5 60 56 4110 76 RTPCFP 4 E 6 0 45 1 0 28 3 60 56 4110 77 RTPCFP 6 D 6 0 65 0 75 0 37 4 60 56 4110 78 RTPCFP 1 E 8 0 1 0 36 3 9 30 56 4110 79 RTPCFP 2 E 8 0 2 1 0 36 3 9 30 56 4110 80 RTPCFP 4 E 8 0 45 1 0 36 3 9 30 56 4110 81 RTP
41. 17 5431 03 17 5431 04 17 5452 01 17 5452 02 17 5272 03 17 5272 05 17 1277 03 17 1277 04 17 1277 05 17 0902 02 17 0902 04 17 0976 03 17 0976 04 17 0969 02 17 0969 04 28 4113 01 21 4113 02 28 4113 03 17 5098 03 17 5098 05 28 4109 03 28 4111 03 28 4111 04 17 5450 01 17 5450 02 www gelifesciences com bioprocess 87 pipaw fiydpibo owo1yD Chromatography columns AxiChrom INdEX BPG Chromaflow FineLINE Manufacturing Solutions 92 94 98 103 Chromatography columns 90 Columns for process chromatography When a chromatographic step is developed to be an integral part of a manufacturing process the choice of column is important to assure consistent performance and reliable operation With over 30 years experience in process chromatography GE Healthcare can provide you with a wide range of columns that ensures the highest performance from our separation media and meets the demands of modern biopharmaceutical manufacturing Know how in packing methodology is available through our User Manuals Workshops with lectures and hands on training can be arranged through our Fast Trak services www gelifesciences com bioprocess Points to consider when selecting your column e Dimensions To determine the appropriate column e Regulatory support Columns used in biopharmaceutical diameter at full scale calculate the column volume or production or
42. 18 1119 29 18 1119 29 SS 316 Manometer kit 18 1119 28 18 1119 28 18 1119 28 18 1119 28 Castor 18 1001 09 18 1001 09 18 1001 09 18 1001 09 Adjustable foot 18 1126 93 18 1126 93 18 1126 93 18 1126 93 Tubing with sanitary fitting i d 6 mm 30 cm 18 0005 42 18 0005 42 8 0005 42 8 0005 42 1 PVC 75 cm 18 0005 43 18 0005 43 8 0005 43 8 0005 43 1 PVC 125 cm 18 0005 44 18 0005 44 8 0005 44 8 0005 44 1 PVC 150 cm 18 0005 45 18 0005 45 8 0005 45 8 0005 45 1 PVC 200 cm 18 0005 47 18 0005 47 8 0005 47 8 0005 47 1 PVC Connectors see p 97 i d 6 mm 25 mm TC 6 mm threaded 18 0251 98 18 0251 98 18 0251 98 18 0251 98 2 PP 25 mmTC 3 4 20 UNF threaded 18 1012 67 18 1012 67 18 1012 67 18 1012 67 2 PP 25 mm TC M6 threaded 18 1031 09 18 1031 09 2 PP 25 mm TC i d 22 mm 51mm TC 18 1012 69 18 1012 69 8 1012 69 8 1012 69 2 PP Clamp 25 mm 18 1001 31 18 1001 31 18 1001 31 18 1001 31 SS 304 Clamp 51 mm 44 7134 01 44 7134 01 44 7134 01 44 7134 01 SS 304 Gasket 25 mm 18 0019 27 18 0019 27 18 0019 27 18 0019 27 2 EPDM Gasket 51 mm 18 1012 88 18 1012 88 18 1012 88 18 1012 88 5 EPDM Blind flange 25 mm incl gasket 18 1001 25 18 1001 25 18 1001 25 18 1001 25 SS 304 EPDM Blind flange 51 mm incl gasket 44 7135 01 44 7135 01 44 7135 01 44 7135 01 SS 304 EPDM Packing device with PP lid 18 1114 35 18 1104 22 18 1114 36 18 1104 23 Glass Lid kit for packing device 18 1108 63 18 1114 37 18 1108 64
43. 20 UNF threaded 8 1012 68 18 1012 68 2 PP 3 i d 10 25 mm TC i d a 14 51 mm TC 8 1027 25 18 1027 25 2 PP i d 14 51 mm TC i d 22 51mmTC 18 1027 26 2 PP Clamp 25 mm 18 1001 31 18 1001 31 18 1001 31 8 1001 31 18 1001 31 1 SS 304 Clamp 51 mm 44 7134 01 44 7134 01 44 7134 01 44 7134 01 44 7134 01 I SS 304 Gasket 25 mm i d 6 mm 18 0019 27 18 0019 27 18 0019 27 2 EPD Gasket 25 mm i d 6 mm 18 0019 28 18 0019 28 18 0019 28 2 PTFE Gasket 25 mm i d 10 mm lt 8 1035 79 2 EPDM Gasket 25 mmi d 10 mm 7 8 1012 40 2 PTFE Gasket 25 mm i d 12 mm s 18 0200 00 2 EPD Gasket 25 mmi d 12 mm 44 5506 20 2 PTFE Gasket 51 mm i d 10 mm 8 1012 88 18 1012 88 5 EPD Gasket 51 mm i d 14mm 18 1017 57 5 EPD Gasket 51 mm i d 22 mm 44 7133 01 44 7133 01 44 7133 01 44 7133 01 44 7133 01 5 EPD Gasket 51 mmi d 22 mm 44 5512 03 44 5512 03 44 5512 03 44 5512 03 44 5512 03 2 PTFE Blind flange 25 mm incl gaske 18 1001 25 18 1001 25 18 1001 25 18 1001 25 18 1001 25 1 SS 304 EPDM Blind flange 51 mm incl gasket 44 7135 01 44 7135 01 44 7135 01 44 7135 01 44 7135 01 1 SS 304 EPDM Torque wrench 18 0251 37 18 0251 37 18 0251 37 18 0251 37 18 0251 37 1 SS 304 12 point opening socket 18 1031 03 18 1031 04 18 1031 04 18 1031 05 18 1105 31 1 SS 304 Allen key 18 1030 98 18 1030 98 18 1030 98 18 1030 98 18 1030 98 1 SS 304 Packing device glass 18 1104 75 18 1113 33 18 1104 77 18 1108 16 1 Glass Packing device 8 1105
44. 30 and 60 cm allow optimization of process conditions and assist future scale up Low flow rate requirements allow the use of smaller pumps Polysulfone membrane minimizes non specific protein binding and provides high product recovery e Range of membrane areas suits different processing needs e Offered with Tri Clamp end fittings for quick and easy aseptic connection e Autoclavable with the exception of 1000 NMWC devices address the need for small volume sanitary processing Xampler ultrafiltration and microfiltration cartridges are for laboratory scale processing with solution volumes typically ranging from a few hundred milliliters to about five liters Nominal flow path lengths are 30 and 60 cm and membrane areas range from 0 01 to 0 14 m 0 12 to 1 5 ft Moreover they are directly scalable to pilot and process scale cartridges with equivalent path lengths Xampler cartridges have self contained housings that match QuixStand and Kvick Lab benchtop systems Vertical operation achieves complete process fluid drainage and maximum product recovery 146 www gelifesciences com bioprocess Ordering information Product Quantity Code No Xampler Cartridge 0 1 micron 0 75 mm lumen size 3M autoclavable CFP 1 D 3MA 1 56 4101 40 Xampler Cartridge 0 2 micron 1 0 mm lumen size 3X2M autoclavable CFP 2 E 3X2MA 1 56 4101 57 Xampler Cartridge 0 45 micron
45. 37 UFP 3 E 55 3000 1 2 1 23 60 56 4103 39 UFP 5 C 55 5000 0 5 3 25 35 60 56 4103 41 UFP 5 E 55 5000 1 2 1 23 60 56 4103 43 UFP 10 C 55 10 000 0 5 3 25 35 60 56 4103 45 UFP 10 E 55 10 000 1 2 1 23 60 56 4103 47 UFP 30 C 55 30 000 0 5 3 25 35 60 56 4103 49 UFP 30 E 55 30 000 1 2 1 23 60 56 4103 51 UFP 50 C 55 50 000 0 5 3 25 35 60 56 4103 53 UFP 50 E 55 50 000 1 2 1 23 60 56 4103 55 UFP 100 C 55 100 000 0 5 3 25 35 60 56 4103 57 UFP 100 E 55 100 000 zl 2 1 23 60 56 4103 59 UFP 300 C 55 300 000 0 5 3 25 35 60 56 4103 61 UFP 300 E 55 300 000 1 2 1 23 60 56 4103 63 UFP 500 C 55 500 000 0 5 3 25 35 60 56 4103 65 UFP 500 E 55 500 000 1 2 1 23 60 56 4103 67 UFP 750 E 55 750 000 1 2 1 23 60 56 4103 80 UFP 3 C 75 3000 0 5 6 65 0 56 4103 82 UFP 3 E 75 3000 1 3 7 40 0 56 4103 84 UFP 5 C 75 5000 0 5 6 65 0 56 4103 86 UFP 5 E 75 5000 1 3 7 40 0 56 4103 88 UFP 10 C 75 10 000 0 5 6 65 0 56 4103 90 UFP 10 E 75 10 000 1 3 7 40 110 56 4103 92 UFP 30 C 75 30 000 0 5 6 65 110 56 4103 94 UFP 30 E 75 30 000 1 3 7 40 110 56 4103 96 UFP 50 E 75 50 000 1 37 40 110 56 4103 98 UFP 100 C 75 100 000 0 5 6 65 110 56 4104 00 UFP 100 E 75 100 000 1 37 40 110 56 4104 02 UFP 300 C 75 300 000 0 5 6 65 110 56 4104 04 UFP 300 E 75 300 000 1 3 40 110 56 4104 06 UFP 500 C 75 500 000 0 5 6 65 110 56 4104 08 UFP 500 E 75 500 000 1 37 40 110 56 4104 10 UFP 750 E 75 750 000 1 3 7 40 110 56 4104 10 UFP 750 E 75 750 000 1 37 40 110 Note Process scale ultrafiltration cartridges are not
46. 400 fold scale up on SOURCE 30RPC to silica based media The high chemical stability of the matrix offers unmatched flexibility when choosing running and cleaning conditions SOURCE 15RPC is intended for polishing where fast preparative separations with the highest resolution are required SOURCE 15RPC is also available in prepacked columns RESOURCE RPC columns and ST 4 6 100 AKTAdesign columns which are well suited for selectivity screening experiments SOURCE 30RPC is well suited for the polishing stage of industrial processes where high flow velocities and low back pressures are needed Flow velocity 150 cm h A 24 ml column 280 nm 2 0 5 10 4 Gradient 20 70 B 5 column volumes cv cv Column SOURCE 30RPC 10 mm i d x 300 mm column 24 ml 200 mm i d x 300 mm column 10 Sample Mixture of Angiotensin II Ribonuclease A and Insulin Sample load 0 064 mg ml media total load Solution A 0 1 TFA 0 05 M NaCl Solution B 0 1 TFA 60 n Propanol FineLINE 200L column i cv A 400 fold scale up of a model sample mix on SOURCE 30 RPC Going from a 24 ml laboratory scale column to a 9 4 liter production scale column in one step gives what is essentially identical results at both scales www gelifesciences com bioprocess 81 pipaw fiydpibo owo1yD Chromatography media 82 Gel filtration Technique description Gel filtration separates biomolecules acc
47. 50 Hz adaptors clamps and gaskets high pressure shut off 56 4105 92 VDM 6SS Diaphragm valve fractional Tri Clamp 56 4106 43 RLP 350DPFT LABTOP 350 stainless steel rotors stainless steel 56 4106 58 RLP 350DPFT HPS LABTOP 350 stainless steel rotors high 56 4105 93 VDM 12SS Diaphragm valve 1 5 in Tri Clamp stainless pressure shut off steel 56 4106 44 RLP 350DPFT 50 LABTOP 350 stainless steel rotors 220 v 50 Hz 56 4105 91 VBF12 Butterfly valve 1 5 in Tri Clamp stainless steel 56 4106 59 RLP 350DPFT 50 HPS LABTOP 350 stainless steel rotors 220 v 50 Hz silicone seat high pressure shut off 56 4105 95 HX12 L1 8 Heat exchanger 1 5 in Tri Clamp 56 4107 60 YS 01 12TCSS Y strainer for RLP 350DPFT suction 5 1 cm diameter 34 cm long protection 1 5 in Tri Clamp 56 4105 96 HX12 L2 9 Heat exchanger 1 5 in Tri Clamp 5 1 cm diameter 63 cm long Pumps peristaltic 56 4107 76 SSCRT RLP Heavy duty stainless steel cart with locking Masterflex peristaltic pumps incorporate variable speed drive and a manual castors control system Masterflex Easy Load pump heads deliver up to 13 Ipm Code No Part No Description 56 4106 45 PRP O1MF Masterflex peristaltic pump with Easy Load head tubing 56 4106 46 PRP 01MF 50 Masterflex peristaltic pump with Easy Load head tubing 220 v 50 Hz 56 4106 47 KPRP O2MF Dual head add on kit for PRP O1MF and PRP 01MF 50 Provides flow rates up to 26 Ipm Includes Easy Load head tubing clamps Y connecto
48. 6201 3700 F 82 2 6201 3804 Email lifescienceskKR ge com Latin America Brazil GE Healthcare do Brasil Ltda Rua Domingos Marchetti 192 Bairro do Limdo SP 02712 150 Brazil T 55 11 3933 7300 or toll free 0800 136833 F 55 11 3933 7304 Email vendas biosciences ge com Sales support to Brazil Colombia Costa Rica Dominican Republic Ecuador Guatemala Honduras Panam Per Tobago Trinidad and Venezulea Malaysia GE Healthcare Bio Sciences Ltd Level 6 1 Sentral Jalan Travers Kuala Lumpur Sentral 50470 Kuala Lumpur MALAYSIA T 60 3 2273 9788 F 60 3 2273 6508 Sales support to South East Asia Region including Brunei Philippines Indonesia amp Vietnam Mexico GE Healthcare Av Santa F 495 Colonia Santa F Distrito Federal CP 05349 T 52 55 9177 0300 Ext 9645 F 52 55 9177 0388 Email alberto suarez ge com Sales support to Mexico Middle East and Africa Greece HVD Biotech Vertriebs GmbH Vouliagmenis Avenue 16 P O Box 70051 GR 16610 Glyfada GREECE T 30 210 96 00 687 F 30 210 96 00 693 Email biotech hvd gr Sales support for Greece Algeria Bahrain Cyprus Egypt Iran Iraq Israel Jordan Kuwait Lebanon Malta Morocco Oman Pakistan Qatar Republic of South Africa Saudi Arabia Syria Tunisia Turkey Ukraine UAE Yemen New Zealand GE Healthcare Bio Sciences NZ Ltd Ground Floor 300 Great South Road Greenlane Auckland 1051 NEW ZEALAND T
49. 73 Q OQ Slurry tank 44 8100 76 Q OQ Control Cab ETTAN LC 44 8101 02 CCPs Change Control Protocols CCP UNICORN upgrade BioProcess system 44 8100 25 CCP UNICORN upgrade OligoProcess system 44 8100 37 CCP UNICORN upgrade AKTA oligopilot 44 8100 38 CCP UNICORN upgrade AKTAexplorer 44 8100 30 CCP UNICORN upgrade AKTAretc 44 8100 32 CCP UNICORN upgrade AKTApurifier 44 8100 34 CCP UNICORN upgrade AKTAprime 44 8100 39 CCP UNICORN upgrade AKTApilot 44 8100 52 CCP UNICORN upgrade AKTAcrossflow system 44 8100 79 CCP UNICORN upgrade OligoPilot II system 44 8100 54 CCP UNICORN upgrade UniFlux system 44 8100 82 Standard Operating Procedures SOP for backup 44 8102 02 SOP for restore 44 8102 03 SOP for revalidation 44 8102 04 SOP for log book 44 8102 08 SOP for system security 44 8102 09 SOP for audit trail 44 8102 10 SOP BioProcess system wetted parts replacement 44 8102 11 SOP AKTApilot system wetted parts replacement 44 8102 13 SOP Chromaflow packing 44 8102 12 Performance of IQ OQ and CCP In addition to providing 1Q OQ and CCP documentation packages we have Service Engineers who can execute the 1Q 0Q and CCP testing for your company This will save valuable time and prepare you for process validation Our engineers are specially trained and certified to perform these procedures On completion of the testing all requisite documentation is completed and handed over Standard Operating Procedures SOPs Fast Trak offers SOPs for
50. 83 10g 17 5253 82 100g 17 5253 80 240 www gelifesciences com bioprocess Primer Support riboA 40 1g 17 5225 17 10g 17 5214 85 Primer Support riboC 40 1g 17 5225 18 10g 17 5214 86 Primer Support riboG 40 lg 17 5225 19 10g 17 5214 87 Primer Support riboU 40 1g 17 5225 20 10g 17 5214 88 Primer Support riboA 80 1g 17 5225 13 10g 17 5214 50 Primer Support riboC 80 1g 17 5225 14 10g 17 5214 51 Primer Support riboG 80 1g 17 5225 15 10g 17 5214 52 Primer Support riboU 80 lg 17 5225 06 10g 17 5214 53 Technical data Composition Cross linked polystyrene Particle size Base protection is ABz CBz Gibu and T for DNA oligonucleotides Base protection is ABz CBz Gibu and U for RNA oligonucleotides The number indicated in the product name refers to loading in umol g The s in the product name indicates spacer Alternative pack sizes are available Glossary of terms BioProcess Media This label designates our media that have been specifically designed to meet the demands of industrial biotechnology e Scalable from lab to production e With comprehensive documentation e Meeting productivity requirements e Having validated manufacturing procedures e With developed CIP and sanitization in place procedures e Offering security of supply Fast Trak Fast Trak is a range of consulting process development validation and training services available to companies working with
51. Bjorkgatan 30 Box 605 SE 751 25 UPPSALA T 46 0 18 612 19 00 F 46 0 18 612 19 10 Customer Service T 46 0 18 612 19 90 Email orderse ge com Technical Support T 46 0 18 612 19 80 Email productse ge com Switzerland GE Healthcare Europe GmbH Zweigniederlassung Schweiz ndustriestrasse 30 CH 8112 Otelfingen T 0848 8028 10 F 0848 8028 11 Email cust orderde ge com Technical Support T 0848 8028 12 F 0848 8028 13 Email cust servde ge com North America In the USA GE Healthcare Bio Sciences Corp 800 Centennial Avenue P O Box 1327 Piscataway NJ 08855 1327 USA T 1 800 526 3593 Technical Support Email ts usa ge com Customer Service Email cs us ge com Instrument Service Email labcrew us ge com Canada GE Healthcare Bio Sciences Inc 500 Morgan Blvd Baie d Urf Qu bec H9X 3V1 CANADA Customer Service T 1 800 463 5800 F 1 800 567 1008 Email csdcanada ge com Technical Support Email ts usa ge com International Argentina GE Healthcare Argentina S A Montaneses 2820 C1429 BLB Buenos Aires T 54 114576 3030 F 54 11 4576 3030 ext 113 Email sales ar ge com Sales support to Argentina Uruguay Paraguay Chile and Bolivia Australia GE Healthcare Bio Sciences Pty Ltd Building 4B 21 South Street Rydalmere NSW 2116 AUSTRALIA T 61 2 8820 8299 F 61 2 8820 8200 Toll free 1800 150 522 Email sales au ge com Postal address
52. Coarse test dust in water lt Technical specifications ci Filtration area Up to 0 6m 6 3ft per 250 mm 10 inch module Recommended operating conditions Recommended operating conditions Up to 70 C k 158 F continuous operating temperature and higher short term temperatures during CIP Capsules may be operated up to a temperature of 40 C 104 F at line pressures up to 5 0 barg 72 psi ne i Se or liquids and 4 0 bar 58 psi in air gas Liquid filter cartridges for clarifying and prefiltering in Materials of construction biopharmaceutical and ultra pure applications Filtration media Glass Microfiber Prefilter layer Polyester Upstream support Polypropylene e Cartridges can be repeatedly steam sterilized in situ Downstream support Polypropylene autoclaved at up to 135 C or sanitized with hot water at Inner support core Polypropylene 5 Outer protection cage Polypropylene up to 90 C Capsules can be repeatedly autoclaved up to End cas Polypropylene 135 C End cap insert 316 stainless steel Standard o ring gaskets Silicone EPDM e Compatible with a wide range of chemicals Capsule body Polypropylene e Materials conform to the relevant biological safety Sai fa segs anced a Wing be olycarbonate requirements of 21 CFR Part 177 and current USP Plastics Class VI 121 C and 1SO10993 equivalents it ratir e Full pharmaceutical validation guide available on request foaane ULTA Prim
53. FF 1x20ml 17 5096 01 HiPrep 16 10 Octyl FF 1x20ml 17 5097 01 HiPrep 16 10 Phenyl FF high sub 1x20ml 17 5095 01 HiPrep 16 10 Phenyl FF low sub 1x20ml 17 5094 01 HiLoad 16 10 Phenyl Sepharose HP 1x20ml 17 1085 01 HiLoad 26 10 Phenyl Sepharose HP 1x 53 ml 17 1086 01 HiTrap HIC Selection Kit Txim 28 4110 07 HiTrap Butyl HP WET 5xim 28 4110 01 HiTrap Butyl HP WET 5x5m 28 4110 05 HiTrap Butyl S FF 5x1m 17 0978 13 HiTrap Butyl S FF 5x5 m 17 0978 14 HiTrap Butyl FF 5x1im 17 1357 01 HiTrap Butyl FF 5x5m 17 5197 01 HiTrap Octyl FF 5x1m 17 1359 01 HiTrap Octyl FF 5x5m 17 5196 01 HiTrap Phenyl FF high sub 5xim 17 1355 01 HiTrap Phenyl FF high sub 5x5m 17 5193 01 Order online at www gelifesciences com orderonline 128 www gelifesciences com bioprocess lon exchange columns for AKTAdesign system Ordering information Product iLoad 16 10 Q Sepharose HP iLoad 16 10 SP Sepharose HP iLoad 26 10 Q Sepharose HP iLoad 26 10 SP Sepharose HP iPrep 16 10 ANX FF high sub iPrep 16 10 CM FF iPrep 16 10 DEAE FF iPrep 16 10 Q FF iPrep 16 10 Q XL iPrep 16 10 SP FF iPrep 16 10 SP XL iScreen Capto adhere WEM iScreen Capto DEAE WEM iScreen Capto MMC WET iScreen Capto Q EW iScreen Capto s WEM Trap Capto IEX Selection Kit WET rap IEX Selection Kit rap ANX FF high sub rap ANX FF high sub Trap Capto adhere WET Trap Capto adhere WET Trap Capto DEAE WEM Trap Capto DEAE WE
54. Functional Requirements Detailed Installation Design D Qualification AL Develop D C System 4 The validation life cycle ensures adequate validation of computerized systems E AAN Performance Qualification Security of electronic records 21 CFR Part 11 from the U S FDA applies to all new and existing systems Protecting the security and integrity of electronic records is essential for compliance with the Rule This includes ensuring the reliability and trustworthiness of electronic records used to support critical decisions such as e Release of a production batch e Pre clinical and clinical trials Key issues in complying with Part 11 are e Validation of system e Accurate complete copies e Protection of records e Limiting system access e Audit trails e Authority checks Qualification in the G x P laboratory Equipment Qualification is the overall process of ensuring that a system performs according to specifications agreed by the user and vendor It is commonly broken down into e Design Qualification DQ e Installation Qualification IQ e Operational Qualification OQ e Performance Qualification PQ Qualifications should only be conducted by GMP trained and experienced personnel To ensure that the system is maintained in a validated state periodic maintenance calibrations and re qualifications are mandatory requirements gt gt For more information please visit www geli
55. GE Healthcare s columns and systems may lisia need quick and easy access to information regarding 8 eer e their equipment To meet these needs GE Healthcare has z ae na developed an efficient and enhanced support site on the _ internet e a a C mme manas Laboralocy Chromatography Gy BRO ayn From its initial focus on standard process scale columns and systems the site has expanded to cover laboratory ae Sass cnet the ae scale equipment as well later tater mach or erir ee E E E AS vg Fha ee ee me ee ee Be ees ee Ee r derhi ii F a gt gt For more information see page 205 s1y6i yb1y yonpoig The technical support site gives quick access to detailed information regarding e AKTAdesign selection guide flow paths and kits e Columns and system recommendations e Columns and system spare parts plus accessories e Maintenance troubleshooting and FAQ e Technical specifications e Certificates of Analysis for chemical products e Packing and testing columns System and column support Installation and validation Dedicated large scale system and column support services are now available They range from having GE Healthcare BioProcess service engineers deliver and assemble your system perform installation tests and prepare it for operation to help with certifying the system and its operation with IQ OQ services We can also certify upgrades to systems o
56. Oligosynt See Solid supports for oligonucleotide synthesis p 239 Percoll See p 181 Pack size Code No 250 ml 17 0891 02 11 17 0891 01 6x1 17 0891 09 Technical data Composition Silica coated with polyvinylpyrrolidone PVP Particle diameter 15 30 nm Density 1 13 0 005 g ml Conductivity max 100 mS m Osmolality max 25 mOsm kg Viscosity 10 5 cP at 20 C pH 9 0 0 5 at 20 C 226 www gelifesciences com bioprocess Pack size Code No 11 17 5098 03 101 17 5089 05 Regulatory Support File 11 0028 25 Technical data Composition highly cross linked 6 agarose Particle size 100 300 um Ligand phenyl Coupling chemistry epoxy pH stability operational 3 13 CIP stability short term 2 14 1 200 1 800 cm h 100 kPa XK 50 60 column bed height 25 cm Pressure flow spec E Phenyl Sepharose 6 Fast Flow high sub See p 74 75 130 Pack size Code No 25 ml 17 0973 10 200 ml 17 0973 05 11 17 0973 03 5 17 0973 04 101 17 0973 06 601 17 0973 60 Data File 18 1020 53 Regulatory Support File 11 0028 23 Prepacked columns HiTrap HIC Selection Kit 7x1 ml 28 4110 07 HiTrap Phenyl FF high sub 5x1 ml 17 1355 01 HiTrap Phenyl FF high sub 5x5 ml 17 5193 01 HiPrep 16 10 Phenyl FF high sub 17 5095 01 HiScreen Phenyl FF high sub 4 7 ml 0 77 x 10 cm 28 9269 88 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d 50 vol Ligand phenyl 3 13 2 1
57. Operational Qualification 1Q 0Q We can help certify your system and its operation with our 1IQ OQ services GE Healthcare s document packages from FastTrak and qualification services cover CGMP requirements and can include 21 CFR Part 11 verification optional Our engineers are fully trained on the complexities of both hardware and software and are efficient quick and precise Initial certification and annual cGMP training keeps them up to date on the latest cGMP regulations and requirements Change Control Protocols CCPs GE Healthcare can also certify upgrades to your system or UNICORN software in a controlled manner Engineers ensure that the changes are carefully evaluated verified documented and reviewed Parts solutions Critical parts To minimize downtime you should keep a stock of critical parts on site A list of parts to keep in stock can be provided Parts locker If you prefer that we hold a guaranteed stock of critical components on your behalf ask about our Parts locker option For a monthly fee we deliver any designated critical part according to an agreed time frame gt 206 www4elifesciences com bioprocess Service agreements BioProcess chromatography and filtration offerings Depending on your needs Service agreements for BioProcess systems can include e Comprehensive Preventive Maintenance including documentation scheduled according to system requirements Re
58. PP i d 10 25 mm TC i d 14 51 mm TC 18 1027 25 2 PP i d 14 51 mm TC i d 22 51 mm TC 18 1027 26 2 PP i d 22 51 mm TC i d 10 25 mm TC 18 1174 11 1 PP i d 22 51 mm TC i d 14 25 mm TC 18 1174 12 1 PP The kit contains a complete set for a column aterial abbreviations EPDM ethylene propylene diene PP polypropylene PTFE polytetrafluoroethene FineLINE columns The FineLINE range of columns has been developed for use with all SOURCE media The novel hydraulic packing method packs SOURCE in a matter of minutes giving densely packed beds and very high packing efficiencies more than 22 000 plates m with SOURCE 15 and more than 11 000 plates m with SOURCE 30 FineLINE Pilot 35 is well suited for both downscaling from the larger FineLINE columns and upscaling from laboratory RESOURCE and AKTAdesign columns This 35 mm inner diameter column has a tube manufactured from calibrated borosilicate glass FineLINE Pilot 35 can also be run on AkKTAexplorer The larger FineLINE 70 100P 200P and 350P columns are intended for scale up work and small scale production Column tubes are manufactured in electropolished stainless steel and are available in two tube lengths 350 mm and 700 mm FineLINE range e Standard inner diameters of 35 70 100 200 mm and 350P e Optimized for use with all SOURCE media e Proven single inlet outlet distribution with special multilayer bed supports for uniform flow at low back pressures e
59. SS 316 Manometer kit 18 1031 07 18 1031 07 18 1031 07 8 1031 08 8 1031 08 1 Manometer 18 1103 67 18 1103 67 18 1103 67 8 1103 68 8 1103 68 1 SS 316 Castor 18 1001 09 28 9270 79 28 9270 79 28 9270 79 28 9226 77 1 Adjustable foot 18 1126 93 18 1126 93 18 1126 93 Manometer 0 10 bar 11 0011 18 11 0011 18 1 0011 18 1 SS 316 Manometer 0 6 bar E 7 1 0011 19 11 0011 19 1 SS 316 Tubing with sanitary fitting 30 cmi d 6mm 18 0005 42 18 0005 42 18 0005 42 I PVC 30 cm i d 10 mm 8 1012 85 8 1012 85 1 PVC 40 cmi d 10 mm 8 1012 86 8 1012 86 1 PVC 75 cm i d 6 Mmm 18 0005 43 18 0005 43 18 0005 43 1 PVC 75 cm i d 14 mm 8 1027 28 1 PVC 90 cmi d 10 mm 8 1012 62 8 1012 62 1 PVC 125 cm i d 6 mm 18 0005 44 18 0005 44 18 0005 44 1 PVC 140 cm i d 10 mm 8 1012 63 8 1012 63 1 PVC 150 cmi d 6 mm 18 0005 45 18 0005 45 18 0005 45 1 PVC 170 cmi d 10 mm 8 1012 64 8 1012 64 1 PVC 180 cm i d 14 mm 8 1027 29 1 PVC 200 cm i d 6 mm 18 0005 47 18 0005 47 18 0005 47 1 PVC 200 cmi d 10 mm 8 1012 87 8 1012 87 1 PVC 9 Connectors see p 111 112 Pa i d 6 25 mm TC 6 mm 3 hreaded 18 0251 98 18 0251 98 8 0251 98 7 2 PP 2 i d 6 25 mm TC 3 4 20 e UNF threaded 18 1012 67 18 1012 67 8 1012 67 a 2 PP q i d 6 25 mm TC M6 hreaded 28 4057 64 2 PP g i d 6 25 mm TC id 22 51 mm TC 18 1012 69 18 1012 69 18 1012 69 2 PP fe id 10 25 mm TC 3 4
60. Support T 49 89 96281 660 F 49 89 96281 620 GE Healthcare Europe GmbH Munzinger St 5 79111 Freiburg Customer Service T 0800 9080 711 F 0800 9080 712 Email cust orderde ge com Great Britain GE Healthcare UK Ltd Amersham Place Little Chalfont Bucks HP7 9NA UK T 44 1494 544000 F 44 1494 542 010 Email orders gb ge com Italy GE Healthcare Europe GmbH Filiale Italiana Via Galeno 36 I 20126 Milano MI T 39 02 2600 1300 F 39 02 2600 1399 Email orderit ge com Netherlands GE Healthcare Europe GmbH Branch office Benelux Kouterveldstraat 20 B 1831 Diegem BELGIUM T 0800 82 82 821 F 0800 82 82 82 4 Email order bnl ge com Norway GE Healthcare Europe GmbH P O Box 4665 Nydalen 0450 Oslo I 47 815 65 555 F 47 815 65 666 Customer service I 47 815 65 555 Email orderno ge com Technical support T 47 815 65 888 F 47 815 65 666 Email productno ge com Portugal GE Healthcare Europe GmbH Sucursal em Portugal Av Do Forte no 6 6A Edificio Ramazzotti 2790 072 Carnaxide Portugal T 35121417 7035 F 35121417 31 84 Email cust servpt ge com Spain GE Healthcare Europe GmbH Sucursal en Espa a Parc Tecnol gic del Vall s Argenters 4 Edificio 2 1 Planta 08290 Cerdanyola Barcelona T 34 935 944 950 Centralita 34 902 117 265 Pedidos F 34 935 944 965 Email cust serves ge com Sweden GE Healthcare Europe GmbH Filial Sverige
61. The centering plug delivered with the column must be used when assembling the column A tool kit with the necessary tools can be ordered separately Ordering information Literature Column Code No Data File Code No AxiChrom 50 300 28 9018 31 AxiChrom Columns 28 9290 41 AxiChrom 50 500 28 9018 41 Application Note AxiChrom 70 300 28 9018 40 Sanitization of AxiChrom columns 28 9290 42 AxiChrom 70 500 28 9018 47 i For more information contact your local AxiChrom 400 600 800 and 1000 Please contact your GE Healthcare representative or GE Healthcare representative visit www gelifesciences com axichrom Accessories for AxiChrom 50 and AxiChrom 70 Item Qty pk Material Code no USP Class VI Pivot stand 50 70 100 300 EN 1 4401 28 4017 09 N A Pivot stand 50 70 100 500 EN 1 4401 28 4017 10 N A AxiChrom foot 70 PS Polystyrene 28 4019 37 N A Mechanical locking 50 EN 1 4401 28 4018 39 N A Mechanical locking 70 EN 1 4401 28 4018 40 N A Tool kit AxiChrom 50 Wrench mm 5 11 14 Allen key mm 1 5 2 5 4 Torque wrench with socket mm 10 28 4047 77 N A Tool kit AxiChrom 70 Wrench mm 6 16 27 Allen key mm 2 2 5 4 Torque wrench with socket mm 13 28 4047 78 N A Tubing kit AxiChrom 50 AKTAexplorer desk 1 PVDF 28 9055 41 Yes Tubing kit AxiChrom 50 AKTAexplorer floor PVDF 28 9056 03 Yes Tubing kit AxiChrom 50 AKTApilot desk PVDF 28 9056 76 Yes Tubing kit AxiChrom 50 AKTApilot floor PV
62. Very easy and fast to pack e Materials include electropolished stainless steel calibrated borosilicate glass and EPDM e All polymeric materials are approved according to USP Class VI tests for toxicity e Documentation to support validation delivered with the suwnjoo fiydns6bo oWo1yD product Overview of FineLINE columns Tube Cross Bed Bed Bed Bed inner Tube sectional height height vol vol Design diam height area min max min max pressure Column mm mm cm mm mm ml ml bar FineLINE Pilot 35 35 330 10 30 150 29 144 20 FineLINE 70 70 350 38 30 150 115 577 20 FineLINE 70L 70 700 38 50 300 192 1155 20 FineLINE 100P 100 350 79 30 150 236 1178 20 FineLINE 100LP 100 700 79 50 300 393 2355 20 FineLINE 200P 200 350 314 30 150 942 4710 20 FineLINE 200LP 200 700 314 50 300 1570 9420 20 FineLINE 350P 350 350 962 30 150 2884 14424 20 FineLINE 350LP 350 700 962 50 300 4808 28848 20 www gelifesciences com bioprocess 107 Chromatography columns What do need The stand for FineLINE 70 70L and FineLine 100P 100LP has adjustable feet Wheels with brakes are available as an accessory The stand for FineLINE 200P 200LP has wheels with brakes as standard Note For FineLINE 70 100 and 200 columns the stand must be ordered as an optional component Useful spare parts Bed supports Columns are delivered with 2 um nets 10 um nets are also available Seals Order solvent resistant seals O ring
63. agarose assures long media lifetime even if harsh cleaning in place procedures are applied Capto media are now available in a range of convenient formats including PreDictor plates and HiTrap HiScreen and ReadyToProcess columns gt gt For more information see page 68 Velocity cm h 2000 7 1800 4 1600 7 1400 7 1200 7 Sepharose 6 Fast Flow 1000 7 800 7 600 7 400 7 200 7 0 5 10 15 20 25 30 35 40 45 50 Bed height cm Capto media offer a wide range of operating conditions This figure shows the predicted working range the area under and to the left of the curved lines for Capto blue and Sepharose 6 Fast Flow red in combinations of bed heights and flow velocities in a 1 m diameter column The green lines show residence time in the column in minutes Capto DEAE is a weak anion exchanger for capture and New intermediate purification The diethyl aminoethyl groups are linked to a highly rigid agarose matrix modified with dextran surface extenders which further increase capacities and mass transfer properties Capto DEAE has a different selectivity compared to Capto Q and expands the options for process chromatography The following Capto products are available Capto Q DEAE and S e Capto Q a strong anion exchanger for capture and intermediate purification e Capto DEAE a weak anion exchanger for capture and intermediate purification e Capto S a st
64. and 2 each clamps ProCell cartridge and housing accessories Code No Model No 56 4106 77 G12S 56 4106 79 G16S 56 4106 88 G48S 56 4106 67 CL12 56 4106 70 CL16 56 4106 74 CL48 56 4106 96 KO6ORS Description 1 5 in TC gasket silicone 2 in TC gasket silicone 6 in TC schedule 5 pipe gasket silicone 1 5 in TC quick disconnect clamp 304SS 2 in TC quick disconnect clamp 304SS 6 in TC schedule 5 pipe clamp 304SS ProCell cartridge O ring set 2 each silicone ProCell housing physical dimensions Technical specifications Housing Diameter Length Endfitting Permeate size cm in cm in connections connections 152 16 8 66 81 32 2 in TC 1 5 in TC 154 16 8 66 139 55 2 in TC 1 5 in TC Stainless steel housing dimensions Nominal not for design purposes www gelifesciences com bioprocess 153 s npoud uoo Filtration products Steam in place hollow fiber cartridges Steam in place hollow fiber cartridges housings STM style e Strong polysulfone cartridge elements e Leak proof sanitary closure e Available in UF and MF pore sizes Polysulfone cartridge elements have the strength and integrity to withstand the rigors of steam in place operations Cartridges slip into stainless steel housings for safety and containment A double O ring seal at the inlet and outlet of the cartridge element ensures leak proof sanitary closure within the housing The element design allows quick
65. and constructed with industrial grade components that withstand harsh synthesis chemicals UNICORN control allows rapid scale up of methods developed on OligoPilot 400 OligoProcess systems are the world s first validated industrial scale systems for oligonucleotide production They are installed and qualified for GMP production by GE Healthcare personnel Flow through technology The flow through reactor is a feature common to KTA oligopilot plus OligoPilot 400 and OligoProcess synthesizers It is superior to the inefficient batch reactors found in other systems The better efficiency of a flow through reactor is due to the way the coupling mixture behaves The figure illustrates this behavior Coupling mixture is added to the solid support as a reagent zone shown in blue and is pushed through the column as a well defined zone Reagents at the front of this zone are consumed by the coupling reaction at a continuous rate As this zone moves down the reactor new reagents continuously replace those used Smooth liquid distribution ensures that coupling efficiencies remain the same even in different parts of the column This continuous replacement of consumed reagents by new keeps the concentration constant throughout the zone Both the amidite concentration and the reaction rate remain the same throughout the reaction In a batch reactor on the other hand consumed reagents are not replaced Amidite concentration red zone dec
66. and corresponding patents issued in other countries No other license is granted to the purchaser either directly or by implication estoppel or otherwise Patented reagents suitable for use with this instrument are available from licensed sources Tricorn Columns The Tricorn column and components are protected by US design patents USD500856 USD506261 USD500555 USD495060 and their equivalents in other countries VII Select VillSelect incorporates BAC BV s proprietary ligand technology which has been exclusively licensed to GE Healthcare in the field of purification of beta domain depleted recombinant factor VIII Other use of this product may require a separate license from BAC BV Huizerstraatweg 28 1411 GP Naarden The Netherlands www gelifesciences com bioprocess 247 jo6a7 pup saxapu Indexes and Legal Alphabetical index A A Z of media and chemicals Affinity chromatography Affinity media Product application guide AKTAcrossflow system 27 AKTAexplorer KTApilot system KTAprocess 26 KTAready system AKTA oligopilot plus 6 AKS Sepharose 4 Fast Flow 72 87 Amino Sepharose 6 Fast Flow 72 87 Anion exchanger groups ANX Sepharose 4 Fast Flow high sub 69 130 ANX Sepharose 4 Fast Flow low sub 87 Application Notes AVB Sepharose High Performance 72 87 AxiChrom columns 25 92 AXP Autoxpress Platform B Benzamidine Sepharose 4 Fast Flow high sub 72 87 Benzamidine Sepharose 4 Fas
67. and quality control and as support for clinical and marketing applications to regulatory agencies GE Healthcare has over 15 years of experience in providing customers with Regulatory Support Files Change Control Notifications Change control notifications alert subscribers of changes associated with the manufacture of products in accordance with a change control policy GE Healthcare offers this regulatory support online including the following features e Direct access e Email notification of updates e Downloadable files in Adobe Acrobat pdf format e Online subscriptions e Sharing subscriptions with colleagues 36 GE Healthcorn i pi dm inp nir e r ri TEIDE th Foghar Peppar J mpini y Ja E a L Li Lily Scena E cet te et CLEE m at i ii po hemp Pa ap ers OS ao n bT Te de ey a a a ee a a eem tari mer ee ee ia ai oe a T FIRAR APEE AAT bap TIAA H EE A RR HE ap m ari ap amoa M a mimis oll eit Tng i lem eg a Famm a TT iihi Lapi im paika ett aha hiai es ahi i haij Pidan amoa ee oh a ma b E PERN DP IRE R i Td PAE e a AEE Ape oe pe eee ee ee ore oe SY Se Se a ee etme hinan pr embed edt Sy cena ere fe i ort ont cou Ce en vio sim ae maaan mi Tra piara 2 e par a a ee aa r pi oi ee ee eS T a F As some of the information is proprietary Regulatory Support online is available only after signing a Secrecy agreement www gelife
68. autoclavable however autoclavable versions of select housing sizes 35 and 55 are available on special order 150 www gelifesciences com bioprocess MaxCell process scale hollow fiber cartridges MaxCell cartridge ordering information MaxCell cartridges for high volume cross flow bioprocessing applications e Superior processing economies e Streamlined design utilizes space very effectively MaxCell cartridges can be manifolded with spacing as close as 18 cm 7 inches on center for incorporation into a compact membrane separations system System sizing can be accurately scaled from testing laboratory and pilot scale cartridges such as MidGee and Xampler cartridges In addition MaxCell cartridges can be used in place of other manufacturer s cartridges Housing size 45 Membrane fiber Cartridge length Membrane area Code No inner diameter cm in m ft Ultrafiltration Model No NMWC mm 56 4104 67 UFP 3 C 45 3000 0 5 39 4 155 3 5 37 56 4104 68 UFP 5 C 45 5000 0 5 39 4 15 5 3 5 37 56 4104 69 UFP 10 C 45 10 000 0 5 39 4 15 5 3 5 37 56 4104 70 UFP 30 C 45 30 000 0 5 39 4 15 5 3 5 37 Membrane fiber Code No Pore size inner diameter Cartridge length Membrane area Microfiltration Model No um mm mm in m ft 56 4104 71 CFP 1 E 45 0 1 1 39 4 15 5 2 5 27 56 4104 72 CFP 2 E 45 0 2 1 39 4 155 25 27 56 4104 73 CFP 4 E 45 0 45 1 39 4 15 5 a5 27 56 4104 74 CFP 6 D 45 0 65 0 75 39 4 15 5 2 8 30
69. column is to be used for biopharmaceutical production A fixed bed column is more hygienic than the respective variable bed height column but this must be set against the greater flexibility afforded by the variable height Q 4 e 3 Q o Q a Qa me 7 C Q 2 c 3 53 v For media requiring additional bed compression at the e Technical support online The process chromatography end of the packing procedure a variable bed height technical support portal provides users with a column would be needed In process development range of information including column and system diagnostics or reagent manufacturing some design recommendations spare parts and accessories for criteria are less critical and for example the use of columns and systems column packing and testing threaded or sanitary connections may not be as information and troubleshooting guides Refer to important Regulatory and Technical Support Services Select only columns with a proven distribution system since performance can be jeopardized with inadequate distribution of sample and buffer Bed support porosity is dictated by the particle size of the medium used gt gt For further information on Online regulatory and technical support see page 204 gt gt Visit us on the web at www gelifesciences com purification techsupport www gelifesciences com bioprocess 91 Chromatography columns AxiChrom columns New AxiChrom 800 mm column The Ax
70. columns 106 Percoll 181 226 Percoll PLUS 181 226 Phenyl Sepharose 6 Fast Flow ReadyToProcess 61 Phenyl Sepharose 6 Fast Flow high sub 74 75 130 226 Phenyl Sepharose 6 Fast Flow low sub 74 75 130 227 Phenyl Sepharose Big Beads 75 87 226 Phenyl Sepharose High Performance 74 75 130 227 Pilot scale hollow fiber cartridges 147 PlasmidSelect Xtra 24 78 79 130 227 PlasmidSelect Xtra Screening Kit 79 129 130 PlasmidSelect Xtra Starter Kit 79 129 130 Plasminogen Removal Gel 72 87 227 Posters 209 PreDictor 96 well filter plates 23 124 126 Prepacked columns for process development 128 Primer Support 200 194 239 Procainamide Sepharose 4 Fast Flow 72 87 228 ProCell hollow fiber cartridges 153 Process Development services Fast Trak 200 Process scale hollow fiber cartridges 149 Products for process development 122 Product highlights 16 Protein A 20 22 70 71 77 228 Protein G Sepharose 4 Fast Flow 72 229 www gelifesciences com bioprocess 251 jo6a7 pup saxapu Indexes and Legal Q QAE Sephadex A 25 68 230 QAE Sephadex A 50 68 230 Qualification IQ OQ 198 QuixStand systems 166 Q Sepharose Big Beads 68 130 229 Q Sepharose Fast Flow 69 130 229 Q Sepharose High Performance 69 130 230 Q Sepharose XL 69 130 230 Q Sepharose XL virus licensed 69 230 R ReadyMate Connectors 51 ReadyToProcess 18 34 AKTAready system 58 Cellbag disposable bioreactors 18 48 Columns 19 37 60 Capto 61 MabSele
71. combined with high physical stability ensures rapid processing of viscous samples Sepharose Fast Flow Media for capture and intermediate purification Proven in validated large scale production of biopharmaceuticals The excellent flow properties and binding capacities of these media make them especially useful for processing large volumes The range of Fast Flow HIC media covers different selectivities The best choice for each application is difficult to predict and therefore several different media need to be tested to find the best selectivity E Butyl Sepharose 4 Fast Flow The standard aliphatic HIC medium of choice The ligand gives different selectivity compared with phenyl media E Butyl S Sepharose 6 Fast Flow A low hydrohobicity HIC medium for capturing recombinant HBsAg and removing hydrophobic contaminants E Octyl Sepharose 4 Fast Flow Gives different and complementary selectivity compared with phenyl and butyl media E Phenyl Sepharose 6 Fast Flow high sub A high capacity HIC medium with a binding capacity for IgG and HSA up to 30 mg ml at flow velocities of 100 cm h Has proven to be a very efficient capture medium E Phenyl Sepharose 6 Fast Flow low sub The standard HIC medium of choice with an aromatic ligand MI Butyl Sepharose 6 Fast Flow The butyl ligand on the well proven Fast Flow matrix Sepharose High Performance Media for intermediate purification and polishing when high resolution is needed E But
72. control capability in the pharmaceutical and biotechnology industries 118 www gelifesciences com bioprocess Benefits of the CBS DeltaV Standard Control Platform include e Efficient and dedicated control solutions for chromatography purification of proteins A key element of GE Healthcare s offering is its service organization Service agreements ensure rapid service and replacement spare parts delivered within 48 hours minimize expensive downtime gt gt For more information on CBS DeltaV Standard Control Platform see datafile 28 4074 95 e Flexible operation recipe development and assessment e Extensive analytical functions for chromatography data with UNICORN Evaluation e Full integration with existing DeltaV systems e Extensive support e g audit trails for regulatory support compliance UNICORN control UNICORN is the control system for real time control of protein purification unit operations column packing chromatography and filtration from laboratory bench through development to full scale production UNICORN is used world wide in over a thousand laboratories and controls hundreds of process development and production systems UNICORN control system meets the needs of full scale production with manufacturing systems while maintaining the flexibility needed for Built in strategy for all AkTAdesign systems method and process development with the range of syste
73. d 10 mm 900 mm 18 1012 62 1 PVC i d 10 mm 1400 mm 18 1012 63 1 PVC id 10 mm 1700 mm 18 1012 64 1 PVC Literature i d 10 mm 2000 mm 18 1012 87 1 PVC Data File Code No i d 14 mm 750 mm 18 1027 28 1 PVC Chromaflow columns 18 1138 92 i d 14 mm 1800 mm 18 1027 29 1 PVC Application Note Tubing with sanitary fitting 51 mm TC Sanitization of Chromaflow 400 column 18 1118 85 i d 19 mm 900 mm 28 4042 30 2 PVC i d 19 mm 1400 mm 28 4042 35 2 PVC gt Euit bare Documentation to support validation available on Ne o mm 2000 mm eO nOHe 5 e 2 FVC request Contact your local GE Healthcare office i d 19 mm 4000 mm 28 4042 33 2 PVC Clamp gasket 25 mm i d 10 mm 18 1035 79 2 EPDM 25 mm i d 12 mm 18 0200 00 2 EPDM 51 mm i d 22 mm 44 7133 01 5 EPDM 51 mm i d 38 mm 44 0515 01 5 EPDM Clamp 25 mm 18 1001 31 1 SS 304 Clamp 51 mm 44 7134 01 1 SS 304 Blind flange 25 mm incl gasket 18 1001 25 1 SS 304 EPDM Blind flange 51 mm incl gasket 44 7135 01 1 SS 304 EPDM Safety valve 3 bar 51 mm TC 18 5738 01 1 SS 316 EPDM Safety valve 5 bar 51 mm TC 44 5498 97 1 SS 316 EPDM T junction i d 10 mm 2 x 25mm 1x 51 mm TC 18 1003 63 1 SS 316 T junction i d 22 mm 3 x 51 mm TC 44 5509 89 SS 316 Castors assembly kit 400 600 18 1171 51 Castors assembly kit 800 1000 18 1171 52 X Pressure sensor i d 10 mm 25 mm TC 44 0507 02 1 SS 316 Pressure sensor i d 22 mm 51 mm TC 44 0507 03 1 55316 Connectors i d 10 25 mm TC 3 4 20 UNF threaded 18 1012 68 2
74. economy on a wide variety of intermediate and final sterilizing applications ULTA Pure HC cartridge filters are high capacity and fast flowing 174 www gelifesciences com bioprocess The inherent low protein binding properties of the HC membrane minimize product loss due to adsorption The filters have low extractable levels and broad chemical compatibility The membrane is inherently hydrophilic and the filters can be easily and repeatedly integrity tested ULTA Pure HC features include e Optimized membrane configuration allows up to ten times the throughput to blockage e Integral prefilter layer can condense filter trains for greater processing economy e Fully validated and integrity testable membrane for assurance of sterility e Low adsorption of proteins for minimal loss of expensive pharmaceutical product Technical specifications Filtration area Recommended operating conditions 0 54 m 5 8 ft per 250 mm 10 inch module Up to 70 C 158 F continuous operating emperature and higher short term temperatures during CIP Materials of construction Filtration membrane Prefilter Membrane Upstream Support Downstream Support Inner Support Core Outer Protection Cage End Caps Standard O rings Gaskets Polyethersulphone Polyethersulphone Polyester Polyester Polypropylene Polypropylene Nylon Silicone Literature Data file ULTA Pure HC 28 9094 70 For ordering information contact
75. for one copy for back up purposes or as may otherwise be permitted by applicable law vi alter or modify the Software or vii reverse engineer decompile disassemble or create any derivative works based upon the Software except as expressly permitted by law 17 Export control The Buyer undertakes not to re export the Products without the requisite export license from the relevant body of the United Nations or other similar international organization the United States Government the country of origin or the original country of export The requirement to obtain a license may vary depending on the country of destination the end user the end use and other factors Upon request from GEHC the Buyer shall furnish GEHC with copies of all documents relating to such re export 18 Waste Electrical and Electronic Equipment WEEE 18 1 Where the Buyer sells disposes of or otherwise transfers the Equipment to any third party and where this would unreasonably increase the cost of the collection treatment or recycling of the Equipment for GEHC under applicable WEEE legislation Buyer shall be liable to GEHC and indemnify GEHC for such increased costs 18 2 Should the Equipment that Buyer acquires from GEHC be Equipment which is intended to replace on a like for like basis any item of Buyer s existing equipment e g the new Equipment is fulfilling the same function as Buyer s existing equipment Buyer must have clearly indicated to G
76. g ml They are based on a cross linked cotton cellulose matrix and have an average pore size of 30 um The microcarriers are both macroporous and microporous Cells can enter the interior of the microcarrier where they are protected from shear forces generated by the stirrer aeration spin filter or bubbles created through sparging The microporosity facilitates nutrient supply to all sides of the cells Cytopore microcarriers are transparent and easily transported through tubing They can be autoclaved at 121 C for 20 minutes The macroporous structure of Cytopore is clearly seen on an empty microcarrier Application areas Cytopore 1 has a charge density of 1 0 meq g and is designed primarily for the production of recombinant CHO cells in stirred tank cultures Cytopore 2 with a charge density of 1 8 meq g is optimized for truly anchorage dependent cells which require a higher charge capacity for optimal cell growth Cytopore functions well in the final stages of protein production when anchorage dependent cells remain on the microcarriers for prolonged periods of time protected from shear forces Cytopore is suitable for the culture of other shear sensitive cells including some hybridomas insect cells and even some bacteria Cytopore 1 filled with CHO cells Cytoline 1 and 2 Cytoline microcarriers are based on a matrix of polyethylene and silica The polyethylene makes the microcarrier hydrophobic while the silica giv
77. grow a variety of cell types and with different hardware investments or production technology Surface Macroporous Cytodex 1 amp 3 Stirred tank Batch culture Cytopore 1 amp 2 Stirred tank Perfusion culture Our range of microcarrier products includes Cytodex Cytopore Cytoline and their derivatives Quality control The entire line of microcarriers from GE Healthcare is thoroughly quality controlled including a function test on all batches with at least one cell type Certificates of Analysis are available Regulatory Support Files Regulatory Support Files have been prepared for Cytodex Cytopore and Cytoline microcarriers These files contain information to help industrial scale manufacturers validate their own production processes gt gt For more information please visit www gelifesciences com cellcult High Density Macroporous Cytoline 1 amp 2 Fluidized bed Perfusion culture www gelifesciences com cellcult 183 BANJND 9 JBIADIOISI o pan 3 3 8 rs o oc 5 oO fe E Cytodex 1 and 3 Cytodex microcarriers are based on cross linked dextran beads The microporous beads are transparent spherical and hydrated and are substituted with positively charged groups The microcarriers have a mean diameter of 200 um and a density of 1 04 g ml Their small size allows them to be easily transported through tubing Cytodex has been derivati
78. holder is a versatile device that houses Kvick Lab packets and facilitates their use on AKTAcrossflow and on other small scale crossflow systems The holder will support linear cross flow versus pressure drop AP through the range of 0 7 and 4 barg 10 and 60 psig indicating the structural strength of the unit The holder is designed with UMF fittings for direct connection to the GE Healthcare AKTAcrossflow system It also comes with an accessory kit for installation onto systems that use luer stule fittings The Packet amp Holder combination is designed for e Performing crossflow trials in preparation for scale up e Working with filters that have the same flow path lengths and geometries as our larger Kvick cassettes e Applications that require a surface area for processing larger volumes than is practical by using Kvick Start cassettes 50 cm The holder is designed to also hold one Kvick Lab 0 11 m cassette Many Packet applications will involve 200 to 2000 ml of feed material per Packet 100 cm Ordering information Product Code No Model No Qty Kvick Lab packet 5 kD 56 4112 02 UFELAQ005001ST 1 Kvick Lab packet 10 kDselect 56 4112 06 UFELAO010001SE Kvick Lab packet 10K kD 56 4112 04 UFELA0010001ST Kvick Lab packet 30 kD 56 4112 08 UFELA0030001ST Kvick Lab packet 50 kD 56 4112 10 UFELAO050001ST Kvick Lab packet 100 kD 56 4112 14 UFELAO100001ST Packet holder 11 0006 70 KLPHOO1SS
79. information Books Handbook of Process Chromatography Development Manufacturing Validation and Economics Hagel L G Jagschies and G Sofer Academic Press London 2007 ISBN10 0123740231 ISBN13 9780123740236 A completely revised edition of the book first published in 1997 Over the last 10 years the biotechnology and biologics industries have gained extensive knowledge and experience in downstream processing using chromatography and other technologies associated with recovery and purification unit operations Protein Purification Principles High Resolution Methods and Applications 2nd Edition Edited by J C Janson and L Ryd n Wiley Liss New York 1998 ISBN 0 471 1866260 Protein Purification provides coverage of chroma tographic and electrophoretic protein separation and characterization methods Balancing theory procedures and applications it offers professionals and students in biochemistry organic chemistry and analytical chemistry quick access to a wide range of important techniques Ordering information Product Code No Handbook of Process Chromatography A Guide to Optimization Scale up and Validation 2nd Edition 18 1121 56 Protein Purification Principles High Resolution Methods and Applications 2nd Edition 18 1128 68 www gelifesciences com bioprocess 209 Woddns pup asinsas Indexes and Legal A to Z of media and chemicals Glossary o
80. is a strong multimodal anion exchanger belonging to the Capto family of BioProcess media Capto adhere allows for increased productivity and reduced cost with e High capacity and productivity e Removal of contaminants after a Protein A capture step e Allowing for a two step purification process of monoclonal antibodies e New selectivity Capto adhere combines recent base matrix developments with a new innovative ligand chemistry Capto ahere was designed as a scavenger medium with the ability features that resemble those of a weak cation exchanger However in addition to the ionic interactions several other types of interactions are involved including hydrophobic bonding and aromatic interactions High salt tolerance and new selectivity Capto MMC has the ability to bind proteins at high conductivities as demonstrated by dynamic binding capacities of three different proteins under different conductivities io E604 7 fe 5 504 3 8 Q g 40 4 gt z a 2 304 s 6 Q E 20 z 5 Lysozyme e 3 ioa B Lactoglobulin 3 A BSA o Q Q T 7 T f 1 0 10 20 30 40 50 Conductivity mS cm Dynamic binding capacities of Capto MMC at 1 minute residence time for three different proteins ranging from low to high conductivities to selectively remove contaminants such as dimer aggregates host cell proteins and leaked protein A after a Protein A capture step of monoclonal antibodies Capto adhere has a
81. kit PFR if the EPDM O rings supplied with the columns are not compatible with the solvent to be used Spare parts to keep on site A complete set of O rings FineLINE Pilot 35 Complete set of O rings flanging start up extra tubing and connectors Isolating the column after packing We recommend using stainless steel valves 2 or 4 way with i d 6 mm to close off the top and bottom of the column and prevent contamination of the bed For storage purposes the 25 mm blind flanges with clamps and gaskets can be used to seal off the column For FineLINE Pilot 35 an extra SRV 1 valve is inserted to close of the bottom of the column The stop plug for the upper column inlet is supplied with the column 108 www gelifesciences com bioprocess Connecting the column to your system Clamps and gaskets with i d 6 mm are required to connect the 25 mm sanitary flanged inlet outlet to either valves or tubing of the same type Preflanged tubing with i d 6 mm is available from GE Healthcare FineLINE Pilot 35 is delivered with flanged 1 2 mm i d propylene tubing and M6 connectors A separate tubing kit is needed to connect the column to AKTAdesign systems Assembly disassembly of column Standard wrenches are recommended in a non explosive environment In potentially explosive atmospheres only tools and protective equipment specially adapted to that environment should be used for operation and maintenance Note Standard
82. multimodal ligand that may interact with the target molecule in many different ways It contains a quaternary ammonium group and thus has features similar to those of a strong anion exchanger However in addition to the ionic interactions several other types of interactions are involved including hydrophobic bonding and aromatic interactions www gelifesciences com bioprocess 77 Chromatography media Two step process for MAb purification The multimodal functionality of Capto adhere offers features different from more traditional ion exchangers in terms of both the ability to selectively remove contaminants such as host cell proteins leaked Protein A aggregates and viruses after a Protein A Capture step of monoclonal antibodies In addition the ligand of Capto adhere may also offer new selectivities for other types of purification challenges where more traditional ligands have not been successful The downstream purification of monoclonal antibodies has traditionally been performed in three step processes comprising Protein A as a capture step followed by anion exchange cation exchange and HIC steps in different combinations Capto adhere offers the PlasmidSelect Xtra Purified plasmid DNA is required in increasingly larger quantities to meet the emerging requirements for gene therapy and DNA vaccination As both human and veterinary applications are in focus plasmid DNA purity quantity and cost per dose req
83. of excellence that offers a wide range of solutions to life sciences research including novel insights into disease mechanisms development and production of therapeutics detection and characterization of immune responses and purification and characterization of protein therapeutics v a o Q c Q Q 2 7 c wn Biacore systems are designed to meet the high demands for quality performance and regulatory compliance needed for research drug discovery and development manufacturing and quality control Biacore T100 Biacore C Biacore G x P Services e Versatile multi application interaction Designed for concentration analysis e Validation to meet G x P analysis e For GLP GMP regulated working GLP GCP GMP regulations e Software Wizard for simplified processes e 21 CFR Part 11 compliance analysis RED Sn PR NO ff 21 CFR Par Siete lt a gt gt For more information see page 188 www gelifesciences com bioprocess 29 Product highlights Fast Trak BioPharma Services Fast Trak BioPharma Services provides practical support and advice to those developing biotech products especially biopharmaceuticals GE Healthcare gt gt For more information on our 1Q 0Q and other validation services please see page 198 experts plus a network of external specialists help you plan implement and document downstream purification from start up to routine production Fast Trak courses WAV1 New
84. of recombinant DNA products and Superdex 200 prep grade is particularly useful for the separation of monoclonal antibodies from dimers and low molecular weight contaminants e g albumin and transferrin Typical flow velocity is up to 50 cm h and back pressure is typically below 3 bar with a 60 cm bed height All of the Superdex prep grade media are available in prepacked high performance HiLoad 120 ml and 320 ml columns Sephacryl High Resolution Well established high resolution gel filtration for production Sephacryl High Resolution media give high resolution and are very well established in production process and industrial scale applications They are a cost effective alternative to Superdex prep grade media Sephacryl S 100 S 200 and S 300 are available in convenient prepacked HiPrep 120 ml 16 60 and 320 ml 26 60 columns Sepharose Fast Flow Industrial scale separations of very large molecules and virus particles The properties of Sepharose 4 and 6 Fast Flow media make them suitable for industrial scale gel filtration These media are also well established as matrices for affinity chromatography Sephadex G 25 Well established for desalting and buffer exchange Sephadex G 25 media are well established for desalting and buffer exchange in industrial applications These media have a low exclusion limit and separate macromolecules from salts and buffer substances with a minimum of sample dilution Prepacked HiPrep 26 10
85. other regulated environments are medium quantity required based on your current scale scrutinized by regulatory authorities Increasingly keeping bed height constant usually 5 to 20 cm for documentation on materials compliance and adsorptive techniques and 50 to 70 cm for gel filtration toxicological data are requested If the exact diameter is not available choose a wider diameter column the advantage being increased GE Healthcare supports the columns recommended capacity for use in therapeutic manufacturing with hardware product documentation The information in these files e Specifications Particle size size distribution flow rates can save you valuable time when submitting clinical and the solvent used will affect your choice of column As and marketing applications to regulatory authorities In particle size decreases operational pressures increase addition Fast Trak services can support installation and Two different media with the same nominal particle size operational qualifications but with different particle size distributions may have significantly different pressure requirements Solvent systems may restrict the choice of column materials for example plastic or rubber components are unsuitable for use with some organic solvents High salt buffers may dictate the grade or type of metal component such as stainless steel 316L e Design features Proven hygienic design and high quality materials are necessary if the
86. pH stability operational CIP stability short term Pressure flow spec cross linked dextran dry min 90 volume share between 100 300 um wet in 0 15 M NaCl 75 510 um 1x10 5x10 2 13 2513 480 660 cm h pressure drop cm H 0 bed height 2 bed height 30 cm 2 6 cm i d 232 www gelifesciences com bioprocess Pack size Code No 100g 17 0032 01 500 g 17 0032 02 5kg 17 0032 03 Data File 18 1115 79 Regulatory Support File 11 0028 38 Prepacked columns HiPrep 26 10 Desalting 1x53 ml 17 5087 01 HiPrep 26 10 Desalting 4x53 ml 17 5087 02 Technical data Composition Particle size Typical flow rate Fractionation range globular proteins pH stability operational CIP stability short term Pressure flow spec cross linked dextran dry min 80 volume share between 20 80 um wet in 0 15 M NaCl 20 130 um 150 cm h 1x10 5x10 2 13 2 13 47 68 cm h pressure drop cm H O bed height 2 bed height 30 cm 2 6 cm i d E Sephadex G 25 Superfine See p 84 85 Sepharose 4B Pack size Code No Pack size Code No 100g 17 0031 01 1l 17 0120 01 500 g 17 0031 02 10 17 0120 05 5 kg 17 0031 03 Regulatory Support File 11 0028 39 Data File 18 1115 79 Technical data Regulatory Support File 11 0028 38 Composition 4 agarose Prepacked columns Particle size 45 165 um HiTrap Desalting 5x5 ml 17 1408 01 Fractionation range HiTrap Desalting 100x5 ml 11 0003 29 Jlobular proteins 6x10 2x
87. pilot and small scale production processes with volumes of 500 ml to 100 Process cassettes are for pilot and production facilities with starting volumes of 50 liters or greater 160 www gelifesciences com bioprocess Kvick Lab packet and Kvick Lab packet holder Kvick Lab packet The Kvick Lab packet is the smallest filtration device in the line of Kvick Lab and Kvick Flow ultrafiltration UF cassettes from GE Healthcare The Kvick Lab packet is intended for the concentration and diafiltration of small process volumes ranging from approximately 50 to 2000 ml Kvick cassettes are constructed of identical materials and have identical flow path geometries to ensure performance scalability and reproducibility across the full product range Kvick Lab packets are specifically designed for use by process development engineers who are interested in developing process parameters for an ultrafiltration step that will be transitioned to full manufacturing scale The packet is well suited to experimentation that will yield concentration and diafiltration process settings for downstream purification of biotechnology products Kvick Lab packets are simple to use and effective for laboratory scientists with a need for rapid ultrafiltration of biomolecules Kvick Lab packet holder The Kvick Lab packet holder is the latest in the GE Healthcare line of design in tools for crossflow applications involving Kvick cassettes The Kvick Lab packet
88. probes dip tubes screw cap ports temperature ports perfusion filters and special tubing ports Cell Culture Bag in Switzerland Reproduced with kind permission of Pacifi cGMP USA www gelifesciences com readytoprocess The Cellbag size you need depends on the culture volume you wish to cultivate cell Culture Bag in Switzerland nie ae Selection guide Cellbag Outlet air filter Cellbag Culture System System System System Oxywell2 volume 2 10 20 50 200 500 1000 Kit 20 Kit 50 Kit500 Kit 1000 Cellbag 500 ml 50 to 250 ml e Cellbag 1 50 to 500 ml e DETA Cellbag 2 100to1000mi Spas ener Cellbag 10 500 ml to 5 e e eee optonapHprbe Cellbag 201 1 to 101 o Cellbag 22 1to101 e Cellbag 50 5 to 251 Cellbag 100 5 to 501 e a Cellbag 2001 10 to 1001 e bt Cellbag 500 50 to 2501 Cellbag 1000 100 to 500 e 9 P wn Technical specifications Ordering information Typical connectors e Air inlet 0 2 um gas filter Product Quantity Code No e Air outlet 0 2 um gas filter with check valve Cellbag 500 ml 1 CB500ML10 01 e Sampling Needleless self sealing syringe port Cellbag 1 1 CBO001L10 01 No laminar hood required Cellbag 2 1 CB0002L10 01 e Fill harvest C Flex tubing suitable for sterile fusing Cellbag 2 includes 20 g FibraCel 1 CBO002L10 07 erminated with Lue
89. productivity in the process development lab by e reducing experimental time the time scale for performing screening experiments can be reduced from weeks to hours e lowering sample consumption the amount of sample required for these experiments is significantly lower than for column experiments e increasing process understanding the ability to screen a large experimental space leads to an increase in process understanding and in the potential to design a robust process early in development 1804 e pH4 25 e pH475 e pH5 25 160 4 140 4 120 4 100 80 60 Binding capacity mg ml 40 204 0 T I l 0 0 05 0 1 0 15 0 2 lonic strength M 1605 e pH4 25 e pH475 e pH5 25 140 4 120 100 80 60 40 Dynamic binding capacity mg ml 20 4 0 0 05 0 1 0 15 0 2 lonic strength M Determination of loading conditions for conalbumin on Capto S A binding capacities at 60 minutes in PreDictor Capto S plates 2 ul Error bars represent one standard deviation based on triplicates B dynamic binding capacities DBC at 10 breakthrough for conalbumin on Capto S Residence time 2 minutes column Tricorn 5 100 CV 2 ml HiScreen columns HiScreen columns are prepacked with 13 different BioProcess media designed for method optimization and parameter screening in process development The 10 cm bed heigh
90. psig 50 C 80 C 2 4 barg 35 psig 0 65 um 0 7 barg 10 psig 50 750 kD lt 10 C 3 4 barg 50 p 10 C 25 C 3 1 barg 25 C 50 C 2 4 barg 50 C 80 C 1 7 barg sig 45 psig 35 psig 25 psig Technical specifications Model Cartridge diameter 3M 3X2M 0 9 cm 0 375 in 4M 4X2M 1 9 cm 0 75 in 5 6 3 2 cm 1 25 in 8 9 5 1 cm 2 in Model Cartridge length 3M 31 7 cm 12 5 in 3X2M 63 5 cm 25 in 4M 34 5 cm 13 6 cm 4X2M 66 cm 26 in 5 31 8 cm 12 5 in 6 63 5 cm 25 0 in 8 34 9 cm 13 75 in 9 63 5 cm 25 0 in Model Path length 3M 4M 5 8 30 cm 12 in 3X2M 4X2M 6 9 60 cm 24 in Model Feed retentate connections 3M 3X2M 4M 4X2M 0 5 in tri clamp 5 6 8 9 1 5 in tri clamp Model Permeate connections 3M 3X2M 0 25 in tubing nipple 4M 4X2M 0 375 in tubing nipple 5 6 8 9 0 5 in tubing nipple Materials of construction Hollow fibers Housing components Potting Support net all cartridge sizes Support net 5 6 8 9 Fitting caps Regulatory conformance Polysulfone Polysulfone Epoxy Polypropylene Polyethylene Polyethylene Vinyl USP lt 88 gt Class VI EMEA 410 01 Compliant Compliant www gelifescie nces com readytoprocess 55 ssa00ig0 fippay ReadyToProcess Ordering information ReadyToProcess Hollow Fiber ultrafiltration cartridges Code N
91. sheet cassettes and hollow fibers A wide range of cross flow devices include MidGee hollow fiber cross flow cartridges and Kvick Start flat sheet cassettes The cassettes require small working volumes and are well suited for ultrafiltration and diafiltration process development The cassettes have a surface are of 50 cm and can be combined for a total surface area of 150 cm Automated cross flow filtration for process development e Broad range of applications that cover ultrafiltration and microfiltration e Flexible operation of either hollow fiber cartridges or cross flow cassettes e Thorough and efficient process development with full TMP and flux scouting e Single familiar UNICORN interface for both chromatography and membrane separations e No disruption to proteins or cells with low shear force pumps that require no cooling e Minimum working volume of 25 ml ensures operation of complete processes using filters between 40 cm and 150 cm e Supported with hardware product documentation to simplify validation e Well suited for small scale processing of material for protein or clinical studies Membrane separations are normally used to concentrate and wash feed prior to chromatography AKTAcrossflow is a fully automated system for cross flow filtration ultrafiltration diafiltration and cell separation during process development and optimization The benchtop system is compact and has a sanitary design with changeable wette
92. shrinking profit margins For gt gt For more information on how corporations it is critical to reduce costs while improving scientific productivity GE Healthcare Scientific Asset To help with these challenges GE Healthcare offers an array of services Services can help your company including the Scientific Asset Services asset management program Performance visit www gelifesciences com sas Solutions LEAN Six Sigma Fast Trak process development and facility validation services Scientific Asset Services SAS is helping leading companies around the world meet the challenges of controlling costs and improving productivity in a difficult business environment Our SAS program can help companies e Reduce operating costs by up to 20 through the implementation of an asset management program e Deploy on site service engineers to improve instrument uptime and output e Apply LEAN Six Sigma to operations to enhance productivity e Remove administrative tasks from your scientists to allow increased scientific productivity e Gain access to innovative financing solutions 32 www4gelifesciences com bioprocess Cell preparation and processing Building on over 30 years experience in the field GE Healthcare supports cell based research and therapy by providing quality tools that facilitate the preparation processing and storage of blood derived cells Ficoll Paque PREMIUM 1 084 and New Ficoll Paque PREMIUM 1 073 F
93. technique does not affect their receptors or genetic make up e The method is fast and allows you to work with large volumes New Ficoll Paque PREMIUM 1 084 and Ficoll Paque PREMIUM 1 073 are complementary products to Ficoll Paque PREMIUM density gradient medium Manufactured according to the same GMP and ISO 13485 2003 standards as the original Ficoll Paque PREMIUM product they have densities of 1 084 and 1 073 g ml respectively As with all Ficoll Paque products endotoxin levels are kept very low lt 0 12 EU ml Ficoll Paque PREMIUM 1 084 can be used for isolating a broad range of human mononuclear cells including those of higher density as well as mouse lymphocytes and Ficoll Paque PREMIUM 1 073 is recommended when mononuclear cells of lower density are to be isolated www gelifesciences com cellprep Ficoll Paque PREMIUM Ficoll Paque PREMIUM is based on Ficoll Paque PLUS which has a proven track record as a sterile density medium for the isolation of high yields of mononuclear cells from bone marrow peripheral blood and umbilical cord blood Ficoll Paque PREMIUM differs from Ficoll Paque PLUS in that it is manufactured in a strictly controlled environment compliant with ISO 13485 2003 and in accordance with GMP Good Manufacturing Practice guidelines and the recommendations of the United States Pharmacopeia for the manufacture of cell therapy products ISO 13485 and GMP compliance requires stringency in validatio
94. up In addition to laboratory scale cross flow devices and systems GE Healthcare also offers a complete range of products for biopharmaceutical scale up to pilot and production operations Hollow fiber ultrafiltration and microfiltration products are supplied as 25 different self contained cartridge designs ranging from 16 cm to 28 m of effective membrane area iat P 142 www gelifesciences com bioprocess MidGee MidGee Hoop and Xampler scale hollow fiber cartridges can be optimized in larger processes by using pilot scale cartridges process scale cartridges Steam in place hollow fiber cartridge elements for pharmaceutical manufacturing are also available For complete systems offerings for hollow fiber cartridges see MidJet QuixStand FlexStand or GrandStand Like cartridges Kvick Cassette offerings provide scalability from laboratory through pilot to production scale Both Kvick Lab System and Kvick Flow System benefit from a design and engineering approach usually reserved for large scale production equipment Automated cross flow systems are available for hollow fiber and Kvick cassettes at laboratory scale as AKTAcrossflow and at pilot production scale as UniFlux Cross flow filtration Hollow fiber cartridges Start AXM AXH cross flow cartridges Hollow fiber Start AXM and Start AXH cross flow cartridges e Rapid concentration and or diafiltration of biological solutions and suspensions using an
95. wealth of literature available from GE Healthcare and most of it is free These include our product Data Files Application Notes well known chromatography handbooks as well as Upstream and Downstream our magazine for bioprocessors Most of these can be found in Acrobat pdf file format on our web site www gelifesciences com bioprocess In addition we can help you with reference lists and reprints of articles and scientific posters Contact us through your local GE Healthcare office or via the web site We look forward to hearing from you Upstream and Downstream With the acquisition of WAVE Biotech GE Healthcare is better able to support the upstream side of bioprocessing To reflect this our customer magazine will cover a range of topics from cell culture and fermentation through downstream processing Hence the change of name to Upstream and Downstream Ordering information Code No Upstream and Downstream 1 28 9324 58 Vaccines Supplement 28 9324 60 Downstream 41 28 9179 38 Downstream 40 28 9022 57 Downstream 39 28 4021 59 Downstream 38 11 1112 70 i gt Downstream 37 11 0008 46 Vaccines Downstream 36 18 1171 05 Downstream 35 18 1161 89 Downstream 34 18 1159 24 o Downstream 33 18 1150 32 Technique handbooks These handbooks are designed as an introduction to the principles behind each technique and as a practical guide to the selection he ye and use of the products availab
96. wrenches are not supplied with the column except for FineLINE Pilot 35 Useful column accessories Pressure gauge We recommend fitting a pressure gauge capable of measuring a negative pressure of 1 bar at the top mobile phase connection to indicate the pressure in the column This monitors the operating pressure and ensures that the correct axial compression packing pressure is set when packing the column Pressure relief valve Required for the packing procedure It is connected between the pump and the hydraulic inlet to ensure flow delivery at constant pressure A suitable pressure relief valve designated RL4 is available Note The valve is not supplied with the column and should therefore be ordered separately As the pressure relief valve is just required when packing the column only one valve will generally be needed irrespective of the number of columns in use A manometer is seldom needed for FineLINE Pilot 35 since the pressure relief valve is preset to 10 bar Ordering information Column Code No FineLINE Pilot 35 18 1102 02 Pressure Relief Valve 18 1110 90 FineLINE 70 18 1152 98 FineLINE 70L 18 1152 99 FineLINE 100P 11 0027 98 FineLINE 100LP 11 0027 99 Stand 100 18 1031 10 FineLINE 200P 1 0031 14 FineLINE 200LP 1 0031 15 Stand 200 8 1031 20 Pressure Relief Valve 8 1105 36 FineLINE 350P EPDM 2 um 1 0027 90 FineLINE 350P EPDM 10 um 1 0027 91 FineLINE 350P PFR 2 um 1 0027 9
97. your local GE Healthcare office Protein synthesis factors Heparin Sepharose 6 Fast Flow nitiation factors elongation factors EF 1 Hormones and hormone receptors Con A Sepharose 4B Heparin Sepharose 6 Fast Flow Follicle stimulating Oestrogen and androgen receptors Coagulation proteins Heparin Sepharose 6 Fast Flow Heparin Sepharose 6 Fast Flow Antithrombin Ill Factors IX X XI XII XIIa prothrombin thrombin m Chelating Sepharose Fast Flow Factor IX Nucleic acids ECH Lysine Sepharose 4 Fast Flow Ribosomal RNA double stranded DNA Polysaccharides and glycoproteins Con A Sepharose 4B Lentil Lectin Sepharose 4B a D Glucosyl a D mannosy a D Glucosyl a D mannosy Membrane proteins Lentil Lectin Sepharose 4B Con A Sepharose 4B a D Glucosyl a D mannosy a D Glucosyl a D mannosul Lipoproteins Heparin Sepharose 6 Fast Flow Con A Sepharose 4B a lipoprotein low density lipoprotein Enzymes Heparin Sepharose 6 Fast Flow Blue Sepharose 6 Fast Flow Restriction endonucleases DNA ligase DNAand RNA polymerases nucleic acid binding broad range of nucleotide requiring enzymes Protease binding Benzamidine Sepharose 4 Fast Flow high sub Trypsin urokinase prekallikrein kallikrein Other E BioProcess Media Con A Sepharose 4B Blue Sepharose 6 Fast Flow Chelating Sepharose Fast Flow Gelatin Sephar
98. 0 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 60 Note All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes www gelifesciences com bioprocess Process scale hollow fiber cartridges Process scale hollow fiber cartridges offered by GE Healthcare are provided in eight basic configurations covering a membrane area range of 0 92 to 28 m 9 9 to 300 ft depending on the fiber internal diameter All of these process scale cartridges feature sanitary connections for both the feed retentate and permeate ports Use of this industry standard makes for easy connections to tanks pumps manifolds and instrumentation GE Healthcare GrandStand systems are cart mounted units designed to accommodate the full range of ultrafiltration and microfiltration process scale cartridges offered by the company The various GrandStand configurations are capable of concentration and or diafiltration of solution volume ranging from 50 to 1000 liters or more Ordering information for process scale microfiltration cartridges Code number Model number Pore size Fiber ID Membrane area Nominal flowpath um mm m ft length cm 56 4103 30 CFP 1 D 35A 0 1 0 75 1 10 8 30 a 56 4103 31 CFP 1 E 35A 0 1 al 0 92 9 9 30 e 56 4103 32 CFP 2 E 35A 0 2 1 0 92 9 9 30 o 56 4103 33 CFP 4 E 35A 0 45 al 0 92 9 9 30 o 56 4103 34 CFP 6 D 35A 0 65 0 75 T 10 8 30 a 56 4103 69 CFP 1 D 5
99. 0 SP XL 20 ml 17 5093 01 Regulatory Support File 11 0028 55 HiTrap SP XL 5x1 ml 17 5160 01 Prepacked columns HiTrap SP XL 5x5 ml 17 5161 01 HiPrep 16 10 SP FF 20 ml 17 5192 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 HiTrap SP FF 5x1 ml 17 5054 01 Technical data HiTrap SP FF 5x5 ml 17 5157 01 Composition cross linked 6 agarose with dextran HiTrap IEX Selection Kit 7x1 ml 17 6002 33 coating Technical data Particle size 45 165 um Composition highly cross linked 6 agarose Binding capacity gt 160 mg lysozyme ml medium Particlesize 45 165 um lon capacity 0 18 0 25 mmol H ml medium Binding capacity lon capacity pH stability operational CIP stability short term Pressure flow spec 120 mg BSA ml drained medium 0 18 0 25 mmol H ml medium 4 13 3 14 400 700 cm h 100 kPa XK 50 30 column bed height 15 cm E SP Sepharose High Performance See p 69 130 Pack size Code No 75 ml 17 1087 01 1l 17 1087 03 5l 17 1087 04 101 17 1087 05 60 17 1087 08 Data File 18 1172 88 Regulatory Support File 11 0028 56 Prepacked columns HiLoad 16 10 SP Sepharose High Performance 20ml 17 1137 01 HiLoad 26 10 SP Sepharose High Performance 53 ml 17 1138 01 HiTrap SP HP 5x1 ml 17 1151 01 HiTrap SP HP 5x5 ml 17 1152 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 Technical data Composition Particle size Binding capacity lon capacity pH stability operational CIP stability short term Pressure flow spec hi
100. 00 SP4 or later and Windows XP Professional SP1 or later Ordering information Please contact your local GE Healthcare sales office Literature Data File Code No UNICORN control system 18 1156 35 Validation support and service 18 1104 73 Validation Support File UNICORN 5 1 11 0029 16 Information on OPC based integration Application Note DeltaV integration 04 0021 64 iFix integration 04 0030 58 MS SQL Server integration 04 0030 59 InTouch integration 04 0030 60 Data File OPC 11 0004 15 Manual OPC 04 0023 04 DeltaV is a trademark owned by Fisher Rosemount Systems Inc UNICORN network allows sharing of systems and a central location for data storage www gelifesciences com bioprocess 121 swaysfis iydpiboywoiyD Products for process development High Throughput Process Development 125 PreDictor 96 well filter plates 126 HiScreen columns 2 Prepacked columns 128 Selection kits 130 Custom packed columns 131 KTAexplorer 132 AKTApilot IBS Fraction Collector Frac 950 134 Process development Products for process development GE Healthcare supports all stages of the drug development process from early discovery to the development of clinical material and the final transfer to full scale production Process development the design and scale up of a process for clinical production is supported by numerous products and services High throughp
101. 0100 050 ST 0 46 5 100 000 1 i 56 4113 37 UFEFL 0005 250 ST 2 33 25 5000 1 56 4113 39 UFEFL 0010 250 SE 2 53 25 10 000 1 56 4113 38 UFEFL 0010 250 ST 2 33 25 10 000 1 56 4113 40 UFEFL 0030 250 ST 2 53 25 30 000 1 56 4113 41 UFEFL 0050 250 ST 2 33 25 50 000 1 56 4113 43 UFEFL 0100 250 ST 2 53 25 100 000 1 10 kD Select membrane is a tighter 10 kD membrane Kvick Flow cassette specifications Kvick Flow cassettes are for batch sizes with 5 to 1000 liter Fits the following holders GE Healthcare Kvick Flow holder and sta rting volumes other industry standard holders i Materials of construction Membrane Polyethersulfone e Precise reproducibly selective membranes Screen Polypropylene e Minimum hold up volume and maximum product Encapsulant Sili one recovery Housing l Polyethersulfone Preservative solution 0 1 0 2 N NaOH and 20 22 glycerine e Low extractables Hold up volume 1 ft 20 ml per cassette e PES polyethersulfone membrane resists a wide range of 5 ft 30 ml per cassette chemicals 25 ft 150 ml per cassette e Anti dead space technology e 100 integrity tested on delivery Recommended operating conditions e Macrovoid free membrane structure for superior pH range long term Storage 2 13 performance pH range short term Cleaning 1 14 e Consistent fluid path for linear scale up SERPS a are i Maximum inlet pressure 4 barg 60 psig e USP 24 Biologicals Test for Plastics Class VI complia
102. 1 0 mm lumen size 3M autoclavable CFP 4 E 3MA 1 56 4101 43 Xampler Cartridge 0 65 micron 0 75 mm lumen size 3M autoclavable CFP 6 D 3MA 1 56 4101 44 Xampler Cartridge 100kD 0 5 mm lumen size 3M autoclavable UFP 100 C 3MA 1 56 4101 33 Xampler Cartridge 10kD 1 0 mm lumen size 3M autoclavable UFP 10 E 3MA 1 56 4101 28 Xampler Cartridge 1kD 0 5 mm lumen size 3M UFP 1 C 3M 1 56 4101 20 Xampler Cartridge 300kD 0 5 mm lumen size 3M autoclavable UFP 300 C 3MA 1 56 4101 35 Xampler Cartridge 30kD 1 0 mm lumen size 3M autoclavable UFP 30 E 3MA 1 56 4101 30 Xampler Cartridge 3kD 0 5 mm lumen size 3M autoclavable UFP 3 C 3MA 1 56 4101 22 Xampler Cartridge 3kD 0 5 mm lumen size 3M autoclavable UFP 3 C 3X2MA 1 56 4101 45 Xampler Cartridge 3kD 1 0 mm lumen size 3M autoclavable UFP 3 E 3MA 1 56 4101 23 Xampler Cartridge 500kD 0 5 mm lumen size 3M autoclavable UFP 500 C 3MA 1 56 4101 37 Xampler Cartridge 50kD 1 0 mm lumen size 3M autoclavable UFP 50 E 3MA 1 56 4101 32 Xampler Cartridge 5kD 0 5 mm lumen size 3M autoclavable UFP 5 C 3MA 1 56 4101 24 This table shows examples of Xampler cartridges currently available For complete product lists and ordering information please contact your local GE Healthcare representative Technical specifications Xampler Cross Flow Cartridges Diameter 3M 3X2M 4 4M 4X2M Length 3 3X2M 4 4 4X2M Endfitting connections 3M 3
103. 1 to 500 liters and are designed for cGMP applications including inoculum production as well as clinical and commercial production of human therapeutics Cellbag disposable bioreactors Cellbag bioreactors are presterilized and disposable requiring no cleaning or validation and eliminating the risk of cross contamination The bags are manufactured from multi layer laminated clear plastic films designed to provide mechanical strength and bioinert fluid contact Cell Culture Bag in Switzerland ReadyToProcess connectivity gt gt For more information on the new range of WAVE systems see pages 38 gt gt For more information on Cellbag disposable bioreactors see pages 48 Connectivity is an important component of GE Healthcare s ReadyToProcess manufacturing solutions Our systems and components can be linked with a set of integrated devices including ReadyMate Disposable Aseptic Connectors Hot Lips Tube Sealer and Sterile Tube Fuser These products provide aseptic connectivity are simple to use and are suitable for a wide range of fluid transfer applications ReadyToProcess connectivity provides e Simple rapid connection solutions e Sterility throughout the process e Seamless connections between ReadyToProcess systems and components 18 www gelifesciences com bioprocess gt gt For further information on ReadyToProcess Connectivity see page 50 ReadyToProcess filtration produ
104. 10 Technical data Composition cross linked dextran Particle size dry min 80 volume share between 20 50 um wet in 0 15 M NaCl 15 100 um Typical flow rate 100 cm h Fractionation range globular proteins 1x103 5x10 pH stability operational 2 13 CIP stability short term 2 13 Pressure flow spec 11 26 cm h pressure drop cm H O bed height 2 bed height 30 cm 2 6 cm i d Special pack size delivered on specific customer order Sephadex LH 20 See p 84 Pack size Code No 25g 17 0090 10 100 g 17 0090 01 500 g 17 0090 02 5 kg 17 0090 03 Data File 18 1107 22 Regulatory Support File 11 0029 00 Technical data Composition hydroxypropylated cross linked dextran based on Sephadex G 25 Particle size dry min 85 volume share between 30 100 um wet in methanol 25 165 um pH stability operational 2 13 CIP stability short term 2 13 Pressure flow spec 25 45 cm h pressure drop cm H O bed height 2 bed height 30 cm 2 6 cm i d pH stability operational 4 9 CIP stability short term 4 9 70 140 cm h pressure drop cm H O bed height 15 bed height 10 cm column 5 cm i d Pressure flow spec Sepharose 6B Pack size Code No 1l 17 0110 01 101 17 0110 05 Regulatory Support File 11 0028 39 Technical data Composition 6 agarose Particle size 45 165 um Fractionation range globular proteins 1x104 4x108 pH stability operational 4 9 CIP stability s
105. 10 cm E SOURCE 15RPC See p 81 Pack size Code No E SOURCE 150 See p 67 69 10 ml 17 0727 20 Pack size Code No 200ml 17 0727 02 10 ml 17 0947 20 500ml 17 0727 03 50 ml 17 0947 01 1l 17 0727 04 200 ml 17 0947 05 5l 17 0727 05 500 ml 17 0947 02 Data File 18 1123 50 1l 17 0947 03 Regulatory Support File 11 0028 49 Data File 18 1123 65 Prepacked columns Regulatory Support File 11 0028 51 RESOURCE RPC 1 ml 17 1181 01 Prepacked columns RESOURCE RPC 3 ml 17 1182 01 RESOURCE Q 1 ml 17 1177 01 SOURCE 15 RPC ST 4 6 100 17 5068 01 RESOURCE Q 6 ml 17 1179 01 Data File 18 1123 50 SOURCE 15Q 4 6 100 PE 17 5181 01 Technical data Data File 18 1123 65 Composition polystyrene divinylbenzene Technical data Particle size 15 um monosized lon exchanger type Composition Particle size Binding capacity Typical flow rate pH stability operational CIP stability short term Pressure flow spec Quaternary ammonium strong anion exchanger polystyrene divinylbenzene 15 um monosized 45 mg BSA ml drained medium 150 900 cm h 2 12 1 14 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm Binding capacity Typical flow rate pH stability operational CIP stability short term Pressure flow spec 10 mg BSA ml medium at 300 cm h 30 mg bacitracin ml medium at 300 cm h 50 mg insulin ml medium at 300 cm h 150 900 cm h 1 12 1 14 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm www gel
106. 1020 66 Regulatory Support File 11 0028 30 Prepacked columns HiTrap Q FF 5x1 ml 17 5053 01 HiTrap Q FF 5x5 ml 17 5156 01 HiPrep 16 10 Q FF 17 5190 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 Technical data Composition Particle size Binding capacity lon capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 6 agarose 45 165 um 120 mg HSA ml drained medium 0 18 0 24 mmol Cl ml medium 2 12 2 14 400 700 cm h 100 kPa XK 50 30 column bed height 15 cm www gelifesciences com bioprocess 229 jo6a7 pup saxapu Indexes and Legal E Q Sepharose High Performance See p 69 130 E Q Sepharose XL virus licensed See p 69 Pack size Code No Pack size Code No 75 ml 17 1014 01 25ml 17 5437 10 11 17 1014 03 300ml 17 5437 01 5 17 1014 04 1l 17 5437 03 101 17 1014 05 5l 17 5437 04 Data File 18 1172 88 Regulatory Support File 11 0028 33 Regulatory Support File 11 0028 31 Technical data Prepacked columns Composition cross linked 6 agarose with dextran HiLoad 16 10 Q Sepharose High Performance 20m 17 1064 01 coating HiLoad 26 10 Q Sepharose High Performance 53ml 17 1066 01 Particle size 45 165 um HiTrap Q HP 5x1 ml 7 1153 01 Binding capacity gt 130 mg bovine serum albumin ml HiT HP 5x5 ml 17 1154 01 none ee palin ine HRD lon capacity 0 18 0 26 mmol Cl ml medium HiTrap IEX Selection Kit 7x1 ml 17 6002 33 i F pH stability operational 2 12 Technic
107. 120m 17 1166 01 HiScreen MabSelect WET 1x47 ml 28 9269 73 oe r ae ah ai 1 x a m a RS iPre ephacryl S x m HiScreen MabSelect Xtra MEY oo pce rA 26 60 Shadi S 200HR 1x 320m 17 1195 01 hitrap Mabseect Sune r cee HiPrep 26 60 Sephacryl S 300HR 1x 320m 17 1196 01 HiTrap MabSelect SuRe 1x5m 11 0034 94 HiTrap MabSelect SuRe 5x5m 11 0034 95 o i i r 2 rder online at www gelifesciences com orderonline HiTrap MabSelec 5x1im 28 4082 53 HiTrap MabSelec 1x5m 28 4082 55 HiTrap MabSelec 5x5m 28 4082 56 HiTrap MabSelect Xtra 5x1m 28 4082 58 HiTrap MabSelect Xtra 1x5m 28 4082 60 HiTrap MabSelect Xtra 5x5m 28 4082 61 HiTrap rProtein A FF 2x1lm 17 5079 02 HiTrap rProtein A FF 5x1lm 17 5079 01 HiTrap rProtein A FF 1x5m 17 5080 01 HiTrap rProtein A FF 5x5m 17 5080 02 Order online at www gelifesciences com orderonline Hydrophobic interaction chromatography columns for AKTAdesign systems Ordering information Ordering information Product Quantity Code No Product Quantity Code No HiScreen Butyl FF WET 1x47 ml 28 9269 84 HiTrap Phenyl FF low sub 5x1ml 17 1353 01 HiScreen Butyl S FF WET 1x47 ml 28 9269 85 HiTrap Phenyl FF low sub 5x5ml 17 5194 01 HiScreen Octyl FF WET 1x47 ml 28 9269 86 HiTrap Phenyl HP Sximl 17 1351 01 HiScreen Phenyl FF high sub WET 1x47 ml 28 9269 88 HiTrap Phenyl HP 5x5ml 17 5195 01 HiScreen Phenyl FF low sub ET 1x47 ml 2873267793 Order online at www gelifesciences com orderonline HiPrep 16 10 Butyl
108. 15 63 Kit 500EH for Base 500 1000EH includes HOLDER500 and HEATERPAD500 1 28 4115 31 Kit 1000EH for Base 500 1000EH includes HOLDER1000 and HEATERPAD1000 1 28 4115 32 Key CO CO air gas mix controller O O air gas mix controller DO Dissolved The WAVE Bioreactor System 500 1000 is designed for R amp D process development and cGMP production use The system is self contained with integrated temperature control aeration pump and rocking controller for use with working culture volumes between 50 and 500 liters Features of the system include e Stainless steel construction with linear motor rocking system e Integrated temperature controller e Integrated Loadcell with adjustable color touchpanel operator interface e Aeration controller oxygen monitor optical PH pH controller ANALOG Analog output card 1 Accomodates 1 x 500 Cellbag only 2 Accomodates 1 x 1000 Cellbag only Technical specifications Base Dimensions e 201 x 124 x 160 cm With Kit 500EH installed e 226 x 124 x 160 cm With Kit 1000EH installed e 226 x 231 x 160 cm Power e 200 240 VAC e 50 60 Hz e 30A e 3 phase operation e Phase phase 5 e NEMA L2130 plug Weight With Kit 500EH e 925kg With Kit 1000EH e 1020 kg gt gt For information on Cellbags for use with WAVE 500 1000 systems see page 48 gt gt Visit us on the web at www gelifesciences com wave Cell Culture Bag in Switzer
109. 17 5272 03 101 17 5272 05 Regulatory Support File 11 0028 12 Technical data Composition highly cross linked 6 agarose Particle size 100 300 um Coupling chemistry epoxy Ligand imino diacetic acid 41 51 umol Cu2 ml packed medium 3 13 3 14 1200 1800 cm h 100 kPa XK 50 60 column bed height 25 cm Metal ion capacity pH stability operational CIP stability short term Pressure flow spec CM Sephadex C 25 See p 68 Pack size Code No 100g 17 0210 01 500 g 17 0210 02 5kg 17 0210 03 Regulatory Support File 11 0028 86 Technical data cross linked dextran wet in 0 15 M NaCl 65 235 um 4 10 3 13 min 120 cm h pressure drop cm H O bed height 5 bed height 10 cm 5 cmi d Composition Particle size pH stability operational CIP stability short term Pressure flow spec CM Sephadex C 50 See p 68 Pack size Code No 100g 17 0220 01 500 g 17 0220 02 5kg 17 0220 03 Regulatory Support File 11 0028 87 Technical data cross linked dextran wet in 0 15 M NaCl 110 400 um 4 10 3 13 min 100 cm h pressure drop cm H O bed height 10 bed height 10 cm 5 cmi d Composition Particle size pH stability operational CIP stability short term Pressure flow spec www gelifesciences com bioprocess 217 jo6a7 pup saxapu Indexes and Legal CM Sepharose Fast Flow See p 69 130 Pack size Code No 25 ml 17 0719 10 500 ml 17 0719 01 101 17 0719 05 601 17 07
110. 19 60 Data File 18 1020 66 Regulatory Support File 11 0028 14 Prepacked columns HiTrap CM FF 5x1 ml 17 5056 01 HiTrap CM FF 5x5 ml 17 5155 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 HiPrep 16 10 CM FF 20 ml 17 5091 01 Technical data Composition Particle size Binding capacity lon capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 6 agarose 45 165 um 50 mg Ribonuclease ml drained medium 0 09 0 13 mmol H ml medium 4 13 2 14 300 600 cm h 100 kPa XK 50 30 column bed height 15 cm CM Sepharose High Performance See p 69 87 Pack size Code No 1l 17 1277 03 5l 17 1277 04 101 17 1277 05 Regulatory Support File 11 0028 15 Technical data Composition Particle size Total capacity H pH stability operational CIP stability short term Pressure flow spec highly cross linked 6 agarose 24 44 um 0 06 0 08 mmol ml medium 4 13 2 14 100 200 cm h 300 kPa BioPilot 60 600 column bed height 30 cm 218 www gelifesciences com bioprocess CNBr activated Sepharose 4B Pack size 15g 250g 1kg Regulatory Support File Technical data Code No 17 0430 01 17 0430 02 17 0430 03 11 0028 16 Composition Particle size For coupling to Activation method Coupling capacity pH stability operational CIP stability short term Pressure flow spec 4 agarose 90 um average d voi NH cyanogen bromide CNBr activa
111. 1x4 7m HiScreen Butyl FF 1x47m HiScreen Butyl S FF 1x47m HiScreen Octyl FF 1x47m HiScreen Phenyl FF high sub 1x4 7m HiScreen Phenyl FF low sub 1x4 7m Code No 28 9269 73 28 9269 76 28 9269 77 28 9269 78 28 9269 79 28 9269 80 28 9269 81 28 9269 82 28 9269 84 28 9269 85 28 9269 86 28 9269 88 28 9269 89 gt gt Visit us on the web at www gelifesciences com protein purification www gelifesciences com bioprocess 127 jualudojanap ssad0id Process development Prepacked columns Affinity columns for AKTAdesign systems Gel filtration columns for AKTAdesign systems Ordering information Ordering information Product Quantity Code No Product Quantity Code No HiTrap Benzamidine FF high sub 2x1ml 17 5143 02 HiLoad 16 60 Superdex 30 pg 1x120m 17 1139 01 HiTrap Benzamidine FF high sub 5x1ml 17 5143 01 HiLoad 16 60 Superdex 75 pg 1x120m 17 1068 01 HiTrap Benzamidine FF high sub 1x5ml 17 5144 01 HiLoad 16 60 Superdex 200 pg 1x120m 17 1069 01 HiPrep 16 10 Heparin FF 1x 20 ml 17 5189 01 HiLoad 26 60 Superdex 30 pg 1x 320m 17 1140 01 HiPrep IMAC FF 16 10 1x 20 ml 17 0921 06 HiLoad 26 60 Superdex 75 pg 1x 320m 17 1070 01 HiTrap IMAC FF 5x1ml 17 0921 02 HiLoad 26 60 Superdex 200 pg 1x320m 17 1071 01 HiTrap IMAC FF 5x5ml 17 0921 04 HiPrep 16 60 Sephacryl S 100 HR 1x120m 17 1165 01 HiScreen MabSelect SuRe WET 1x47 ml 28 9269 77 HiPrep 16 60 Sephacryl S 200 HR 1x
112. 2 224 MacroCap SP 66 68 225 Manufacturing Solutions 113 Media Wand 113 MaxCell hollow fiber cartridges 151 Media BioProcess 241 22 62 207 212 See Selection kits Media chromatography Media Selection kits Media safety stock 64 207 Media selection strategy 64 Media toolbox 22 78 Media Wand 25 113 MEM1 Fast Trak Course 201 Microcarrier cell culture 183 Microcarrier selection guide 183 Microfiltration 138 MidGee cross flow cartridges 144 MidGee Hoop cross flow cartridges 145 MidJet systems 164 Monoclonal antibodies MAbs 20 21 70 78 Multimodal Chromatography 24 76 N NHS activated Sepharose 4 Fast Flow 70 72 225 Ni Sepharose 6 Fast Flow 70 72 225 Normal Flow Capsule Filters See ReadyToProcess Normal flow filtration vs Cross flow filtration 138 Normal flow filtration 173 ULTA Prime CG 175 ULTA Prime GF 176 ULTA Prime PP 177 ULTA Pure HC 28 174 ULTA Pure SG 28 173 nProtein A Sepharose 4 Fast Flow 72 228 O Octyl Sepharose 4 Fast Flow 74 75 130 226 Oligonucleotide synthesis 192 Custom Primer Support 200 195 Flow through technology 193 OligoPilot 400 192 OligoProcess 193 Oligosynt prepacked disposable columns 195 239 Primer Support 200 194 Solid supports 194 KTA oligopilot plus 192 Online regulatory and technical support 204 OPC Connectivity 121 Operational Qualification OQ 198 OQ See Operational Qualification P Packing stations Chromaflow
113. 2 FineLINE 350P PFR 10 um 1 0027 93 FineLINE 350P PFR 2 um Oligo 11 0027 94 FineLINE 350P PFR 10 um Oligo 11 0027 95 FineLINE 350LP EPDM 2 um 11 0027 84 FineLINE 350LP EPDM 10 um 11 0027 85 FineLINE 350LP PFR 2 um 11 0027 86 FineLINE 350LP PFR 10 um 11 0027 87 FineLINE 350LP PFR 2 um Oligo 11 0027 88 FineLINE 350LP PFR 10 um Oligo 11 0027 89 Accessories for FineLINE Pilot 35 column Designation Code No Qty Material pack Tubing Kit for AKTAexplorer 8 1121 65 1 Tubing Connector SRTC2 9 2143 01 5 PEEK Tubing Connector 9 7476 01 5 PP Tubing D flangedi d 1 2 mm 420 mm 18 1102 20 1 ETFE PEEK PP Tubing D flangedi d 1 2 mm 750mm 18 4546 01 1 ETFE PEEK PP 7 3 tubing i d 1 2 mm 2000 mm 943700 ETFE Spare parts for FineLINE Pilot 35 column Stop Plug 8 1102 21 Designation Code No Qty pack Material Domed Nut M6 8 2450 01 4 PP Glass tube 18 1102 16 Borosilicate glass Flanging Start up Kit 120 V 8 4605 70 3 Adaptor bed support 2 um 18 1102 10 PP SS 316L dae He art T 220 V 8 4603 71 f i Bottom bed support 2m 18 1102 11 PP SS 316L Hanging Mp ii Se mir SA39 O Sealing Kit comprising 18 1102 12 EPDM Pressure Relief Valve 8 1110 90 SS 316 ETFE O ring 39 2 x 16 PEEK PP e On Off Valve i d 1 5 SRV 1 9 2145 01 FP O ring 28 25 2 62 4 Valve SRV 3 8 1110 95 1 FP Orting 12S 28 1 Mechanical locking 28 9172 95 1 O ring 19 2 x 3 O rings 28 3 x 2 6 mm 8 1102 15 PFR O ring 3 6 x 1 6 2 A
114. 20 x 250 mm bottles Rack options E and F require Prep Mode Conversion Kit see Ordering Information Ordering information Product Code No Fraction Collector Frac 950 including Rack A 18 6083 00 Standard mode Rack A complete with bowl for 18 mm and 30 mm tubes 18 6083 11 Rack B complete with bowl for 12 mm tubes 18 6083 12 Rack C complete with bowl for 96 well microtiter plates and 30 mm tubes 18 6083 13 Rack D complete with bowl for 30 mm tubes 18 6083 14 Prep mode Prep Mode Conversion Kit for use with Rack E and Rack F 18 6083 18 Fraction Collector Frac 950 is an automated fraction collector for Rack E complete for 30 mm tubes 8 6083 15 reliable and flexible collection of fractions based on time or volume from Rack F complete for 250 ml bottles eet AKTAdesign chromatography systems ats 3 Funnel to Flask Kit with funnels tubing and tubing organizer for use with Rack E 18 6083 17 i www gelifesciences com orderonline Fraction collector Frac 950 can be used together with KTApurifier KTAexplorer or KTApilot at flow rates up to 100 ml min Fractions can be collected in 96 well microplates in standard 12 18 or 30 mm tubes or in 250 ml bottles To deal with large fraction volumes preparative mode allows fraction collection in eighty 30 mm standard tubes twenty 250 ml bottles or in 30 funnels which connect to practically any vessel Collection is in volume o
115. 213 03 Primer Support 200 T Synth Technical data 1 mmol 17 5292 01 Composition Cross linked polystyrene 10 mmol 17 5292 02 Particle size 30 um 50 mmol 17 5292 03 The 15 pmol columns are sold in packs of 10 the 30 umol columns in packs of 5 100 mmol 17 5292 04 and the 120 umol columns in packs of 2 Regulatory Support File 11 0029 20 Technical data Composition Particle size Matrix Bead size in acetonitrile Bead form Particle size distribution Storage Degree of nucleoside substitution Max recommended bed height Cross linked polystyrene 30 um Cross linked polystyrene divinylbenzene 30 um retains size in all oligonucleotide in all synthesis reagents Spherical porous monodispersed Max 5 CV 4 to 30 C 200 10 mol g 10 cm www gelifesciences com bioprocess 239 jo6a7 pup saxapu Indexes and Legal Custom Primer Support 200 See p 195 Product Code No Primer Support dA 40s 1g 17 5214 37 10g 17 5214 31 100g 17 5214 11 Primer Support dC 40s 1g 17 5214 38 10g 17 5214 32 100g 17 5214 12 Primer Support dG 40s 1g 17 5214 39 10g 17 5214 33 100g 17 5214 13 Primer Support T 40s 1g 17 5214 40 10g 17 5214 34 100g 17 5214 14 Primer Support dA 80s 1g 17 5250 83 10g 17 5250 82 100g 17 5250 80 Primer Support dC 80s 1g 17 5251 83 10g 17 5251 82 100g 17 5251 80 Primer Support dG 80s 1g 17 5252 83 10g 17 5252 82 100g 17 5252 80 Primer Support T 80s 1g 17 5253
116. 28 9258 07 PreDictor Capto MMC 50 ul 4 x 96 well plates 28 9258 16 Technical data Technical data multimodal weak cation exchanger Ligand type Composition highly cross linked agarose Particle size 75 um average d lon capacity pH stability operational 3 12 CIP stability 2 14 Pressure flow spec 0 07 0 09 mmol H ml medium 300 kPa at 600 cm h 1 m diameter column 20 cm bed height in water on exchanger type Composition Particle size on capacity pH stability operational 2 12 CIP stability 2 14 Pressure flow spec 90 um average d 0 16 0 22 mmol Cl ml medium Quaternary ammonium strong anion with dextran coating highly cross linked agarose 300 kPa at 700 cm h 1 m diameter column 20 cm bed height in water 216 www gelifesciences com bioprocess E Capto ViralQ See p 68 Pack size Code No 25 ml 28 9032 30 100 ml 28 9032 31 11 28 9032 32 Datafile 11 0025 76 Regulatory Support File 11 0028 45 Prepacked columns HiTrap Capto ViralQ 5x5 ml 28 9078 09 Technical data lon exchanger type Composition Particle size 90 um average d lon capacity pH stability operational 2 12 CIP stability 2 14 Pressure flow spec Quaternary ammonium strong anion with dextran coating highly cross linked agarose 0 16 0 22 mmol Cl ml medium 300 kPa at 700 cm h 1 m diameter column 20 cm bed height in water E Capto S See p 66 69 130 E Chelating Sepharose Fast Flow S
117. 3 B2 and equivalent patents and patent applications in other countries owned by Centelion SAS Such a license is not included with the purchase of Q Sepharose XL but is included with the purchase of Q Sepharose XL virus licensed products With the purchase of Q Sepharose XL virus licensed the customer is granted a free limited license under US patent 6 537 793 B2 and equivalent patents and patent applications in other countries owned by Centelion SAS to separate viral particles solely through use of the product purchased ReadyMate ReadyMate is covered by US patent No 6 679 529 B2 owned by Johnson amp Boley Holdings LLC and licensed to GE Healthcare companies STREAMLINE With the purchase of STREAMLINE columns and adsorbents the customer is granted a free license to use the product for the manufacture of biopharmaceutical products under US patent application number 09 250 976 and all US and counterparts in other countries thereof as well as any patents issuing there from including US patent number 6 027 650 and equivalent patents and patent applications in other countries The customer shall not have the right to transfer or sub license these license rights Support for oligonucleotide synthesis Use of support for the synthesis of polynucleotides is licensed under the following patents when the synthesis is performed on an instrument provided by a licensed supplier US patent numbers 4 458 066 4 973 679 5 047 524 and 5 262 530
118. 32 1 SS 316 Media stirrer 80 mm 28 9191 03 28 9191 03 28 9191 03 1 Media stirrer 150 mm z 28 9191 04 28 9191 04 1 1 The packing device for BPG 100 200 consists of a 380 mm high glass tube flanges rods O rings in EPDM nuts and screws The packing device for BPG 300 consists of a 380 mm high glass tube flanges rods O rings in EPDM nuts and a clamp The packing device for BPG 450 consists of a 300 mm high stainless steel tube O rings nuts and a clamp 2 25 mm TC s1 mm TC 4 2x25 1x51 mm TC 5 BPG 100 8 bar BPG 140 200 6 bar BPG 350 4 bar www gelifesciences com bioprocess 101 Chromatography columns Spare parts for BPG columns Spare part Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Bed suppor Column tube 500 Column tube 750 Column tube 950 Column tube 1000 Flange O ring Flange O ring Adaptor O ring Adaptor O ring U shaped seal U shaped seal adaptor end piece 10 um adaptor 10 um end piece 12 um adaptor 12 um end piece 23 um adaptor 23 um end piece 54 um adaptor 54 um end piece Qty pack s NNNNNNNNNAN Material Borosilicate glass Borosilicate glass Borosilicate glass Borosilicate glass EPDM FEP EPDM FEP EPDM PFR PP PP PA PA PEEK PEEK PP PP PP PP One per pack Material ab PP pol
119. 32 457 8064 Bangalore 560 066 India Fax 1 732 457 8246 Email fasttrakindia ge com Tel 91 80 2527 9538 Fax 91 80 2526 8423 Fast Trak administrative offices Sweden Japan GE Healthcare GE Healthcare Bj rkgatan 30 Sanken Bldg 3 25 1 SE 751 84 Uppsala Hyakunincho 3 chome Shinjuku ku Sweden 169 0073 Tokyo Japan Tel 46 18 612 0219 Fax 46 18 120 329 Tel 81 0 3 5331 9316 Fax 81 0 3 5331 9372 202 www4elifesciences com bioprocess Life Science Performance Solutions Improve Operational Excellence and Life Science Performance The GE Healthcare Life Science Performance Solutions team combines decades of biopharmaceutical expertise with proven GE best practices to transfer skills and lead process improvement projects that will drive and sustain change throughout your organization Our team can help you e Achieve measurable gains in operational efficiency e Streamline your processes and operations e Maximize the value you provide to customers e Adopt proven methods for change management Establish a framework for ongoing skills transfer Whether you face an immediate challenge or want to build a solid framework for the future we can help Our experts work closely with your team to shape a common vision improve operational outcomes strengthen your bottom line and develop strong leaders GE Lean Workflow Improvement e Collaborative approach optimizes process workflows e Reduces non value added work
120. 4 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm pH stability operational CIP stability short term Pressure flow spec E Phenyl Sepharose 6 Fast Flow low sub See p 74 75 130 Pack size Code No 25 ml 17 0965 10 200 ml 17 0965 05 11 17 0965 03 5 17 0965 04 Data File 18 1020 53 Regulatory Support File 11 0028 23 Prepacked columns HiTrap HIC Selection Kit 7x1 ml 28 4110 07 HiTrap Phenyl FF low sub 5x1 ml 17 1353 01 HiTrap Phenyl FF low sub 5x5 ml 17 5194 01 HiPrep 16 10 Phenul FF low sub 20 ml 17 5094 01 HiScreen Phenyl FF low sub 4 7 ml 0 77 x 10 cm 28 9269 89 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d 50 vol Ligand phenyl 3 13 2 14 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm pH stability operational CIP stability short term Pressure flow spec E Phenyl Sepharose High Performance See p 74 75 130 Pack size Code No 75 ml 17 1082 01 1l 17 1082 03 5l 17 1082 04 Data File 18 1020 56 Regulatory Support File 11 0028 24 Prepacked columns HiLoad 16 10 Phenyl Sepharose High Performance 20 ml 17 1085 01 HiLoad 26 10 Phenyl Sepharose High Performance 53 ml 17 1086 01 HiTrap HIC Selection Kit 7x1 ml 28 4110 07 HiTrap Phenyl HP 5x1 ml 17 1351 01 HiTrap Phenyl HP 5x5 ml 17 5195 01 Technical data Composition highly cross linked 6 agarose Particle size 34 um average d va L
121. 4 EPDM Clamp 51 mm 44 7134 01 1 SS 304 Gaskets 51 mm i d 22 mm 44 7133 01 5 EPDM Gasket 51 mm i d 22 mm 44 5512 03 2 PTFE Castors 8 1001 09 1 1 Includes One O ring 104 33 x 3 53 18 1105 50 PTFE One O ring 91 67 x 3 53 8 1105 49 PFR Two O rings 5 3 x 2 4 8 1105 51 PFR 2 Includes One O ring 202 79 x 3 53 8 1106 30 PFR One O ring 187 3 x 6 99 18 1106 29 PFR Two O rings 7 3 x 2 4 18 1106 31 PFR 3 Fits 18 5757 01 and 18 5758 01 Maximum working pressure 8 bar 525mm TC 651 mm TC www gelifesciences com bioprocess 109 Chromatography columns 110 Spare parts for FineLINE 70 70L 100P 100LP 200P 200LP and 350P 350LP columns FineLINE Description 70 70L 100P 100LP 200P 200LP 350P 350LP Quantity Material Code No Bed support adaptor complete 2 mm 18 1153 61 11 0034 04 11 0034 06 11 0034 08 1 SS 316L Bed support adaptor complete 10 mm 18 1153 67 11 0034 72 11 0034 74 11 0034 10 1 SS 316L Bed support end piece complete 2 mm 18 1153 62 11 0034 05 11 0034 07 11 0034 09 1 SS 316L Bed support end piece complete 10 mm 18 1153 68 11 0034 73 11 0034 75 11 0034 11 1 SS 316L O ring 104 37 x 3 53 18 1103 89 3 EPDM O ring 104 37 x 3 53 18 1105 50 I PTFE O ring 202 79 x 3 53 18 8489 01 2 EPDM O ring 202 79 x 3 53 18 1106 30 1 PFR O ring 5 3 x 2 4 18 1103 92 5 EPDM O ring 5 3 x 2 4 18 1105 51 2 PFR O ring 7 3 x 2 4 18 1103 90 5 EPDM O ring 7 3 x 2 4 18 1106 31 2 PFR O ring 64 5 x 3 18 1105 48 18 1105 48
122. 58 13 PreDictor Capto MMC 6 ul 4 x 96 well filter plates 28 9258 14 PreDictor Capto MMC 20 ul 4 x 96 well filter plates 28 9258 15 PreDictor Capto MMC 50 ul 4 x 96 well filter plates 28 9258 16 PreDictor Capto adhere 6 ul 4 x 96 well filter plates 28 9258 17 PreDictor Capto adhere 20 ul 4 x 96 well filter plates 28 9258 18 PreDictor Capto adhere 50 ul 4 x 96 well filter plates 28 9258 19 PreDictor MabSelect 6 pl 4 x 96 well filter plates 28 9258 20 PreDictor MabSelect 20 ul 4 x 96 well filter plates 28 9258 21 PreDictor MabSelect 50 ul 4 x 96 well filter plates 28 9258 22 PreDictor MabSelect SuRe 6 ul 4 x 96 well filter plates 28 9258 23 PreDictor MabSelect SuRe 20 ul 4 x 96 well filter plates 28 9258 24 PreDictor MabSelect SuRe 50 ul 4 x 96 well filter plates 28 9258 25 Note For optimal results different applications will require different amount of chromatography media in the wells Thus plates with each chromatography medium are available with three different volumes of media Generally for binding studies plates with 2 or 6 ul chromatography media should be used For wash and elution studies larger gel volumes are required and both feed sample concentration and the actual load load density will determine what plate to use The first option for wash studies is the 50 ul plates For elution studies the 20 ul plate should be tested first 126 www gelifesciences com bioprocess PreDictor plates shorten time to clinic and increase
123. 5A 0 1 0 75 25 27 60 Q 56 4103 70 CFP 1 E 55 0 1 1 21 23 60 56 4103 72 CFP 1 E 55A 0 1 1 at 23 60 56 4103 73 CFP 2 E 55 0 2 1 21L 23 60 56 4103 75 CFP 2 E 55A 02 1 21 23 60 56 4105 63 CFP 2 G 55 0 2 1 75 1 8 19 4 60 56 4103 76 CFP 4 E 55 0 45 1 21 23 60 56 4103 78 CFP 4 E 55A 0 45 1 21 23 60 56 4103 79 CFP 6 D 55A 0 65 0 75 25 27 60 Note Process scale microfiltration cartridges with model numbers that end in A are autoclavable www gelifesciences com bioprocess 149 Filtration products Ordering information for process scale ultrafiltration cartridges Code number Model number Pore size Fiber ID Membrane area Nominal flowpath NMWC mm m ft length cm 56 4103 14 UFP 3 C 35 3000 0 5 135 14 5 30 56 4103 15 UFP 3 E 35 3000 4 0 92 9 9 30 56 4103 16 UFP 5 C 35 5000 0 5 1 35 14 5 30 56 4103 17 UFP 5 E 35 5000 1 0 92 9 9 30 56 4103 19 UFP 10 C 35 10 000 0 5 135 14 5 30 56 4103 20 UFP 10 E 35 10 000 1 0 92 9 9 30 56 4103 21 UFP 30 C 35 30 000 0 5 135 14 5 30 56 4103 22 UFP 30 E 35 30 000 1 0 92 9 9 30 56 4103 23 UFP 100 C 35 100 000 0 5 135 14 5 30 56 4103 24 UFP 100 E 35 100 000 1 0 92 9 9 30 56 4103 25 UFP 300 C 35 300 000 0 5 135 14 5 30 56 4103 26 UFP 300 E 35 300 000 1 0 92 9 9 30 56 4103 27 UFP 500 C 35 500 000 0 5 135 14 5 30 56 4103 28 UFP 500 E 35 500 000 1 0 92 9 9 30 56 4103 29 UFP 750 E 35 750 000 1 0 92 9 9 30 56 4103 35 UFP 3 C 55 3000 0 5 3 25 35 60 56 4103
124. 5x5 ml 17 5080 02 Technical data Composition Particle size Ligand Coupling chemistry Dynamic binding capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 4 agarose d 90 um recombinant Protein A from E coli epoxy min 27 mg human IgG ml medium at 3 min residence time 3 10 2 11 base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm E rmp Protein A Sepharose Fast Flow See p 72 Pack size Code No 5 ml 17 5138 01 25 ml 17 5138 02 200 ml 17 5138 03 1l 17 5138 04 5 17 5138 05 Dota File 18 1141 34 Regulatory Support File 11 0029 25 Technical data Composition Particle size Ligand Coupling chemistry Dynamic binding highly cross linked 4 agarose d 90 um recombinant Protein A from E coli reductive amination capacity min 22 mg human IgG ml medium at 3 min residence time pH stability operational 3 10 CIP stability short term 2 11 Pressure flow spec base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm Protein G E Q Sepharose Big Beads See p 68 130 Pack size Code No Pack size Code No 5 mg 17 0619 01 1 17 0989 03 1g 17 0619 09 101 17 0989 05 10g 17 0619 10 601 17 0989 60 IEX Selection Kit 17 0939 01 E Protein G Sepharose 4 Fast Flow See p 72 Data File 18 1104 91 Pack size Code No Regulatory Support File 11 0028 32 5 ml 17 0618 01 Technical data 25 ml 1
125. 61 40 Stroke length 200 400 8 1157 42 18 1159 42 18 1161 42 Stroke length 300 500 18 1157 44 18 1159 44 8 1161 44 I d 400 mm Auto nozzle Stroke length 100 300 18 1157 41 18 1159 41 18 1161 41 Stroke length 200 400 18 1157 43 18 1159 43 8 1161 43 Stroke length 300 500 8 1157 45 18 1159 45 18 1161 45 I d 400 mm SFP Man nozzle Stroke length 100 300 18 1170 53 18 1176 12 1 0011 85 Stroke length 200 400 11 0011 80 11 0011 83 11 0011 86 Stroke length 300 500 11 0011 82 11 0011 84 1 0011 87 I d 400 mm SFP Auto nozzle Stroke length 100 300 1 0011 89 11 0011 91 11 0011 94 Stroke length 200 400 11 0011 88 11 0011 92 1 0011 95 Stroke length 300 500 11 0011 90 11 0011 93 11 0011 96 1 d 600 mm Man nozzle Stroke length 100 300 18 1150 60 18 1159 60 8 1161 60 Stroke length 200 400 8 1157 62 18 1159 62 18 1161 62 Stroke length 300 500 18 1157 64 18 1159 64 18 1161 64 I d 600 mm Auto nozzle Stroke length 100 300 18 1157 61 18 1159 61 8 1161 61 Stroke length 200 400 18 1157 63 18 1159 63 18 1161 63 Stroke length 300 500 18 1157 65 18 1159 65 8 1161 65 1 d 800 mm Man nozzle Stroke length 100 300 8 1150 80 18 1159 80 18 1161 80 Stroke length 200 400 18 1157 82 18 1159 82 8 1161 82 Stroke length 300 500 18 1157 84 18 1159 84 18 1161 84 I d 800 mm Auto nozzle Stroke length 100 300 18 1157 81 18 1159 81 8 1161 81 Stroke length 200 400 18 1157 83 18 1159 83 18 1161 83 Stroke length 300 500 18 1157 85 18 1159 85 8 1161 85 I d 1000 mm Man nozzle Stroke
126. 7 0618 02 Composition highly cross linked 6 agarose 200 ml 17 0618 05 Particle size 100 300 um 1 17 0618 06 lon capacity 0 18 0 25 mmol Cl ml medium 5 17 0618 04 PH stability operational 2 12 Data File 18 1012 91 CIP stability short term 2 14 Regulatory Support File 11 0028 29 Pressure flow spec 1 200 1 800 cm h 100 kPa Technical data Composition Particle size Ligand Ligand density Coupling chemistry pH stability operational CIP stability short term Pressure flow spec highly cross linked 4 agarose 45 165 um recombinant Protein G from E coli 2 mg protein G ml drained medium CNBr 3 9 2 10 base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm VillSelect See p 72 87 Pack size Code No 25 ml 17 5450 01 500 ml 17 5450 02 Technical data Composition Highly cross linked high flow agarose Particle size 75 um average d50 vol Ligand 13 kD recombinant protein produced Coupling chemistry Pressure flow spec in S cerevisiae Binds to beta domain depleted factor VIII molecules NHS At least 300 cm h in a BPG 300 column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at lt 2 bar 0 2 MPa XK50 60 column bed height 25 cm E Q Sepharose Fast Flow See p 69 130 Pack size Code No 25 ml 17 0510 10 300 ml 17 0510 01 5 17 0510 04 101 17 0510 05 601 17 0510 60 IEX Selection Kit 17 0939 01 Dota File 18
127. 70 3 25 200 100 80x80x140 59 4 79 7 96 8 2 5 215 100 80x80x165 100 0 112 5 121 8 25 230 100 80x80x190 Bed volumes and bed heights are based on a slurry concentration of 75 and a packing compression of 15 Where compression is the difference in volume between a sedimented bed and a bed under pressure 1 Values achievable without a packing extension Values achievable when a packing extension is used for sedimentation of the bed 75 of the slurry must fit into the column and extension when the adapter is mounted 3 Values achievable when the packing extension remains attached to the column for the duration of column use The adapter must seal at least 5 cm into the column tube to avoid high tensions in the glass tube 4 Use a manometer to monitor the pressure What do I need The column BPG 100 140 amp 200 stand kit must be ordered separately BPG 100 has adjustable feet wheels with brakes are available BPG 140 amp 200 stands have wheels with brakes as standard BPG 300 amp 450 supplied with stainless steel stand with wheels and foot operated brakes Useful spare parts Nets The column is delivered with 23 um polypropylene nets For media with an average particle diameter lt 70 um change to 10 um polyamide or 12 um PEEK in both adaptors and endpieces For Sepharose Big Beads use 54 um nets O rings FEP adaptor and sealing O rings if solvents not compatible with the EPDM O rings supplied with th
128. 77 Code No 17 0872 50 17 0872 01 17 0872 02 Procainamide Sepharose 4 Fast Flow See p 72 87 Pack size 1l 5l Technical data Code No 28 4111 03 28 4111 04 Composition Particle size Coupling chemistry Ligand Ligand density Pressure flow spec highly cross linked 4 agarose 45 165 um amide linkage carbodiimide procainamide approx 23 umol ml drained medium min 150 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix E nProtein A Sepharose 4 Fast Flow See p 72 Pack size Code No 5ml 17 5280 01 25 ml 17 5280 04 200 ml 17 5280 02 1l 17 5280 03 5 17 5280 05 101 17 5280 06 Data File 18 1125 19 Regulatory Support File 11 0029 19 Technical data Composition Particle size Ligand Coupling chemistry pH stability operational CIP stability short term Pressure flow spec 228 highly cross linked 4 agarose d 90 um Protein A from Staphylococcus aureus CNBr 3 9 2 10 base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm www gelifesciences com bioprocess E rProtein A Sepharose 4 Fast Flow See p 72 Pack size Code No 5 ml 17 1279 01 25 ml 17 1279 02 200 ml 17 1279 03 11 17 1279 04 5 17 1279 05 101 17 1279 06 Data File 18 1113 94 Regulatory Support File 11 0028 35 Prepacked columns HiTrap rProtein A FF 5x1 ml 17 5079 01 HiTrap rProtein A FF 2x1 ml 17 5079 02 HiTrap rProtein A FF 1x5 ml 17 5080 01 HiTrap rProtein A FF
129. 8 1020 86 18 1117 76 Documentation to support validation available on request Contact your local GE Healthcare office Chromaflow columns Chromaflow columns represent an innovative development in process scale chromatography resulting in improved process reliability safety and economics With Chromaflow columns packing operation unpacking and cleaning can be done without removing the lid or adaptor all due to the design of the nozzle in both the top and bottom end pieces With the establishment of packing protocols for individual media large scale chromatography is more convenient scalable and safer for both the operators and the product Chromaflow columns are intended for GMP production Materials of manufacture and column design which are consistent over all scales meet the demands of regulatory authorities for cGMP facilities producing biopharmaceuticals Chromaflow range e Diameters start at 300 mm and end at 2000 mm Design principle is common to all column dimensions making scale up a simple operation 3 bar pressure rating as standard and up to 5 bar as custom made Transparent high quality cast acrylic or electropolished stainless steel tube Hygienic design tested in microbial challenge studies Packing stations simplify packing and unpacking All polymeric materials are approved according to USP Class VI tests for toxicity Full documentation package Validation support docum
130. AU AxiChrom 50 AxiChrom 70 AxiChrom 400 AxiChrom 1000 Results from HETP test on 10 cm SP Sepharose Fast Flow in different sizes of AxiChrom columns AxiChrom features e Currently available in 50 mm 70 mm 400 mm 600 mm 800 mm and 1000 mm diameters e Small 50 70 mm columns with two different tube lengths allowing bed volumes between 0 2 to 2 liters Large columns with bed volumes of 36 to 393 liters Pressure rating at 20 bar g 50 mm 15 bar g 70 mm and 4 bar g 400 1000 mm Sanitary design with recommended CIP methods Preprogrammed verified packing methods for Capto MabSelect and Sepharose Fast Flow media families through Intelligent Packing e cGMP compliant documentation e Wetted polymers are approved according to USP Class VI tests for toxicity e Supported with IQ OQ documentation packages What do need Useful accessories Pivot stand needs to be ordered separately for AxiChrom 50 The column is delivered with a foot stand Tubing kits are available for different set ups depending on what type of stand and system you use Mechanical locking is recommended for maintaining axial compression between runs and for longer periods of storage The locking device allows the position of the adapter to be locked without the need for hydraulic pressure Useful spare parts to keep on site Bed supports a complete set of O rings and scraper sealing Assembly disassembly of column
131. CFP 6 D 8 0 65 0 75 0 41 44 30 56 4110 89 RTPCFP 1 E 9 0 1 0 84 9 60 56 4110 90 RTPCFP 2 E 9 0 2 1 0 84 9 60 56 4110 91 RTPCFP 4 E 9 0 45 1 0 84 9 60 56 4110 92 RTPCFP 6 D 9 0 65 0 75 0 93 10 60 56 www gelifesciences com readytoprocess ReadyToProcess Normal Flow Capsule Filters ReadyToProcess Normal Flow Capsule Filters are single use filters designed for laboratory through process scale applications Volumes range from a few milliliters to thousands of liters of solution The filters provide sterilizing grade filtration for a wide range of biopharmaceutical solutions Two capsule filters are available RTP ULTA Cap SG for sterilizing grade filtration of typical biopharmaceutical solutions RTP ULTA Cap HC for sterilizing grade filtration of difficult to filter solutions ReadyToProcess Normal Flow Capsule Filters offer a range of benefits including e decreased risk of cross contamination ssa901g0 fippay e simplified and rapid bioprocessing e reduced process development time Ordering information Code Number Model Number Description Pore Size Capsule e lower capital investment costs um Size 28 4002 64 KMPHHC9202HH ULTA HC RTP 0 2 2IN 0 2 2 Inch HBHB 3p 28 4002 65 KMPHHC9204HH ULTA HC RTP 0 2 4IN 0 2 4 Inch HBHB 3p 28 4002 66 KMPHHC9206HH ULTA HC RTP 0 2 6IN 0 2 6 Inch HBHB 3p 28 4002 67 KMPHHC9202TH ULTA HC RTP 0 2 2IN 0 2 2 Inch T
132. CHB 3pk 28 4002 68 KMPHHC9204TH ULTA HC RTP 0 2 4IN 0 2 4 Inch TCHB 3pk 28 4002 69 KMPHHC9206TH ULTA HC RTP 0 2 6IN 0 2 6 Inch TCHB 3pk 28 4002 70 KMPHSG9202HH ULTA SG RTP 0 2 2IN 0 2 2 Inch HBHB 3p 28 4002 71 KMPHSG9204HH ULTA SG RTP 0 2 4IN 0 2 4 Inch HBHB 3p 28 4002 72 KMPHSG9206HH ULTA SG RTP 0 2 6IN 0 2 6 Inch HBHB 3p 28 4002 73 KMPHSG9202TH ULTA SG RTP 0 2 2IN 0 2 2 Inch TCHB 3pk 28 4002 74 KMPHSG9204TH ULTA SG RTP 0 2 4IN 0 2 4 Inch TCHB 3pk 28 4002 75 KMPHSG9206TH ULTA SG RTP 0 2 6IN 0 2 6 Inch TCHB 3pk Area Integrity specifications Product Name 6 Capsule 4 Capsule 2 Capsule Water Wet Bubble Point Integrity Spec RTP ULTA Cap SG 0 22 m 2 3 ft 0 11 m 1 2 ft 0 05 m 2 3 ft 3 4 barg 49 psig Diffusion Specification 6 1 mL min 2 8 barg 3 0 mL min 2 8 barg 1 4 mL min 2 8 barg w Water Wet Filter 40 6 psig 20 C 40 6 psig 20 C 40 6 psig 20 C RTP ULTA Cap HC 0 22 m 2 3 ft 0 11 m 1 2 ft 0 05 m 2 3 ft 3 4 barg 49 psig Diffusion Specification 6 1 mL min 2 8 barg 3 0 mL min 2 8 barg 1 4 mL min 2 8 barg w Water Wet Filter 40 6 psig 20 C 40 6 psig 20 C 40 6 psig 20 C www gelifesciences com readytoprocess 57 ReadyToProcess 58 AKTAready system New AkTAready is a liquid chromatography system built for process scale up and production for early clinical phases The system operates with ready to use disposable flow paths and as a consequence cleaning bet
133. Code No 25g 17 0448 01 50ml 17 1269 01 100g 17 0448 02 500ml 17 1269 02 500 g 17 0448 03 5l 17 1269 03 2 5 kg 17 0448 25 Data File 18 1060 65 5kg 17 0448 04 Regulatory Support File 11 0028 74 Data File 18 1060 61 Technical data Regulatory Support File 11 0028 70 Sedimentation velocity 25 75 cm min Technical data Length 1 7 2 5 mm Density 1 03 g ml in 0 9 NaCl Thickness 0 4 1 1 mm Particle size d 190 um Density 1 03 g ml Particle size d 4 147 248 um Pore size 10 400 um Approx area 4 400 cm g dry weight Surface area gt 0 1 m g Approx no microcarriers 4 3x10 g dry weight swelling 20 ml g crue Cytopore 1 See p 183 184 EMME rer Pack size Code No Cytodex 3 See p 183 184 20g 17 0911 01 Pack size Code No 100g 17 0911 02 10g 17 0485 01 500g 17 0911 03 100g 17 0485 02 Data File 18 1132 68 500g 17 0485 03 Regulatory Support File 11 0028 73 2 5 kg 17 0485 25 Technical data 5kg 17 0485 04 Particle diameter 200 280 nm Data File 18 1060 61 Effective surface area 1 1 m g dry weight Regulatory Support File 11 0028 72 Density 1 03 g ml Technical data Average diameter Density 1 04 g ml in 0 9 NaCl et ponesapeninge 30 uma Paitielesizet 175 um Volume 40 ml g dry weight Particle size d 141 211 um ln NaCI Approx area 2700 cm g dry weight Data from Ashai Chemical Industry Co Ltd Japan Approx no microcarriers 3x10 g dry weight swelling 15 ml g dry weight Cytopore 2 See p 183 184 In 0 9 NaCl Pack size Code No No
134. DF 28 9136 13 Yes Tubing kit AxiChrom 70 AKTApilot floor PVDF 28 9136 14 Yes SRV 1 M6 EFTE Titanium 19 2145 01 No Valve 5 16 straight PEEK 28 9076 74 Yes Spare parts Item 50 mm 70 mm Qty pk Material gt gt For the latest updates on the Bed Support top 28 9245 64 28 9245 76 1 PEEK EN 1 4404 availability and dimensions of Bed Support bottom 28 4018 51 28 4019 23 PEEK EN 1 4404 AxiChrom columns visit Scraper sealing 28 9245 28 28 9245 70 UHMWPE EPDM www gelifesciences com axichrom O ring bed support top 28 9245 57 28 9245 72 EPDM O ring bed support bottom 28 401774 28 4019 18 FPM O ring adaptor tube 28 4017 77 28 4017 77 3 EPDM O ring adaptor 28 9245 22 28 9245 68 EPDM O ring bottom plate 28 4017 73 28 4019 17 EPDM www gelifesciences com bioprocess 93 suwnjoo fiydns6bo oWo1y gt D Chromatography columns INdEX columns INdEX are easy to use general purpose glass columns well suited for applications such as process development and diagnostics production These columns are characterized by their simple design and the novel axial compression packing method that yields a densely packed bed in under 10 minutes INdEX range e Scalable from inner diameters of 70 to 200 mm and bed volumes from 0 1 to 25 liters e Pressure rating 3 bar e For use with an array of techniques and media especially Sepharose Fast Flow e Proven distribution system a e Dynamic axial compression yields densely packed high efficienc
135. Data File 18 1128 86 Regulatory Support File 11 0028 47 Prepacked columns RESOURCE ISO 1 ml 17 1185 01 RESOURCE HIC Test kit 17 1187 01 Technical data Composition Particle size Typical flow rate pH stability operational CIP stability short term Pressure flow spec polystyrene divinylbenzene 15 um monosized 150 900 cm h 2 12 1 14 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm E SOURCE 15PHE E SOURCE 30Q See p 69 79 Pack size Code No Pack size Code No 50 ml 17 0147 01 50ml 17 1275 01 200 ml 17 0147 02 200ml 17 1275 02 1l 17 0147 04 1l 17 1275 03 5l 17 0147 05 5l 17 1275 04 Data File 18 1128 86 Data File 18 1107 12 Regulatory Support File 11 0028 48 Regulatory Support File 11 0028 52 Prepacked columns Technical data RESOURCE PHE 1 ml 17 1186 01 lon exchanger type Quaternary ammonium strong anion RESOURCE HIC Test kit 17 1187 01 exchanger SOURCE 15PHE PE 4 6 100 17 5071 01 Composition polystyrene divinylbenzene Technical data Particle size 30 um monosized Composition polystyrene divinylbenzene Binding capacity 40 mg BSA ml drained medium Particle size 15 um monosized Typical flow rate 300 1 000 cm h Typical flow rate 150 900 cm h pH stability operational 2 12 PH stability operational 2 12 CIP stability short term 1 14 CP swiitylshortterm 1 14 ee 2 ea Pressure flow spec 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d
136. Desalting columns 53 ml are available for fast and convenient desalting as well as Hitrap Desalting 1 ml and 5 ml columns Sephadex LH 20 Gel filtration in organic solvents This medium is for use with organic solvents when separating small molecules lipids steroids fatty acids hormones etc E BioProcess Media 84 www4elifesciences com bioprocess E Superdex 30 prep grade E Superdex 75 prep grade E Superdex 200 prep grade E Sephacryl S 100 High Resolution E Sephacryl S 200 High Resolution E Sephacryl S 300 High Resolution E Sephacryl S 400 High Resolution E Sephacryl S 500 High Resolution E Sepharose 4 Fast Flow E Sepharose 6 Fast Flow E Sephadex G 25 Coarse E Sephadex G 25 Medium E Sephadex G 25 Fine E Sephadex G 25 Superfine E Sephadex LH 20 Application guide For very small For peptides and globular For larger molecules molecules proteins or particles 10 10 104 105 106 107 108 i 5 Superdex 30 prep grade Superdex 75 prep grade t Superdex 200 prep grade Sephacryl S 300 High Resolution Sepharose CL 2B C Coarse M Medium F Fine SF Superfine pipaw fiydpibo owo1yD Getting started Testing the performance of separation media at the laboratory bench will help you select the most appropriate for process scale use HiLoad and HiPrep prepacked columns are convenient and reproducible and are well suited for method development
137. EHC the following the brand type age condition current use and the exact location and all other relevant information In the event Buyer has not complied with such obligations GEHC may charge Buyer such reasonable additional fees to reflect any related obligations it may have under national legislation regarding the recycling reuse and or disposal of such existing equipment and related costs it may incur 18 3 Unless the relevant mandatory national legislation provides otherwise or unless otherwise agreed in writing GEHC s obligation does not include without limitation creation of physical access to the equipment de installation decoupling disinfecting craning lifting transportation to a ground level loading area or ramp packing or any related similar activities and Buyer agrees to perform such activities at its own cost as and when required 19 Governing Law This Contract shall be governed by and construed in accordance with the substantive laws of the country or state where the GE Healthcare group company or relevant branch office referred to in the Contract is situated and the parties hereby submit to the non exclusive jurisdiction of the courts of that country or state 20 Product Specific Terms and Conditions Additional terms and conditions govern the sale of certain Products and Services These additional terms and conditions are available from the sales offices of GEHC and shall take precedence in the event of
138. EK 450G Stand 316 For more information contact your GE Healthcare representative Packing position The bottom nozzle extends part of the way mid position into the column The top nozzle is fully retracted Slurry enters the column via the bottom nozzle and excess liquid exits via the top mobile phase outlet After packing the slurry lines are isolated from the mobile phase and can be cleaned independently from the rest of the column Running position The top and bottom nozzles are retracted Mobile phase enters the column directly into an annulus immediately behind the bed support The annulus is cut through at an angle to ensure that the linear flow rate is kept constant during distribution of the mobile phase across the bed Unpacking position In this position both bottom and top nozzles are fully extended into the column thereby exposing a third passage through which medium leaves the column Cleaning solution can be pumped through the nozzles and sprayed into the column In this way the column is easily and effectively cleaned without exposing the interior or the medium to the outside or without dismantling the column Ordering information Chromaflow columns Bed support Bed support Bed support with acrylic tubes 10 mm SS sinter 20 mm SS sinter 20 mm PE sinter 1 d 400 mm Man nozzle Stroke length 100 300 18 1150 40 18 1159 40 8 11
139. F 86 2 India sttrakasia ge com 50504666 2600 50808591 GE Healthcare Life Sciences John F Welch Technology Center 122 EPIP Whitefield Banga Email fa lore 560 066 India sttrakindia ge com T 91 80 2527 9538 F 91 80 2526 8423 Taiwan GE Healthcare Taiwan Branch Office 10F No 55 Sec 2 Chihshan Road Shih Lin District Taipei 111 T 886 2 2888 3570 F 886 2 2888 3580 Thailand GE Healthcare Bio Sciences Thailand Ltd Thanapoom Tower 12th Floor 1550 New Petchburi Road Makasan Ratthewi Bangkok 10400 T 662 624 8484 F 662 624 8490 Ukraine See listing for Middle East and Africa Greece Administrative offices Sweden GE Healthcare Bj rkgatan 30 SE 751 84 Uppsala Sweden T 46 18 612 0219 F 46 18 120 329 Japan GE Healthcare Sanken Bldg 3 25 1 Hyakunincho 3 chome Shinjuku ku 169 0073 Tokyo Japan T 81 0 3 5331 9316 F 81 0 3 5331 9372 Contents Bioprocessing Product highlights 16 ReadyToProcess ReadyToProcess Platform ReadyToProcess WAVE systems Cellbag disposable bioreactors ReadyToProcess connectivity ReadyToProcess filtration products KTAready system ReadyToProcess columns Filtration products 136 Filtration Cross flow filtration Normal flow filtration Chromatography media lon exchange Affinity Hydrophobic interaction Multimodal Reversed phase Gel filtration Custom designed media Chromatogr
140. GE Healthcare BioProcess Product Guide 2008 2009 BioProcess How to contact us www gelifesciences com bioprocess or by phone T fax F and Email Europe Austria T 43 157 606 1613 Great Britain T 0800 515 313 F 43 157 606 1614 F 0800 616 927 Email cust orderde ge com Email orders gb ge com Belgium T 0800 73890 Italy T 39 02 2600 1300 F 02 416 8206 F 39 02 2600 1399 Email order bni ge com Email orderit ge com Central and T 43 197272 2712 Netherlands T 0800 82 82 82 1 East Europe Austria F 43 197272 2750 Email cust servex ge com F 0800 82 82 82 4 Email order bni ge com Denmark T 45 4516 2400 Norway T 47 815 65555 F 45 4516 2424 F 47 815 65666 Email orderdk ge com Email orderno ge com Eire T 1800 709 992 Portugal T 351 214177035 F 44 1494 542 010 F 351 21 4173184 Email orders gb ge com Email cust servpt ge com Finland T 358 95123940 Spain T 34 935 944 950 F 358 951239439 F 34 935 944 965 Email orderfl ge com Email cust serves ge com France T 33 169 35 67 00 Sweden T 46 18 612 19 00 F 33 169 41 96 77 F 46 18 612 19 10 Email productfr ge com Email orderse ge com Germany T 0800 9080 711 Switzerland T 0848 8028 10 F 0800 9080 712 F 0848 8028 11 Email cust orderde ge com Email cust orderde ge com North America In the USA T 1 800 526 3593 In Canada T 1 800 463 5800 F 1 800 567 1008 Press1 To reach an extension Email csdcanada ge com sa
141. H stability short term PH stability long term CIP stability Chemical stability Flow velocity Strong cation SO 3 0 10 0 13 mmol H ml medium a proteins in excess of 150 kDa b functionalized Dextrans or PEGs gt 20 000 MW PEG proteins containing gt 10 000 PEG total per conjugate 3 12 2 13 4 11 2 13 all commonly used aqueous buffers 0 1 M citric acid 0 5 M NaOH 25 ethanol 30 propanol 30 methanol 50 ethylene glycol 1 Tween 20 1 SDS 120 cm h in BPG 300 columns with 20 cm bed height at 20 C using process buffers with the same viscosity as water at lt 300 kPa C pH stability operational CIP stability short term Pressure flow spec 3 13 ligand dependent 3 13 ligand dependent base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm E Ni Sepharose 6 Fast Flow See p 70 72 Pack size Code No 5 ml 17 5318 06 25 ml 17 5318 01 100 ml 17 5318 02 500 ml 17 5318 03 1l 17 5318 04 5 17 5318 05 Dota File 11 0008 86 Regulatory Support File 11 0028 43 Prepacked columns HisTrap FF 5x1 ml 17 5319 01 HisTrap FF 100x1 ml 17 5319 02 HisTrap FF 5x5 ml 17 5255 01 HisTrap FF 100x5 ml 17 5255 02 HisPrep FF 16 10 17 5256 01 His GraviTrap 10x1 ml 11 0033 99 His GraviTrap Kit 20x1 ml buffers 28 4013 51 His MultiTrap FF 96 well prepacked plate 4 plates 28 4009 90 Technical data Composition highly cross linked 6 agarose Particle size 90 um ave
142. High Resolution See p 84 85 E Sephadex G 25 Medium See p 84 85 Pack size Code No Pack size Code No 150 ml 17 0613 10 25g 17 0033 10 750 ml 17 0613 01 100g 17 0033 01 10 17 0613 05 500g 17 0033 02 Data File 18 1009 28 5kg 17 0033 03 Regulatory Support File 11 0028 36 Data File 18 1115 79 Technical data Regulatory Support File 11 0028 38 Composition ally dextran and N N methylene Prepacked columns bisacrylamide Prepacked Disposable Columns PD 10 30x9 1ml 17 0851 01 Particle size 50 um Fractionation range globular proteins pH stability operational CIP stability short term Pressure flow spec not determined 3 11 2 13 flow at 100 kPa gt 125 cm h XK 50 30 column bed height 15 cm E Sephadex G 25 Coarse See p 84 85 Pack size Code No 100g 17 0034 01 500 g 17 0034 02 5kg 17 0034 03 40 kg 17 0034 07 Data File 18 1115 79 Regulatory Support File 11 0028 38 Technical data Technical data Composition Particle size Typical flow rate Fractionation range globular proteins pH stability operational CIP stability short term Pressure flow spec cross linked dextran dry min 90 volume share between 50 150 um wet in 0 15 M NaCl 40 250 um 200 cm h 1x10 5x10 2 13 2 13 100 150 cm h pressure drop cm H O bed height 2 bed height 30 cm 2 6 cm i d E Sephadex G 25 Fine See p 84 85 Composition Particle size Fractionation range globular proteins
143. IADIOISI Cytoline 1 with recombinant CHO attached WAVE Bioreactor The WAVE Bioreactor and components are now available for Cell Therapy applications www gelifesciences com cellcult 185 Label free interaction analysis 188 Oligonucleotide synthesis 192 Label free interaction analysis ps O Label free interaction analysis 7 f F Biacore systems allow for rapid label free interaction analyses giving unique insights into the interactions of proteins with other molecules The integration of Biacore s world leading protein interaction analysis systems into the product portfolio of GE Healthcare creates a product portfolio that offers a wide range of solutions to the life science community Biacore systems can provide solutions to elucidate disease mechanisms develop and produce novel therapeutics detect and characterize immune responses or purify and characterize protein therapeutics www gelifesciences com biacore Biacore systems characterize molecules in terms of their e specificity of interaction e on and off rates kinetics e binding strength affinity The systems also provide sensitive accurate concentration measurements This is based on the ability of the biomolecule of interest to interact with a specific binding partner and may therefore be more informative than generic measurement techniques total protein concentration for example gt gt Fo
144. M Trap Capto MMC Trap Capto MMC Trap Capto Q rap Capto Q Trap Capto S Trap Capto S Trap Capto ViralQ rap CM FF rap CM FF rap DEAE FF rap DEAE FF rap Q FF rap Q FF rap Q HP rap Q HP E L rapQX rapQX rap SP rap SP F rap SP HP rap SP HP rap SP XL rap SP XL nm Quantity 1x 20ml 1x20 ml 1x53 ml 1x53 ml 1x20 ml 1x20 ml 1x20 ml 1x20 ml 1x20 ml 1x20 ml 1x20 ml 1x 4 7 ml 1x 4 7 ml 1x 4 7 ml 1x47 ml 1x 4 7 ml 5x1 7x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x 5x Sx 5x SX 5x 5x 5x 5x 5x ax 5x 5x 3 s s wn s wn s ea 3 U a UT S GT gt tn 2 tn gt tn gt tn a UT OT A 3 on 333333333333333333333333333333 wn x wn Code No 17 1064 01 17 1137 01 17 1066 01 17 1138 01 17 5191 01 17 5091 01 17 5090 01 17 5190 01 17 5092 01 17 5192 01 17 5093 01 28 9269 81 28 9269 82 28 9269 80 28 9269 78 28 9269 79 28 9343 88 17 6002 33 17 5162 01 17 5163 01 28 4058 44 28 4058 46 28 9165 37 28 9165 40 11 0032 73 11 0032 75 11 0013 02 11 0013 03 17 5441 22 17 5441 23 28 9078 09 17 5056 01 17 5155 01 17 5055 01 17 5154 01 17 5053 01 17 5156 01 17 1153 01 17 1154 01 17 5158 01 17 5159 01 17 5054 01 17 5157 01 17 1151 01 17 1152 01 17 5160 01 17 5161 01 Order online at www gelifesciences com orderonline Reversed phase chromatography column for AKTAdesign system Ordering inform
145. N class for AKTAcrossflow has been introduced SYS3 Customized training Customized training courses can deal with specific practical or theoretical topics within downstream processing They are an excellent way to increase the efficiency of your team and to train personnel to comply with cGMP requirements Modules can be given at a Fast Trak Center or on site at your facilities depending on the equipment involved Formal Training Certification is provided to trainees upon successful completion of the course Lectures or experiments may be used in different combinations and other topics may be included to match your specific requirements English is the language for most of our standard courses but we can offer customized modules in a variety of languages The format may be a seminar open to everybody in your company or a strictly confidential discussion about your specific work Workshops These one or two day Fast Trak workshops cover the latest topics related to regulatory and validation issues in bioprocessing e g column packing validation amp cleaning virus clearance validation etc Standard courses MEM1 Bioprocessing using Membrane Separations A two and a half day practical course on membrane separation techniques in downstream processing MAB1 Downstream Bioprocessing of Monoclonal Antibodies A three and a half day practical course on the downstream processing of antibody molecules using chromatogra
146. No RTP Capto Q 2 5 25 28 9017 23 9 RTP Capto Q 10 0 28 9017 24 H RTP Capto Q 20 20 28 9017 25 eH RTP Capto S 2 5 25 28 9017 29 RTP Capto S 10 0 28 9017 30 RTP Capto S 20 20 28 9017 31 RTP Capto adhere 2 5 25 28 9017 14 RTP Capto adhere 10 0 28 9017 15 RTP Capto adhere 20 20 28 9017 16 RTP MabSelect SuRe 2 5 25 28 9017 17 RTP MabSelect SuRe 10 0 28 9017 18 RTP MabSelect SuRe 20 20 28 9017 19 RTP Phenyl Sepharose 6 FF low sub 2 5 25 28 9017 35 RTP Phenyl Sepharose 6 FF low sub 10 0 28 9017 36 RTP Phenyl Sepharose 6 FF low sub 20 20 28 9017 37 Technical specifications 25 101 201 Inner diameter mm 126 251 359 Inner cross section cm 124 495 1012 Column volume I 2 5 9 9 20 2 Packed bed height mm 200 200 200 Net mesh um 23 23 23 Mechanical compression factor 12 5 15 12 5 15 12 5 15 Outer height mm 378 388 407 Outer diameter incl lid mm 195 342 484 Weight kg 6 25 55 nlet TC25 connectors tubing i d 6 3 mm 0 25 9 5 mm 0 375 12 7 mm 0 5 Outlet TC25 connectors tubing i d 6 3 mm 0 25 9 5 mm 0 375 12 7 mm 0 5 Ambient temperature C 4 30 4 30 4 30 Liquid temperature C 4 40 4 40 4 40 Maximum liquid pressure bar 4 4 4 Estimated shelf life yr 1 1 1 1 The mechanical compression factor varies depending on the medium 2 The temperature difference between the fluid running through the column and the ambient temperature in the room
147. ORN Historical Data Access allows any OPC client application access to the entire batch result generated by UNICORN e UNICORN OPC Security controls client access to the UNICORN OPC DA A amp E and HDA to protect sensitive information and to guard against unauthorized modification of process parameters This is an important security feature Network support Network support allows control and monitoring of systems from any connected UNICORN workstation subject to access rights defined by the system administrator UNICORN is specifically designed for Windows networks operating system control The figure below illustrates how it can be applied in a fully networked system This facility gives a larger number of operators access to what is happening Nevertheless security is still very controlled and subject to strict user defined access rights Network support also enables results to be automatically saved on a server Evaluation and generation of reports can then be made locally or at a remote PC Computer and networking specifications System Recommendations for UNICORN v 5 11 Workstation PC Pentium 4 1 5 GHz or higher 1024 Mb RAM 500 Mb disk space available at all times NTFS file system Controller CU 900 requires 1 2 length PCI slot CU 950 USB requires USB 1 1 Port CU 950 Advanced requires a 10 Mbit network interface card Network server Microsoft Windows 2003 Server TCP IP Operating system Windows 20
148. P 5 C 85 FP 5 E 85 FP 10 C 85 FP 10 E 85 FP 30 C 85 FP 30 E 85 FP 100 C 85 FP 100 E 85 FP 500 C 85 U U U U U U U U U U U UFP 500 E 85 Membrane fiber Membrane area inner diameter Cartridge length m ft NMWC mm cm in 3000 0 5 20 47 3 13 140 3000 1 120 47 3 8 8 95 5000 0 5 120 47 3 13 140 5000 1 20 47 3 8 8 95 10 000 0 5 120 47 3 3 40 10 000 i 120 47 3 8 8 95 30 000 0 5 20 47 3 13 140 30 000 1 120 47 3 8 8 95 100 000 0 5 120 47 3 13 140 100 000 1 120 47 3 8 8 95 500 000 0 5 20 47 3 13 140 500 000 1 120 473 8 8 95 Add 4 25 in 10 8 cm for straight adaptors MaxCell cartridge accessories Code No 56 4107 26 56 4107 27 56 4107 21 56 4107 22 56 4107 23 56 4107 28 56 4107 37 56 4107 38 56 4107 70 56 4106 79 56 4107 92 56 4107 39 56 4107 40 Model No RBMX 16PS ST RBMX 16PS EL RB16 12SS RB16 12FNPTSS RB16 16FNPTSS EL16 16SS KAMX 16PS KAMX 16EL PS CL16 LT G16S KO4ORS SWR MX01 SWR MX02 Description Straight adaptor for MaxCell Cartridge polysulfone Elbow adaptor for MaxCell Cartridge polysulfone 2 in TC to 1 5 in TC Concentric Adaptor 316L SS 2 in TC to 1 5 in female NPT Adaptor 304 SS 2 in TC to 2 in female NPT Adaptor 304 SS 2 in TC elbow 316LSS Straight Adaptor Kit for Installation Either kit KAMX 16PS or kit KAMX 16EL PS required for each new MaxCell Cartridge Contains 2 each RBMX 16PS ST straight adaptors polysulfo
149. PO Box 21 Rydalmere NSW 1701 AUSTRALIA Sales support to New Zealand China Beijing GE Healthcare Beijing Representative Office No 1 Yongchong North Road Beijing Economic amp Technological Development Area Beijing 100176 T 86 10 5806 9689 F 86 10 6787 1162 China Guangzhou GE Healthcare Guangzhou Representative Office Room 1212 Yian Plaza No 33 Jianshe 6 Road Guangzhou 510060 T 86 20 8363 3828 ext 67961 F 86 20 8363 4210 China Hong Kong GE Healthcare Bio Sciences Ltd L12 Office Tower Langham Place 8 Argyle Street Mongkok Kowloon HONG KONG T 852 2100 6300 Fax 852 2100 6338 Order Hotline 852 2100 6336 Email lifesciences ge com China Shanghai GE Healthcare Shanghai Representative Office 24 Floor Maxdo Centre No 8 Xinyi Road Shanghai 200137 T 86 21 5257 4650 ext 67337 F 86 21 5208 2008 India GE Healthcare Bio Sciences Ltd India Branch Office FF3 First Floor Palani Centre 32 Venkatnarayana Road T Nagar Chennai 600 017 INDIA T 91 44 2434 0747 F 91 44 2432 3770 Email supportdesk india ge com Sales support to Bangladesh amp Sri Lanka Japan GE Healthcare Bio Sciences KK Sanken Bldg 3 25 1 Hyakunincho Shinjuku ku Tokyo 169 0073 BioDirect Line T 81 3 5331 9336 F 81 3 5331 9370 Email Tech JP ge com Korea GE Healthcare Bio Sciences Ltd GE Tower 5F 71 3 Cheongdam dong Kangnam ku Seoul 135 100 Republic of Korea T 82 2
150. Pa to ensure minimized runtime at maximum flow rates or at 10 ml min 25 MPa pressure for applications using columns with higher back pressure and resolution 132 www gelifesciences com bioprocess Ordering information Product Code No AKTAexplorer 100 18 1112 41 AKTAexplorer 100 Air 18 1403 00 AkKTAexplorer 10 18 1300 00 AkKTAexplorer 10S 18 1145 05 gt gt For detailed information about AKTAexplorer systems please refer to AKTAexplorer chromatography systems data file Code No 18 1124 09 gt gt Visit us on the web at www gelifesciences com akta AKTApilot system rrr WY Wy AKTApilot is a high performance automated liquid chromatography system designed for process development process scale up scale down and small scale production The system has the capacity to purify from milligrams to tens of grams of product and is biocompatible hygienic and sanitizable AKTApilot meets all GLP and cGMP demands for Phase I III in drug development and final scale production e Hygienic design enables purification of microbial free and contaminant free products e High dynamic capacity flow capacity 4 to 400 ml min with 0 to 100 gradient 4 to 800 ml min flow with limited gradient possibility to purify 10 g product per cycle e Built in and EVB sanitary fraction collection valves for maximum use of bench space e Fast and convenient start with UNICORN Method Wizard for easy programming
151. Paque PREMIUM 181 221 Ficoll Paque PREMIUM 1 073 33 180 221 Ficoll Paque PREMIUM 1 084 33 180 221 Ficoll PM400 181 221 Filtration products 136 Cross flow filtration Hollow fiber cartridges 143 Cross flow filtration Kvick cassettes and holders 155 Cross flow filtration Systems 163 Filtration 138 Normal flow filtration ULTA cartridges 173 FineLINE columns 107 FlexStand benchtop pilot system 167 Flow through technology oligosynthesis 193 Fraction Collector Frac 950 134 www gelifesciences com bioprocess 249 jo6a7 pup saxapu Indexes and Legal G GammaBind G Type 2 221 Gelatin Sepharose 4 Fast Flow 72 87 221 Gel Filtration 82 Application guide 85 Selection guide 83 Glossary of terms 241 Glutathione Sepharose 4 Fast Flow 72 222 GrandStand pilot process systems 28 169 H Handbooks 208 Heparin Sepharose 6 Fast Flow 70 72 222 HIC See Hydrophobic interaction chromatography High Throughput Process Development 125 HiLoad columns 67 74 83 85 128 129 HiPrep columns 67 74 83 85 128 130 HiScreen columns 23 67 124 127 129 HiTrap Capto IEX Selection Kit 67 69 129 130 HiTrap columns 67 69 74 128 130 HiTrap HIC Selection Kit 74 128 130 HiTrap IEX Selection Kit 67 69 129 130 Hollow fiber cartridges See Cross flow filtration Hollow fiber cartridges See ReadyToProcess Hot Lips Tube Sealer 53 HTPD See High Throughput Process Development Hydrophobic interaction chromatography HIC 73
152. Performance are other products based on cross linked agarose These media are designed for robust high capacity high resolution ion exchange chromatography at various stages of process scale purification For many years they have been the industry standard for ion exchange of biomolecules Sephadex Other key products include Sephadex ion exchangers based on cross linked dextran beads and offering high capacities for batch or column mode SOURCE media for late intermediate purification and polishing also belong to a long line of ion exchangers specifically designed to meet the processing needs of the biopharmaceutical manufacturer Selection guide Capture Polishing Sephadex Sepharose High Performance effo Ke Sepharose Fast Flow XL Sepharose Big Beads SOUREL Q gt a Intermediate 2 purification a gt p C Getting started 3 a Testing the performance of separation For method development the new a media at the laboratory bench helps HiScreen as well as HiPrep and you select the best one for process HiLoad prepacked column ranges scale use are recommended depending on scale and column length They are convenient to use and give reproducible results HiTrap columns 1 ml and 5 ml are a particularly fast simple and reproducible way of testing different ion exchange media They can be HiScreen columns are 0 77 x 10 cm operated with a syringe a peristaltic 4 6 ml prepacked columns with
153. Sanitary Gasket EPDM KFSYO0107TCGO5 1 56 4112 86 Kvick Lab Holder torque wrench KLTW0001 56 4112 84 Kvick Lab Cassette Gasket KYLAGS001011 56 4113 64 Kvick Lab Cassette Gasket KYLAGS001033 5 56 4113 65 In line pressure gauge 0 4 barg 0 60 psig KLSY0105PGA60 56 4113 07 Kvick Lab Pressure Gauge Kit KLSYO1O5PRKIT 1 56 4113 69 1 2 inch Sanitary to 1 4 inch Hose Barb Adaptor KLSYO10SHB4F01 1 56 4115 26 1 2 inch Sanitary to 3 8 inch Hose Barb Adaptor KLSYO10S5HBFO1 56 4113 97 Technical specifications Kvick Lab cassette holders Feed retentate and permeate port fittings 1 2 in sanitary Dimensions W x L x H 13 2 x 22 6 x 16 7 cm 5 2 x 8 9 x 6 6 in Weight 7 7 kg 17 Ib Max temperature 121 C 250 F Max operating pressure 4 bar 60 psi Installable membrane area 0 01 0 55 m 0 11 6 0 ft System hold up volume 30 ml Materials of construction Wetted parts Non wetted parts Polished 316L stainless steel Ra v 0 8 um Tie rods washers stand Stainless steel Tie rod nuts Bronze Kvick Flow cassettes Ordering Information n Kvick Flow cassettes a Code No Model No Membrane area Cassette Qty 4 m ft NMWC 56 4113 49 UFEFLO0050505 S 0 46 5 5000 1 i m 56 4113 50 UFEFL 0010 050 SE 0 46 5 10 000 1 i 56 4113 47 UFEFL 0010 050 ST 0 46 5 10 000 1 56 4113 51 UFEFL 0030 050 ST 0 46 5 30 000 1 56 4113 52 UFEFL 0050 050 ST 0 46 5 50 000 1 n 56 4113 54 UFEFL
154. Security of supply Literature 198 203 204 206 207 208 Service and support Fast Trak BioPharma Services Fast Trak BioPharma Services provides practical support and advice to the developer of biotech products in particular biopharmaceuticals We can help you plan implement and document upstream and downstream purification processes from start up to routine production as well as train your personnel The services described here are supported by experts in a wide range of relevant specialist fields both from within GE Healthcare and from a network of outside suppliers Validation Validation is a key activity integrated into the development and implementation of a downstream process Fast Trak Validation staff continuously monitor world wide regulatory trends and together with the Fast Trak network of advisory consultants provide a wealth of knowledge relevant to your specific biotech project We can help you design document and implement downstream purification processes thus simplifying the journey to market The end results are time savings and cost efficiency Validation Documentation e System and Column Installation and Operational Qualification packages IQ OQs e Change Control Protocols CCPs for software updates and other modifications e Standard Operating Procedures SOPs for UNICORN controlled systems and Process columns Installation Qualification and Operational Qualificat
155. TC i d 36 mm 50 mm TC PEEK USP Class VI Code no 28 4057 58 O 50 25 36 50 e Connector i d 14 mm 25 mm TC i d 22 mm 50 mm TC PEEK USP Class VI Code no 28 4057 62 n gt qA 25 14 22 50 pA a Connector i d 10 mm 25 mm TC i d 22 mm 50 mm TC PEEK USP Class VI Code no 28 4057 59 N a H nN N u fo 7 y aanl i Connector i d 6 mm 25 mm TC i d 22 mm 50 mm TC PEEK USP Class VI Code no 28 4057 61 Connector i d 10 mm 25 mm TC i d 14 mm 25 mm TC PEEK USP Class VI Code no 28 4057 57 B d j 25 10 14 25 n Linch 25 mm UNF Standard for finer pitch which fits a lot of female connectors Connector i d 6 mm 25 mm TC i d 14 mm 25 mm TC PEEK USP Class VI Code no 28 4057 56 i aa 2516 14 25 b Connector i d 6 mm 25 mm TC i d 10 mm 25 mm TC PEEK USP Class VI Code no 28 4057 55 B Ic __b Wd Connector M6 i d 6 mm 25 mm TC PEEK USP Class VI Code no 28 4057 64 d F M6i 46 25 A Connector 3 4 20 UNF i d 10 mm 25 mm TC PP Code no 18 1012 68 7 r 25 to 3 4 20 UNF 14 f E Connector 3 4 20 UNF i d 6 mm 25 mm IC PP Code no 18 1012 67 np A i 2567 3 4 20 UNF 14 1 p Lawn Connector i d 6 mm Jaco i d 6 mm 6 PP Code no 18 4603 89 5 S Ie i
156. The Hot Lips Tube Sealer is a portable device that can heat seal thermoplastic tubing from 6 4 to 31 8 mm OD The seal forms a tamperproof and leakproof closure for securing tubes from bags bottles and other vessels The Hot Lips Tube Sealer is preprogrammed for many brands of tubing is fully automated for validatable operation and prevents fluids such as inoculum products media and buffers from leaking through tubing clamps and plugs Hot Lips Tube Sealer has a range of applications including e Sealing tubing attached to bags e Tamperproof sealing e Sampling e Shipping storage e Sealing transfer sampling lines Key features of Hot Lips Tube Sealer include e Keypad selectable programs for virtually all types and sizes of thermoplastic tubing up to 31 8 mm OD e No adapters required over the entire size range e Lightweight unit can be used anywhere in the plant or laboratory e Microprocessor controlled motor ensures reproducible and validatable performance Ordering information Product Quantity Code No Hot Lips Tube Sealer II preprogrammed to thermally seal C Flex Sanipure PVC Tygon and PharMed thermoplastic tubing from 6 4 to 31 8 mm OD 1 Calibration Verification Kit includes maintenance manual validation documents PC Kit with security key and jaw distance calibration tool 1 28 4117 04 28 4117 07 Technical specifications e 6 4 to 31 8 mm e Dry or fluid filled thermoplas
157. U Kvick UNF accessory Kit 11 0006 71 KSPOO1AKT Kvick Lab packet holder torque wrench 56 4112 84 KLTW0001 Technical specifications Materials of construction Kvick Lab packet Membrane Polyethersulfone Screen Polypropylene Encapsulant Silicone Gasket Silicone Preservative solution Kvick Lab packet holder Holder 0 1 0 2N NaOH and 20 22 glycerin 316L stainless steel with electropolished inner surface with Ra less than 0 63 um 25 pin 400 stainless steel threaded posts Luer lock adapters Polypropylene Luer lock adapter gasket EPDM UNF block PEEK Operating conditions Long term storage pH 2 13 Cleaning sanitization 1 14 Maximum inlet pressure Operating cross flow rate 4 barg 60 psig 60 ml min per 100 cm filter Literature Data File for Kvick Lab packet and holder 18 1171 60 AB User Manual for Kvick Lab packet holder 11 0003 86 AA www gelifesciences com bioprocess 161 sjonpoid uoo Cross flow filtration Systems AKTAcrossflow system UNICORN control software means one common control platform and user interface for all scales of operation in filtration and chromatography Scouting gives automatic support to process development and optimization Method wizards and pre programmed cleaning methods provide a high degree of efficiency UNICORN is compatible with all applicable regulations including 21 CFR Part 11 The system is for use with flat
158. USP 25 and a strain of yeast commonly found in production environments gave 6 log reduction results that fulfill the USP 25 requirements Ordering information Product Code No AKTApilo 18 1170 63 Additional items EVB 981 Inlet 28 4079 75 EVB 988 Outlet 28 4079 78 EVB Rack 28 4079 72 CIP Manifold 28 4009 03 3 KTApilot Tubing Kit Column 18 1167 68 8 AKTApilot Valve Membrane CPL 18 1169 10 bY AKTApilot Elbow 90 TC25 Short 18 1169 19 Qa AKTApilot TUBE S7 CPL 18 1169 71 2 AKTApilot TUBE S8 CPL 18 1169 75 Wetted parts kit 18 1171 07 no O ring top air trap 18 1169 12 3 Connector M6 fem 5 16 fem 18 1169 17 3 Connector M6 fem 5 16 male 18 1169 16 Clamp TC 25 18 1169 18 Connector TC 5 16 fem 18 1169 22 Connector TC 5 16 male 18 1169 23 TC gasket 25 4 mm 18 1169 24 TC gasket 25 6 5 mm 18 1169 25 T connector 5 16 24 18 1170 59 Connector 5 16 fem 5 16 fem 18 1173 51 Data Files KTApilot 18 1167 90 UNICORN Control System 18 1156 35 gt gt Visit us on the web at www gelifesciences com akta www gelifesciences com bioprocess 133 Fraction Collector Frac 950 Technical specifications Fraction Collector Frac 950 Flow rate range 0 001 ml min 100 ml min Rack A 120 x 18 mm tubes 8 x 30 mm tubes Optional racks Rack B 240 x 12 mm tubes Rack C 8 x 30 mm tubes 4 microplates 96 wells per plate Rack D 45 x 30 mm tubes Rack E 80 x 30 mm tubes Rack F
159. W x L x H 38 x 61 x 53 cm 15 x 24 x 21in Weight approximate 68 kg 150 Ib Max operating temperature 60 C 140 F Max temperature 121 C 250 F Max inlet pressure 4 bar 60 psi Installable membrane area 0 01 to 0 55 m 0 11 to 6 0 ft System hold up volume v 30 ml Materials of construction Wetted parts Polished 316L stainless steel Ra v 0 8 um www gelifesciences com bioprocess 165 Filtration products QuixStand systems ve Versatile QuixStand system accommodates Xampler cartridge sizes 3M 3X2M 4 4M and 4X2M e Rapid processing of volumes up to 10 liters e Quick easy cartridge change out e Low hold up volume allows concentration to as low as 30 to 50 ml e Reservoir can be pressurized for gentle recirculation of labile solutions e Accommodates Xampler cartridge sizes 3M 3X2M 4 4M and 4x 2M QuixStand benchtop system is a compact laboratory scale separation system that uses GE Healthcare membrane cross flow filtration cartridges Fitted with a hollow fiber cartridge QuixStand gives quick efficient concentration and diafiltration of a wide range of biological solutions The system rapidly processes solution volumes up to 10 liters As well as concentrating to volumes as low as 30 to 50 ml the low hold up design provides speed efficiency and true scale up data impossible to achieve using conventional dialysis or stirred cells 166 www gelifesciences com bioprocess The basic Qui
160. X2M 4M 4X2M 4 Permeate connections 3M 3X2M 4 4M 4X2M Membrane area nominal Hold up volume nominal Lumen side Shell side Autoclavable Materials of construction Hollow fibers Shell Luer Lok fittings Potting Fiber bundle 0 9 cm 0 375 in 1 9 cm 0 75 in 31 7 cm 12 5 in 63 5 cm 25 in 36 2 cm 14 25 in 34 5 cm 13 6 in 66 cm 26 in 0 5 in Tri Clamp 0 375 in Tubing barb 0 25 in Tubing nipple 0 375 in Tubing nipple 110 1400 cm 17 216 in 2 30 ml 5 75 ml All except 1000 NMWC models Polysulfone Polysulfone Polycarbonate Epoxy Polypropylene Pilot scale hollow fiber cartridges To bridge the several steps between research and production volumes GE Healthcare offers a full range of pilot scale ultrafiltration and microfiltration hollow fiber membrane J cartridges These cartridges feature industry standard 1 5 in Tri Clamp sanitary feed and retentate fittings Both 30 and 60 cm flowpath lengths are offered with cartridges that provide an order of magnitude membrane area span from 0 12 to 1 15 m 1 3 to 12 5 ft Please feel free to contact our technical support team for guidance with linear scaling parameters for small volume processing y l Uiii GE Healthcare s FlexStand benchtop system product line is designed to suit the entire range of pilot scale cartridges Two basic models are offered with optional peristaltic or rotary lobe pumps a
161. al data CIP stability working 2 14 Composition cross linked agarose Particle size 34 um average d 50 voll Binding capacity lon capacity pH stability operational 2 12 CIP stability short term 2 14 Pressure flow spec bed height 30 cm min 75 cm h 250 kPa BioPilot 60 100 column 120 mg HSA ml drained medium 0 14 0 20 mmol Cl ml medium E Q Sepharose XL See p 69 130 Pack size Code No 300 ml 17 5072 01 5 17 5072 04 101 17 5072 05 601 17 5072 60 Data File 18 1123 82 Regulatory Support File 11 0028 33 Prepacked columns HiPrep 16 10 Q XL 17 5092 01 HiTrap Q XL 5x1 ml 17 5158 01 HiTrap Q XL 5x5 ml 17 5159 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 Technical data Composition cross linked 6 agarose with dextran coating Particle size 45 165 um Binding capacity gt 130 mg bovine serum albumin ml medium lon capacity 0 18 0 26 mmol Cl ml medium pH stability operational 2 12 CIP stability working 2 14 Flow rate 300 500 cm h 230 www gelifesciences com bioprocess Flow rate 300 500 cm h QAE Sephadex A 25 See p 68 Pack size Code No 100g 17 0190 01 500 g 17 0190 02 5kg 17 0190 03 Data File 18 1117 58 Regulatory Support File 11 0028 96 Technical data Composition Particle size pH stability operational CIP stability short term Pressure flow spec cross linked dextran dry 40 125 um 2 10 2 13 min 100 cm h pressure drop cm H O
162. al support online 31 91 205 Technique handbooks 208 Terms and conditions of sale 242 Trademarks 246 Training courses Fast Trak 201 U ULTA Prime CG 175 ULTA Prime GF 176 ULTA Prime PP 177 ULTA Pure HC 28 174 ULTA Pure SG 28 173 Ultrafiltration 138 UNICORN control 119 UniFlux systems 171 Upstream and Downstream magazine 208 V Validation Fast Trak 198 VIIISelect 72 87 229 WAV1 Fast Trak Course 30 201 WAVE systems 38 Bioreactor System 2 10 44 Bioreactor System 20 50 43 Bioreactor System 200 42 Bioreactor System 500 1000 41 WAVEPOD integrated controller 45 WAVE Mixers 46 Workshops Fast Trak 201 X Xampler laboratory cartridges 146 www gelifesciences com bioprocess 253 jo6a7 pup saxapu Notes Notes Notes 2008 General Electric Company All rights reserved First published June 2008 GE Healthcare UK Ltd Amersham Place Little Chalfont Buckinghamshire HP7 9NA UK GE Healthcare Europe GmbH Munzinger Strasse 5 D 79111 Freiburg Germany GE Healthcare Bio Sciences Corp 800 Centennial Avenue P O Box 1327 Piscataway NJ 08855 1327 USA GE Healthcare Bio Sciences KK Sanken Bldg 3 25 1 Hyakunincho Shinjuku ku Tokyo 169 0073 Japan For contact information for your local office please visit w
163. ality control both during development and at full scale production Specific studies such as stability can be performed and Regulatory Support Files can be provided Custom products GE Healthcare offers a large selection of prepacked columns and bulk media encompassing most liquid chromatography techniques Should you require a special configuration or combination of column and medium not offered in the catalog just contact your local sales office and ask for Custom Products gt gt See also Process Development on page 128 for details Ordering information Product 6 AKS Sepharose 4 Fast Flow Amino Sepharose 6 Fast Flow ANX Sepharose 4 Fast Flow low sub AVB Sepharose High Performance Benzamidine Sepharose 4 Fast Flow high sub Benzamidine Sepharose 4 Fast Flow low sub Butyl Sepharose 6 Fast Flow Capto Blue hs Chelating Sepharose Big Beads CM Sepharose High Performance ECH Lysine Sepharose 4 Fast Flow Gelatin Sepharose 4 Fast Flow IgG Sepharose 6 Fast Flow IgSelect Phenyl Sepharose Big Beads Plasminogen Removal Gel Procainamide Sepharose 4 Fast Flow villSelect Pack size 1 1 500 ml 75 mi 100 ml 500 ml 5l 5i 1l S 25 ml 500 ml 101 101 500 ml 200 ml 25 ml 200 ml 25 ml 500 ml Code No 17 3100 04 17 3092 09 17 1286 01 17 1286 04 28 4112 01 28 4112 02 17 5123 01 17 5123 02 17 5123 03 28 4108 03
164. all important functions in a UNICORN controlled computer system as well as for column packing SOPs describe how to use and maintain the system and equipment during regular operation They need to be in place for systems and equipment used in an environment regulated according to cGMP SOPs are offered in sets of related documents as hard copy or in Microsoft Word The electronic copy can be used to modify or customize the template SOPs The benefits of using these template SOPs are shorter implementation time reduced development costs and fewer regulatory setbacks www gelifesciences com bioprocess 199 yoddns pup ad1asas H Service and support Process Development services Fast Trak Biopharma services can support you with hands on process development assistance in the screening and optimization of purification protocols using both standard chromatographic media and Custom Designed Media prototypes scale up and scale down studies and troubleshooting of both filtration and chromatographic operations At our centers in the USA Europe China and India we have fully equipped laboratories and highly skilled scientists with many years of experience in industrial bioprocessing Fast Trak process development projects can be run at your facility or at one of our Fast Trak Centers as your needs dictate Typically a Fast Trak process development project starts during the pre clinical phase However even at late
165. als These media are the first choice for separating crude mixtures early in purification schemes Here a combination of good resolution and high flow rate is essential Typical flow velocities for these media are 100 to 400 cm h Sepharose High Performance Where high resolution is essential for intermediate purification and polishing These media are well suited for intermediate purification and polishing Use them when resolution and capacity have priority Typical flow velocities are 100 cm h SOURCE For rapid high resolution preparative separations at low or high pressure SOURCE ion exchangers are monosized rigid polystyrene divinyl benzene matrices for chromatography of proteins peptides and oligonucleotides SOURCE 15Q and 15S media are well suited for complex separations during polishing SOURCE 30Q and 30S are for intermediate purification and large scale polishing Typical flow velocities are up to 1000 cm h at large scale and even higher on the laboratory bench HiTrap Capto IEX Selection Kit Code no 28 9343 88 New This kit provides five different ion exchange ligands based on Capto enabling convenient and easy screening Contains five 1 ml HiTrap columns prepacked with Capto Q Capto S Capto DEAE Capto MMC Capto adhere as well as connectors and instructions HiTrap IEX Selection Kit Code No 17 6002 33 This kit allows fast and easy screening of seven different ion exchange ligands based on Sepharose Fast Flow an
166. alve fractional sanitary drain High pressure shut off switch 1 Tubing connector kit KTC 2 Set of clamps gaskets piping tubing Assembly guide Same as FS O2RLP except with 220 v 50 Hz electrical system Low void volume FlexStand Benchtop Pilot Cartridge Support Assembly with fractional Tri Clamp connections rotary lobe pump Includes Qty Description Stand and support rods with manifold 2 Pressure gauge back mount 0 4 barg 0 60 psig mechanically dampened Rotary lobe recirculation pump FlowTech LABTOP 250 with low point drain Gear box for LABTOP 250 pump 2 Diaphragm valve fractional sanitary High pressure shut off switch Tubing connector kit KTC FS 03VS Set of clamps gaskets piping tubing Assembly guide 56 4107 59 FS O4LVS RLP 50 Same as FS O4LVS RLP except with 220 v 50 Hz electrical system 56 4107 57 FS 02RLP 50 56 4107 58 FS O4LVS RLP 0 2 barg 0 30 psig gauges may be substituted www gelifesciences com bioprocess 167 sjonpoid uoo Filtration products FlexStand benchtop pilot options Other options Pumps rotary lobe Code No Part No Description FlowTech LABTOP rotary lobe pumps incorporate variable speed drive and a 56 4107 62 KFSMO4 Conversion kit to change standard FlexStand to manual control system LABTOP 250 pumps have a vertical pump head fractional low void volume assembly Iii Clamp ings and
167. alyze Improve and Control processes that affect quality and operational objectives Work Out Work Out was developed at GE to bust bureaucracy and improve the decisionmaking process Using a structured problemsolving approach and facilitation tools a team is empowered to develop solutions and ensure completion of action plans Work Out helps to break down organizational barriers by developing cross functional teams and creating a culture that can quickly address key issues reach consensus and implement the best solutions Change Acceleration Process CAP GE s Change Acceleration Process CAP provides a structured framework and a comprehensive set of tools to quickly mobilize teams and generate enthusiasm With CAP organizations are able to overcome resistance develop a common approach to managing change build leadership and facilitation skills and establish organizational alignment www gelifesciences com bioprocess 203 yoddns pup ad1nsas ke Service and support 204 Online regulatory and technical support Regulatory Support Files GE Healthcare pioneered the development of Regulatory Support Files to provide customers with detailed information about performance stability extractable compounds and analytical methods for BioProcess media This information is an invaluable starting point for process development and validation for preparing Standard Operating Procedures
168. am sterilization cycle A 0 5 in sanitary of the housing shell to ensure complete GE Healthcare offers a complete SIP pro the rigors of a full validation and maximi protocol ocol To ensure that the cycle will support ze the cartridge lifetime GE Healthcare strongly suggests that customers adhere to all recommendations of the SIP Cross flow filtration Kvick cassettes and holders Kvick Start cassettes Ordering information Code number Model number Membrane area Cassette Quantity cm NMWC 11 0006 02 UFESTOOOSOSOST 50 5kD 1 11 0006 04 UFESTOO10050SE 50 10kD 1 11 0006 03 UFESTOO10050ST 50 10kD 1 11 0006 05 UFESTOO30050ST 50 30 kD 1 11 0006 06 UFEST0050050ST 50 50 kD 1 11 0006 08 UFESTO100050ST 50 100 kD 1 11 0006 61 UFESTCPAKO45ST 50 per cassette 5 10 10 30 5 50 and 100 kD 10 kD Select membrane is a tighter 10 kD membrane and is particularly effective for recombinant proteins Technical specifications Kvick Start cassettes are for research product Materials of construction development lab scale evaluations and process Housing neil cif ae a Membrane Polyethersulfone development where starting material is limited Membrane screen Polypropylene Port Sealer Solvent free urethane meth acrylate blend A K x Inner plates Polyester copolymer e UNF fittings for use in the AKTAcrossflow instrument and Shinning solution 20 22 glycerin by weight Luer lok adapters for use in virt
169. amiliar to many operators conversant with GE Healthcare chromatography systems from bench top AKTAdesign to production scale AKTAprocess Uniflux Systems amp Accessories System Description UniFlux 30 AH CFF system for Hollow fiber 60 Ipm UniFlux 120 AH CFF system for Hollow fiber 120 Ipm UniFlux 400 AH CFF system for Hollow fiber 400 Ipm UniFlux 10 AC CFF system for Kvick Lab cassette 10 Ipm UniFlux 30 AC CFF system for Kvick Flow cassette 60 lpm UniFlux 120 AC CFF system for Kvick Flow cassette 120 lpm UniFlux 400 AC CFF system for Kvick Flow cassette 400 Ipm Accessories Description UniFlux 10 UV Permeate UV sensor UniFlux 30 UV Permeate UV sensor UniFlux 120 UV Permeate UV sensor UniFlux 400 UV Permeate UV sensor UniFlux 10 Transfer pump Transfer pump 2 3 Ipm UniFlux 30 Transfer pump Transfer pump 19 lpm UniFlux 120 Transfer pump Transfer pump 19 lpm UniFlux 400 Transfer pump Transfer pump 60 Ipm UniFlux 10 Permeate control pump Permeate control pump 2 3 Ipm UniFlux 30 Permeate control pump Permeate control pump 19 lpm UniFlux 120 Permeate control pump Permeate control pump 19 lpm UniFlux 400 Permeate control pump Permeate control pump 60 lpm UniFlux 10 Conversion Cass to HF Kit for conversion from cassette to Hollow fiber system Kit for conversion from cassette to Hollow fiber system iFlux 30 Conversion Cass to HF f 2 T Kit for conversion from cassette to Hollow fibe
170. ance Solutions Scientific Asset Services Ficoll Paque PREMIUM 1 073 and 1 084 27 28 28 29 10 gi Sil 32 52 55 Product highlights ReadyToProcess Platform New ReadyToProcess is a new platform of ready for use products designed to provide maximum flexibility The products simplify and speed up bioprocessing reducing upfront investment and accelerating development The platform also helps eliminate wasteful practices and increases manufacturing agility ReadyToProcess products provide smooth interconnectivity and seamless scalable implementation in biopharmaceutical operations ReadyToProcess WAVE systems cr WAVE Now part of GE Healthcare GE Healthcare acquired WAVE Biotech LLC and its subsidiary WAVE Europe Pvt Ltd in April 2007 The acquisition enables GE Healthcare to expand its offering of products and services for the manufacture of biopharmaceuticals especially in its focus areas of antibodies and vaccines GE Healthcare s new line of WAVE disposable technologies are state of the art products for the biopharmaceutical industry These patented products offer a range of advantages including rapid installation reduced time to market and lower costs due to the elimination of the need for cleaning and validation WAVE Bioreactors comprise a rocking platform and a cell culture bag to form a closed sterile system for cell culture The systems are capable of handling quantities of 0
171. and immobilization media at the laboratory bench will NH 6 AKS Sepharose 4 Fast Flow Ligand immobilization Epoxy activated Sepharose 68 Ligand immobilization help you select the best one for ieee Amino Sepharose 6 Fast Flow Ligand immobilization T COOH CHO process scale use All of the media Immunoglobulins described in this section can be ordered as laboratory sized packs gt gt Turn to page 212 for the A Z of media and chemicals IgSelect MabSelect MabSelect SuRe MabSelect Xtra rmp Protein A Sepharose Fast Flow rProtein A Sepharose 4 Fast Flow nProtein A Sepharose 4 Fast Flow Protein G Sepharose 4 Fast Flow Human IgG all subclasses gG some IgM and IgA gG some IgM and IgA gG some IgM and IgA gG some IgM and IgA gG some IgM and IgA gG some IgM and IgA gG Histidine tagged proteins Ni Sepharose 6 Fast Flow IMAC Sepharose 6 Fast Flow Polyhistidine tagged proteins Polyhistidine tagged proteins GST tagged proteins gt gt This table is only a brief guide to application areas for our affinity Glutathione Sepharose 4 Fast Flow Glutathione S transferase GST agged proteins other glutathione S transferases and glutathione binding proteins media For further information on Growth factors Heparin Sepharose 6 Fast Flow Blue Sepharose 6 Fast Flow Fibroblast growth factor FGF endothelial cell growth factor ECGF these applications please contact
172. any inconsistency with these Terms and Conditions gt Qa o x p wn Q a o Q 21 Translations and Local Variations Translations of these terms and conditions are available from the sales offices of GEHC In some territories local variations to these Terms and Conditions may apply If so such variations shall take precedence in the event of any inconsistency with these Terms and Conditions www gelifesciences com bioprocess 245 Indexes and Legal Trademarks GE Healthcare trademarks AKTA AKTAbasic AKTAcrossflow AKTAdesign AKTAexplorer AKTArptc AKTApilot AKTAprime AKTAprocess AKTApurifier AxiChrom Biacore BioPilot BioProcess BPG Capto Cellbag Chromaflow Cytodex Cytoline Cytopore Downstream Drop Design Ettan Fast Trak Validation Ficoll Ficoll Paque FineLINE Flexstand GammaBind Grandstand GSTrap GSTPrep GraviTrap HiLoad HiPrep HiScreen HisPrep HisTrap HiTrap Hot Lips Tube Sealer INdEX Kvick Kvick Flow Kvick Lab Kvick Process Kvick Start MabSelect MabSelect Xtra MabSelect SuRe MacroCap Media Wand MidGee MidJet MultiTrap OligoPilot OligoProcess Oligosynt Percoll Primer Support Quixstand ReadyToProcess RESOURCE Sephacryl Sephadex Sepharose SOURCE STREAMLINE Superdex Superose Tricorn ULTA UNICORN Uniflux WAVE WAVE Bioreactor WAVE Mixer WAVEPOD and Xampler are trademarks of GE Healthcare companies GE imagination at work and the GE mo
173. ap MabSelect 1x5 ml 28 4082 55 Technical data HiTrap MabSelect 5x5 ml 28 4082 56 Composition highly cross linked 6 agarose HiScreen MabSelect 4 7 ml 0 77 x 10 cm 28 9269 73 Particle size 90 um average d val 96 well filter plates Metal ion capacity 15 umol Ni ml drained medium PreDictor MabSelect 6 ul 4 x 96 well plates 28 9258 20 Dynamic binding PreDictor MabSelect 20 ul 4 x 96 well plates 28 9258 21 capacity 40 mg histidine tagged protein ml PreDictor MabSelect 50 ul 4 x 96 well plates 28 9258 22 medium protein and metal ion dependent pH stability operational 3 12 PH stability short term 2 14 Pressure flow spec 100 kPa XK50 60 column bed height 25 cm base matrix 200 400 cm h Lentil Lectin Sepharose 4B See p 72 Pack size Code No 25 ml 17 0444 01 11 17 0444 03 Regulatory Support File 11 0028 92 Technical data Composition 4 agarose Particle size 90 um average d Ligand lentil lectin Ligand density Coupling chemistry CNBr pH stability operational 3 10 CIP stability short term 3 10 Pressure flow spec base matrix 70 140 cm h 2 mg lentil lectin ml drained medium pressure drop cm H O bed height 15 bed height 10 cm cm 5 cm i d Technical data Composition Particle size d a 85 um Ligand Coupling chemistry epoxy highly cross linked agarose recombinant Protein A E coli Dynamic binding capacity min 30 mg human IgG ml medium at 2 4 min residence time
174. aphy columns AxiChrom INdEX BPG Chromaflow FineLINE Manufacturing Solutions Bioprocessing Enabling fast development and efficient production 12 be Bioprocessing 12 Enabling fast development and efficient production Taking biopharmaceuticals from research to market involves transfer from the lab bench through first in human trials to widespread use by patients Great care is needed to ensure high quality while not jeopardizing efficacy or process economy Meanwhile the clock is running production schemes need to be finalized as quickly as possible to ensure maximal returns To help you meet these challenges GE Healthcare continues to develop products platform technologies and services to help you achieve fast development and efficient and robust production Time to clinic is key Optimizing your production processes offers competitive advantages and is essential to both drug discovery and production However discovery labs and pilot plants impose very different challenges on these production processes The challenges are to take methods from an explorative discovery environment manage them through testing and clinical trials and then optimize them to meet the stringent demands of a highly regulated production environment All the time the pressure is on to secure drug safety and ensure process robustness and economy Our aim is to help teams plan experiment and optimize manage regulatory re
175. ar at 40 60 C and max 1 bar at 60 80 C Literature Data File AKTAprocess 11 1135 43 www gelifesciences com bioprocess 117 swaysfis iydpiboywoiyD Chromatography systems Customized BioProcess Solutions For some applications only customized solutions fit the bill Through its Customized BioProcess Solutions CBS group GE Healthcare can offer a wide range of engineered solutions for chromatography membrane filtration and oligonucleotide synthesis The CBS group has more than 20 years experience of engineering systems and columns to meet customer s application needs specifications and regulatory requirements The choice of components materials manufacturing methods and system configuration are made by the gt gt For more information please contact your local GE Healthcare representative or visit the CBS homepage www gelifesciences com cbs customer in consultation with our engineers to ensure performance and compatibility Choice of control software includes DeltaV UNICORN PLC or any other requirement Auxiliary equipment can also be manufactured according to specifications CBS DeltaV Standard Control Platform CBS DeltaV Standard Control Platform is a flexible control software that simplifies process automation of protein purification by industrial scale chromatography The control platform employs Emerson DeltaV software which has a solid track record of providing excellent
176. arious compounds such as proteins endotoxins DNA plasmids vaccines and viruses ReadyToProcess columns provide a range of benefits including e Time savings by eliminating several time consuming steps Cost savings by lowering buffer consumption and reducing cleaning validation demands Process security robust column construction and performance Scalability by facilitating conventional approaches in larger scales Reduced cross contamination gt gt Visit us on the web at www gelifesciences com readytoprocess www gelifesciences com readytoprocess ReadyToProcess chromatography columns offer the possibility to work in a fully flexible mode in early clinical phases while keeping a conventional re use option for large scale manufacturing open The chromatography media used in ReadyToProcess columns have a long track record of use in full scale manufacturing using conventional large scale chromatography where columns can be used for tens or hundreds of cycles The transition from ReadyToProcess format to full scale manufacturing is therefore straightforward Currently the following BioProcess media are available in the ReadyToProcess format MabSelect SuRe Capto Q Capto S Capto adhere and Phenyl Sepharose 6 Fast Flow low sub In addition several of GE Healthcare s other BioProcess chromatography media are available on request Ps 2 Ordering information Product Column size Code
177. as to he Cellbag for insect cell virus and high cell density applications Maintains low oxygen environment for near anaerobic applications Range 0 to 50 O pH Controller e Enables continuous pH measurement and control using CO or acid base addition e Electrochemical probe is single use and available pre installed in Cellbags Loadcell e Enables online measurement of weight e Used for automated fill harvest and perfusion operations where precise volume control is critical Perfusion Controller Perfusion controller with Loadcell 1 Instrument Modules are available in WAVEPOD or as stand alone units for System 2 10 and System 20 50 Fully integrated modules are available for System 200 and System 500 1000 2 Fully integrated in System20 50 option System200 and System500 1000 standard 3 For System 2 10 instrument only www gelifesciences com readytoprocess 39 ssa00igo fippay ReadyToProcess 40 Overview Systems Unit Working volume range Integral features Options Weight Dimensions Power System 500 100023 50 to 500 e Speed angle control e Temperature control e Aeration e Loadcell e CO2MIX e O2MIX e DO pH with Kit 500EH 925 kg with Kit 1000EH 1020 kg 201 x 124 x 160 cm with Kit 500EH 226 x 124 x 160 cm with Kit 1000EH 226 x 231 x 160 cm e 200 to 240 VAC e 50 60 Hz 30 A e 3 Phase e Phase phase 5 e NEMA L2130 plug Sys
178. atch documentation and report generation UNICORN Method Development i Scale zE Scale up down a up down Lab Scale Pilot Scale Manufacturing UNICORN methods can be transferred between systems at different scales Validation support UNICORN is fully compliant with 21 CFR Part 11 and is extensively documented for validation purposes A Validation Support File is available describing our software development model including routines and test models gt gt Installation and Operational Qualification documentation packages consisting of preprinted forms and test methods are also available see p 198 OPC Connectivity The UNICORN OPC server provides a standardized integration interface to support integration between UNICORN and other software systems such as laboratory information systems LIMS and manufacturing execution systems like DCS and MES OPC enables open connectivity via open standards created in collaboration with a number of worldwide leading automation manufacturers including Microsoft UNICORN OPC server supports the following four areas e UNICORN OPC Data Access gives access to all process data e g real time values valve status process step information and commands e UNICORN Alarm amp Events server informs an OPC client application that a system parameter has exceeded an upper or lower limit value The UNICORN Alarm amp Events server also provides information about the process LogBook e UNIC
179. ation Product Code No 17 5068 01 Quantity SOURCE 15RPC ST 4 6 100 1 Order online at www gelifesciences com orderonline Column not suitable for use with AKTAprime plus chromatography system Please contact us for assistance with selection of columns for AKTAprime plus Prepacked columns for purification of high quality plasmid DNA Ordering information Product Quantity Code No PlasmidSelect Xtra Starter Kit ji 28 4052 68 PlasmidSelect Xtra Screening Kit 1 28 4052 69 Order online at www gelifesciences com orderonline www gelifesciences com bioprocess 129 ua wdoj n p SS JOld Process development Selection kits In addition to the individual columns there are a number of selection kits available These kits usually contain three to seven prepacked columns that enable you to quickly screen potential media IEX Selection Kit Eight different Sepharose media differentiated by process stage For Capture Q Sepharose Big Beads and SP Sepharose Big Beads in 50 ml packs For Intermediate Purification Q Sepharose Fast Flow SP Sepharose Fast Flow CM Sepharose Fast Flow and DEAE Sepharose Fast Flow in 50 ml packs For Polishing Q Sepharose High Performance and SP Sepharose High Performance in 1 ml prepacked HiTrap columns HiTrap Capto IEX Selection Kit 28 9343 88 New Five different ion exchange ligands on Capto enable convenient and easy screening Contains five 1 ml HiTrap columns prepac
180. bed height 5 bed height 10 cm 5 cmi d QAE Sephadex A 50 See p 68 Pack size Code No 100g 17 0200 01 5 kg 17 0200 03 Data File 18 1117 58 Regulatory Support File 11 0028 97 Technical data Composition Particle size pH stability operational CIP stability short term Pressure flow spec cross linked dextran dry 40 125 um 2 10 2 13 min 60 cm h pressure drop cm H O bed height 10 bed height 10 cm 5 cmi d E Sephacryl S 100 High Resolution See p 84 85 E Sephacryl S 300 High Resolution See p 84 85 Pack size Code No Pack size Code No 150 ml 17 0612 10 150ml 17 0599 10 750 ml 17 0612 01 750ml 17 0599 01 101 17 0612 05 101 17 0599 05 Data File 18 1009 28 Data File 18 1009 28 Regulatory Support File 11 0028 36 Regulatory Support File 11 0028 36 Prepacked columns Prepacked columns HiPrep 16 60 Sephacryl S 100 HR 120 ml 17 1165 01 HiPrep 16 60 Sephacryl S 300 HR 120 ml 17 1167 01 HiPrep 26 60 Sephacryl S 100 HR 320 ml 17 1194 01 HiPrep 26 60 Sephacryl S 300 HR 320 ml 17 1196 01 Technical data Technical data Composition allyl dextran and N N methylene bisacrylamide Particle size 50 um Fractionation range globular proteins 1x10 1x105 pH stability operational 3 11 CIP stability short term 2 13 Pressure flow spec flow at 100 kPa gt 125 cm h XK 50 30 column bed height 15 cm Composition ally dextran and N N methylene bisacrylamide Particle
181. chanical strength Film seal strength gt 67 N cm Cellbag 22 I pH version 1 Cope 10 0 Cellbag 50 1 CB0050L10 01 Cellbag 50 includes 500 g FibraCel 1 CB0050L10 07 Cellbag 50 Oxywell version 1 CBOO50L10 02 Cellbag 50 perfusion version 1 CBOO50L10 04 Cellbag 50 pH version 1 CBOO50L10 05 Cellbag 100 Oxywell version 1 CBO100L10 02 Cellbag 100 pH version 1 CBO100L10 05 Cellbag 200 Oxywell version 1 CBO200L10 02 Cellbag 200 pH version 1 CB0200L10 05 Cellbag 500 pH version 1 CBO500L10 05 Cellbag 1000 pHversion 1 CB1000L10 05 Check valve 2 50 pack of 25 1 WV050087 Check valve 100 200 pack of 50 1 WV050088 Clave sampling valve on 1 4 OD C Flex 1 TKOO1 PVC tubing with press in plug 1 TKOO2 Tube Kit PVC and Silicone tubing with T connectors 1 TKOO3 www gelifesciences com readytoprocess 49 wn N o Q aa gt me io ay ReadyToProcess connectivity GE Healthcare s line of solutions ReadyToProcess ReadyToProcess systems and connectivity products provide the accessories are supported by links between our systems and integrated devices that help maintain components allowing rapid secure secure connectivity throughout the workflows and maintaining sterile manufacturing process Simple integrity sterile connections between media bags as well as leak proof seals of th jastie tubi gt gt Visit us on the web at ee ial www gelifesciences com of ReadyToProcess connecti
182. chemistry pH stability operational CIP stability short term Pressure flow spec 222 www gelifesciences com bioprocess NHS 17 mg ml at 2 4 min residence time Coupling chemistry Dynamic binding capacity At least 600 cm h in a 1 m column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at lt 3 bar 0 3 MPa 3 11 2 13 Pressure flow specification pH stability long term pH stability short term IgG Sepharose 6 Fast Flow See p 87 Pack size Code No 10 ml 17 0969 01 200 ml 17 0969 02 5 17 0969 04 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d va CNBr human polyclonal IgG Coupling chemistry Ligand 5 mg Protein A ml drained medium 3 10 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Capacity pH stability operational Pressure flow spec E IMAC Sepharose 6 Fast Flow See p 70 72 E MabSelect See p 71 72 Pack size Code No Pack size Code No 25 ml 17 0921 07 25ml 17 5199 01 100 ml 17 0921 08 200ml 17 5199 02 1l 17 0921 09 1l 17 5199 03 5l 17 0921 10 5l 17 5199 04 Data File 28 4041 06 101 17 5199 06 Regulatory Support File 11 0029 31 Data File 18 1149 94 Prepacked columns Regulatory Support File 11 0028 20 HiTrap IMAC FF 5x1 ml 17 0921 02 Prepacked columns HiTrap IMAC FF 5x5 ml 17 0921 04 HiTrap MabSelect 5x1 ml 28 4082 53 HiPrep IMAC FF 16 10 17 0921 06 HiTr
183. chromatography experiment Incubation die f S ia g gt g g equilibration sample loading wash and elution Vacuum filtration or centrifugation Vacuum filtration or centrifugation o s b b Analysis www gelifesciences com bioprocess 125 juawidojanap Ss 201d Process development PreDictor 96 well filter plates PreDictor 96 well filter plates are prefilled with BioProcess chromatography media They are developed to support HTPD by allowing parallel screening of chromatographic conditions either in a manual or in an automated workflow Data generated by using PreDictor plates show good correlation with data obtained in chromatography columns which makes the plates an excellent tool for initial screening of process conditions Ordering information Product Quantity Code No PreDictor Capto Q 2 ul 4 x 96 well filter plates 28 9257 73 PreDictor Capto Q 20 ul 4 x 96 well filter plates 28 9258 06 PreDictor Capto Q 50 ul 4 x 96 well filter plates 28 9258 07 PreDictor Capto S 2 ul 4 x 96 well filter plates 28 9258 08 PreDictor Capto S 20 ul 4 x 96 well filter plates 28 9258 09 PreDictor Capto S 50 ul 4 x 96 well filter plates 28 9258 10 PreDictor Capto DEAE 2 pl 4 x 96 well filter plates 28 9258 11 PreDictor Capto DEAE 20 ul 4 x 96 well filter plates 28 9258 12 PreDictor Capto DEAE 50 ul 4 x 96 well filter plates 28 92
184. compatibility Inherently hydrophilic membrane Technical specifications Filtration area Recommended operating conditions 2 Capsule 0 05 m 0 6 ft 4 Capsule 0 11 m 1 2 ft Capsules may be operated up to a temperature of 40 C 104 F at ine pressures up to 5 0 bar 72 psig for liquids and 4 0 bar 58 psi in air gas Materials of construction Filtration media Upstream support Downstream support Inner support core Outer protection cage Polyethersulphone Polyester Polyester Polypropylene Polypropylene End caps Nylon End cap insert 316 stainless steel Standard o ring Gaskets Silicone Capsule body Nylon Capsule vent seals Silicone Literature Data file ULTA Pure HC 11 0012 06 For ordering information contact your local GE Healthcare sales representative www gelifesciences com bioprocess 173 s npoud uono Filtration products ULTA Pure HC ug ULTA Pure HC capsules and cartridges have been specifically designed to extend the throughput of a traditional sterilizing grade filter through the incorporation of an integral PES pre filter layer The optimized ULTA Pure HC membrane configuration features a highly asymmetric membrane prefilter layer which significantly extends throughput and prevents problems associated with premature filter blockage with complex solutions The integral prefilter layer can also result in compression of filter trains for greater
185. components The Advanced MidJet System comprises the basic system plus pressure transducers and displays for precise pressure and flow control Such control ensures high product recovery and minimal shear denaturation and provides data for scale up 164 www gelifesciences com bioprocess Kvick Lab systems Ordering information Product Quantity Code No Kvick Lab System 115 V KLSY0105 RLPSS15 T 56 4112 77 Kvick Lab System 220 V KLSYO105RLPSS20 1 56 4112 78 Accessories Flowmeter Kit 115 V for Kvick Lab System KLSYO105FLKIT15 I 56 4113 66 Flowmeter Kit 220V for Kvick Lab System KLSYO105FLKIT20 1 56 4113 67 Pressure gauge w CPM fitting 0 4 barg 0 60 psig KLSYO1OSAPGA60CPM 1 56 4113 91 Kvick Lab Pressure Gauge Kit KLSYO105PRKIT 1 56 4113 69 Kvick Lab 2 Liter Tank Cover KLSY0105TC001 1 56 4113 58 2 inch Sanitary Clear Acrylic Tank Cap KLSY0105SAC20 1 56 4113 16 1 2 inch Sanitary to 1 4 inch Hose Barb Adaptor KLSY0105HB4F01 1 56 4115 26 1 2 inch Sanitary to 3 8 inch Hose Barb Adaptor KLSYO105HBFO1 1 56 4113 97 1 2 inch Sanitary CPM Fitting KLSYOLOCPM05 1 56 4113 92 CPM O ring KFSYO107CPMORI 6 56 4113 89 Clamps Kvick Lab system with feed tank and sanitary rotary lobe 1 2 inch Sanitary Clamp KFSYO107TCLOS 1 3674112789 pump for shear sensitive products 2inch Sanitary Clamp KLSYO105TCL20 1 56 4113 12 6 inch Sanitary Clamp KYSLO105TCL60 1 56 4113 13 Gaskets e Stainless steel jack
186. ct SuRe 61 Phenyl Sepharose 6 Fast Flow 61 Connectivity 18 36 50 Hot Lips Tube Sealer 53 ReadyMate Connectors 51 Sterile Tube Fuser 52 Filtration products 19 36 54 ReadyToProcess Hollow Fiber Cartridges 55 ReadyToProcess Normal Flow Capsule Filters 57 ReadyToProcess Platform 18 36 WAVE systems 18 36 38 Bioreactor System 2 10 44 Bioreactor System 20 50 43 Bioreactor System 200 42 Bioreactor System 500 1000 41 WAVEPOD integrated controller 45 WAVE Mixers 46 Regulatory Support Files 204 Reversed phase chromatography RPC 80 rmp Protein A Sepharose Fast Flow 72 228 RPC See Reversed phase chromatography rProtein A Sepharose 4 Fast Flow 72 228 252 www gelifesciences com bioprocess S Scientific Asset Services 32 Security of supply 64 207 Selection kits HiTrap HIC Selection Kit 130 HiTrap IEX Selection Kit 130 IEX Selection Kit 130 PlasmidSelect Xtra Screening Kit 129 130 PlasmidSelect Xtra Starter Kit 129 130 Sephacryl High Resolution 84 Sephacryl S 100 High Resolution 84 85 231 Sephacryl S 200 High Resolution 84 85 231 Sephacryl S 300 High Resolution 84 85 231 Sephacryl S 400 High Resolution 84 85 231 Sephacryl S 500 High Resolution 84 85 232 Sephadex 66 68 Sephadex G 25 Coarse 84 85 232 Sephadex G 25 Fine 84 85 232 Sephadex G 25 Medium 84 85 232 Sephadex G 25 Superfine 84 85 233 Sephadex LH 20 84 233 Sepharose
187. ct membrane is a tighter 10 kD membrane e Precise reproducibly selective membranes e Minimum hold up volume and maximum product Kvick Pilot and Process specifications recovery pH range long term storage 2 to 13 pH range short term cleaning 1 to 14 e Low extractabl ow extractables Maximum operating temperature 50 C 122 F e PES polyethersulfone membrane resists a wide range of Maximum inlet pressure 4 barg 60 psig chemicals Typical operating cross flow rate e Anti dead space technology a 24 Vemin z 2 5 ft 2 l min 0 e 100 integrity tested on delivery Holders Pilot cassettes GE Healthcare Kvick Pilot holders e Macrovoid free membrane structure for superior and other industry standard performance holders i z Holders Process cassettes GE Healthcare Kvick Process e Consistent fluid path for linear scale up holderand other industry standard e USP 24 Biologicals Test for Plastics Class VI compliant holders sia sa Materials of construction e Dimensions that match competitive holders providing a au Membrane Polyethersulfone drop in replacement for this size cassette format Sereen Polypropylene Encapsulant Silicone Kvick Pilot and Process cassettes enable linear scale up to Preservative solution vole N NaOH and 20 22 glycerin pilot and production scale operations either via multiple Kvick Pilot and Process cassettes or by scaling up from Kvick Pilot to Kvick Process Pilot cassettes are ideally suited for
188. ctivity between supercoiled and open circular plasmid DNA N The PlasmidSelect Xtra process PlasmidSelect Xtra forms the basis of a generic process for purifying supercoiled circular DNA suitable for bulk to clinical grade applications The process provides high capacity delivers high yields and can be scaled up to fulfill requirements for economical industrial manufacturing of plasmid DNA in highly regulated environments The same principle can also be used to rapidly analyze the quantity and quality of plasmid DNA in complex solutions PlasmidSelect Xtra which uses ionic strength to modulate binding to the matrix is part of a fully scalable chromatographic process for purifying supercoiled plasmid DNA This process PlasmidSelect Xtra platform also employs Sepharose 6 Fast Flow and SOURCE 30Q The complete purification process comprises both chromatography and filtration steps such as clarification and ultrafiltration The PlasmidSelect Xtra Starter Kit contains all three media in prepacked columns to purify at least 5 mg of supercoiled plasmid DNA in a single run The PlasmidSelect xtra Screening Kit can be used to determine plasmid DNA quantity within 10 minutes and plasmid DNA quality ration supercoiled covalently closed plasmid DNA to open circular within 30 minutes It also purifies up to 2 mg plasmid DNA within 1 hour e Generic process for purification of supercoiled plasmid DNA e Screening Kit Q
189. cts The ReadyToProcess platform offers a comprehensive range of pilot to process scale plug and play devices that includes cross flow filtration and normal flow filtration Normal flow filtration capsule filters including the new ULTA range of filters were designed for processing solutions from laboratory up to process scale and can handle volumes ranging from a few hundred milliliters to thousands of liters of solution ReadyToProcess cross flow filters are suitable for a wide variety of applications including clarification of lysates and cell cultures or concentration diafiltration and purification of monoclonal antibodies plasmids proteins viruses vaccines colloids and plasma ReadyToProcess filtration products offer e Time savings during development e Lowered risk of cross contamination e Simple and rapid operations AKTAready system AkKTAready is a liquid chromatography system built for process scale up and production for early clinical phases The system operates with ready to use disposable flow paths and as a consequence the need for cleaning between products batches is eliminated and development and validation of cleaning procedures is not required Replacing flow paths between projects is simple and when used together with ReadyToProcess columns the risk for cross contamination is removed Features of AKTAready system include e Simple exchange of the complete flow path eliminates the need for syste
190. d by and a trademark of Thermogenesis Corp is an automated functionally closed sterile system that reduces cord blood volume to a precise 20 ml in less than 40 min while retaining more than 99 mononucleated cells MNCs The AXP platform is comprised of the AXP device docking station processing set and XpressTRAK software that assists cGMP and cGTP compliance A range of accessories is also available The microprocessor controlled AXP device is self powered by a NiMH battery that is recharged from a docking station concurrent with data downloading It contains flow control optical sensors that separate a concentrated MNC fraction of uniform volume nominally 20 ml The device fits into standard refrigerated blood bank centrifuge buckets Six units of cord blood can be processed at one time AXP Autoxpress Platform captures data essential for quality assurance and compliance with current good tissue practices cGTP XpressTRAK software tracks and documents each cord blood unit s separation data during and after centrifugation www gelifesciences com cellprep e Consistently high recoveries of stem cell rich MNC cells from cord blood e Simultaneous processing of multiple cord blood units e Sterile sample collection through integrated sample pillows e Quick and accurate data capture tracking e No HESpan required Performance data provided by CBR Cord Blood Registry 99 3 Ordering information
191. d Protein A derived E coli Coupling chemistry epoxy Dynamic binding capacity 3 12 0 1 0 5 M NaOH pH stability operational CIP stability short term Pressure flow spec bed height 20 cm min 30 mg human IgG ml medium at 2 4 min residence time up to 500 cm h lt 200 kPa BPG 300 224 www gelifesciences com bioprocess Coupling chemistry epoxy Dynamic binding capacity at 2 4 min residence time 3 10 2 12 pH stability operational CIP stability short term Pressure flow spec bed height 20 cm approx 40 mg human IgG ml medium up to 300 cm h lt 200 kPa BPG 300 E MacroCap SP See p 66 68 E NHS activated Sepharose 4 Fast Flow See p 70 72 Pack size Code No Pack size Code No 25 ml 17 5440 10 25ml 17 0906 01 100 ml 17 5440 01 500ml 17 0906 02 1l 17 5440 02 5l 17 0906 04 5l 17 5440 03 Data File 18 1113 53 101 17 5440 05 Regulatory Support File 11 0028 21 601 17 5440 60 Technical data Data File 28 4005 84 Composition highly cross linked 4 agarose Regulatory Support File 11 0029 33 Particle size 90 um average d va Technical data For coupling to NH Composition Cross linked co polymer of allyl dextran Active groups NHS ester on 14 atom spacer and N N methylene bisacrylamide Amount of active groups 18 umol NHS ml drained medium Particle size 50 um d o lon exchanger type Charged group Total ionic capacity Recommended separation range pH stability operational p
192. d Sepharose XL which is excellent for laboratory studies with small sample quantities before scaling up Contains SP Q CM ANX high sub and DEAE Sepharose Fast Flow and Q and SP Sepharose XL in 1 ml HiTrap columns The kit contains detailed instructions IEX Media Selection Kit Code No 17 0939 01 This kit is an excellent tool for use in industrial process development The kit contains a selection of ion exchangers based on Sepharose to be used in each of the stages in a purification scheme A comprehensive instruction manual is also included gt gt For further information please contact your local GE Healthcare office E Q Sepharose XL E Q Sepharose XL virus licensed E SP Sepharose XL E DEAE Sepharose Fast Flow E CM Sepharose Fast Flow E Q Sepharose Fast Flow E SP Sepharose Fast Flow E ANX Sepharose 4 Fast Flow high sub E SP Sepharose High Performance E Q Sepharose High Performance CM Sepharose High Performance E SOURCE 15S m SOURCE 150 SOURCE 30S E SOURCE 300 www gelifesciences com bioprocess 69 pipaw fiydpibo owo1yD Chromatography media Affinity chromatography Technique description The inherent high specificity of ligand target interactions makes affinity chromatography particularly suitable for the Capture stage of downstream processing One of the typical advantages of using affinity techniques is that the capacity of the media is usually not affected by the presence of co
193. d parts It can be installed in a laboratory which reduces facility and infrastructure expenditure Product Quantity Code No AKTAcrossflow 1 18 1180 00 Operating range Feed flow rate 1 600 ml min Transfer flow rate 0 1 200 ml min Permeate flow rate 0 1 200 ml min Max system pressure Min recirculation volume Detection and control Pressure transducers TMP control accuracy 5 2 bar 75 4 psi less than 25 ml excluding cartridge Less than 0 01 bar 0 15 psi Less than 0 05 bar 0 73 psi Literature Data File Technical specifications AKTAcrossflow systems 11 0032 71 www gelifesciences com bioprocess 163 sjonpoid uoo MidJet systems Advanced MidJet System is complete with peristaltic pump Ordering information Product Basic MidJet System MDG 3SP Advanced MidJet System MDG 4SP Accessories MidGee Starter Kit KMDG 1 MidGee Reservoir Kit 175 ml Autoclavable KMDG 175R01A MidGee Replacement Reservoir Kit 175 ml Autoclavable KMDG 175R02A MidJet System Accessory Kit KMDG 2 Quantity Code No 56 4106 37 56 4106 38 56 4105 79 56 4105 86 56 4105 87 56 4105 82 Technical specifications Max process volume Min working volume Pump power requirement Max Recirculation Rate Basic MidJet system 200 ml 2 5 ml 24 VDC Adv MidJet System 200 ml 2 5 ml 24 VDC size 14 tubing 50 ml min 50 ml min Fil
194. daptor filter rings in PFR includes all O rings for FineLINE Pilot 35 column Accessories for FineLINE 70 70L 100P 100LP and 200P 200LP columns Designation Code No Qty pack Material O ring Kit RPC FineLINE 70 70L 18 1155 43 1 O ring Kit RPC FineLINE 100 100L 18 1105 45 1 O ring Kit RPC FineLINE 200 200L 18 1106 23 1 Set of spare gaskets for the pressure relief valve 8 1105 52 1 SS 316L FPM a Air trap complete FineLINE 100 20045 8 1102 96 1 SS 304 316 Glass EPDM Air trap complete FineLINE 200 200L 8 1102 97 l SS 304 316 Glass EPDM re Manometer kit 8 1031 07 1 SS 304 316 EPDM 3 Valves Q 4 port 2 way 18 5757 01 1 SS 316L PTFE Q 4 port 4 way 18 5758 01 1 SS 316L PTFE Hydraulic inlet valve Ball valve 18 1105 37 1 SS 316L PTFE lt Valve sealing washer 18 1128 69 2 PTFE o Tubing with sanitary fitting i d 6 mm5 3 30 cm 8 0005 42 PVC n 75cm 8 0005 43 1 PVC 125 cm 18 0005 44 1 PVC 150 cm 18 0005 45 1 PVC 200 cm 8 0005 47 1 PVC Connectors see p 111 i d 6 25 mm clamp 3 4 20 UNF threaded 18 1012 67 2 PP i d 6 25 mm clamp 6 mm threaded 8 0251 98 2 PP i d 6 25 mm clamp M6 threaded 18 1031 09 2 PP i d 6 25 mm TC id 22 51 mm TC 8 1012 69 2 PP Clamp 25 mm 18 1001 31 1 SS 304 Clamp 25 mm 44 0568 01 12 SS 304 Gaskets 25 mm i d 6 mm 18 0019 27 2 EPDM Gaskets 25 mm i d 6 mm 18 0019 28 2 PTFE Blind flange 25 mm incl gasket 18 1001 25 I SS 30
195. dation Contents include product descriptions column wetted components and certificates and statements of materials www gelifesciences com bioprocess 241 jp6a7 pup saxapu ine 5 Dm o l ge c 5 wn v x v ge Cc Terms and conditions of sale Trademarks Licensing information Unless otherwise agreed in writing all goods and services are sold subject to the following terms and conditions Any use of commercially available software is subject to GE Healthcare Standard Software End User License Agreement for Life Sciences Software Products In no event shall the products be used for in vivo applications Any warranty granted by GE Healthcare shall be deemed void if any goods covered by such warranty are used for any purpose not permitted hereunder For the latest information on our trademarks patent and licensing please go to our website www gelifesciences com protein_purification GE Healthcare Bio Sciences AB 2008 General Electric Company All rights reserved English Translations of the following terms and conditions are available at www gelifesciences com protein_purification In same territories local variations to these terms and conditions may apply If so such variations are available at www gelifesciences com protein_purification and at the local sales office The local variations shall take precedent in the event of any inconsistency with these conditions Dansk Overs ttelser af ef
196. dges can be repeatedly steam sterilized in situ autoclaved at up to 121 C or sanitized with hot water at up to 90 C Capsules can be repeatedly autoclaved up to 121 C e Materials conform to the relevant biological safety requirements of 21 CFR Part 177 current USP Plastics Class VI 121 C and ISO10993 equivalents Low concentrations of surfactant maybe present e Full pharmaceutical validation guide available on request 176 www gelifesciences com bioprocess ULTA Prime GF cartridges utilize a glass microfiber filter medium encased within an upstream polypropylene mesh and a downstream non woven filter support material ULTA Prime GF filter cartridges are dimensionally stable with no media migration The pleat pack is supported by an inner polypropylene core and outer polypropylene cage heat bonded to polypropylene end caps The hydrophilic nature of ULTA Prime GF filter cartridges also makes them suitable for gravity fed systems Retention characteristics have been determined through controlled laboratory tests challenging with a standard aqueous suspension of ACFTD AC Fine Test Dust using on line laser particle counters Technical specifications Filtration area Recommended operating conditions Up to 0 6m 6 3ft per 250 mm 10 inch module Recommended operating conditions Up to 70 C 158 F continuous operating temperature and higher short term temperatures during CIP Capsules may be operated up to a temperat
197. diate purification Important characteristics of media for gel filtration include particle size pore volume adsorptive properties and matrix rigidity Traditionally media have been manufactured to encompass a broad separation range but the trend is now towards a focus on a few key separations These include a renewed interest in separating smaller macromolecules such as peptides and protein fragments and removing dimers and aggregates The Sephacryl range of gel filtration products is available in convenient prepacked HiPrep 120 ml and 320 ml columns The Superdex range of gel filtration media has been specifically designed to solve particular purification problems The fractionation ranges are narrow and selectivity curves are steep compared with other gel filtration media Additionally Superdex media are available in prepacked HiLoad 120 ml and 320 ml columns which are a convenient way of obtaining reproducible results at lab scale www gelifesciences com bioprocess 83 pipaw fiydpibo owo1yD Chromatography media Superdex prep grade High productivity gel filtration for Polishing Superdex prep grade is a high resolving gel filtration medium with average particle size of 34 um It is a composite of cross linked agarose and dextran Superdex 30 prep grade is well suited for the Polishing and formulation of peptides with molecular weights of less than 1x10 Superdex 75 prep grade is designed for the separation
198. downstream processing of biopharmaceuticals and diagnostics ISO 9001 This International Standard is one of a series of three quality management standards that ensure consistent and reliable quality ISO 9001 has the widest scope and covers design development production installation and servicing ISO 9001 is accepted as a basic qualification for any company supplying the biotechnology industry Validation This is the process of establishing documentary evidence that provides a high degree of assurance that any product process activity procedure system equipment or software used in the control and manufacture consistently performs to or meets its predetermined specifications Sanitization in Place The use of chemical reagents to reduce microbial populations to very low levels in packed columns equipment and systems CIP Cleaning in place is the in situ removal of tightly bound substances or particulate matter from media and equipment used in downstream purification Regulatory Support File This document contains information about our products in particular our media to support process validation writing of SOPs quality control and applications submitted to regulatory authorities The contents include technical specifications examples of Certificates of Analysis instructions for use and leakage and toxicity data Hardware Product Documentation This documentation contains column information to support process vali
199. e column Gaskets Use PTFE gaskets if solvent not compatible with EPDM Spare parts to keep on site All nets support screens and O rings In some cases a spare tube may be advisable Longer bed heights Packing extensions are available for all diameters Isolating the column after packing We recommend using sanitary stainless steel valves of the appropriate inner diameter to prevent contamination of the packed bed The 2 way or 4 way valves with a 6 mm i d are suitable for BPG 100 140 and 200 columns The 10 mm i d is suitable for BPG 300 and 450 columns For storage purposes the 25 mm blind flange with a clamp and gasket can be used to seal off the column co Ei F kT k he tt t g Standard accessories packing extension 3 tubing valves safety valves air trap T junction pressure relief valve clamps gaskets manometer and top valve www gelifesciences com bioprocess 99 suwnjoo fiydp16ozowosiyy Chromatography columns Connecting the column to your system A clamp and gasket 6 or 10 mm i d are required to connect the 25 mm sanitary flanged inlet outlet to either valves or tubing of the same type Preflanged tubing in 6 and 10 mm i d is available Assembly disassembly of column A torque wrench with an appropriate sized socket is required and can be ordered separately Useful column accessories Air Traps BPG Air Trap Complete includes the air trap mounting bracket stee
200. e PP 11 0012 07 Validation guide ULTA Prime PP capsule and cartridge filters 28 9094 71 For ordering information contact your local GE Healthcare sales representative sjonpoid uoo www gelifesciences com bioprocess 177 Cell preparation and processing Cell preparation and processing GE Healthcare is one of the world s largest suppliers of density gradient media for cell preparation Our cell preparation product range is used to isolate mononuclear cells sub cellular particles and organelles and large viruses for example Cell preparation using density gradient media is a convenient and reliable technique for isolating and purifying cells viruses and sub cellular particles By centrifuging the cell solution in a medium containing particles that form a sedimentation gradient cells can be separated according to their density isopycnic centrifugation or size rate zonal centrifugation Gradients can be Ficoll Paque PREMIUM 1 084 and Ficoll Paque PREMIUM 1 073 either preformed or formed in situ In comparison with other techniques commonly used for cell separation e g fluorescent cell sorters and magnetic beads density gradient separation offers several important advantages e No antibodies or reagents are needed to bind the cells to a matrix Thus no such substances risk being carried along with the cells e No labeling of the cells is required Your cells remain in their native state The
201. e challenged by the demands of regulatory agencies and the need to assure product quality and safety You must also be able to withstand the economic and time pressures associated with developing a new biologic Fast Trak staff can save you time and money by providing useful advice on a range of topics We can help you e Understand the latest regulatory trends e Perform internal audits e Plan process and system validation e Review the status of purification development projects e Facilitate Technology Transfer of bioprocesses Typically we arrange a first visit to define the nature and scope of the activity time lines and deliverables Follow up may require deeper discussions on site reviews and generation of reports with descriptive sections and recommendations Don t risk delays at the end of a project Call in the experts as early as possible Training and education courses Fast Trak training amp education courses can improve skill levels and ways of working in your development labs and production halls They are designed for research development and production staff and are directed at training both innovators and operators Hands on training courses and laboratory exercises are run at our regional Fast Trak Centers or they can be customized and run at your facility All course programs undergo continuous updates and improvement for example the MAB1 course now includes extensive practical work and a new UNICOR
202. e chromatography media toolbox for MAb purification simplifies this process MabSelect SuRe characterized by alkaline stability enhanced protease resistance and a generic elution profile is used for the initial Protein A capture step The new medium of choice for polishing is Capto adhere Capto adhere is a strong multimodal anion exchanger that offers a different selectivity relative to traditional ion exchangers Capto adhere selectively removes leaked Protein A aggregates host cell proteins nucleic acids and viruses when run in flow through mode With Capto adhere the two post Protein A steps can be replaced by a single polishing step thereby reducing the overall MAb purification process from three steps to two If needed Capto adhere can also be used in combination with Capto Q in a three step process An alternative intermediate step is cation exchange chromatography using Capto S for high capacity or SP Sepharose Fast Flow for high resolution gt gt For more information see page 78 SP Sepharose Fast Flow Capto S Capto adhere g culture g removal MabsSelect SuRe Om inactivation amp filtra Final UF DF and Sterile Filtratic AIEX Capto Q Capto adhere Capto adhere The GE Healthcare chromatography media toolbox WO 2004 076485 Lonza 22 wwwgelifesciences com bioprocess PreDictor 96 well filter plates New PreDictor 96 well filter plates are prefi
203. e filtration The asymmetrical pore structure with a high voids volume which offers high dirt holding capacity results in higher throughputs ang higher fowrates gt gt For more information see page 173 than symmetrical membranes z e Liquid column guard filters for reducing bioburden and prefiltering upstream solutions ULTA PureHc CU ULTA Pure HC capsules and cartridges Typical applications have been specifically designed to extend the throughput of a traditional sterilizing grade filter through the incorporation of an integral PES e Liquid filter cartridges for clarifying stabilizing and reducing bioburden in aqueous solutions media and biologicals pre filter layer ULTA Pure HC cartridge filters are high capacity and fast flowing gt gt For more information see page 174 28 www4gelifesciences com bioprocess Label free interaction analysis Biacore systems enable comprehensive label free characterization of binding events giving unique insights into how proteins and other biomolecules interact Analyses utilizing Biacore systems provide a wealth of information including binding kinetics affinity specificity thermodynamics and concentration A wide range of molecules from proteins to low molecular weight compounds can by characterized according to binding properties The integration of Biacore s protein interaction analysis systems into the product portfolio of GE Healthcare creates a center
204. e up and sophistication from pilot to process scale Modular kits enhance the flexibility of the GrandStand systems to meet the needs of process development and process manufacturing groups without the delivery issues associated with custom systems Simply purchase the base system and the modules needed for your specific application The system and selected modules ship together with easy instructions to assemble them on site A service option is available for on site assembly combined with IQ OQ For those with changing requirements simply select the modules that provide the necessary system upgrade thereby eliminating the need to purchase a completely new system Available modules facilitate customization for e Varying process volumes e Data acquisition e Flow rate e Pressure e Temperature e Conductivity e UV e Permeate flow control e Filter type flexibility hollow fiber or cassette e Steam in place SIP GrandStand system specifications GrandStand 450 1576 Ibs 715 kg GrandStand 550 1876 Ibs 851 kg Base system Weight approximate Materials of Construction Frame Fluid path 304 stainless steel 316 L stainless steel 304 stainless steel 316 L stainless steel Fluid path surface finish lt 20 Ra pin 0 5 Ra um lt 20 Ra in 0 5 Ra um Kvick Flow holder surface finish Front and back plate lt 25 Raw in 0 6 Ra um Feed retentate permeate ports lt 25 Ra pin 0 6 Ra um
205. ective membranes Materials of construction e Minimum hold up volume and maximum product Membrane Polyetnersultane Screen Polypropylene recovery Encapsulent Silicone e Low extractables silicone versus polyurethane Preservative solution 0 1 0 2 N NaOH and 20 22 glycerine Hold up volume Approximately 20 ml per 0 09 m 1 ft encapsulant e PES polyethersulfone membrane resists a wide range of chemicals Recommended operating conditions e 100 integrity tested on delivery prange longterm storage f i pH range short term Cleaning 1 14 e Macrovoid free membrane structure for superior Maximum operating temperature 50 C performance Maximum inlet pressure 4 barg 60 psig Operating cross flow 85 ml min for each 0 009 m 0 1 ft cassette installed A 7 i i A ft The Kvick family of cassettes is designed for easy set up Operating cross flow oe for each 0 11 me 1 2 ft cassette enhanced cleanability minimum product hold up volume and optimum membrane selectivity Kvick Lab cassettes are for laboratory work with starting volumes of less than 0 5 liters up to 100 liters They fit exactly into the Kvick Lab cassette holder and can be retro fitted to other types of holders allowing existing equipment to benefit from high product recovery and better flux gains Kvick Lab cassettes are available with a membrane area of 0 11 m 1 2 ft and six molecular weight cut offs 5k 10k select 10k 30k 50k and 100k to fit a br
206. ee p 70 72 Pack size Code No Pack size Code No 25 ml 17 5441 10 50ml 17 0575 01 100 ml 17 5441 01 500ml 17 0575 02 1l 17 5441 03 5l 17 0575 04 5l 17 5441 04 Data File 18 1171 41 101 17 5441 05 Regulatory Support File 11 0028 13 601 17 5441 60 Technical data Datafile 11 0025 76 Composition highly cross linked 6 agarose Regulatory Support File 11 0029 32 Particle size 90 um average d va Prepacked columns Ligand iminodiaceticacid groups on spacer HiTrap Capto S 5x1 ml 17 5441 22 Coupling chemistry ether HiTrap Capto S 5x5 ml 17 5441 23 Metal ion capacity 30 37 umol Cu2 ml medium HiScreen Capto S 4 7 ml 0 77 x 10 cm 28 9269 79 pH stability operational 3 13 HiTrap Capto IEX Selection Kit 5x1 ml 28 9343 88 CIP stability short term 2 14 96 well filter plates Pressure flow spec base matrix 200 400 cm h PreDictor Capto S 2 ul 4 x 96 well plates 28 9258 08 io As column PreDictor Capto S 20 ul 4 x 96 well plates 28 9258 09 PreDictor Capto S 50 ul 4 x 96 well plates 28 9258 10 Technical data lon exchanger type Sulfonate strong cation exchanger with dextran coating Composition highly cross linked agarose Particle size 90 um average d va lon capacity 0 11 0 14 mmol Na ml PH stability operational 4 12 CIP stability 3 14 Pressure flow spec 300 kPa at 700 cm h 1 m diameter column 20 cm bed height in water Chelating Sepharose Big Beads See p 87 Pack size Code No 11
207. eep on site All nets support screens and O rings In some cases a spare tube may be advisable Longer bed heights Packing extensions are available for all diameters For packing INdEX columns with the packing device for BPG columns an extra lid kit has to be ordered Isolating the column after packing We recommend using 25 mm blind flanges with clamp and gasket to prevent contamination of the packed bed Connecting the column to your system A clamp and gasket 6 mm i d is required to connect the 25 mm sanitary flanged inlet outlet to either valves or tubing of the same type Preflanged tubing in 6 mm i d is also available Assembly disassembly of column No tools are required as all fittings are finger tight Useful column accessories Air Traps INdEx Air Trap Complete includes the air trap mounting bracket steel valves clamps gaskets and tubings 25 mm TC Top valve Manually operated valve recommended at the top of the airtrap as an air outlet control Manometers Manometer kits contain a pressure gauge T junction necessary clamps and gaskets for sanitary connections Pressure relief valve Required for the hydraulic packing procedure It is connected between the pump and hydraulic inlet to ensure flow delivery at a constant pressure throughout the packing procedure Safety valve Precalibrated valve that releases pressure if the calibrated value is exceeded Recommended if the column may exceed its maximum pressure limi
208. ells always stay in their native natural state Percoll PLUS is also well suited for making finally formulated sterile density gradient solutions Gradient formulations may even be re sterilized by autoclaving which helps save time and money Percoll PLUS is particularly useful for clinical research applications where its stability and flexibility help provide reproducible results Percoll Percoll is the density gradient medium of choice for thousands of researchers y around the world The physical characteristics of Percoll facilitate its a a use in separating cells organelles E viruses and other subcellular particles F P F Percoll is especially useful as a first step to enrich cell populations before attempting finer resolution or extracting nucleic acids Percoll is used to separate and isolate lymphocytes monocytes erythrocytes neutrophils liver cells leydig cells spermatozoa bone marrow cells macrophages mast cells mitochondria granules plant organelles and many other cells and organelles Separation of human blood cells in a gradient of Percoll Bottom layer contains red blood cells the middle band is polymorphonuclear cells and top band is mononuclear cells www gelifesciences com cellprep 181 O o o ge Q b Q T 3 Q 5 2a so fe O fp wn 2 3 Co Cell preparation and processing 182 AXP AutoXpress Platform The AXP Autoxpress Platform designe
209. ems for laboratory scale to larger scale systems that are modular in design MidJet Systems are compact and self contained They use MidGee Cross flow Filters to facilitate rapid processing of volumes up to 200 ml Low hold up volumes allow concentration of volumes as small as 2 to 5 ml QuixStand Basic Systems are compact self contained units designed for Xampler laboratory cartridges for rapid processing of volumes up to 10 liters plus linear scale up from pilot to process scale FlexStand Basic Systems accommodate Pilot Process Scale Cartridges from 0 14 to 3 4 m for processing volumes from 5 to 100 liters and more GrandStand pilot process systems are self contained and designed for MaxCell Large Process Scale Cartridges up to 13 m Process volumes range from 50 to 1000 liters and higher Kvick cassette systems The Kvick Lab separation system uses up to five Kvick Lab cassettes and includes a 2 5 liter reservoir rotary lobe pump pressure gauges and necessary valves piping connectors and fittings The pilot process scale system can accommodate up to 10 Kvick Flow cassettes UniFlux systems UniFlux systems provide a highly flexible means for incorporating filtration solutions into an overall downstream process Available in 4 sizes 10 30 120 and 400 Ipm for pilot to production scales UniFlux is a fully automated system with UNICORN control software now expanded to encompass filtration as well as chromatograph
210. ensor Dimensions e 230 x 330 x 160 mm e With KIT 2EH 489 x 330 x 200 mm Weight e 4 2kg Power e 110 or 220 VAC e User programmoble Options e Optional PERFCONT2E weight based Perfusion Controller with integral feed harvest pumps gt gt For information on Cellbags for use with WAVE 2 10 systems see page 48 gt gt Visit us on the web at www gelifesciences com wave WAVEPOD integrated controller The WAVEPOD integrated controller integrates all instrumentation associated with WAVE Bioreactor 20 50EHT including dissolved oxygen pH and CO O gas mixing controls to meet individual cell culture needs for insect cell mammalian cell perfusion or cell therapy applications The unit combines these four key instruments into a single compact device which connects via a digital link to the WAVE Bioreactor base A large color touchscreen allows easy access to all parameters including data from the bioreactor Detailed features include DOOPT Dissolved oxygen optical monitor with miniature fiber optic microprobes allows real time measurement of dissolved oxygen DOOPT is the only optical DO detector resistant to photobleaching and ambient light and capable of high accuracy measurement pH Enables continuous pH measurement and control using CO or acid base addition Electrochemical probe is also available pre installed in Cellbags CO2MIx Infrared CO sensor and aeration system provides a continuous supp
211. entation available on request e Documentation to support validation delivered with the product gt gt For customized Chromaflow columns please contact your local representative www gelifesciences com bioprocess 103 suwnjoo fiydns6bo oWos1y gt D Chromatography columns Properties of Chromaflow columns Design specifications Design temperature 4 30 C Operating pressure 3 bar CE directive compliance PED ATEX100 Design standard GE Healthcare GEP Surface finishes stainless steel Internal wetted lt 0 5 um Ra EP Non wetted parts lt 3 um Ra EP Principle of operation Nozzles sit in both the top and bottom of the column allowing packing in either an upward or downward direction There are three nozzle positions mid position for priming and packing retracted for running and fully extended into the column for unpacking and cleaning The nozzle also enables isolation of slurry lines from the mobile phase during operation allowing removal of residual medium and cleaning of the slurry lines independently of the rest of the column In the example opposite packing is via the lower nozzle with upward flow 104 www gelifesciences com bioprocess Material specifications Tube Distributor plates Bed supports Acrylic PMMA 316L Polypropylene Polyethylene 316L Seals FEP encapsulated silicone amp EPDM Nozzle body Polypropylene Nozzle tube PEEK 450 G 316L Nozzle tip PE
212. epacked columns Ligand density 23 31 umol carboxylic acid groups ml HiTrap ANX FF high sub 5x1 ml 17 5162 01 drained medium l i E A NH HiTrap ANX FF thigh sub 5x5 ml 17 5163 01 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 pH stability of medium after coupling 3 13 depending on ligand stability 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Pressure flow spec Amino Sepharose 6 Fast Flow See p 72 87 Pack size Code No Tl 17 3092 09 Regulatory Support File 11 0028 05 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d 50 vol Coupling chemistry epoxy Ligand amino groups on long spacer arm 10 umol primary amino groups ml drained medium COOH CHO 17 22 umol Cl ml drained medium Ligand density For coupling to Chloride ion capacity pH stability of medium after coupling 3 13 depending on ligand stability 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Pressure flow spec 212 www gelifesciences com bioprocess Technical data Composition highly cross linked agarose 4 Particle size 45 165 um lon capacity 0 13 0 18 mmol Cl ml drained medium pH stability operational 3 13 CIP stability working 2 14 Pressure flow spec min 200 cm h 100 kPa XK 50 60 column bed height 25 cm ANX Sepharose 4 Fast Flow low sub See p 87 Pack size Code No 500 ml 17 1286 01 5 17 1286 04 Regu
213. epacked columns Technical data HiLoad 16 60 Superdex 200 prep grade 120 ml 17 1069 01 Composition composite of cross linked agarose and HiLoad 26 60 Superdex 200 prep grade 320 ml 17 1071 01 dextran Technical data Particle size 34 um Composition composite of cross linked agarose and Fractionation range dextran globular proteins 3x10 7x10 Particle size 34 um pH stability operational 3 12 CIP stability short term 1 14 Max pressure 300 kPa 238 www gelifesciences com bioprocess Fractionation range globular proteins 1x10 6x10 30 60 cm h pH stability operational 3 12 CIP stability short term 1 14 Max pressure 300 kPa Flow rate Solid supports for oligonucleotide synthesis Oligosynt prepacked disposable columns See p 195 Primer Support 200 See p 194 Product Code No Product Code No Oligosynt dA Primer Support 200 dA Synth 15 umol 17 5210 01 1mmol 17 5288 01 30 umol 17 5210 02 10 mmol 17 5288 02 120 umol 17 5210 03 50 mmol 17 5288 03 Oligosynt dC 100 mmol 17 5288 04 15 umol 17 5211 01 Primer Support 200 dC Synth 30 umol 17 5211 02 1mmol 17 5289 01 120 umo 17 5211 03 10 mmol 17 5289 02 Oligosynt dG 50 mmol 17 5289 03 15 umol 17 5212 01 100 mmol 17 5289 04 30 umol 17 5212 02 Primer Support 200 dG Synth 120 umo 17 5212 03 1 mmol 17 5290 01 Oligosynt T 10 mmol 17 5290 02 15 umol 17 5213 01 50 mmol 17 5290 03 30 umol 17 5213 02 100 mmol 17 5290 04 120 umol 17 5
214. er of benefits e Prepacked columns with thirteen different BioProcess media for convenient process development e Excellent for method optimization and parameter screening due to the 10 cm bed height e Easily connected in series to achieve 20 cm bed height e Small bed volume for fast results with minimal sample and buffer consumption e Reproducible results and scalable to BioProcess columns gt gt For more information on HiScreen columns see page 127 www gelifesciences com bioprocess 23 y gt G E Pr Q gt 2 Pe N Product highlights Multimodal chromatography Multimodal separations are based GE Healthcare s line of multimodal ion Media containing multimodal ligands on different types of interactions exchangers is based on two main types are characterized by interactions that that are dependent on the of interaction are different from those of traditional characteristics of the multimodal 1 selective reversible adsorption ligands and have in many cases been ligand as well as the process of charged molecules to an designed for a specific purpose GE conditions immobilized multimodal ion Healthcare s multimodal ligands also exchange group of opposite charge offer new selectivities that may be with hydrophobic character and beneficial to other purification challenges gt For more information on 2 hydrophobic together with where more traditional ligands do not Multimodal chromatography
215. erials Material compliance Maximum pressure Sterilization method Shelf life Storage temperature Product Quantity Code No ReadyMate DAC 250 with 1 4 barb 50 28 9366 91 ReadyMate DAC 375 with 3 8 barb 50 28 9366 92 ReadyMate DAC 500 with 1 2 barb 50 28 9366 93 ReadyMate DAC 750 with 3 4 barb 50 28 9366 94 ReadyMate DAC 750 Mini TC 50 28 9367 07 Strap clamps 25 28 9366 90 Technical specifications 1 4 6 4 mm hose barb 3 8 9 5 mm hose barb 1 2 12 7 mm hose barb 3 4 19 1 mm hose barb Standard Mini TC ID 15 7 mm 50 mm 1 ISO standard 2852 ssa00igo fippay Polycarbonate Silicone Rubber USP Class VI CFR 177 Animal free or compliance to EMEA 410 01 5 bar at 20 C Gamma irradiation 25 kGy Autoclaving 125 C 30 min One sterilization cycle Not intended for Steam In Place SIP 2 urs 4 C to 30 C Depends on strapping and assembly components Standard clamp Strap clamp www gelifesciences com readytoprocess 51 ReadyToProcess Sterile Tube Fuser The Sterile Tube Fuser is a fully automated device for welding together dry or fluid filled thermoplastic tubing in a sterile operation without the need for a laminar flow cabinet or similar environmental control device The instrument is useful for connecting tubing between sterile containers bioreactor bags and process equipment The unit can connect large diam
216. es it a slightly negative charge The silica also increases the density of the microcarriers enabling them to be used in fluidized bed cultures Cytoline 1 has a density of 1 3 g ml and Cytoline 2 has a density of 1 03 g ml Cytoline microcarriers are macroporous with a pore size between 10 and 400 um Cells gain easy access to the interior of Cytoline where they are protected from shear forces Since the microcarriers are not microporous nutrients can only reach the cells through the macroporous structure Cytoline microcarriers are lentil shaped with a length of 2 to 2 5 mm This size makes their transfer through tubing more difficult but facilitates their retention in fluidized bed or perfusion cultures Weighted Cytoline microcarriers are intended for use in fluidized bed reactors such as Cytopilot Mini but can also be used in stirred tank packed bed and suspension cultures They are autoclavable at 121 C but melt at higher temperatures Application areas Cytoline 1 is intended for the culture of CHO cells It can also be used for the culture of other cells that attach well are less sensitive to shear forces and require a high circulation rate in the reactor Cytoline 2 is more suitable for hybridomas and other cells that attach less well Its lower density requires a lower circulation rate and as a consequence shear forces are less Cytoline microcarriers can also be used to immobilize insect cells and bacteria BANJND 9 JB
217. es high capacity and high recovery contribute to the overall economy of an industrial process e Sanitization CIP All BioProcess Media can be cleaned and sanitized in place e Scalability Packing methods are established for a wide range of scales You can use the same BioProcess Media for development work pilot studies and routine production lon exchange chromatography Technique description Anion exchanger groups Separation in ion exchange ANX CH CHOHCH NH ICH CH chromatography IEX is based upon 3 bound Q Quatenary ammonium O CH CHOHCH OCH CHOHCH Aer CH C H he selective reversible adsorption of eS the selective reversible dso ptior 4 DEAE Diethylaminoethyl O C H N H a charged molecules to an immobilized S 7 ion exchange group of opposite g E f S A 2 5 Q charge Anion exchanger consists of QAE Quatenary aminoethyl O C H N CH CH OH CH o an insoluble porous matrix to which Neu 2 Q charged groups have been covalently Ta i E US 3 oO Q Q Cation exchanger groups CM Carboxymethyl O CH COO S Sulphoethyl O CH CH SO SP Sulphopropyl O CH CHOHCH OCH CH CH SO Q S and SP are strong ion exchange groups that maintain charge capacity over a very wide pH range The other groups are weak ion exchangers and their charge capacity varies with pH www gelifesciences com bioprocess 65 Chromatography media 66 New and established media GE Healthcare i
218. ess UniFlux systems The UniFlux series is a standard line of membrane separations filtration systems that utilizes UNICORN software for full automation with data logging capabilites of the entire cross flow process e Available in 4 sizes 10 30 120 and 400 lpm for pilot to production scales e Fully automated using UNICORN control software e Maximizes productivity in cross flow filtration e Consistent repeatable and validatable results e Developed using input from biopharmaceutical manufacturers UniFlux membrane separation systems incorporate cross flow membranes and high performance hardware in a single system The systems are configured to operate hollow fiber cartridges ideal for microfiltration applications such as cell clarification harvesting or cassettes for ultrafiltration applications such as protein concentration and diafiltration in downstream unit operations UniFlux systems are delivered with pH and conductivity measurement on the permeate side as well as flow meters on the feed and permeate side A range of standard options is available for all systems sizes these include UV sensor on the permeate side for detection of protein leakage permeate flow control transfer pump and filter configuration conversion kits Automated configurations use a membrane separations specific version of GE Healthcare UNICORN control system UNICORN supports FDA 21 CFR Part 11 compliant software in a form f
219. eted feed tank with multiple ports for 1 2 inch Sanitary Gasket EPDM process flexibility KFSY0107TCG05 1 56 4112 86 e Low shear rotary lobe pump with touch controls and ee i0 EEEE LCD display Kvick Lab Cassette Gasket KYLAGS001011 1 56 4113 64 e Sanitary diaphragm valves and zero dead leg pressure Kvick Lab Cassette Gasket KYLAGSO01033 3 56 4113 65 2 inch Sanitary Gasket EPDM gauges velsvoiosteaed 1 56 4113 18 e Protection against over pressurization 6 inch Sanitary Gasket EPDM e For Kvick cassettes and hollow fiber cartridges ean i a Valves Diaphragm Valve stainless steel 1 2 inch Engineered for consistency and precise control Kvick Lab sanitary connections KFS 01071DV05 1 36 4112 95 System is a flexible cross flow laboratory scale separations aee h A stainless i re system With a complementary 2 5 liter reservoir pump Rated products z pressure gauges cassette holder piping and fittings the Kvick Lab Holder KLHR0105000SS 1 56 4112 79 F system quick to set up and easy to use Kvick Lab Holder torque wrench KLTW0001 1 56 4112 84 2 e As with all Kvick products trial data can be scaled to larger o systems The GE Healthcare range of cross flow equipment SeGwilslspechestians G Kvick Lab Systems G is consistent and repeatable across all size ranges to Eed eed retentate and Q allow linear scale up on laboratory pilot and production permeate port fittings 1 2 in sanitary a equipment Dimensions approximate
220. eter up to 22 2 mm OD dry only tubing for the rapid and safe transfer of large volumes of inoculum media buffers process intermediates and other products Applications include Sterile media transfer e Vaccine manufacture Filling and formulation Bioreactors feed and harvest e Pharmaceutical process fluid transfer High containment operations e In process pooling Transferring buffers Sterile Tube Fuser features include e Safe and rapid fluid transfer LCD display for prompts and data Infrared blade temperature sensor e PC interface for data printing and parameter download PTFE coated blades for strong welds 52 www gelifesciences com readytoprocess Ordering information Product Quantity Code No Sterile Tube Fuser IRc Compact 1 28 4116 77 Sterile Tube Fuser IRc for liquid filled welding auto switching 1 28 4116 89 Tube Holder Set for 15 5 mm 5 8 OD tubing 1 28 4116 81 Tube Holder Set for 15 5 mm 5 8 OD tubing clamped tube holder set for wet welding for use with STF IRCWW 28 4116 92 Tube Holder Set for 19 1 mm 3 4 OD tubing 28 4116 82 Tube Holder Set for 11 2 mm 7 16 OD tubing 28 4116 83 Tube Holder Set for 11 2 mm 7 16 OD tubing clamped tube holder set for wet welding for use with STF IRCWW 1 28 4116 93 Tube Holder Set for 6 4 mm 1 4 OD tubing 1 28 4116 84 Tube Holder Set for 6 4 mm 1 4 OD tubing clamped tube holder set for wet we
221. f terms Terms and conditions of sale Trademarks Licensing information Alphabetical index 212 241 242 246 246 248 Indexes and Legal A Z of media and chemicals This is an alphabetical listing of our chromatography media and other chemical products for industrial scale applications it includes technical and ordering information For laboratory scale media columns and equipment and convenience products and kits for research applications please consult www gelifesciences com Lot number specific Certificates of Analysis and country specific Material Safety Data Sheets are available on the internet 6 AKS Sepharose 4 Fast Flow See p 72 87 Note pH stability operational for long term exposure CIP Cleaning in Place pH for short term exposure For ion exchangers the working pH range is dependent on the titration curve Pressure is given in kPa conversion as follows 100 kPa 0 1 MPa 1 bar 14 5 psi I BioProcess Media Custom Designed Media E ANX Sepharose 4 Fast Flow high sub See p 69 130 Pack size Code No Pack size Code No 1l 17 3100 04 25ml 17 1287 10 Regulatory Support File 11 0028 04 500ml 17 1287 01 Technical data 5 17 1287 04 Composition highly cross linked 4 agarose 101 17 1287 05 Particle size 90 um average d val 601 17 1287 60 Coupling chemistry epoxy Dota File 18 1142 25 Ligand carboxylic acid groups on long spacer Regulatory Support File 11 0028 07 arm Pr
222. fesciences com biacore www gelifesciences com biacore 191 sishjDUD UO DDJaqUI BaJJ aqD Oligonucleotide synthesis bh eS Oligonucleotide synthesis Oligonucleotides are a major tool in drug discovery and diagnostic chip technology They are used in initial research and screening through to target validation and drug production Developers of oligonucleotide based drugs have a clear need for regulatory compliant material to use in pre early phase clinical trials Similarly companies involved in molecular diagnostics need cost effective oligonucleotide based probes to include in commercial kits Oligonuleotides synthesized on our instruments and supports are currently in several clinical trials All our synthesizers are based on flow through column technology described opposite This gives cost efficient synthesis creates less waste and allows simple scale up It also permits exact control of flow rate and thus fine control of reactions All systems are compatible with most synthesis chemistries used today including RNA synthesis Recirculation of monomers over the column reactor is included The common use of UNICORN control software means convenient scale up from research to full production and enables use of PAT Process Analytical Technology in combination with in line monitors System selection guide System Nominal scale AKTA oligopilot plus 10 AKTA oligopilot plus 100 OligoPilot 400
223. for linear scale up USP 24 Biologicals Test for Plastics Class VI compliant Kvick SCU cassettes give easy set up enhanced clean ability minimum product hold up volume and optimum membrane selectivity They are ideally suited for laboratory work with starting volumes of less than 250 milliliters to 25 liters The self contained holder does not require cassette installation thus promoting easy set up and use 156 www gelifesciences com bioprocess Kvick Lab cassettes Ordering information Code No Model No Membrane area Cassette Quantity m ft NMWC a 56 4112 02 UFELA0005001ST 0 009 0 1 5000 1 56 4112 06 UFELA0010001SE 0 009 0 1 10 000 1 i 56 4112 04 UFELA0010001ST 0 009 0 1 10 000 1 56 4112 08 UFELA0030001ST 0 009 0 1 30 000 1 56 4112 10 UFELA0050001ST 0 009 0 1 50 000 iT 56 4112 14 UFELAO100001ST 0 009 0 1 100 000 1 56 4113 31 UFELA0005010ST 0 11 12 5000 1 a 56 4113 26 UFELAQ010010SE 0 11 12 10 000 i 3 56 4113 25 UFELA0010010ST 0 11 12 10 000 il 56 4113 27 UFELAQ030010ST 0 11 1 2 30 000 i 56 4113 28 UFELA0050010ST 0 11 12 50 000 il 56 4113 29 UFELAO100010ST 0 11 1 2 100 000 1 10 kD Select membrane is a tighter 10 kD membrane The wide range of Kvick Lab cross flow cassette designs Technical specifications can handle almost any application Fit the following holders Kvick Lab holders Kvick packet holders and other i industry standard holders e Precise reproducibly sel
224. fy GEHC and hold GEHC harmless from and against any and all claims damages losses costs expenses and other liability of whatever nature that GEHC suffers or incurs by reason of any such unintended use 9 General Warranty 9 1 Section 9 2 9 5 shall apply in the event no other specific warranty has been agreed in the Contract 9 2 Goods GEHC warrants that its Goods meet GEHC s specifications at the time of delivery All warranty claims on Goods must be made in writing within ninety 90 days of receipt of the Goods GEHC s sole liability and Buyer s exclusive remedy for a breach of this warranty is limited to repair replacement or refund at the sole option of GEHC 9 3 Equipment GEHC s Equipment of its own manufacture is warranted from date of delivery or completion of installation if later to be free of defects in workmanship or materials under normal usage for a period of one 1 year and any claim shall be submitted in writing within such period GEHC s sole liability and Buyer s exclusive remedy for a breach of this warranty is limited to repair replacement or refund at the sole option of GEHC Such repairs or replacement will not extend the warranty period 9 4 Software GEHC warrants for a period of ninety 90 days from the date of receipt that the Software substantially conforms to its published specifications and the media on which the Software resides will be free from defects in materials and workmanship under n
225. gential flow operation Unlike single pass or normal flow dead end filtration cross flow filtration continuously sweeps the membrane surface by circulating the feed stream across it This circulation minimizes blinding of the membrane pores and promotes consistent long term productivity It also allows units to be cleaned stored and re used as needed As the feed stream is pumped through the cassette or cartridge the retentate the materials excluded by the membrane pores continues through the recirculation loop while the permeate including solvent and solutes is transported through the membrane pores and collected separately Cross flow filtration format selection guide Cassette Best Hollow fiber Best Attribute Low binding Reliable liner scale up Best Best Low solids concentration Good Best Cell clarification Best Good Diafiltration Best Good Laboratory scale Best Best UF Best Best Steam in Place Best NR 1 some models available contact GE Healthcare 140 www gelifesciences com bioprocess Normal flow filtration GE Healthcare provides comprehensive normal flow filtration products designed to maximize process efficiency from early phase product development through to full bioprocess production Liquid sterilization Filters incorporating high flow membrane formats minimize filtration system sizes while meeting full validation and integrity test requirements Bioburden reduction Exten
226. ghly cross linked 6 agarose 34 um average d val 55 mg Ribonuclease ml drained medium 0 15 0 20 mmol H ml medium 4 13 3 14 min 100 cm h 250 kPa BioPilot 60 100 column bed height 30 cm pH stability operational 4 13 CIP stability working 3 14 Flow rate 300 500 cm h E Superdex 30 prep grade See p 84 85 Pack size Code No 25 ml 17 0905 10 150 ml 17 0905 01 1l 17 0905 03 5 17 0905 04 Dota File 18 1020 92 Regulatory Support File 11 0028 67 Prepacked columns HiLoad 16 60 Superdex 30 prep grade 120 ml 17 1139 01 HiLoad 26 60 Superdex 30 prep grade 320 ml 17 1140 01 Technical data Composition composite of cross linked agarose and dextran Particle size 34 um Fractionation range globular proteins up to 1x10 pH stability operational 3 12 CIP stability short term 1 14 Max pressure 300 kPa www gelifesciences com bioprocess 237 jo6a7 pup saxapu Indexes and Legal E Superdex 75 prep grade See p 84 85 E Superdex 200 prep grade See p 84 85 Pack size Code No Pack size Code No 25 ml 17 1044 10 25ml 17 1043 10 150 ml 17 1044 01 150ml 17 1043 01 1l 17 1044 02 1l 17 1043 02 5 17 1044 04 5l 17 1043 04 Data File 18 1020 92 101 17 1043 05 Regulatory Support File 11 0028 66 60 17 1043 06 Prepacked columns Data File 18 1020 92 HiLoad 16 60 Superdex 75 prep grade 120 ml 17 1068 01 Regulatory Support File 11 0028 66 HiLoad 26 60 Superdex 75 prep grade 320 ml 17 1070 01 Pr
227. h thermal bonded construction in both capsule and cartridge formats ensure low extractables and quick flush up devices All products are 100 integrity tested before release and are shipped with a certificate of quality Filters are flushed with pharmaceutical grade purified water prior to packaging Technical specifications Filtration area Recommended operating conditions 0 54 m 5 8 ft per 250 mm 10 inch module Up to 70 C 158 F continuous operating emperature and higher short term temperatures during CIP Materials of construction Filtration membrane Polyethersulphone Prefilter layer Polyester Upstream support Polyester Downstream support Polyester Polypropylene Polypropylene Inner support core Outer protection cage End caps Nylon End cap insert 316 stainless steel Standard o ring gaskets Silicone Literature Data file ULTA Prime CG 28 9094 69 Validation guide ULTA Prime CG capsule and cartridge pleated filters 28 9094 73 For ordering information contact your local GE Healthcare sales representative www gelifesciences com bioprocess 175 s npoud uoo Filtration products ULTA Prime GF Liquid filter cartridges for clarifying stabilizing and reducing bioburden in aqueous solutions media and biologicals e High dirt holding capacity and exceptional flow performance compared with polypropylene filters e Compatible with a wide range of chemicals e Cartri
228. he latest information about our filtration products visit www gelifesciences com fitration 138 www gelifesciences com bioprocess Filtration how it works Membrane filters retain matter primarily due to size differences between the molecules and the pores in the membrane The precise nature of GE Healthcare s porous synthetic membranes used in the CFF product range makes them ideal for bioprocess purification and recovery The key advantage of a positive barrier is GE Healthcare s advanced void free technology which allows optimal performance with a wide variety of feed stream constituents Our manufacturing technology provides sharp cut off to enhance clarification and fractionation applications Our filters are engineered specifically for accurate linear scale up and our family of CFF and NFF devices offers consistent performance excellent durability and ease of use The GE Healthcare array of CFF and NFF filtration devices How cross flow membranes work Cross Flow Flow ear rere i Pressure SSE DE SEE Permeate Flow Time The feed stream moves parallel to the membrane surface cross flow and purified liquid passes through the membrane permeate Most of the particulates and aggregates are carried away by the cross flow How normal or dead end flow filters work Feed Flow Flow a Pressure e ere oe e a ge oP oe 0 Filtrate Flow Time The feed stream moves perpendicular to the membrane and purified
229. hell side 1ml lt 1ml Materials of Construction Hollow fibers Polysulfone Polysulfone Housing components Polysulfone Polysulfone Potting Epoxy Epoxy Fitting caps Vinyl Vinyl www gelifesciences com bioprocess 143 sjonpoid uono Filtration products MidGee cross flow cartridges a MidGee Cross flow cartridges are for biological solution volumes up to 200 ml e Rapid concentration and or diafiltration of critical biological solutions and suspensions Ultrafiltration pore sizes from 1000 to 750 000 NMWC microfiltration pore sizes from 0 1 to 0 65 microns e Maximum product recovery due to cross flow design e Sealed system permits convenient continuous hands free diafiltration e Contaminating proteins and electrolytes can be washed through membrane fibers and reduced to undetectable levels e Low hold up volume for concentration of 2 to 5 ml cartridge hold up volume 0 5 ml e Quick convenient Luer Lok connections MidGee disposable cross flow cartridges are for small scale processing rapid laboratory concentration and or diafiltration of biological solution volumes up to 200 ml with a convenience and speed impossible to achieve with stirred cells or dialysis tubing MidGee cartridges are optimized for use in our compact MidJet cross flow filtration system Test data can be used to linearly scale up to larger cartridge and system designs or for scale down process optimization and trouble shooting experimen
230. hort term 4 9 100 200 cm h pressure drop cm H O bed height 15 bed height 10 cm 5 cmi d Pressure flow spec Sepharose CL 2B See p 85 Pack size Code No 1l 17 0140 01 101 17 0140 05 Regulatory Support File 11 0028 40 Technical data Composition cross linked 2 agarose Particle size 45 165 um Fractionation range globular proteins 7x10 4x10 pH stability operational 3 13 CIP stability short term 2 14 Pressure flow spec 60 120 cm h pressure drop cm H O bed height 15 bed height 10 cm 5 cmi d www gelifesciences com bioprocess 233 jo6a7 pup saxapu Indexes and Legal Sepharose CL 4B E Sepharose 6 Fast Flow See p 84 85 Pack size Code No Pack size Code No 11 17 0150 01 1l 17 0159 01 101 17 0150 05 10l 17 0159 05 Regulatory Support File 11 0028 40 Data File 18 1020 52 Technical data Regulatory Support File 11 0028 42 Composition Particle size Fractionation range globular proteins pH stability operational CIP stability short term Pressure flow spec cross linked 4 agarose 45 165 um 6x10 2x10 3 13 2 14 80 150 cm h pressure drop m H O bed height 15 bed height 10 cm column 5 cm i d Sepharose CL 6B Pack size Code No 1l 17 0160 01 101 17 0160 05 Regulatory Support File 11 0028 40 Technical data Composition Particle size Fractionation range globular proteins pH stability operational CIP stability short term Press
231. iChrom column platform simplifies column handling procedures from process development to full scale manufacturing Intelligent Packing Packing AxiChrom columns is facilitated by the Intelligent Packing methodology where optimal compression of the bed is achieved by preprogrammed verified packing methods Preprogrammed methods reduce the need for extensive packing know how and facilitate scale up and tech transfer In AxiChrom 400 gt gt Larger and larger columns columns packing is controlled available by the AxiChrom during 2008 Master a separate unit comprising a touch screen operator interface a motor drive and preprogrammed methods that support Intelligent Packing Intuitive handling The AxiChrom Master provides interactive guidance for all key handling steps which promotes the development of SOPs as well as increasing safety The www gelifesciences com bioprocess AxiChrom 70 mm column novel swing out tube of AxiChrom 400 and larger columns allows easy access to parts and maintenance in situ AxiChrom 50 and 70 columns feature a pivot design that eliminates heavy lifting promoting safer operation and easy access for maintenance Predictable scale up The distribution system within the AxiChrom family is based on a theoretical model to ensure uniform flow through the bed producing reproducible results over a range of scales The column is sanitizable and has the same seal design across all scales m
232. icoll Paque PREMIUM 1 084 and Ficoll Paque PREMIUM 1 073 are complementary products to Ficoll Paque PREMIUM density gradient medium Manufactured according to the same GMP and ISO 13485 2003 standards as the original Ficoll Paque PREMIUM product they have densities of 1 084 and 1 073 g ml respectively BS e fou A or H Q Z3 S er wn Ficoll Paque PREMIUM 1 084 Ficoll Paque PREMIUM 1 073 For isolating a broad range of For isolation of lower density human mononuclear cells including human mononuclear cells those of higher density as well as mouse mononuclear cells gt gt For more information see page 180 Announcement GE Healthcare Plasma Product Biotechnology Meeting 2009 Sixth International Meeting Insotel Club Punta Prima Session O O Menorca Spain May 11 15 2009 Manufacturing MEETING New Approaches to Quality For program developments visit www bo conf com ppb09 atnogen sarety Issues Innovations in Plasma Processing Keynote lecture imag ination at work The sixth Plasma Product Biotechnology Meeting is jointly sponsored by CSL Ltd Melbourne Australia and GE Healthcare Uppsala Sweden www gelifesciences com bioprocess 33 ReadyToProcess ReadyToProcess Platform ReadyToProcess WAVE systems Cellbag disposable bioreactors ReadyToProcess connectivity ReadyToProcess filtration products AKTAready system ReadyT
233. iewed 1Q 0Q and CCP documentation 1Q 0Q documentation Code No Q OQ BioProcess LPLC system customized 44 8100 03 Q OQ BioProcess LPLC system standard 44 8100 40 Q OQ BioProcess LPLC system with PLC 44 8100 50 Q OQ BioProcess MPLC HPLC system isocratic PLC 44 8100 70 Q OQ BioProcess MPLC HPLC system gradient PLC 44 8100 71 Q OQ BioProcess MPLC HPLC system isocratic UNICORN 44 8100 74 Q OQ BioProcess MPLC HPLC system gradient UNICORN 44 8100 75 Q OQ BioProcess system MPLC HPLC Pilot 44 8100 81 Q OQ BioProcess Column LPLC MPLC 44 8100 72 Q OQ BioProcess Column HPLC 44 8100 73 Q OQ OligoProcess system 44 8100 08 Q OQ OligoPilot 400 system 44 8100 80 Q OQ KTA oligopilot system 44 8100 43 Q OQ OligoProcess PPSM system 44 8100 53 Q OQ KTAexplorer 44 8100 11 Q OQ KTApurifier 44 8100 13 Q OQ AKTArpic 44 8100 23 Q OQ KTAprime 44 8100 44 Q OQ KTApilot 44 9100 49 Q OQ AKTAcrossflow system 44 8100 77 Q OQ KTAprocess system 44 8100 61 Q OQ UniFlux Automated system standard 44 8200 58 Q OQ UniFlux Automated system customized 44 8200 59 Q OQ Kvick Benchtop system 44 8200 03 Q OQ Membrane Benchtop system 44 8200 06 Q OQ Chromaflow column 44 8100 12 Q OQ BPG column 44 8100 24 Q OQ BPSS column 44 8100 28 Q OQ STREAMLINE column 44 8100 14 Q OQ FineLINE column 44 8100 29 Q OQ Packing station Pressure vessel 44 8100 35 Q OQ BioProcess LPLC MPLC column 44 8100 72 Q OQ BioProcess HPLC column 44 8100
234. ifesciences com bioprocess 235 jo6a7 pub saxapu Indexes and Legal Mi SOURCE 30RPC See p 81 E SOURCE 30S See p 69 Pack size Code No Pack size Code No 10 ml 17 5120 20 50ml 17 1273 01 200 ml 17 5120 02 200 ml 17 1273 02 500 ml 17 5120 03 11 17 1273 03 1l 17 5120 04 5l 17 1273 04 5l 17 5120 05 Data File 18 1107 12 Data File 18 1129 73 Regulatory Support File 11 0028 54 Regulatory Support File 11 0028 53 Technical data Technical data Composition Particle size Binding capacity Typical flow rate pH stability operational CIP stability short term Pressure flow spec polystyrene divinylbenzene 30 um monosized 14 mg BSA ml medium at 300 cm h 23 mg bacitracin ml medium at 300 cm h 72 mg insulin m medium at 300 cm h 100 1000 cm h 1 12 1 14 2 000 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm E SOURCE 15S See p 67 69 Pack size Code No 10 ml 17 0944 10 50 ml 17 0944 01 200 ml 17 0944 05 500 ml 17 0944 02 1l 17 0944 03 Data File 18 1123 65 Regulatory Support File 11 0028 50 Prepacked columns RESOURCE S 1 ml 17 1178 01 RESOURCE S 6 ml 17 1180 01 SOURCE 15S 4 6 100 PE 17 5182 01 Data File 18 1123 65 Technical data lon exchanger type Composition Particle size Binding capacity Typical flow rate pH stability operational CIP stability short term Pressure flow spec Sulfonate strong cation exhanger polystyrene divinylbenzene 15 um monos
235. igand 16 umol ml drained medium 3 12 2 13 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Ligand density pH stability operational CIP stability short term Pressure flow spec Epoxy activated Sepharose 6B See p 72 Ficoll Paque PREMIUM 1 073 See p 180 Pack size Code No Pack size Code No 15g 17 0480 01 6x100 ml 17 5446 52 250g 17 0480 03 Regulatory Support File 11 0029 36 Technical data Technical data Composition 6 agarose Composition Solution containing Ficoll PM400 and Particle size 90 um average d g va sodium diatrizoate Density 1 073 0 001 g ml For coupling to NH OH SH Active groups epoxy groups on 12 atom spacer Amount of active groups 19 40 umol epoxy groups ml drained medium pH stability operational CIP stability short term Pressure flow spec 3 13 ligand dependent 3 13 ligand dependent base matrix 100 200 cm h pressure drop cm H O bed height 15 bed height 10 cm 5 cm i d Ficoll PM400 See p 181 Pack size Code No 100g 17 0300 10 500 g 17 0300 50 5 kg 17 0300 05 40 kg 17 0300 08 Technical data Composition sucrose polymer Molecular weight 3x10 to 5x10 Specific rotation 50 to 65 degrees Stokes radius 10 nm Ficoll Paque PLUS See p 181 Pack size Code No 6x100 ml 17 1440 02 6x500 ml 17 1440 03 Technical data Composition Solution containing Ficoll PM400 and sodium diatrizoate Density 1 077 0 001 g ml
236. igand phenyl pH stability operational 3 13 CIP stability short term 2 14 Max pressure 300 kPa E PlasmidSelect Xtra See p 78 130 Pack size Code No PlasmidSelect Xtra Screening Kit 28 4052 69 PlasmidSelect Xtra Starter Kit 28 4052 68 25 ml 28 4024 01 200 ml 28 4024 02 1l 28 4024 03 5 28 4024 04 Dota File 28 4094 87 Regulatory Support File 11 0029 34 Technical data Composition highly cross linked 6 agarose Particle size 24 44 um Ligand 2 mercaptopyridine Ligand concentration 3 5 mg ml Capacity for supercoiled pDNA 6125 bp gt 2 mg ml pH stability operational 3 11 CIP stability short term 2 13 Cleaning in place 0 5 M NaOH Flow velocity for supercoiled plasmid purification lt 120 cm h XK 16 20 column bed height 15 cm Plasminogen Removal Gel See p 72 87 Pack size Code No 1l 28 4109 03 Regulatory Support File 11 0029 29 Technical data Composition highly cross linked 4 agarose Particle size 45 165 um Coupling chemistry epoxy Ligand Tranexamic acid 9 13 umol ml drained medium 3 12 2 14 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix Ligand density pH stability operational CIP stability short term Pressure flow spec www gelifesciences com bioprocess 227 jo6a7 pup saxapu Indexes and Legal Primer Support 200 See Solid supports for oligonucleotide synthesis p 239 Protein A See p 70 71 Pack size 50 mg 1g 10g
237. imize productivity due to fast mass transfer plus high dynamic binding capacity Capto MMC is a multimodal weak cation exchanger that is salt tolerant and binds proteins at the conductivity of most standard feed materials Capto adhere is a strong multimodal anion exchanger for intermediate purification and polishing of monoclonal antibodies after capture on Protein A media MacroCap For purification of large biomolecules MacroCap is a new product line designed to purify PEGylated and other large biomolecules MacroCap SP is a cation exchanger that delivers high product purity and yield at high sample loads Mono PEGuylated proteins are separable from oligo PEGylated and native protein in a single run The MacroCap SP base matrix is hydrophilic and chemically stable thereby increasing media lifetime PEGylation is typically performed after purification of the target protein Sephadex High binding capacities for column or batch techniques Sephadex ion exchangers are very well established and have been used in industry for many years Their high binding capacities and reliability make them both simple and economical to use Due to their excellent stability and ease of packing Sephadex A 25 and C 25 are popular choices for column techniques Sephadex A 50 and C 50 are also widely used for batch applications especially processing crude feedstocks and in plasma fractionation Sepharose Big Beads For capture steps handling very large volumes
238. improvement program We endeavor to be your best supplier Our greatest motivation is your success www gelifesciences com bioprocess Products and platforms across bioprocessing With the recent launch of the ReadyToProcess platform and the acquisition of WAVE disposable technologies we are able to support bioprocessing from cell culture and fermentation through recovery and purification to formulation Our products and platform solutions are designed to meet the key challenges posed at every stage in the process delivering the desired product at the require purity and safety all with fast development and Lean processing in mind Key goals Technology Product e High product titer e Product folding amp post translational modifications correct Product easily ransferred to DSP Cell Culture Upstream e High producer cell grown in reactors and fermenters e WAVE Bioreactors e WAVE Mixers e Microcarriers e ReadyToProcess solate and prepare e Cell disruption e ULTA e Initial purification of target molecule Recovery product for methods e ReadyToProcess purification e Normal flow e Removal cells and filtration cells debris e Clarification and e Filtration e ReadyToProcess Capture concentration e Affinity MabSelect Capto e Secure process chromatography PreDictor robustness amp e lon exchange e Sepharose Sephadex CDM economy e Multi modal e Kvick cassettes ULTA cartridges
239. in levels The single use nature of the columns eliminates the need for cleaning protocols and cleaning validation as well as eliminating cross contamination between runs ReadyToProcess Hollow Fiber Cartridges are packaged in high purity water and exposed to gamma radiation for bioburden stability Typical applications of ReadyToProcess Hollow Fiber Cartridges include e Aseptic clarification and purification of vaccines monoclonal antibodies recombinant proteins and plasmids Aseptic cell processing e Environments where terminal sterilization is not feasible Preclinical through Phase II clinical trials Fast track drug development processes ReadyToProcess Hollow Fiber Cartridges are available in a wide variety of ultrafiltration molecular weight cut offs and microfiltration pore sizes from lab to pilot scale Operating specifications Temperature range Ultrafiltration Up to 80 C Microfiltration 0 1 and 0 2 um up to 80 C 0 45 and 0 65 um up to 50 C Maximum feed lt 10 C 5 2 barg 75 psig At 25 C pressure 10 C 25 C 4 5 barg 65 psig 0 1 um 2 1 barg 30 psig 25 C 80 C 3 4 barg 50 psig 0 2 um 1 7 barg 25 psig 0 45 um 1 barg 15 psig 0 65 um 1 barg 15 psig Maximum 10 30 kD At 25 C transmembrane lt 10 C 4 1 barg 60 psig 0 1 um 1 4 barg 20 psig pressure 10 C 25 C 3 4 barg 50 psig 0 2 um 1 barg 15 psig 25 C 50 C 3 1 barg 45 psig 0 45 um 0 7 barg 10
240. in the bag Cell Culture Bag in Switzerland Technical specifications 20 50EHT Electric Model Dimensions e With KIT 20EHT 711 x 575 x 254 mm e With KIT SOEHT 775 x 700 x 254 mm for Loadcell models add 32 mm to height dimension Weight base only 16 kg Environmental e Operating conditions 0 C to 50 C lt 95 rh non condensing e Storage conditions 40 C to 80 C e 100 240 VAC 6 3 A 50 60 Hz user selected e Fuse 20 x 10 A Slow blow long time lag Power Additional configurations e Dual bag temperature and aeration controls 20 SOEHTD e Integral CO controller 20 SOEHT CO2 e Integral O controller 20 SOEHT O2 e Integral Loadcell Module all L models Options e Optional data acquisition and PC monitor interface PCDAQ e Optional RS485 Ethernet ETHERNET485 e BASE20 50EHT 573 x 465 x 179 mm Ordering information Product Quantity Code No Electric Rocker Base for 20 50EHT 1 28 4115 08 Electric Rocker Base for 20 50EHT with Loadcell module installed 1 28 4115 10 Electric Rocker Base for 20 50EHT dual sided air dual temperature model 1 28 4115 12 Electric Rocker Base for 20 50EHT dual sided air dual temperature model with Loadcell module installed 1 28 4115 14 Electric Rocker Base for 20 50EHT includes CO2MIX20 for mammalian cell cult
241. ing the bag ensures each aliquot is identical Using the bag as the mixing container ensures sterility and GMP operation Reconstitution and dissolution Preparation of media from powdered and concentrated components and preparation of sterile buffers In process reactions Reactions can be carried out in the bag This may involve adding oxidants or reductants The headspace in the bag can be controlled to maintain the desired oxygen level Working volume Range Integral features Options Weight Dimensions Power MIXER20 50ET MIXER20 SOEHT 1to35 Speed angle control Temperature control EHT pH 18 kg 502 x 381 x 172 mm with MIXKIT20 502 x 654 x 254mm with MIXKIT5O 740 x 635 x 300 mm 110 220 VAC 10A MIXER500 1000E23 MIXER500 1000EH 50 to 500 Speed angle control Temperature control EH Loadcell pH With MIXKIT500 925 kg With MIXKIT1000 1020 kg 201 x 124 x 160 cm with MIXKIT500 226 x 124 x 160 cm with MIXKIT1000 226 x 231 x 160 cm 208 to 240 VAC 30A 3 Phase Mixer 20 50EHT Thawing of frozen materials Warming blood and other biological fluids Maintaining temperature during pooling operations 1 MIXER 20 50 requires selection of MIXKIT20 or MIXKIT50 MIXKIT20 accommodates M BAG2O0L MIXKIT50 accommodates M BAGSOL MIXER 500 1000 requires selection of MIXKIT500 or MIXKIT1000 MIXKIT500 accommodates M BAGSOOL MIXKIT1000 accommodates M BAG1000L
242. ing with reactors of 12 000 to 15 000 liters and larger coming on line Expression levels currently in the 1 to 5 g l range are expected to increase several fold In downstream processing efforts are directed at improving process economics by decreasing the number and cost of unit operations Current trends in antibody production indicate an increased use of Protein A chromatography media for product capture Benefits of Protein A based chromatography media e High selectivity reduces the number and size of subsequent unit operations through high purities and yields e Insensitivity to variations in additives pH and conductivity facilitates the use of generic protocols e Usually validated for both viral clearance and subsequent inactivation The handbook Affinity Chromatography Principles and Methods can be obtained through your local GE Healthcare office Code No 18 1022 29 MabSelect family overview MabSelect is the common name for a range of process to production scale chromatography media for monoclonal antibody purification All MabSelect media feature e A base matrix of high flow agarose e High chemical stability compatible with allaqueous buffers commonly used in Protein A chromatography e Mammalian product free no animal derived components involved in the fermentation or purification of the recombinant Protein A ligand e Epoxy as coupling chemistry e Recommended storage reagents 20 ethanol 2 ben
243. ion IQ OQ Fast Trak can help you get new equipment quickly into operation in your facility Our IQ OQ document packages are developed according to all current and relevant US FDA and European EMEA guidelines and regulations They are available for a wide range of our systems and columns including AKTApilot AKTAcrossflow AKTAexplorer 198 www gelifesciences com bioprocess AkTAprocess AKTApurifier AKTArptc BioProcess Chromatography and UniFlux Membrane systems OligoProcess and AKTA oligopilot Systems as well as BPG Chromaflow and BioProcess columns The documents are always system specific indicating the correct number of valves tag numbers etc They are also designed so that text can only be entered in permitted areas thereby securing valuable system information Each 1Q OQ document consists of printed forms detailed test protocols and expected results There are also descriptions of the software program and hardware components for UNICORN which are necessary for validating the control system Change Control Protocols CCPs CCP document packages are available for a range of systems for upgrading UNICORN software and for other system modifications The documents are intended for companies working in a regulated environment and describe procedures for upgrading GE Healthcare systems in a controlled manner In this way changes to software and hardware will be carefully evaluated verified documented and rev
244. ises or to the agreed destination 5 2 Partial deliveries shall be permitted If the Buyer fails to accept delivery of the Products within a reasonable period after receiving notice from GEHC that they are ready for delivery GEHC may dispose of or store the Products at the Buyer s expense 5 3 GEHC will use all reasonable endeavours to avoid delay in delivery on the notified delivery dates Failure to deliver by the specified date will not be a sufficient cause for cancellation nor will GEHC be liable for any loss or damage due to delay in delivery 5 4 The Buyer shall notify GEHC in writing within five 5 working days of delivery of any short delivery or defects reasonably discoverable on careful examination GEHC s sole obligation shall be at its option to replace or repair any defective Products or refund the purchase price of any undelivered Products 5 5 Where delivery of any Product requires an export license or other authorization before shipment GEHC shall not be responsible for any delay in delivery due to delay in or refusal of such license or authorization 5 6 Where the Equipment requires installation the Buyer shall be responsible at its own cost for making the place where the Equipment will be located ready for installation in accordance with GEHC s instructions Installation will not begin unless such responsibilities are completed 5 7 Following installation where applicable GEHC will proceed with final tes
245. ixing of liquids solvents without air bubbles so that even challenging gradients can be created with 2 accuracy The UNICORN software allows standalone operation or integration into any plant wide control system Additional configurations include for example the choice of extra inlets and outlets the type and quantity of selected monitors and isocratic versus gradient functionality 116 www gelifesciences com bioprocess re Sanitary design AkTAprocess has a number of features that make sanitization with 1 M sodium hydroxide simple and effective UNICORN allows automated cleaning in place CIP and a new type of air trap makes CIP more efficient All wetted parts can be changed to prevent cross contamination when the system is used for campaigning In a sanitization study the system was subjected to high level of microbial challenge organisms 1x10 Colony Forming Units CFU ml The yeast Pichia pastoris was used for antimicrobial testing The results show that the system is sanitized effectively and that the numbers of viable organisms are efficiency reduced gt gt For more information please contact your local GE Healthcare representative See also chromatography system at www gelifesciences com bioprocess Up to ten i inlet valves i Air outlet Air trap Xi valve A liquid vortex at high flow rates allows controlled the system to expel air effectively during r operation and make CIP more effective
246. ized 75 mg lysozyme ml drained medium 150 900 cm h 2 13 1 14 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm 236 www gelifesciences com bioprocess lon exchanger type Composition Particle size Binding capacity Typical flow rate pH stability operational CIP stability short term Pressure flow spec Sulfonate strong cation exhanger polystyrene divinylbenzene 30 um monosized 80 mg lysozyme ml drained medium 300 1 000 cm h 2 13 1 14 2 000 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm E SP Sepharose Big Beads See p 68 130 Pack size Code No 1l 17 0657 03 101 17 0657 05 601 17 0657 60 IEX Selection Kit 17 0939 01 Data File 18 1104 91 Regulatory Support File 11 0028 57 Technical data Composition Particle size lon capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 6 agarose 100 300 um 0 18 0 25 mmol H ml medium 4 13 3 14 1 200 1 800 cm h 100 kPa XK 50 60 column bed height 25 cm E SP Sepharose Fast Flow See p 69 130 E SP Sepharose XL See p 69 130 Pack size Code No Pack size Code No 25 ml 17 0729 10 300ml 17 5073 01 300 ml 17 0729 01 5l 17 5073 04 5 17 0729 04 601 17 5073 60 101 17 0729 05 Data File 18 1123 82 601 17 0729 60 Regulatory Support File 11 0028 58 IEX Selection Kit 17 0939 01 Prepacked columns Data File 18 1020 66 HiPrep 16 1
247. k 10k 30k 50k and 100k to fit a broad range of cross flow applications www gelifesciences com bioprocess 155 Filtration products Kvick Lab SCU cassette Ordering information Code No Model No Membrane area Cassette Qty m ft NMWC 56 4115 30 UFESC 0010 010 SE 0 11 1 2 10 000 1 56 4115 31 UFESC 0010 010 ST 0 11 1 2 10 000 1 56 4115 32 UFESC 0030 010 ST 0 11 12 30 000 I 56 4115 33 UFESC 0050 010 ST 0 11 12 50 000 I 56 4115 35 UFESC 0100 010 ST 0 11 1 2 100 000 1 56 4113 70 KLSC 010 ST Kvick Lab SCU holder 1 10 kD Select membrane is a tighter 10 kD membrane Kvick SCU cassette specifications Materials of construction Housing Polyethersulfone Membrane Polyethersulfone Screen Polypropylene Encapsulent Silicone Preservative solution 0 1 0 2N NaOH and 20 22 glycerine Hold up volume 1 2 ft 20 ml Recommended operating conditions pH range long term Storage 2 to 13 pH range short term Cleaning 1 to 14 Maximum operating temperature 50 C 122 F Maximum inlet pressure 3 barg 45 psig Operating cross flow rate 850 ml min 1 2 ft Easy use with minimum hold up volume and maximum product recovery Precise reproducibly selective membranes Low extractables PES polyethersulfone membrane resists a wide range of chemicals Anti dead space technology 100 integrity tested on delivery Macrovoid free membrane structure for superior performance Consistent fluid path
248. k Lab packet holder 161 Kvick Lab SCU cassettes 156 Kvick Pilot and Process cassettes 160 Kvick Start cassettes 155 Cross flow filtration Systems 141 163 AKTAcrossflow system 163 FlexStand benchtop pilot system 167 Grandstand pilot process systems 169 Kvick Lab systems 165 MidJet systems 164 QuixStand systems 166 UniFlux systems 171 Custom packed laboratory columns 131 Customized BioProcess Solutions CBS 118 Custom Designed Media CDM 69 72 75 86 Custom Primer Support 200 195 240 Cytodex 1 183 184 219 Cytodex 3 183 184 219 Cytoline 1 183 185 219 Cytoline 2 183 185 219 Cytopore 1 183 184 219 Cytopore 2 183 184 219 D DAC ReadyMate Data Files DEAE Sephadex A 25 DEAE Sephadex A 50 DEAE Sepharose Fast Flow DeltaV software DEV1 Fast Trak Course DEV2 Fast Trak Course DEV4 Fast Trak Course Disposable Aseptic Connectors ReadyMate 51 Downstream magazine See See ReadyMate Connectors 209 68 220 68 220 69 130 220 118 201 201 201 Upstream and Downstream E ECH Lysine Sepharose 4 Fast Flow 72 87 220 Educational services 201 Epoxy activated Sepharose 6B 72 221 eSYS1 Fast Trak Course 201 F Fast Trak BioPharma Centers 30 202 Fast Trak BioPharma Consulting 200 Fast Trak BioPharma Services 30 198 Fast Trak Courses 30 201 Fast Trak workshops 201 Fast Trak process development 200 Fast Trak Validation 198 Ficoll Paque PLUS 181 221 Ficoll
249. ke it an excellent choice for laboratories involved in method and process development Flexibility from laboratory to production e Easy system modification e Fast transfer of methods to AKTApilot Easy safe selection of columns optimally suited to each purification e Comprehensive column library for support of HiTrap HiScreen RESOURCE Tricorn HiPrep and HiLoad Also supports FineLINE Pilot 35 and XK columns Fast systematic method optimization e Automatic media screening e Vary any run parameter in automated scouting schemes The flexibility to combine and run several methods in series is often needed if high purity is a requirement AKTAexplorer meets this need and enables faster completion of method optimization Variable wavelength monitoring with UV 900 lets you record up to three wavelengths simultaneously so target protein and critical impurities can be viewed at the same time The UNICORN method wizard and optimized system configurations allow fast and easy media screening method scouting method optimization and scale up experiments Parameters can be varied over repeated runs in automated scouting schemes The optimized methods can be quickly and easily scaled up and transferred to AKTApilot for small scale production AkKTAexplorer systems are available in different standard configurations to suit most purification needs but are easily modified if required Systems can be used for flow rates up to 100 ml min at 10 M
250. ked with Capto Q Capto S Capto DEAE Capto MMC Capto adhere as well as connectors and instructions HiTrap IEX Selection Kit 17 6002 33 Seven different ion exchange ligands on Sepharose Fast Flow and Sepharose XL enable fast and easy screening Contains seven 1 ml HiTrap columns prepacked with SP Sepharose Fast Flow Q Sepharose Fast Flow CM Sepharose Fast Flow DEAE Sepharose Fast Flow ANX Sepharose 4 Fast Flow high sub SP Sepharose XL and Q Sepharose XL as well as connectors and instructions HiTrap HIC Selection Kit 28 4110 07 For screening different HIC media and experimental conditions Contains seven 1 ml HiTrap columns prepacked with Phenyl Sepharose High Performance Phenyl Sepharose 6 Fast Flow high sub Phenyl Sepharose 6 Fast Flow low sub Butyl Sepharose High Performance Butyl Sepharose 4 Fast Flow Butyl S Sepharose 6 Fast Flow Octyl Sepharose 4 Fast Flow connectors and instructions PlasmidSelect Xtra platform kits PlasmidSelect Xtra Starter Kit 28 4052 68 Fast and convenient process development Contains one HiPrep 26 10 Sepharose 6 FF column 53 ml one HiTrap PlasmidSelect Xtra column 5 ml and one HiTrap SOURCE 30Q column 5 ml plus accessories Does not include buffers PlasmidSelect Xtra Screening Kit 28 4052 69 Quick and easy analysis with an AKTAdesign system Contains five 5 ml HiTrap Sepharose HP and five 1 ml HiTrap PlasmidSelect Xtra columns plus accessories Does not include buffers
251. l enough to mix and aerate the culture yet it is gentle enough to cultivate anchorage dependent cells on various microcarriers The wave motion prevents settling and provides oxygenation without bubbles Virus production The WAVE Bioreactor provides a closed system that is ideal for virus production In a gene therapy application human 293 cells have been grown in suspension and then infected with recombinant adenovirus Cells grew to 4 x 108 cells ml and virus production was 100 000 virus particles cell The WAVE Bioreactor produces viruses under complete containment without the need for a biosafety cabinet Selection guide Systems Culture volume Cellbag WAVE Bioreactor 50 to 250 ml Cellbag 500 ml System 2 10 50 to 500 ml Cellbag 11 System 2 10 100 to 1000 ml Cellbag 2 System 2 10 System 20 50 Kit 20 500 ml to 51 Cellbag 10 System 2 10 System 20 50 Kit 20 1to 10 Cellbag 20 System 20 50 Kit 20 1to 10 Cellbag 22 System 20 50 Kit 50 5 to 25 Cellbag 50 System 20 50 Kit 50 5 to 50 Cellbag 100 System 200 10 to 1001 Cellbag 200 System 200 50 to 2501 Cellbag 500 System 500 1000 Kit 500EH 100 to 500 I Cellbag 1000 System 500 1000 Kit 1000EH Cell Culture Bag in Switzerland gt gt For information on Cellbags for use with WAVE systems see page 48 cGMP production WAVE Bioreactors are in use in CGMP applications producing inoculum for large conventional bioreactors
252. l valves clamps and gaskets For air traps for BPG 100 140 and 200 tubing is included Top valve Manually operated valve recommended at the top of the airtrap as an air outlet control Manometers Manometer kits contain a pressure gauge T junction and necessary clamps and gaskets for sanitary connections Air trap top valve manometer and safety valve 100 www gelifesciences com bioprocess Pressure relief valves Connected between the pump and column inlet permit flow delivery at a constant pressure throughout the packing procedure Safety valve Precalibrated valve that releases pressure if the calibrated value is exceeded Recommended if the column may exceed its maximum pressure limit and no other pressure sensor is included in the chromatographic system T junction clamps and gaskets have to be ordered separately Earlier design For ordering accessories and spare parts to the former design of the BPG 100 200 and 300 columns design pressure 3 bar see Instruction Manual Code No 18 1030 99 Suitable systems BPG columns are designed for use with KTAprocess Systems and have design pressures of 8 bar BPG 100 6 bar BPG 140 and 200 4 bar BPG 300 and 2 5 bar BPG 450 Please contact your local GE Healthcare representative for details Ordering information Tube height Column 500 mm 750 mm 950 mm Stand BPG 100 18 1103 01 18 1103 02 18 1103 03 18 1031 10 BPG 140 18 1113 08 18 1113
253. labor Media Wand 50 is designed for use with containers containing 5 to 10 liters of media and Media Wand 100 for the containers with up to 60 liters of media While the Chromaflow Pack Station 100 can also be used with Media Wand the Media Handling Unit offers more functions and thereby provides easier and safer operations Decanting Device 50 for Media Wand 50 and Decanting Device 100 for Media Wand 100 are shields connected to the spray nozzle of the Media Wand which act to prevent loss of media during decanting The Media Handling Unit ClP manifold simplifies the cleaning in place process of the Media Handling Unit When working with solvents PTFE tubing 2 m stainless steel over braid and silicon covered tubing should be used to connect the Media Wand to the Media Handling Unit PTFE tubing eliminates any potential differences in static electricity between the Media Wand and the Media Handling Unit For more controlled careful removal of supernatant a decanting filter can be used instead of the decanting device Ordering information Product Quantity Code No Media Wand 50 1 28 9227 64 Media Wand 100 1 28 9227 67 Media Handling Unit 1 28 9227 69 Decanting Device 50 1 28 9227 70 Decanting Device 100 1 28 9227 71 CIP manifold MHU 1 28 9227 73 PTFE tubing 1 28 9230 74 Filter for Media Wand 1 28 9297 73 www gelifesciences com bioprocess 113 Q 4 e Q e Q ad Q me 7 C Q
254. land www gelifesciences com readytoprocess 41 ssa0igo fippay WAVE Bioreactor System 200 Ordering information Product Quantity Code No SYSTEM200E with DualTemp DualAir 1 28 9366 86 SYSTEM200E with CO 1 28 4126 02 SYSTEM200E with CO ANALOG 1 28 4115 45 SYSTEM200E with CO DO PH 1 28 4115 49 SYSTEM200E with CO O DO 28 4115 47 SYSTEM200E with CO O DO PH 28 4115 48 SYSTEM200E with CO O ANALOG 28 4115 44 SYSTEM200E with CO O DO ANALOG 28 4115 43 SYSTEM200EH with CO 28 4115 57 SYSTEM200EH with CO O 28 4115 55 SYSTEM200EH with CO PH 28 4126 29 SYSTEM200EH with CO DO PH 28 4115 56 SYSTEM200EH with CO ANALOG 28 4125 89 SYSTEM200EH with CO O ANALOG 28 4115 52 SYSTEM200EH with CO O DO PH 28 4115 54 SYSTEM200EH with CO O DO PH ANALOG 28 4115 50 SYSTEM200EH with CO O DO ANALOG 28 4115 51 SYSTEM200EH with O DO PH 28 4115 58 SYSTEM200EH with O DO ANALOG 28 4115 53 wn wn v la e I gt s D a Key CO CO air gas mix controller O O air gas mix controller DO Dissolved oxygen monitor optical PH pH controller ANALOG Analog output card Designed for R amp D and cGMP production use the WAVE Bioreactor 200 is a self contained system with integrated temperature control aeration pump and rocking controller for use with working culture volumes between 5 and 100 Technical specifications Dual con
255. latory Support File 11 0028 06 Technical data Composition highly cross linked 4 agarose Particle size 45 165 um lon capacity 0 06 0 08 mmol Cl ml drained medium pH stability operational 3 13 CIP stability short term 2 14 min 200 cm h 100 kPa XK 50 60 column bed height 25 cm Pressure flow spec AVB Sepharose High Performance See p 72 87 Pack size Code No 75 ml 28 4112 01 11 28 4112 02 Regulatory Support File 11 0029 38 Prepacked columns HiTrap AVB Sepharose High Performance 5x1 ml 28 4112 11 HiTrap AVB Sepharose High Performance 1x5 ml 28 4112 12 Technical data Composition highly cross linked 6 agarose Particle size 24 44 um Coupling chemistry NHS Ligand protein ligand with affinity for Adeno associated virus Benzamidine Sepharose 4 Fast Flow high sub See p 72 87 Pack size Code No 25 ml 17 5123 10 100 ml 17 5123 01 500 ml 17 5123 02 5 17 5123 03 Regulatory Support File 11 0028 08 Prepacked columns HiTrap Benzamidine FF high sub 5x1 ml 17 5143 01 HiTrap Benzamidine FF high sub 2x1 ml 17 5143 02 HiTrap Benzamidine FF high sub 1x5 ml 17 5144 01 Technical data Composition highly cross linked 4 agarose 45 165 um amide linkage carbodiimide Particle size Coupling chemistry Ligand p aminobenzamidine Ligand density gt 12 umol ml drained medium gt 35 mg trypsin ml packed medium 2 8 2 9 min 150 cm h 100 kPa XK 50 60 column bed height 25 cm ba
256. lding for use with STF IRCWW 1 28 4116 94 Tube Holder Set for 8 0 mm 5 16 OD tubing 1 28 4116 85 Tube Holder Set for 9 6 mm 3 8 OD tubing 1 28 4116 86 Tube Holder Set for 12 5 mm 1 2 OD tubing 1 28 4116 87 Tube Holder Set for 12 5 mm 1 2 OD tubing clamped tube holder set for wet welding for use with STF IRCWW 28 4116 95 Tube Holder Set for 22 2 mm 7 8 OD tubing 28 4116 88 Single use stainless steel cutting blades with PTFE coating Non sterile 50 blades package 1 28 4117 01 Calibration Verification Kit for Sterile Tube Fuser includes maintenance manual validation documents PC Kit blade sensor and security key 1 28 4116 98 Technical specifications Sterile Tube Fixer e 6 4 to 22 2 mm dry tubing model e 6 4 to 15 5 mm fluid filled tubing model e STF IRc Dry thermoplastic e STF IRCWW Fluid filled thermoplastic Tubing OD range Tubing condition Fusing cycle e 2to3 min Weight e 16kg Dimensions e 395 x 355 x 265 mm Power e 110 220 VAC 1A Autoswitching Options for STF IRc e Tube Holder Set for 6 4 8 9 6 11 2 12 5 15 5 19 1 and 22 2 mm OD Tubing Calibration Verification Kit for STF IRcWW e Tube Holder Set for 6 4 11 2 12 5 and 15 5 mm OD Tubing e Calibration Verification Kit 1 Clamped tube holder set for wet welding Use with STF IRCWW only gt gt Visit us on the web at www gelifesciences com wave Hot Lips Tube Sealer
257. le from GE Healthcare They are db ii o regularly updated and are frequently used in university education H SEEN ee a T A a a a F i ty Handbooks Code No s Gel Filtration Principles and Methods 18 1022 18 a on Exchange Chromatography and chromatofocusing Principles and Methods 11 0004 21 al d he Affinity Chromatography Principles and Methods 18 1022 29 2 a k Hydrophobic Interaction Chromatography amp Reversed Phase Chromatography AIA Principles and Methods 11 0012 69 e t Protein Purification Handbook 18 1132 29 gt Microcarrier Cell Culture Principles and Methods 18 1140 62 m x Antibody Purification Handbook 18 1037 46 a Recombinant Protein Purification Handbook Principles and Methods 18 1142 75 Cell Separation Media Methodology and applications 18 1115 69 solation of Mononuclear Cells Methodology and applications 18 1152 69 2 D Electrophoresis Principles and Methods 80 6429 60 GST Gene Fusion Systems Handbook 18 1157 58 Purifying Challenging Proteins Principle and Methods 28 9095 31 208 www4elifesciences com bioprocess Data Files Application Notes and Posters Data files are available on request for most of our products These are often complemented with specific technical information or relevant case studies published separately as Application Notes or Posters You can download many of these in PDF format from our web site Find them under related literature beside product
258. lementary to ion exchange and size exclusion chromatography and its ability to clear endotoxins nucleic acids and viruses makes it an indispensable tool for the purification of therapeutic proteins pipaw fiydpibo owo1yD Choice of adsorbent Developing an efficient HIC method involves steps similar to these of other techniques scouting for potentially suitable adsorbents optimization and scale up Adsorbents differ in the type of ligand degree of substitution and base matrix The correct choice is made after experiments to determine the best selectivity and strength of binding Choice also depends upon the scale of operation and position in the purification scheme Help with experimental design m The theory of HIC experimental design and process considerations are comprehensively described and a w A discussed in the HIC RPC handbook eth Please contact your local k A E k BY x Pig ng i GE Healthcare office to obtain your copy Code No 11 0012 69 J amp www gelifesciences com bioprocess 73 Chromatography media Selection guide Capture Polishing Sepharose Fast Flow Sepharose Big Beads Sepharose High Performance Intermediate CDM product see page 86 Getting started Testing the performance of separation media at the laboratory bench will help you select the best one for process scale use Note that selec
259. length 100 300 18 1150 10 18 1160 10 18 1162 10 Stroke length 200 400 18 1158 12 18 1160 12 8 1162 12 Stroke length 300 500 18 1158 14 18 1160 14 18 1162 14 I d 1000 mm Auto nozzle Stroke length 100 300 18 1158 11 18 1160 11 8 1162 11 Stroke length 200 400 8 1158 13 18 1160 13 18 1162 13 Stroke length 300 500 18 1158 15 18 1160 15 8 1162 15 For column specifications other than listed in the table please contact your local GE Healthcare representative SFP Smal Flow Path on mobile phase only available on 400 mm i d columns www gelifesciences com bioprocess 105 suwnjoo fiydp16ozowosiyy Chromatography columns Options to the standard configuration Details Description Casters For columns with a maximum diameter up to 1000 mm Nozzle pipings Extension pipings for the Mobile phase inlet top and Slurry outlet top avoids tubing getting bent Nozzle control The nozzle can be controlled either by the Chromaflow Nozzle control unit or the Chromaflow Packing station Chromaflow Packing stations Chromaflow MKIII caster kits Casters to 400 600 mm MKIII columns 18 1171 51 Casters to 800 1000 mm MKIII columns 18 1171 52 Chromaflow Nozzle control unit Nozzle control unit 18 1164 61 Chromaflow Nozzle pipings PVC polyvinyl chloride SS stainless steel 106 www gelifesciences com bioprocess
260. les or service representative Press 2 Customer Service to place an order or for pricing and product availability Hours 8 30 am 7 30 pm Eastern Time Press 3 For Technical Support or Instrument Repair Hours 9 00 am 6 30 pm Eastern Time Press 0 To reach an operator F 1 877 295 8102 Email cs us ge com International Argentina Australia Belarus Brazil China Beijing China Guangzhou China Hong Kong China Shanghai India Japan Kazakhstan Korea Addresses T 54 11 4576 30 30 F 54 11 4576 30 30 Ext 113 Email sales ar ge com T 61 2 8820 8299 1800 150 522 F 61 2 8820 8200 Email sales au ge com See listing for Russian Federation T 55 11 3933 7300 0800 136833 F 55 11 3933 7304 Email vendas biosciences ge com T 86 10 5806 9689 F 86 10 6787 1162 Email lifesciences ge com T 86 20 8363 3828 ext 67961 F 86 20 8363 3291 Email lifesciences ge com T 852 2100 6300 F 852 2100 6338 Email lifesciences ge com T 86 21 5257 4650 ext 67337 F 86 21 5208 2008 Email lifesciences ge com T 91 44 2434 0747 F 91 44 2432 3770 Email supportdesk india ge com T 81 3 5331 9336 F 81 3 53319370 Email Tech JP ge com See listing for Russian Federation T 82 2 6201 3700 F 82 2 6201 3804 Email lifesciencesKR ge com Latin America Brazil Malaysia Mexico Middle East Greece Moldavia Mongolia New Zealand Russian Federation and other CIS NIS Mo
261. liters kilograms GE Healthcare has the media production capacity to meet your needs In part security of supply means being certain that you will receive the right quantity of media manufactured to specified quality levels and delivered at the right time Given today s competitive marketplace there really is no room for unnecessary risks Safety stock of chromatography media Media safety stock agreements offer assurance of a smooth continuous supply of chromatography media A customized media safety stock agreement guarantees e Assured media supply chain efficiency Maintained optimum stock levels of media Minimized downtime and product loss due to an incident occurring during development campaign production or regular production Minimized cash layout transfer cost from balance sheet to profit and loss account Simplified management of consumption fluctuations of production material during therapeutic and clinical trials Help in meeting security and safety demands of regulatory agencies and insurance companies GE Healthcare maintains full responsibility for effective media stocking rotation and rapid supply during any emergency situation You choose e Stock situation e Media products and quantities e Maximum shelf life e Storage period e Commencement date yoddns pup ad1nsas He Fe www gelifesciences com bioprocess 207 Service and support Literature There is a
262. lled with GE Healthcare BioProcess chromatography media PreDictor plates support high throughput process development HTPD by allowing parallel screening of chromatographic conditions either in a manual or in an automated workflow Data generated by using PreDictor plates show good correlation with data obtained in chromatography columns making the plates an excellent tool for initial screening of process conditions Using PreDictor plates shortens time to clinic and increases productivity in the process development lab by e Reduced experimental time the time scale for performing screening experiments can be reduced from weeks to hours e Low sample consumption new format significantly reduces sample consumption e Increased process understanding the enlarged experimental space allows for a significant increase in process understanding gt gt For more information see page 126 HiScreen columns New HiScreen columns are part of the process development platform available from GE Healthcare The columns are prepacked with a range of BioProcess media and designed for method optimization and parameter screening HiScreen columns have small bed volumes 4 7 ml reducing the cost of sample and buffer consumption The media used in HiScreen columns are also available in other column formats and as bulk packs for purification at scales from development and pilot studies to routine production HiScreen columns include a numb
263. low Kit Operating temperature Volumetric flow rates System pressure rating 5 0 bar high pressure flow path upstream column 3 0 bar high pressure flow path downstream column 0 6 bar low pressure inlet and outlet manifolds Ordering information Product Code No KTAready system including column trolley and UNICORN 28 9062 61 Accessories High Flow Kit AKTAready 28 9301 83 Low Flow Kit AKTAready 28 9301 82 Low flow test kit AKTAready 28 9336 80 UV Cond test tools AKTAready 28 9336 88 Pressure calib tool AKTAready 28 9329 42 ReadyToProcess columns see page 60 www gelifesciences com readytoprocess 59 ReadyToProcess ReadyToProcess columns ReadyToProcess columns are high performance bioprocessing columns that come prepacked prequalified and presanitized ReadyToProcess columns are designed for seamless scalability delivering the same performance level as available in conventional processing columns such as AxiChrom and BPG ReadyToProcess columns are currently available with a range of BioProcess media in three different sizes 2 5 liters 10 liters and 20 liters ReadyToProcess columns are designed for purification of biopharmaceuticals for clinical phase and II studies Depending on the scale of operations they can also be used for full scale manufacturing as well as for preclinical studies The columns can be used in a wide range of chromatographic applications for separation of v
264. lt 20 Ra pin 0 5 Ra um lt 20 Ra pin 0 5 Ra um CIP tank 15 gal Polypropylene 30 gal Polypropylene Pump Type Rotary lobe Rotary lobe Max Pump Flow rate 120 L min 30 psig 400 L min 30 psig O rings gaskets valve diaphragms EPDM EPDM Power requirements 230 460 vac 3 Phase 50 60 Hz except 380 vac 3 Phase 50 60 Hz for GSMRLP450380V and GSM550380V System dead volume 9 5L 18 9L Approximate base system without tank or filter cartridge Note To determine minimum working volume add volume of filter holder tank working volume to system dead volume www gelifesciences com bioprocess 169 sjonpoid uono Filtration products 170 Ordering Information Catalog Numbers Modular GrandStand Systems and Accessory Kits Code Number Base System 28 4005 31 28 4005 32 28 4004 48 28 4004 49 Catalog Number GSMRLP550SYS GSMRLP450SYS GSMRLP550380V GSMRLP450380V4 Description GrandStand 550 Modular System GrandStand 450 Modular System GrandStand 550 Mod Sys 380VAC GrandStand 450 Mod Sys 380VAC Filter Modules 28 4005 45 28 4005 33 11 0006 67 GSMS550HF4KIT GSMKF2MFDKIT KFHRO115TQE GS 550 HF 4 Position Exp Kit GS 2 Kvick Flow Adapter Kit Kvick Flow Manual Cassette Holder Data Acquisition 28 4005 34 28 4005 35 28 4005 36 28 4004 46 28 4004 47 28 4005 38 28 4005 39 SIP Modules 28 4005 40 56 4106 27 56 4106 28 56 4106 29 56 4106 30 56 4106 31 56 4106 32 56 4106 33
265. lue F3G A Ligand density 18 pmol Cibacron blue ml drained resin Coupling chemistry Amine functional spacer Pressure flow spec At least 300 cm h in a BPG 300 column with 20 cm bed height at 20 C using process buffers with the same viscosity as water at lt 2 bar 0 2 MPa www gelifesciences com bioprocess 215 jo6a7 pup saxapu Indexes and Legal E Capto MMC See p 66 69 77 130 E Capto Q See p 66 69 130 Pack size Code No Pack size Code No 25 ml 17 5317 10 25ml 17 5316 10 100 ml 17 5317 02 100ml 17 5316 02 1l 17 5317 03 1l 17 5316 03 5 17 5317 04 101 17 5316 05 101 17 5317 05 60 17 5316 60 601 17 5317 60 Data File 11 0025 76 Data File 11 0035 45 Regulatory Support File 11 0028 45 Regulatory Support File 11 0029 30 Prepacked columns Prepacked columns HiTrap Capto Q 5x1 ml 11 0013 02 HiTrap Capto MMC 5x1 ml 11 0032 73 HiTrap Capto Q 5x5 ml 11 0013 03 HiTrap Capto MMC 5x5 ml 11 0032 75 HiScreen Capto Q 4 7 ml 0 77 x 10 cm 28 9269 78 HiScreen Capto MMC 4 7 ml 0 77 x 10 cm 28 9269 80 HiTrap Capto IEX Selection Kit 5x1 ml 28 9343 88 HiTrap Capto IEX Selection Kit 5x1 ml 28 9343 88 96 well filter plates 96 well filter plates PreDictor Capto Q 2 ul 4 x 96 well plates 28 9257 73 PreDictor Capto MMC 6 ul 4 x 96 well plates 28 9258 14 PreDictor Capto Q 20 ul 4 x 96 well plates 28 9258 06 PreDictor Capto MMC 20 ul 4 x 96 well plates 28 9258 15 PreDictor Capto Q 50 ul 4 x 96 well plates
266. lumen diameters e 316 L stainless steel housings e Efficient processing of thousands of liters e Compact design with low hold up volume e Multiple cartridges can be manifolded into compact production systems ProCell hollow fiber cartridges of 15 cm 6 inch diameter are for large production scale ultrafiltration and microfiltration Containing up to 28 m 300 ft of membrane area in a single compact module these cartridges are well suited to a wide range of bioprocessing applications ProCell cartridges are available in two path lengths and in a selection of ultrafiltration nominal molecular weight cut offs and microfiltration pore sizes as well as several membrane fiber inner diameters ProCell cartridge ordering information ProCell ultrafiltration cartridges Code No Model No Membrane fiber Membrane area NMWC ID mm m f 56 4105 13 UFP 10 C 154 10 000 0 5 28 305 56 4105 11 UFP 500 E 152 500000 1 9 97 56 4105 14 UFP 500 E 154 500000 1 19 5 210 ProCell microfiltration cartridges Code No Model No Membrane fiber Membrane area Pore size ID mm m ft 56 4105 12 CFP 2 E 152 0 2u I 9 97 ProCell stainless steel housings one housing required per cartridge Code No Model No Description 56 4106 35 SS 152TC Housing assembly for ProCell 152M cartridges 316LSS with 2 each gaskets and 2 each clamps 56 4106 36 SS 154TC Housing assembly for ProCell 154M cartridges 316LSS with 2 each gaskets
267. ly of CO conditioned air to the Cellbag O2MIxX Oxygen air mixing controller provides continuous supply of O enriched gas to the Cellbag for insect cell virus and high cell density applications O2MIX can also be used to maintain low oxygen environment for near anaerobic applications Cell Culture Bag in Switzerland By integrating all the controls associated with a WAVE Bioreactor it is possible to develop complex control schemes by automatically varying rocker speed or oxygen concentration supplied to the Cellbag The WAVEPOD and WAVE Bioreactor 20 50EHT form a control cluster that can be accessed remotely over the built in Ethernet interface for remote data acquisition and supervisory control Ordering information Product Quantity Code No WAVEPOD Integrated controller and instruments for WAVE Bioreactor 20 50EHT models ncludes pH DOOPT CO2MIx and O2MIX modules right facing R probe connections 1 28 4116 06 ncludes pH DOOPT CO2MIx and O2MIX modules left facing L probe connections 1 28 4115 96 ncludes pH DOOPT and CO2MIX modules right facing R probe connections 1 28 4116 04 ncludes pH DOOPT and CO2MIX modules left facing L probe connections 1 28 4115 94 ncludes DOOPT and O2MIX modules right facing R probe connections 1 28 4115 98 ncludes DOOPT and O2MIX modules left facing L probe connections 1 28 4115 88 ncludes DOOPT CO2MIX and O2MIX modules right facing R probe co
268. m 12 125 in Male Luer Lok Male Luer Lok 16 to 26 cm 2 3 4 03 in 0 25 ml 0 25 ml All except 1000 NMWC models Polysulfone Polysulfone Polycarbonate Epoxy MidGee Hoop cross flow cartridges ae 5 MidGee Hoop cross flow cartridges are perfect for scaling trials e Rapid concentration and or diafiltration of critical biological solutions e Ultra compact design e Full range of UF MF pore sizes and lumen diameters e 60 cm and 110 cm pathlengths match pilot production scale designs e Autoclavable e Require minimal solution volume pump capacity e High product recoveries with minimal shear denaturation e No wall effects to distort scale up projections Throughout the R amp D process access to product is often limited As a result investigations into optimization of operating conditions are sometimes postponed or avoided entirely Now scale up and scale down using minimum product volumes is easy with our MidGee Hoop cross flow cartridges Hoop cartridges provide all the critical features of full production scale in a miniature cross flow device allowing simulation of process parameters including path length with minimal solution volume and pump capacity The uniform flow path design from laboratory to production scale makes hollow fibers the most attractive of the various cross flow configurations for linear scale up MidGee Hoop cartridges are optimized for use in our compact MidJet cross flo
269. m cleaning e Improved economy and productivity due to simpler procedures e Risk for cross contamination between products batches is eliminated e Scalable processes using UNICORN ReadyToProcess columns ReadyToProcess columns are prepacked prequalified and presanitized process scale columns designed for the purification of biopharmaceuticals intended for phase and phase II trials for full scale manufacturing and for preclinical studies Their design allows for easy connectivity to chromatography systems and simplified disposal after production Materials used to manufacture ReadyToProcess columns were chosen for their biological and chemical compatibility with samples buffers and solutions used in biomanufacturing Features of ReadyToProcess columns include e Rapid delivery simplified operation and easy disposal e Eliminates the need for column packing qualification and sanitization e Prepacked with BioProcess media including MabSelect SuRe Capto Q Capto S Capto adhere and Phenyl Sepharose 6 Fast Flow gt gt For detailed information on ReadyToProcess Filtration products see page 54 gt gt For more information on AKTAready system see pages 58 gt gt For further information on ReadyToProcess Columns see page 60 www gelifesciences com bioprocess 19 s ybi YyBiy yonpoig Product highlights MabSelect media The clinical success of monoclonal a
270. m www gelifesciences com protein_purification ou no respectivo escrit rio de vendas no local Caso as variantes locais vdlidas desviem das regras gerais do com rcio as variantes locais v lidas devem ser tomadas como determinantes Suomi Seuraavien yleisten kauppaehtojen k nn kset voi lukea sivulta www gelifesciences com protein_purification Joissakin maissa n ist yleisist kauppaehdoista voi olla voimassa paikallisia muunnelmia Jos n in on voit lukea paikallisesti voimassa olevat muunnelmat sivulta www gelifesciences com protein_purification tai paikallisessa myyntikonttorissa Jos paikalliset muunnelmat poikkeavat yleisist kauppaehdoista paikallisia muunnelmia on pidett v ratkaisevina Svenska vers ttning av nedanst ende villkor r tillg ngliga under www gelifesciences com protein_purification n gra l nder till mpas lokala varianter av dessa best mmelser och villkor Dessa varianter r d tillg ngliga under www gelifesciences com protein_purification och i de lokala f rs ljningslokalerna De lokala varianterna har f retr de i fall av of renlighet med dessa villkor express written agreement of GEHC The failure of GEHC to enforce its rights under the Contract at any time for any period of time shall not be construed as a waiver of any such rights 2 Prices and Quotations The price of the Products and or Services will be GEHC s quoted price inclusive of any duties but exclusive of val
271. ms in the AKTA family This flexibility allows quick and simple transition from one stage of a project to the next Clinical trial equipment can be turned into a final production installation overnight Documentation and user interface remain consistent from one step to the next and re investment and validation requirements are reduced to a minimum UNICORN can also be adapted to control other liquid handling process units or to connect to other control systems in a plant via the OPC interface Among the many features of UNICORN are easy method programming powerful functions for method assessment a dynamic display to keep you posted on process status and the configurable user access profiles to keep your methods secure In addition UNICORN can simultaneously supervise up to four liquid handling units from a single work station independently or in E TTET PEGEGEGUGRRAEES i i i Bimi mar rp alier siam a pre programmed sequence Full validation support for the control system software is available to help speed your product to market The software consists of separate modules for method programming system control and data evaluation Easy method programming Most complex valving sequences are handled through valve macros Programming can be done in time volume or column volume base Automatic scouting of important separation variables is easily performed Conditional responses to specific m
272. n and documentation of manufacturing procedures gt gt For technical specifications see page 221 Ficoll Paque PLUS Ficoll Paque PLUS is a ready to use sterile medium for isolation of lymphocytes in high yield from peripheral blood using a simple and rapid centrifugation procedure It maintains the viability and a representative distribution of B and T lymphocytes Ficoll PM400 Ficoll PM400 is a synthetic neutral highly branched hydrophilic polymer of sucrose with an average molecular weight of 400 000 It has long been used to form density gradients for separating and isolating eukaryotic cells organelles and bacterial cells as a a m stabilizing agent and as a preparation ee a s PTA j af 4 pHi 5 a medium for isolating mononuclear cells Applications can also be found TA MP Ae In ed in defined culture media nucleic acid hybridization electrophoresis and immunological studies gt gt For the latest information about our cell preparation products visit www gelifesciences com cellprep Percoll PLUS Percoll PLUS is a sterile density gradient separation medium with low endotoxin level plus low osmolality toxicity and viscosity Percoll PLUS comprises silica particles covalently coated with silane and has the same physical properties and features as Percoll which is cited in more than 5000 references i E um No antibodies or reagents are needed to bind cells with Percoll PLUS so c
273. nd full scale production and validation www gelifesciences com bioprocess Media definition The first stage involves discussions about the construction matrix ligands and coupling chemistry required to obtain the desired product function Alternatives can be suggested and samples prepared for your evaluation From this evaluation and further discussions the medium is defined Media assurance After proof of principle has been obtained a robust and scalable manufacturing process is developed This includes optimization of the medium design and development of relevant analytical methods to secure functionality Preliminary specifications are set for the mutually agreed test criteria Pilot scale volumes can be delivered when needed Full scale production and P gt gt For further validation information In the final stage the process is about CDM scaled up to a manufacturing scale please contact appropriate for the customer needs your local GE Test methods are validated and Healthcare final specifications are set If the office product has potential as a widely used product it will be launched as a CDM product in the catalog After delivery of several manufacturing batches to the customer the process is validated CDM products are not kept in stock but only manufactured on order Every CDM product is designed to meet the stringent quality standards for commercial industrial use Each undergoes full qu
274. nd polysulfone feed reservoirs These systems can be cart mounted for ease of movement between the laboratory and the cold room Ordering information for pilot scale microfiltration cartridges Code number Model number Pore size Fiber ID Membrane area Nominal flowpath um mm m ft length cm 56 4102 46 CFP 1 D 5A 0 1 0 75 0 16 17 30 56 4102 47 CFP 1 E 5A 0 1 1 0 12 L3 30 56 4102 48 CFP 2 E 5A 0 2 1 0 12 13 30 56 4102 49 CFP 4 E 5A 0 45 1 0 12 13 30 56 4102 50 CFP 6 D 5A 0 65 0 75 0 16 17 30 56 4102 69 CFP 1 D 6A 0 1 0 75 0 37 4 60 56 4102 70 CFP 1 E 6A 0 1 1 0 28 3 60 56 4102 71 CFP 2 E 6A 0 2 1 0 28 3 60 a 56 4105 61 CFP 2 G 6A 0 2 1 75 0 23 25 60 g 56 4102 72 CFP 4 E 6A 0 45 1 0 28 3 60 56 4102 73 CFP 6 D 6A 0 65 0 75 0 37 4 60 56 4102 86 CFP 1 D 8A 0 1 0 75 0 41 44 30 56 4102 87 CFP 1 E 8A 0 1 1 0 36 3 9 30 2 56 4102 88 CFP 2 E 8A 0 2 1 0 36 3 9 30 56 4102 89 CFP 4 E 8A 0 45 1 0 36 3 9 30 a 56 4102 90 CFP 6 D 8A 0 65 0 75 0 41 44 30 56 4103 09 CFP 1 D 9A 0 1 0 75 0 93 10 60 56 4103 10 CFP 1 E 9A 0 1 1 0 84 9 60 56 4103 11 CFP 2 E 9A 0 2 1 0 84 9 60 56 4105 62 CFP 2 G 9A 0 2 1 75 0 59 6 3 60 56 4103 12 CFP 4 E 9A 0 45 1 0 84 9 60 56 4103 13 CFP 6 D 9A 0 65 0 75 0 93 10 60 Note All pilot scale cartridges are autoclavable except those with 1000 NMWC ultrafiltration membranes www gelifesciences com bioprocess 147 Filtration products 148 Ordering information for pilot scale ultrafil
275. ndelsvoorwaarden gelden Indien dit het geval is kunnen de plaatselijk geldende varianten onder www gelifesciences com protein_purification of in het betreffende verkoopkantoor ter plaatse ingezien worden Indien de plaatselijk geldende varianten van de algemene handelsvoorwaarden afwijken dienen de plaatselijk geldende varianten als doorslaggevend te worden aanzien Norsk Oversettelser av de etterfalgende generelle forretningsvilkar finnes pa www gelifesciences com protein_purification For enkelte land gjelder lokale tilpasninger av forretningsvilkdrene Der hvor dette er tilfelle gir www gelifesciences com protein_purification eller det lokale salgskontor innsikt i de vilk r som gjelder Dersom det ikke er samstemmighet mellom lokale og generelle forretningsvikar vil de lokale vilk rene gjelde Portug s As tradu es das seguintes regras gerais do com rcio podem ser visualizadas em www gelifesciences com protein_purification Em alguns pa ses podem ser v lidas variantes locais destas Terms and conditions of sale 1 General 1 1 In these Terms and Conditions The Buyer means the person firm company or other organization who or which has ordered Products and or Services from GEHC GEHC means he GE Healthcare group company referred to in the final written offer quotation or order acknowledgement or if none the GE Healthcare company making the supply The Contract means the contract for the sale and purchase of P
276. nds rigorous and cost production scale effective CIP protocols e Prioritized volume throughput e g 0 1 to 0 5 M NaOH e Optimized matrix and ligand e Alkali stabilized rProtein A ligand coupling e Generic and economic CIP e The antibody purification sanitization standard e Product safety and process robustness e Low leakage media All MabSelect media are now available in convenient 1 and 5 ml HiTrap columns for start up and in 10 cm prepacked HiScreen columns for easy process design in MabSelect Xtra For capturing high titer antibody feedstocks and reducing processing costs e Outstanding dynamic binding capacity e Improved process economics and reduced raw material costs e High purity capture due to minimal non specific binding 20 www4elifesciences com bioprocess Capto media Capto is a BioProcess media product line specifically designed to meet the growing need in the biopharmaceutical market to process large feed volumes in a fast efficient and cost effective way The base matrix is a highly rigid agarose that allows for a broader working range of flow velocities bed heights and sample viscosities at large scale High flow velocities increase volume throughput and reduce process time Longer bed heights eliminate the need for large equipment and keep footprints small High flow processing of viscous samples means less dilution and shorter cycle times In addition the chemical stability of
277. ne cartridge end nuts polysulfone O rings silicone Elbow Adaptor Kit for Installation Either kit KAMX 16PS or kit KAMX 16EL PS required for each new MaxCell Cartridge Contains 2 each RBMx 16PS EL elbow adaptors polysulfone cartridge end nuts polysulfone O rings silicone 2 in TC toggle clamp 304 SS 2 in TC gasket silicone MaxCell O ring set 2 each silicone MaxCell Wrench Set standard MaxCell Wrench Set applied torque MaxCell cartridge physical dimensions Technical specifications Housing size 45 65 85 Diameter cm in 10 8 4 25 10 8 4 25 10 8 4 25 Length Endfitting Permeate cm in connections connections 39 4 15 5 2 in sanitary 1 5 in sanitary 62 5 24 6 2 in sanitary 1 5 in sanitary 120 0 AIS 2 in sanitary 1 5 in sanitary Add 4 25 in 10 8 cm for straight adaptors 2 at retentate ends MaxCell cartridge membrane area as a function of housing size and lumen diameter Housing Membrane Fiber size inner diameter mm 45 0 5 0 75 1 65 0 5 1 85 0 5 1 Membrane area m ft 3 5 37 2 65 28 5 2 3 25 6 1 66 44 47 13 140 9 95 152 www gelifesciences com bioprocess ProCell hollow fiber cartridges ProCell hollow fiber cartridges of 15 cm 6 inch diameter are for large production scale processes and are installed inside sanitary stainless steel housings e Sanitary design for production scale applications e Selection of UF MF pore sizes and
278. nnections 1 28 4116 00 ncludes DOOPT CO2MIXx and O2MIX modules left facing L probe connections 1 28 4115 90 ncludes pH and CO2MIX modules right facing R probe connections 1 28 4116 02 ncludes pH and CO2MIX modules left facing L probe connections 1 28 4115 92 Accessories pH Probe 1 28 4116 71 DOOPT Probe 1 28 4116 72 RTD Probe 1 28 4116 67 SRTDX Surface Probe 1 28 4116 65 gt gt Visit us on the web at www gelifesciences com wave www gelifesciences com readytoprocess 45 ssa0igo fippay wn wn v oO 2 le gt 3 D ac WAVE Mixers The WAVE Mixer makes it possible to mix materials contained in bags in a completely sterile manner The rocking platform induces a wave motion in the liquid without an impeller or other invasive mixer The WAVE Mixer has been optimized for efficient mixing and dispersion of up to 35 liters of liquid in a choice of 20 or 50 liter M Bags and 10 liters of liquid can be mixed to homogeneity in less than 7 seconds The WAVE Mixer performs a number of functions including e Thawing e Pooling e Mixing e Media and buffer preparation WAVE Mixer features include e Disposable single use system for mixing liquids without the need for a mixing tank or conventional mixer e No equipment cleaning sterilization validation or cross contamination e Mixes liquid volumes from 1 to 35 liters in 20 and 50 liter mixing bags Larger bag size
279. nogram are trademarks of General Electric Company Cell Culture Bag in Switzerland Trademarks owned by other companies Other trademarks registered trademarks product names and company names or logos displayed in the catalogue are the property of their respective owners 246 www4gelifesciences com bioprocess Licensing information Butyl S Sepharose 6 Fast Flow Separating Miraculin with this product is subject to US patent number 5 886 155 Licenses are available from BioResources International Inc of Somerset N J U S A Capto ViralQ Separating viral particles with Capto Q products may require a license under United States patent number 6 537 793 B2 and equivalent patents and patent applications in other countries owned by Centelion SAS Such a license is not included with the purchase of Capto Q but is included with the purchase of Capto ViralQ products With the purchase of Capto ViralQ the customer is granted a free limited license under US patent 6 537 793 B2 and equivalent patents and patent applications in other countries owned by Centelion SAS to separate viral particles solely through use of the product purchased Chelating Sepharose Fast Flow and Ni Sepharose 6 Fast Flow US patent numbers 5 284 933 and 5 310 663 and equivalent patents and patent applications in other countries assignee Hoffman La Roche Inc relate to the purification and preparation of fusion proteins and affinity peptides comprising at lea
280. ns under these patents is requested to contact Hoffman La Roche AG Corporate licensing attention Dr Andreas Maurer CH 4070 Basel Switzerland telephone 41 61 687 2548 fax 41 61 687 2113 for the purpose of obtaining a license IMAC Sepharose products Ni Sepharose products and Fe Sepharose products IMAC Sepharose products Ni Sepharose products and Fe Sepharose products are covered by US pat No 6 623 655 and their equivalents in other countries OligoPilot columns Use of these supports for the synthesis of polynucleotides is licensed under the following patents when the synthesis is performed on an instrument provided by a licensed supplier US patent numbers 4 458 066 4 973 679 5 047 524 and 5 262 530 and equivalent patents and patent applications in other countries No other license is granted to the purchaser either directly or by implication estoppel or otherwise Patented reagents suitable for use with this instrument are available from licensed sources OligoPilot II The use of this instrument is licensed under US patent numbers 4 458 066 and 4 973 679 and equivalent patents and patent applications in other countries when synthesis of oligonucleotides is performed thereon using solid phase supports provided from a licensed supplier Patented reagents suitable for use with this instrument are available from licensed sources No other license is granted to the purchaser either directly or by implication estoppel or othe
281. ns up to M 2 5x10 and other low molecular weight biomolecules that are stable in aqueous organic solvents www gelifesciences com bioprocess Required for polishing RPC is a widely used analytical technique but it is also employed in preparative applications up to process scale for more demanding polishing problems such as separating microheterogeneities from the native molecule of recombinant peptides RPC is also a standard technique for purifying synthetic peptides and oligonucleotides The technique often requires medium to high pressure columns and systems and explosion proof equipment for handling high concentrations of flammable volatile organic solvents RPC media from GE Healthcare are designed for difficult preparative separations at all scales Products SOURCE 15RPC and SOURCE 30RPC both BioProcess Media are designed for fast high performance preparative separations of biomolecules such as proteins peptides and oligonucleotides The media have matrices based on rigid highly cross linked polystyrene diviny benzene with monosized beads of diameters 15 um and 30 um respectively Pore size distribution is controlled and reproducible Emphasis during development has been on quality reproducibility and scalability features that are particularly important for industrial applications Their wide pH stability pH 1 to 14 and high capacity make SOURCE RPC media an interesting alternative
282. nt Operating cross flow 3400 ml min for each 0 46 m 5 ft cassette installed Kvick Flow cassettes fit exactly into the Kvick Flow cassette Operating cross flow 17000 ml min for each 2 33 m 25 ft cassette installed holder and can be retro fitted into other types of cassette holders allowing existing equipment to benefit from high product recovery and better flux gains sjonpoid uoo www gelifesciences com bioprocess 159 Filtration products Kvick Pilot and Process cassettes Ordering Information ae Cor ar oa Kvick pilot cassettes fi Code No Model No Membrane area Cassette i m ft NMWC Qty 56 4115 69 UFEPT 0005 025 ST 0 23 2 5 5000 al i 56 4115 70 UFEPT 0010 025 SE 0 23 2 5 10 000 L 56 4115 71 UFEPT 0010 025 ST 0 23 2 5 10 000 1 i 56 4115 72 UFEPT 0030 025 ST 0 23 25 30 000 1 56 4115 73 UFEPT 0050 025 ST 0 23 25 50 000 1 i 56 4115 75 UFEPT 0100 025 ST 0 23 2 5 100 000 1 l 10 kD Select membrane is a tighter 10 kD membrane ig ve ET i 68686 Kvick process cassettes i Code No Model No Membrane area Cassette we m ft NMWC Qty i 56 4115 55 UFEPR 0005 300 ST 2 79 30 5000 1 56 4115 56 UFEPR 0010 300 SE 2 79 30 10 000 1 56 4115 57 UFEPR 0010 300 ST 2 79 30 10 000 1 56 4115 58 UFEPR 0030 300 ST 2 79 30 30 000 1 56 4115 59 UFEPR 0050 300 ST 2 79 30 50 000 l For linear scale up to pilot and production scale 56 4115 63 UFEPR 0100300ST__ 2 79 30 100 000 1 10 kD Sele
283. ntaminants since they have no affinity for the coupled ligand The result is reliable product purity often with purification factors well over 1000 and effective concentration achieved in a single step Affinity chromatography may also be suitable for the Intermediate or Polishing stages to remove small amounts of specific contaminants In affinity chromatography the product to be purified adsorbs to an affinity ligand that is coupled to a matrix The ligand is specific for a single type of protein peptide molecule or group of such molecules The targeted product often binds to the ligand under specific conditions of ionic strength and pH After unbound impurities are rinsed away the product can be eluted by using a step gradient of increasing or decreasing ionic strength and or by changing the pH or by a more selective elution technique 70 www gelifesciences com bioprocess g A fal Affinity chromatography The most widely used affinity chromatography purification step today is the capture of antibodies using the Protein A ligand Protein A media The MabSelect family for the capture of monoclonal antibodies has been developed with industrial needs in mind The expanded product range focuses on better overall process economy and reduced time for optimization Group specific media Heparin Sepharose 6 Fast Flow and Blue Sepharose 6 Fast Flow are examples of media with affinity for a group of related molecule
284. ntibodies is one of the most exciting achievements in our industry resulting in annual production requirements of in some cases tons scales Cell culture bioreactors are today built up to 25 000 liters scale and titers are increasing currently in the 3 to 5 g l range and are expected to increase several fold New challenges are consequently addressed to Downstream processing and efforts are directed at improving process economics by decreasing the number and cost of unit operations Current trends in antibody production indicate an increased use of MabSelect and Protein A media for production capture MabSelect is a modern range of chromatography media for purification of monoclonal antibodies at large production scale All MabSelect media feature e A base matrix of high flow agarose e High chemical stability compatible with all aqueous buffers commonly used in Protein A chromatography e Regulatory Support File availability e Simple scale up to production sized columns e Large scale quantities available on request The MabSelect family consists of Like all our BioProcess media MabSelect media meet every requirement for process design and scale up Prepacked and ready to use columns and bulk quantities are available For large scale packing we recommend AxiChrom Chromaflow or BPG columns gt gt For more information see page 71 MabSelect MabSelect SuRe For high purity and throughput at Withsta
285. nts Basic and Advanced QuixStand 1 cartridge stand 2 support rods 2 pressure guages 0 2 bar 0 30 psi 1 backpressure tubing valve 1 reservoir kit includes 400 ml and 1 reservoirs sample drain valve 1 accessory kit 1 assembly guide Advanced QuixStand only peristaltic recirculation pump 1 system stand FlexStand benchtop pilot system Versatile processing system with a compact modular design e Accommodates a variety of cartridge sizes up to 3 5 m 37 ft e Process volumes from 5 to 100 liters and more e Quickly change from lab to pilot scale e Stainless steel fittings and USP XXIV Class 6 polymers elastomers ensure compatibility with cleaning regimens 316L stainless steel wetted surfaces ensures compatibility with process and cleaning fluids Sturdy base holds cartridges in vertical position and allows maximum product recovery FlexStand benchtop pilot system accommodates GE Healthcare laboratory cartridges as well as up to 2 inch diameter pilot scale cartridges with 1 5 inch Tri Clamp fittings The standard pilot system is a compact sanitary device with autoclavable pressure gauge pinch type backpressure valve tubing connector kit and associated gaskets and clamps It takes up minimal bench space and is easily moved from laboratory to cold room Various pump and reservoir options create a versatile processing system capable of concentration and or diafiltration of process volumes ranging f
286. o protect sensitive information Safety stock of spare parts and consumables Securing the supply of spare parts and consumables ensures maximum uptime of your AKTAprocess system Our safety stock agreements for AKTAprocess can be tailored to meet your unique availability needs Table 1 System specifications System specifications System flow rate 6 mm i d PP 4 180 I h 3 8 o d 7 7 mm i d SSt 4 180 I h 10 mm i d PP 13 600 I h o d 9 4 mm i d SS 13 600 I h 1 o d 20 4 mm i d PP 45 1800 I h 1 o d 22 1 mm i d SS 45 1800 I h UV wavelength range Single 280 nm or multiple wavelengths pH range 0 14 spec valid between 2 and 12 Conductivity range 1 mS cm to 200 mS cm Ingress protection cabinet electrical NEMA 4x IP 56 Electrical standards UL 508A EN 61010 1 Tubing size PP 6 mm 10 mm SS 3 8 and 1 2 Skid size 6mm 10 mm 3 8 and 1 2 WxDxH 850 mm x 1205 mm x 1670 mm D 750 mm if monitor and keyboard included 1 PP and SS WxDxH 1050 mm x 1730 mm x 1900 mm D 2275 mm if monitor and keyboard included PP polypropylene t SS 316 L stainless steel Table 2 Operating conditions Operating pressure and temperature PP 6 mm 10 mm and 1 6 bar max 40 C SS 3 8 and 10 bar max 40 C SS 1 6 bar max 40 C Surrounding temperature 2 30 C Applied solutions PP systems 4 60 C max 3 bar at 40 60 C Applied solutions SS systems 4 80 C max 3 b
287. oProcess columns 36 38 48 50 54 58 60 ReadyToProcess ReadyToProcess Platform ReadyToProcess WAVE Bioreactor systems mixers and associated devices are an integral part of the ReadyToProcess platform ReadyToProcess products have features that effectively eliminate the need to clean sterilize or validate multiple use systems in the manufacturing process ReadyToProcess products are designed to enable Lean and responsive biopharmaceutical development and production with assured safety and cost efficiency From cell culture and fermentation to purification ReadyToProcess allows for faster processing and simpler operations O OU wu Media and buffer eo F lt oe Pre seed culture Seed culture Bioreactor Main filtration Concentration Normal flow filtration Waste bag Bioreactor feed and media filtration Bioreactor Cell liquid clarification filtration Connectivity 7 gt a ti Fi a T TAVA wa Ys L ba x sF r ae i ce ReadyToProcess ULTA Cap WAVE Bioreactor for scalable ReadyToProcess Hollow fiber micro and ReadyMate Disposable Aseptic SG HC capsules single use operations ultrafiltration cartridges Connector 36 www4elifesciences com readytoprocess Applications Typical applications of ReadyToProcess products include e Aseptic clarification and purification of vaccines monoclonal antibodies recombinant proteins and
288. oad range of cross flow applications s npoud uoo www gelifesciences com bioprocess 157 Filtration products Kvick Lab cassette holder Designed for fast assembly Kvick Lab cassette holder utilizes sanitary connections e Capacity of 1 to 5 Kvick Lab cassettes e Three forward facing ports for convenience e Vertical inlet and outlet flow paths for excellent drainage and product recovery with less than 30 ml hold up volume e Perfectly sized to fit Kvick Lab cassettes e Adjustable stand for ease of use on the laboratory bench The Kvick Lab cassette holder is for cross flow membrane separations at volumes from less than 0 5 liters to 25 liters The holder is easy to set up and quick and convenient to use Its design with fewer parts and connections makes assembly very fast Drainage and product recovery are excellent with less than 30 ml hold up volume Together this holder and Kvick cassettes enable fast and accurate concentration and diafiltration of biological solutions Furthermore trial data can be scaled quickly to larger systems Product development scale up is linear from laboratory to production 158 www gelifesciences com bioprocess Ordering information Product Quantity Code No Kvick Lab Holder KLHRO105000SS 1 56 4112 79 Accessories Diaphragm Valve stainless steel 1 2 inch sanitary connections KFSY01071DV05 1 56 4112 95 1 2 inch Sanitary Clamp KFSY0107TCLOS 1 56 4112 85 1 2 inch
289. of feed or viscous feedstocks Sepharose Big Beads is the natural choice for the capture step in a process where high throughput and capacity are essential in packed column mode Typical flow velocities for dilute samples are gt 1000 cm h The large particle size combined with high physical stability ensures rapid processing of viscous samples These media should be chosen for clarified feedstocks when high throughput is required and resolution is of less importance E BioProcess Media Custom Designed Media g produced on receipt of order 68 www gelifesciences com bioprocess E Capto DEAE New E Capto Q E Capto ViralQ E Capto S E Capto MMC E Capto adhere gt gt For further information about Capto MMC and Capto adhere see the Multimodal chromatography section page 76 E MacroCap SP e DEAE Sephadex A 25 e QAE Sephadex A 25 e CM Sephadex C 25 e DEAE Sephadex A 50 e QAE Sephadex A 50 e CM Sephadex C 50 E SP Sepharose Big Beads E Q Sepharose Big Beads Sepharose XL High loading capacities for more productive capture from clarified feedstocks Q Sepharose XL and SP Sepharose XL have high loading capacities compared with Sepharose Fast Flow ion exchangers Combined with high throughput this helps improve the production economy of manufacturing processes Both adsorbents are based on the well established Sepharose Fast Flow media Sepharose Fast Flow Proven in validated large scale production of biopharmaceutic
290. on Quartz glass Transfer permeate control pump option STA PURE PVDF 316L Glass EPDM PTFE Silicone Al O PFA Kynar Titanium Santoprene Polypropylene Buna UV option Fused quartz Transfer permeate control pump option STA PURE PVDF Santroprene depending on hose 316 stainless steel 172 www gelifesciences com bioprocess Normal flow filtration ULTA cartridges ULTA Pure SG ULTA Pure SG utilizes the unique properties of a patented microbially retentive polyethersulphone membrane to provide sterilizing grade filtration to meet the specific needs of the pharmaceutical industry ULTA Pure SG membranes have an asymmetrical pore structure with a high voids volume which offers high dirt holding capacity resulting in higher throughputs and higher flow rates than symmetrical membranes ULTA Pure SG filters have low chemical and protein binding characteristics which result in minimal levels of material lost to adsorption They can handle a wide range of liquids across the full pH range including many organic solvents The filter cartridges have low extractable levels The membrane is inherently hydrophilic and the filters can be easily and repeatedly integrity tested ULTA Pure SG filters feature e 0 2 micron polyethersulphone membrane e Microbially retentive and validated to ASTM F838 83 methodology High throughputs and flow rates e Low adsorption of chemicals and proteins e Wide range of chemical
291. on exchangers are well established in industry A wide range of base matrices has been developed to address most customer requirements Capto is a new product line specifically developed to enable quick and economical handling of large volumes in biopharmaceutical production The rigidity of Capto media allows for longer bed heights in smaller diameter columns thereby simplifying column handling as well as reducing investment in large scale equipment The Capto line is composed of a strong anion exchanger Capto Q a strong cation exchanger Capto S a weak anion exchanger Capto DEAE a multimodal weak cation exchanger Capto MMC and Capto adhere a strong multimodal anion exchanger gt gt For further information about Capto MMC and Capto adhere see the Multimodal chromatography section page 76 The flexibility offered by Capto media opens new possibilities in large scale protein purification The handbook lon Exchange Chromatography and Chromatofocusing Principles and Methods can be obtained through your local GE Healthcare office Code No 11 0004 21 www gelifesciences com bioprocess MacroCap SP is a macroporous cation exchanger designed for the purification of PEGylated and other large biomolecules It allows separation of mono from oligo and non PEGylated proteins with high selectivity even under high load conditions Sepharose Big Beads Sepharose Fast Flow Sepharose XL and Sepharose High
292. on highly cross linked 4 agarose Particle size 90 um average d g val Ligand n butyl pH stability operational 3 13 CIP stability short term 2 14 min 150 cm h 100 kPa XK 50 60column bed height 25 cm Pressure flow spec E Butyl S Sepharose 6 Fast Flow See p 74 75 130 Pack size Code No 25 ml 17 0978 10 200 ml 17 0978 02 11 17 0978 03 5 17 0978 04 Data file 11 0026 34 Regulatory Support File 11 0028 44 Prepacked columns HiTrap Butyl S FF 5x1 ml 17 0978 13 HiTrap Butyl S FF 5x5 ml 17 0978 14 HiTrap HIC Selection Kit 7x1 ml 28 4110 07 HiScreen Butyl S FF 4 7 ml 0 77 x 10 cm 28 9269 85 Technical data Composition highly cross linked 6 agarose Particle size 90 um average d val Ligand butyl S pH stability operational 3 13 CIP stability short term 2 14 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm Pressure flow spec E Capto adhere See p 66 69 77 130 E Capto DEAE See p 66 69 130 Pack size Code No Pack size Code No 25 ml 17 5444 10 25ml 17 5443 10 100 ml 17 5444 01 100ml 17 5443 01 1l 17 5444 03 1l 17 5443 03 5l 17 5444 04 5l 17 5443 04 101 17 5444 05 101 17 5443 05 60 17 5444 60 601 17 5443 60 Data File 28 9078 88 Data File 11 0025 76 Regulatory Support File 11 0029 40 Regulatory Support File 11 0029 46 Prepacked columns Prepacked columns HiTrap Capto adhere 5x1 ml 28 4058 44 HiTrap Capto DEAE 5x1 ml 28 9165 37 HiTrap Capto adhere 5
293. onitor signals UV conductivity pH pressure and air are established through simple WATCH commands Real time process monitoring As the chromatography run progresses selected monitor signals are displayed numerically or as trend curves The process picture with actual flow path and the continuously updated logbook can be displayed UNICORN architecture Method text editor UNICORN control module www gelifesciences com bioprocess 119 swaysfis ydppozowoyy Chromatography systems Real time control Up to four systems can be connected to one UNICORN workstation where individual controllers handle the real time control of each system Data evaluation or methods programming can be done while the systems are running The control unit CU 950 Ethernet and USB provides a high degree of security for control and data The unit secures started runs even if the local PC and communication is disrupted CU 950 Advanced also contains an internal memory that collects data in case of communication failure Extensive data evaluation All monitor data are stored in a Result File for storage and evaluation Extensive data processing routines include curve smoothing differentiation normalization baseline calculation peak integration and height equivalent to a theoretical plate HETP calculations Evaluation procedures can be retrieved from a programmed method to process data and generate reports as pa
294. open flow path design e Integrated UNF fittings for feed and retentate permeate connections allows direct connection to AKTAcrossflow system e Membrane area of 40 cm AXH or 50 cm AXM allows direct performance comparison when evaluating multiple membrane pore sizes e Standard path lengths of 30 and 60 cm enables accurate scale up and scale down studies Hollow fiber Start AXM and Start AXH cross flow cartridges are self contained disposable filtration devices They enable process development and optimization of ultrafiltration UF and microfiltration MF operations for cell processing and upstream clarification of biopharmaceutical solutions The cartridges are designed for small scale processing rapid laboratory concentration and or diafiltration of biological solutions at research scale volumes with convenience and speed The cartridges are easy to use and minimize membrane polarization due to the sweeping action generated by a recirculation pump Typical application areas for Start cross flow cartridges include cell harvesting and washing clarification of lysates and cell cultures and concentration diafiltration and purification of monoclonal antibodies plasmids proteins viruses vaccines colloids and plasma Start hollow fiber cartridges are comprised of polysulfone PS based membranes of seven UF molecular weight ratings and four MF micron ratings for processing a wide range of cells viruses and biomolec
295. or information on Cellbags for use with WAVE 20 50 systems see page 48 www gelifesciences com readytoprocess 43 ssa00igo fippay ReadyToProcess WAVE Bioreactor System 2 10 Ordering information Product Quantity WAVE Bioreactor System 2 10EH includes Cellbag Holder System 2 10 Perfusion Controller for use with Cellbag2L P only includes two Watson Marlow pumps for feed and harvest System 2 10 Perfusion Controller for use with Cellbag2L P only includes two pinch valves for feed and harvest Protective white opaque PVC lid for use with BASE2 10EH 1 Code No 28 4115 00 28 4116 35 28 4116 36 28 4115 33 Technical specifications WAVE Bioreactor System 2 10 is for use with working culture volumes between of 100 ml and 5 I This compact unit is ideal for animal insect and plant cell cultures and includes features such as aeration heating and temperature control Features of the WAVE Bioreactor System 2 10 include e Cellbag holder e LCD display and control interface e Integral airpump with mass flow meter e Temperature control with heater and sensor Cell Culture Bag in Switzerland 44 www gelifesciences com readytoprocess Performance e Adjustable rock rate 3 to 40 rocks min e Adjustable angle from 2 to 9 e Integral airpump with mass flow meter e RS 485 communications port e LCD display and control interface e Temperature control with heater and s
296. ording to size Large molecules elute either in the void volume or early in a chromatographic separation Smaller molecules depending on their degree of penetration of the pores of the matrix elute later Gel filtration is a simple technique which complements ion exchange hydrophobic interaction reversed phase and affinity In process chromatography gel filtration is used principally for desalting the product for buffer exchange or for specific removal of contaminants with molecular weights above or below the desired product s molecular weight Typically molecules must differ in size by two fold to yield a good separation although other adsorptive effects can augment some separations where molecules are similar in size The handbook Gel Filtration Principles and Methods can be obtained through your local GE Healthcare office or downloaded from our website Code No 18 1022 18 www gelifesciences com bioprocess Excellent range Gel filtration is useful at Polishing or final purification stages where volumes are much lower than at the Capture or Intermediate stages and there is a need to remove dimers or aggregates GE Healthcare has an excellent range of gel filtration media ranging from Sephadex G types and different Sephacrul selectivities to the Superdex family p C _ a Selection guide Capture Sepharose Fast Flow Polishing Sephacryl Superdex Sephadex G 25 Interme
297. ormal use GEHC does not warrant that the Software is error free or that Buyer will be able to operate the Software without problems or interruptions GEHC s sole liability and Buyer s exclusive remedy in the event of breach of this warranty is limited to repair replacement or refund at the sole option of GEHC 9 5 Services GEHC warrants that all Services will be carried out with reasonable care and skill GEHC s sole liability for breach of this warranty shall be at its option to give credit for or reperform the Services in question This warranty shall only extend for a period of ninety 90 days after the completion of the Services 9 6 To the maximum extent permitted by applicable law GEHC hereby expressly disclaims and Buyer hereby expressly waives any warranty regarding results obtained through the use of the Products including without limitation any claim of inaccurate invalid or incomplete results All other warranties representations terms and conditions statutory express implied or otherwise as to quality condition description merchantability fitness for purpose or non infringement except for the implied warranty of title are hereby expressly excluded 9 7 Unless expressly agreed GEHC is not obliged to carry out dismantling or re installation of any Product in connection with any warranty claims 10 Limitation of Liability 10 1 GEHC shall have no liability under the warranties contained in Section
298. ormance of the WAVE Bioreactor and related WAVE equipment yoddns pup ad1nsas Web based courses eSYS1 Basic control of AKTAexplorer and AKTApurifier using UNICORN The online course is interactive and can be completed at your own pace Animations audio instructions and interactive exercises are included demonstrating system controls basic and advanced programming and report generation He ke www gelifesciences com bioprocess 201 Service and support Fast Trak Centers Fast Trak services including training amp education consulting and validation are available from GE Healthcare throughout the world via our Fast Trak Centers Contact a center listed here or your nearest GE Healthcare office IF i Fast Trak Center Europe Fast Trak Center China GE Healthcare Europe GmbH GE Healthcare Oskar Schlemmer Strasse 11 GE China Research and Development 80807 M nchen Germany Center Co Ltd 1800 CaiLun Road Email ftcourses europe ge com Zhangjiang High tech Park Pudong Tel 49 0 89 96 28 16 90 Shanghai 210203 China Fax 49 0 89 96 28 16 79 Email fasttrakasia ge com Tel 86 21 50504666 2600 Fax 86 21 50808591 Fast Trak Center North America GE Healthcare Bio Sciences Corp 800 Centennial Avenue Fast Trak Center Bangalore India Piscataway NJ 08855 1327 USA GE Healthcare Life Sciences John F Welch Technology Center Email FasttrakNA ge com 122 EPIP Whitefield Tel 1 7
299. ose 4 Fast Flow Heparin Sepharose 6 Fast Flow ECH Lysine Sepharose 4 Fast Flow Blue Sepharose 6 Fast Flow Blue Sepharose 6 Fast Flow Heparin Sepharose 6 Fast Flow Chelating Sepharose Fast Flow AVB Sepharose High Performance Custom Designed Media produced on receipt of order www gelifesciences com bioprocess Procainamide Sepharose 4 Fast Flow villSelect Plasminogen Removal Gel a1 antitrypsin a 2 macroglobulin a2 macroglobulin Fibronectin Fibronectin Plasminogen and plasminogen activator Albumin Interferon Interferon Interferon Adeno associated viruses Butyrylcholinesterase Beta domain depleted FVIII Plasminogen Hydrophobic gt interaction ae chromatography JO Technique description Proteins and peptides differ from one another in their surface hydrophobicity and this difference forms the basis of a HIC separation Salt solutions are used to mediate the binding of sample molecules to a hydrophilic matrix substituted with a hydrophobic ligand Widespread application Hydrophobic interaction chromatography HIC is well established within protein purification today and has evolved into one of the most powerful methods in preparative biochemistry By combining versatility with high selectivity it is mainly employed in the intermediate or final purification stages of a wide variety of substances Its speed resolution and capacity rival ion exchange chromatography its selectivity is comp
300. owntime of less than 1 h This saves time capital investment start up cost and costs of labor and consumables Validation with UNICORN software UNICORN software has an installation wizard that checks the setup and the installation and functionality of the new Flow Kit and sensors A report is generated with completed installation procedures including instructions from the wizard traceability to Flow Kit process information and results from the component test The installation wizard also contains instructions and reports for column installation UNICORN has undergone an independent audit and is designed as a control package in FDA 21 CFR part 11 and GMP compliant environments The record system uses a document locking scheme and traceable audit log For integration purposes UNICORN communicates with control systems within the plant via OLE for Process Control OPC OPC supports application areas such as data access for real time values and security control to protect sensitive information ssad0jgolfippay available 2008 Technical specifications Width Depth Height 1000 800 1650 mm Weight 230 kg UNICORN version 5 11 or higher AC Voltage 1 x 100 120 200 208 220 230 240 V 10 50 60 Hz Control system Instrument input voltage Max power consumption 1 kVA Ingress protection IP45 Compressed air interface 5 5 7 bar 50 NI min oil and particle free 2 C 30 C 7 5 510 I h High Flow Kit 3 175 I h Low F
301. pecifications Detection technology Information provided Data presentation Analysis time per cycle Automation Sample type Required sample volume Injection volume Flow rate range Flow cell volume Flow cell height Sample reagent capacity Analysis temperature range Sample storage Sample refractive index range Buffer selector In line reference subtraction Surface Plasmon Resonance SPR biosensor Kinetic and affinity data KD ka kd specificity concentration and thermodynamics data Result tables result plots and real time monitoring of sensorgrams Typically 2 15 min 48 hours unattended operation Low MW drug candidates to high molecular weight proteins also DNA RNA polysaccharides lipids cells and viruses in various sample environments e g in DMSO containing buffers plasma serum Injection volume 20 50 ul application dependent 2 350 ul From 1 100 pl min 0 06 ul 40 um 1x 96 or 384 well microplate up to 33 reagent vials 4 45 C maximum 20 degrees below ambient temperature 4 45 C maximum 15 degrees below ambient temperature 133 139 Automatic switching between 4 buffers Automatic Literature Brochure Code No Biacore T100 28 9168 13 AA www gelifesciences com biacore 189 s s jpup uo1 20137 U1 2314 q07 ES Label free interaction analysis Biacore C The Biacore C system is optimized for quantitative and qualitati
302. phic techniques DEV1 Introduction to Chromatography Techniques and Bioprocessing A three day basic hands on course on chromatographic techniques suitable for production scale biomolecule purification DEV2 Downstream Bioprocess Development A five day hands on course for people with basic experience who want to improve their knowledge in downstream process development DEV4 Bioprocess Scale up and Technology Transfer A three day hands on course focused on designing and scaling up a laboratory scale process to production COL1 Large scale Column Packing A three day practical course on packing qualifying and maintaining production chromatography columns SYS1 Introduction to UNICORN System Control for Chromatography Systems A two day basic course on practical and theoretical control of the system as well as the report functions SYS2 Advanced UNICORN System Control for Chromatography Systems A three day advanced course on conditional control programming to achieve optimal performance of the system document and report results as well as network considerations SYS3 UNICORN System Control for Automated Filtration Systems A two and a half day intensive course on how to control an AKTAcrossflow system WAV1 Theory Setup and Operation of the single use WAVE Bioreactor A two day practical course providing theoretical and technical background knowledge as well as hands on experience on the operation and optimum perf
303. placement of wetted components after product change Calibration and function testing Parts coverage on a part for part exchange basis Parts locker with guaranteed delivery times of critical stock Engineer labor and travel coverage with unlimited service calls Guaranteed on site engineer response 1 day or 2 day selective availability Column offerings Column maintenance Service agreements for columns can include e Comprehensive column maintenance including documentation scheduled as required by the process Parts coverage on a part for part exchange basis Parts locker with guaranteed delivery times of critical stock Engineer labor and travel coverage with unlimited service calls Guaranteed on site engineer response 1 day or 2 day selective availability Other column services e Trouble shooting e Column re packing scheduled e Column performance evaluation e Functional test 1Q OQ Security of supply Securing the supply of chromatography media is essential to successful biopharmaceutical development and manufacture As protein based drugs and or vaccines progress further along their route to market manufacturers need to be confident that they can produce enough material on time for clinical trials and product launches The media must be of consistently high quality and delivered on time during all stages of your production cycle With an annual media production exceeding 450 000
304. plasmids Aseptic cell processing Environments where terminal sterilization is not feasible Preclinical through Phase II clinical trials Fast track drug development processes Lean Manufacturing The ReadyToProcess line of products simplifies and accelerates bioprocessing reducing investment and shortening development time They also help reduce wasteful practices increasing manufacturing agility and opening doors to new business opportunities gt gt Visit us on the web at www gelifesciences com readytoprocess ssa00jgo fippay Sterile Virus Virus filtration filtration filtration Aseptic filling Chromatography Concentration Chromatography Concentration Chromatography Sterile Diafiltration Diafiltration filtration mm CU mE CI Wu O La Buffer bags Buffer bags Buffer bags Column protection Chromatography Final fill filtration a ReadyToProcess ULTA Cap ReadyToProcess chromatography columns ReadyToProcess ULTA Cap SG HC capsules and AKTAready system SG HC capsules www gelifesciences com readytoprocess 37 ReadyToProcess 38 ReadyToProcess WAVE systems The WAVE Bioreactor is an effective cost efficient device for cell culture Culture medium and cells contact only a presterile disposable chamber that is positioned on a special rocking platform The rocking motion of the platform induces waves in the culture fluid and thereby provides continual mixing and o
305. preprogrammed sanitization method and column lists constant pressure regulation of flow rate during sample application and during column packing e Validation support 1Q 0Q documentation available UNICORN supports FDA 21 CFR Part 11 for Electronic Signatures and Electronic Records e Bench top design fits in small areas e All wetted parts are externally mounted and are easily changeable for convenient product change over when campaigning simplified cleaning validation The sanitary system for rapid process development and small scale production The system consists of the AKTApilot separation unit a computer including a flat screen monitor and UNICORN control system UNICORN ensures quick simple communication between systems and users and meets the stringent control and data handling procedures of modern production and laboratory facilities Method wizards provide easy method generation Optimized methods are transferred easily from laboratory to production scale In addition to the two outlet fraction valves you can connect four extra EVB 988 valves External Valve Block Two extra EVB 981 inlet valves can also be connected on the outlet valve rack Trouble free sanitization AKTApilot system is easily sanitized with 1 M sodium hydroxide NaOH Microbial challenge tests that subject the system to infection with solutions containing three strains of bacteria recommended by the United States Pharmacopoeia
306. produce approximately Top a Pa PSIG APTOP S50 56 4107 61 KFSM12 Conversion kit to change low void volume pumps have a low point drain port 1 5 in Tri Clamp fittings and produce approxi FlexStand to standard assembly mately 30 Ipm at 25 psig 56 4107 64 KTC 2 Tubing connector kit for FS 01S Code No Part No Description 56 4107 65 KTC FS 03VS Tubing connector kit for FS O3LVS 56 4106 39 RLP 250F1 LABTOP 250 Teflon rotors 56 4106 03 PG TCP30 Pressure gauge 0 2 barg 0 30 psig 56 4106 54 RLP 250FT HPS LABTOP 250 Teflon rotors high pressure mechanically dampened autoclavable shut off 56 4106 04 PG TCP60 Pressure gauge 0 4 barg 0 60 psig 56 4106 40 RLP 250FT 50 LABTOP 250 Teflon rotors 220 v 50 Hz mechanically dampened autoclavable 56 4106 55 RLP 250FT 50 HPS LABTOP 250 Teflon rotors 220 v 50 Hz high 56 4106 06 PG TCV30P30 Vacuum pressure gauge 2 to 2 barg 30 to 30 pressure shut off psig mechanically dampened autoclavable 56 4106 41 RLP 250FT SS LABTOP 250 stainless steel rotors 56 4107 72 KDV F1 Drain valve kit for FS 01S includes custom tee 56 4106 56 RLP 250FT SS HPS LABTOP 250 stainless steel rotors high sanitary plug valve gasket and clamp pressure shut off 56 4107 73 KPCM 1 anual permeate control kit includes vacuum 56 4106 42 RLP 250FTSS 50 LABTOP 250 stainless steel rotors 220 v 50 Hz pressure gauge backpressure valve supports 56 4106 57 RLP 250FTSS 50 HPS LABTOP 250 stainless steel rotors 220 v
307. quirements and make smooth transitions into clinical trials and manufacture This helps bring drug candidates to market in a faster simpler more reliable and cost effective manner Improving efficiencies The choice of bioprocessing steps has the greatest impact on how efficiently you manage the fermentation capture purification and polishing stages We offer a broad range of products and platform technologies to address these challenges Our tools and solutions such as bioreactors cell culture growth media chromatography selecitvities membrane cut offs allow us to provide an integrated and Lean enabling approach to bioprocessing that combines upstream and downstream Examples of how GE Healthcare supports more efficient processing are the recently introduced ReadyToProcess platform that includes ready to use and disposable products and PreDictor filter plates for high throughput screening of chromatographic conditions www gelifesciences com bioprocess ReadyToProcess products simplify and speed up bioprocessing by reducing upfront investment and accelerating development They also help eliminate wasteful practices facilitating the introduction of Lean production schemes ReadyToProcess products are designed for smooth interconnectivity and seam less scalable implementation in biopharmaceutical operations both upstream and downstream Hulssadoidoig PreDictor plates support high throughput process development by allowing par
308. r stages or during second generation process planning we can provide the skills to help you develop a cost efficient cGMP compliant manufacturing process Typical projects Development of chromatographic or filtration protocols for the purification of monoclonal antibodies viruses vaccines plasmids peptides oligonucleotides and proteins from recombinant or natural sources Trouble shooting optimization of an existing unit operation as well as an entire downstream process Screening and optimization of chromatographic steps using automated high throughput PreDictor 96 well plate technology currently only available in Europe Automated screening for normal and crossflow unit operations using AKTAcrossflow system Process scale up technical transfer support and assessment of corresponding hardware requirements Our service can significantly enhance the speed and value of your downstream process development or optimization project Together with our Life Science Performance Solution team see also related section on page 203 we can support you in running process improvement projects and skills transfer sessions that will drive and sustain change throughout your organization We have a long history of working with the pharmaceutical and biopharmaceutical industries under strict confidentiality agreements 200 wwwelifesciences com bioprocess Consulting Both newly started and well established biopharmaceutical companies ar
309. r UNICORN software Spare parts Spare parts are not neglected To help minimize downtime we can provide a list of essential parts to keep on site Holding a guaranteed stock of critical components on your behalf and for a monthly fee delivering any designated part according to an agreed time frame is also part of the service Service agreements Service agreements for BioProcess systems and large scale columns include comprehensive preventive maintenance scheduled according to requirements parts support engineer labor and travel costs and guaranteed on site response gt gt For more information see page 206 www gelifesciences com bioprocess 31 Product highlights Life Science Performance Solutions New Building on decades of expertise GE Healthcare s Life Science Performance l EJ Solutions team provides a range of consulting services all aimed at driving and gt For further details on Life Science sustaining organizational changes and improvements Panionmenee seliniene seepage 20 We apply a range of solutions including e GE Lean Workflow Improvement e GE Management and Leadership Systems e Lean Six Sigma training Acceleration Effective Results Process Customized programs can also be created to help reach specific performance goals Scientific Asset Services New Pharmaceutical and biotech companies face many challenges today such as higher operational costs regulatory pressures and
310. r more information please visit www gelifesciences com biacore Biacore T100 New Productive research and development Biacore T100 offers a versatile multi application solution that sets the performance standard for interaction analysis Software wizards assist with the evaluation of every interaction parameter making the system very straightforward to use Applications such as antibody characterization which could take weeks by conventional methods can be completed in days Regulatory compliance An optional G x P support package saves significant time during validation procedures Biacore T100 has been specifically designed with a high level of built in GLP GMP GCP support for 21 CFR Part 11 compliance The versatility of the Biacore T100 system allows users to e Elucidate disease mechanisms by characterizing native or recombinant protein interactions e Select the best antibodies as research tools assay components or therapeutics by fully defining their interaction behavior e Define potential drug targets and diagnostic markers eCharacterize protein LMW compound interactions in drug discovery e Select protein therapeutic candidates according to their on off rates e Detect and characterize immune responses during preclinical and clinical development e Characterize protein therapeutics and implement QC methods mass spectrometry e Recover interaction partners for characterization by Technical s
311. r or MPC coupling Cellbag 2 Oxywell version 1 CB0002L10 02 e Multiuse Luer port with cap Cellbag 2 perfusion version 1 CB0002L10 04 e Oxywell2 Silicone sheath for DO probe Cellbag 2 screw cap ports 1 CB0002L10 03 Biocompatability e Testing is performed on irradiated film 50 kGy Cellbag 10 1 CBO010L10 01 e USP XXII plastic class VI and ISO 10993 Cellbag 10 includes 100 g FibraCel al CB0010L10 07 e ISO 10993 4 Hemolysis study in vivo extraction method Cellbag 10 Oxywell version 1 CB0010L10 02 e ISO 10993 5 Cytotoxicity study using ISO elution Cellbag 10 perfusion version 1 CB0010L10 04 method Cellbag 10 pH version 1 CBO0010L10 05 e ISO 10993 6 Muscle implantation study in rabbit Cellbag 10 screw cap ports 1 CB0010L10 03 e ISO 10993 10 Acute intracutaneous reactivity study in Cellbag 20 1 CB0020L10 01 rabbit Cellbag 20 includes 200 g FibraCel 1 CB0020L10 07 e ISO 10993 11 Acute systemic toxicity in mouse Cellbag 20 Oxywell version 1 CB0020L10 02 Sterility and Cellbag 20 perfusion version 1 CBO020L10 04 endotoxin e Sterilized by gamma radiation at 25 to 40 kGy Cellbag 20 pH version 1 CB0020L10 05 e Lot release requires lt 0 125 EU ml endotoxin Cellbag 20 screw cap ports 1 CB0020L10 03 Temperature rating Cellbags may be used from 0 C to 50 C Cellbag 22 includes 200 g FibraCel 1 CB0022L10 07 Pressure rating e Maximum operating pressure 1 5 psig 0 1 bar Cellbag 22 Oxywell version 1 GROOF ALTORA Me
312. r system iFlux 120 Conversion Cass to HF 3 T Kit for conversion from cassette to Hollow fiber system iFlux 400 Conversion Cass to HF c 2 T Kit for conversion from Hollow fiber to cassette system iFlux 30 Conversion HF to Cass c 2 T Kit for conversion from Hollow fiber to cassette system iFlux 120 Conversion HF to Cass fe 2 Kit for conversion from Hollow fiber to cassette system iFlux 400 Conversion HF to Cass Cc 2 UniFlux 30 Spool kit 35 Flux 30 Spool kit 75 Flux 120 Spool kit 35 Flux 120 Spool kit 75 Flux 400 Spool kit 45 iFlux 400 Spool kit 85 Spool piece for size 35 Hollow fiber cartridge Un Spool piece for size 75 Hollow fiber cartridge Un Spool piece for size 35 Hollow fiber cartridge Un Spool piece for size 75 Hollow fiber cartridge Un Spool piece for size 45 Hollow fiber cartridge c 2 T Spool piece for size 85 Hollow fiber cartridge Literature Data File UniFlux membrare separation systems 18 1177 25 www gelifesciences com bioprocess 171 sjonpoid uoo Filtration products System performance System size 10 LPM 30 LPM 120 LPM 400 LPM Hollow fiber membranes No of cartridges 1 I 2 up to 4 Min Max area ft 1 3 5 2 3 9 65 19 8 130 108 560 m 0 12 0 48 0 36 6 18 12 10 52 Cartridge size 5 6 55 55 5 35 5975 45 65 85 Lumen diameter Consult your GE Healthcare representative for application specific information
313. r time mode and different fraction sizes can be collected during different stages of a separation 4 fa wo E v gt v Ee N w w oO fe a Automatic peak fractionation based on peak detection using slope or level sensing minimizes peak dilution and cross contamination Event marks correlate the fractions with the chromatogram A recycle function enables collection from repetitive runs 134 www gelifesciences com bioprocess tion products Filtration 138 Normal flow filtration ULTA cartridges 173 Filtration products Filtration Cross flow filtration CFF normal dead end flow filtration The following classes of filtration products are available NFF and chromatographic separations are all frequently e Hollow Fiber Hollow Fiber Cartridges amp Systems required in the purification process of biological fluids e Cassettes Kvick Cassettes Holders amp Systems CFF and NFF are positive barrier separations and thus flat sheet membrane devices complement chromatography e Normal Flow ULTA Normal Flow Cartridges amp Hardware GE Healthcare provides filtration solutions and support The above classes comprise membranes and systems for integrated bioprocessing applications at every step that provide optimum membrane packing density ease and every scale of the drug development validation and of validation and reliable scale up from laboratory to manufacturing process
314. ra Si las variantes de validez local difieren de las Condiciones Comerciales Generales estas variantes deber n considerarse normativas Fran ais Les traductions des Conditions G n rales de Vente suivantes pourront tre consult es sous www gelifesciences com protein_purification Des variantes locales des Conditions G n rales de Vente peuvent tre applicables dans certains pays Si cela est le cas les variantes en vigueur localement peuvent tre consult es sous www gelifesciences com protein_purification ou dans les bureaux de distribution sur place Si les variantes en vigueur localement divergent des Conditions G n rales de Vente les variantes en vigueur localement devront tre consid r es comme d terminantes Italiano Le traduzioni delle seguenti condizioni generali di contratto possono essere visionate sotto www gelifesciences com protein_purification In alcuni paesi possono trovare applicazione alcune varianti locali In questo caso le eventuali varianti vigenti in loco possono essere visionate sotto www gelifesciences com protein_purification o negli uffici di vendita in loco Se queste varianti differiscono dalle condizioni generali di contratto sono da considerarsi determinanti le varianti locali Nederlands Vertalingen van de navolgende algemene handelsvoorwaarden kunnen ingezien worden onder www gelifesciences com protein_purification In enkele landen kunnen plaatselijke varianten voor de algemene ha
315. rage dy val Metal ion capacity Dynamic binding capacity pH stability operational CIP stability short term Pressure flow spec 15 umol Ni ml medium 40 mg histidine tagged protein ml medium protein dependent 3 12 2 14 base matrix 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm Special pack size delivered on specific customer order www gelifesciences com bioprocess 225 jo6a7 pub saxapu Indexes and Legal E Octyl Sepharose 4 Fast Flow See p 74 75 130 Percoll PLUS See p 181 Pack size Code No Pack size Code No 25 ml 17 0946 10 250ml 17 5445 02 200 ml 17 0946 02 1l 17 5445 01 1l 17 0946 03 Regulatory Support File 11 0029 39 5 17 0946 04 Technical data Regulatory Support File 11 0028 22 Composition Silica with covalently linked silane Prepacked columns Particle diameter 15 30 nm HiTrap HIC Selection Kit 7x1 ml 28 4110 07 Density 1 13 0 005 g ml HiTrap Octyl FF 5x1 ml 17 1359 01 Osmolality max 30 mOsm kg HiTrap Octyl FF 5x5 ml 17 5196 01 Viscosity max T56P HiPrep 16 10 Octyl FF 20 ml 17 5097 01 HiScreen Octyl FF 4 7 ml 0 77 x 10 cm 28 9269 86 Phenyl Sepharose Big Beads See p 75 87 Technical data Composition highly cross linked 4 agarose Particle size 90 um average d Ligand n octyl pH stability operational 3 13 CIP stability short term 2 14 base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm Pressure flow spec
316. raphy Technique description Multimodal separation is based on different types of interaction depending on the nature of the multimodal ligand and overall process conditions The most common interaction for GE Healthcare s line of multimodal ion exchangers is based upon the selective reversible adsorption of charged molecules to an immobilized multimodal ion exchange group of opposite charge with hydrophobic character For other multimodal media such as PlasmidSelect Xtra the predominate interactions are of aromatic and thiophilic nature Both types of media consist of an insoluble porous matrix to which the multimodal ligands have been covalently bound In multimodal chromatography it is important to A range of Data Files covering our Multimodal Chromatography media is now available Please contact your local GE Healthcare office to obtain your copy Capto MMC Code No 11 0035 45 Capto adhere 28 9078 88 PlasmidSelect Xtra 28 4094 87 www gelifesciences com bioprocess E whe BP as 8 screen the overall process conditions e g pH and conductivity in order to evaluate the full potential of the media both for binding and elution mode In many cases the specific interaction between the multimodal ligand and the target molecules is a complex mixture of different interactions which is also very dependant of the overall process conditions Media containing multimodal ligands are characterized by interactions
317. rawings and specifications to GEHC to enable it to manufacture non standard or custom made Products the Buyer warrants that such manufacture will not infringe the intellectual property rights of any third party 11 2 All intellectual property rights in the Products and or Services shall at all times remain vested in GEHC or its licensors 12 Health Safety and Waste The Buyer shall ensure that i the Products provided such Products comply with its specifications are suitable and safe for the Buyer s intended use ii the Products are handled in a safe manner iii containers packaging labelling equipment and vehicles where provided by the Buyer comply with all relevant national and international safety regulations 13 Indemnities Except where a claim arises as a direct result of the negligence or breach of contract of GEHC the Buyer shall indemnify GEHC in respect of any claim which may be made against GEHC i arising in connection with the Buyer s use of the Products ii alleging that the Buyer s use of the Products infringes the intellectual property rights of any third party 14 Insolvency In the event that the Buyer becomes insolvent or applies for bankruptcy or being a company goes into liquidation other than for the purposes of reconstruction or amalgamation GEHC shall be entitled immediately to terminate the Contract without notice and without prejudice to any other rights of GEHC hereunder
318. reases continuously thus lowering the overall reaction rate Moreover flow through technology delivers three further advantages its synthesis cycle time is faster which thus reduces overall production time it produces less waste and in combination with high accuracy pumps it allows more exact control of reagent contact times A Flow through reactor The coupling mixture moves down as a reagent zone continuously replacing reagents consumed by the reaction The amidite concentration is the same at the end of the reaction as at the beginning B Batch reactor Reagents consumed by the coupling reaction are not replaced Amidite concentrations fall to low levels A Flow through reactor B Batch reactor Start End Start End Amidite conc 25mM 25mM Amidite conc 11 5mM 3 8mM Activator conc 375 mM 375 mM Activator conc 173 mM 173 mM The efficiency of the flow through reactor A is superior to that found in a batch reactor B At the end of the reaction when one equivalent has been consumed the active concentration of amidite in OligoPilot 400 for example can be more than 6 times higher www gelifesciences com oligo 193 sisayjufis apijoajanuobijo hb je Oligonucleotide synthesis bh 194 Solid supports Polystyrene based supports have full length products and reduce been produced by GE Healthcare reagent consumption A significant since the mid 1980 s They allow cost reduction in other
319. rlassung Osterreich Europlaza Geb ude E Wienerbergstrasse 41 A 1120 Wien T 43 1 57606 1613 F 43 1 57606 1614 Email cust orderde ge com Technical Support T 43 157606 1619 Belgium GE Healthcare Europe GmbH Branch office Benelux Kouterveldstraat 20 B 1831 Diegem BELGIUM T 0800 73 890 F 02 416 82 06 Email order bnlI ge com Central amp East Europe Austria GE Healthcare Europe GmbH Branch Vienna International Europlaza Building E Technologiestrasse 10 A 1120 Vienna Austria T 43 197272 2712 F 43 197272 2750 Email cust servex ge com Sales support to Czech Republic Hungary Poland Slovakia Slovenia Croatia Bulgaria Romania Albania FYROM Macedonia Serbia and Montenegro Bosnia Hercegowina Denmark GE Healthcare Europe GmbH Huginsvej 8 DK 3400 Hiller d T 45 45 16 24 00 F 45 45 16 24 24 Customer Service T 70 25 24 50 Email orderdk ge com Finland GE Healthcare Europe GmbH Suomen sivuliike PL 3130 FIN 00002 Helsinki T 358 9 512 3940 F 358 9 512 39439 Email orderfl ge com France GE Healthcare Europe GmbH Succursale France Parc Technologique Rue Ren Razel Saclay F 91898 Orsay Cedex T 33 0 169 35 67 00 F 33 0 169 41 96 77 Email productfr ge com Germany GE Healthcare Europe GmbH Munich Commercial Center Oskar Schlemmer Str 11 80807 M nchen T 49 899 6281660 F 49 899 6281620 Email cust servde ge com Technical
320. rmaceutical industry s need for increased flexibility and Lean enabling solutions from cell culture and fermentation to purification and final filling ReadyToProcess products include WAVE Bioreactors WAVE Mixers fluid handling as 2 or AS jia readuto information on We y ReadyToProcess use filtration and products see chromatography pages 34 61 solutions At any stage of your process development optimization or evaluation GE Healthcare can support you by offering professional services such as Fast Trak Biopharma Process Development and Consulting gt gt For more information on Biopharma manufacture of biopharmaceuticals Services Services see page 198 Lead A A Clinical phase Clinical phase Clinical phase Marketing Market eer Pre clinical testing e identification l ll approval introduction Research Pilot Scale D GMP Production 2 Process Development Process Dev gt GE Healthcare s formats for process development through manufacturing 124 www gelifesciences com bioprocess High Throughput Process Development The challenge of Process Development Efficient process development is crucial for the overall efficiency of biopharma development By pushing more projects through the early pipeline and rapidly identifying and discontinuing the unsuccessful ones resources can be focused on those that are likely to succeed In addition purification processes should be well characterized to increase rob
321. rocess chromatography AxiChrom BPG Chromaflow FineLINE INdEX 21 66 77 126 127 129 61 130 21 24 66 69 77 78 130 215 87 215 21 66 69 130 215 21 24 66 69 77 130 216 21 22 66 69 130 216 21 22 66 69 130 217 68 216 See Cross flow filtration 65 See Customized BioProcess Solutions See Change Control Protocols See Custom Designed Media 18 48 33 180 198 87 217 70 72 217 103 22 62 207 212 22 78 68 217 68 217 69 130 218 69 87 218 218 70 72 218 201 67 74 83 85 128 129 67 74 83 85 128 130 23 67 124 127 129 67 69 74 128 130 See ReadyToProcess 90 92 98 103 107 94 Column support 31 206 Connectors for process scale columns 111 112 Con A Sepharose 4B 72 218 Courses Fast Trak 30 201 Cross flow filtration vs Normal flow filtration 138 Cross flow filtration Hollow fiber cartridges 143 MaxCell process scale hollow fiber cartridges 151 MidGee cross flow cartridges 144 MidGee Hoop cross flow cartridges 145 Pilot scale hollow fiber cartridges 147 ProCell hollow fiber cartridges 153 Process scale hollow fiber cartridges 149 Start AXM and AXH cartridges 143 Steam in place hollow fiber cartridges 154 Xampler laboratory cartridges 146 Cross flow filtration Kvick cassettes and holders 155 Kvick Flow cassettes 159 Kvick Lab cassettes 157 Kvick Lab cassette holder 158 Kvick Lab packet 161 Kvic
322. roducts and or Services between GEHC and the Buyer as may be further evidenced by GEHC s final written offer quotation or order acknowledgement and no prior proposals statements representations or conditions will be binding on either party The Equipment means all electronic equipment hardware and other electronic or mechanical items agreed to be supplied by GEHC excluding any consumables and spare parts sold separately The Goods means all items agreed to be supplied by GEHC other than the Equipment and Software The Products means any Goods Equipment or Software agreed to be supplied by GEHC and The Services means all advice given and services performed by GEHC and The Software means any firmware software or data compilations i identified in the Contract or ii provided to Buyer by GEHC in connection with installation or operation of the Equipment For the avoidance of doubt Software shall not include any open source firmware software or data compilations as any such open source firmware software or data compilations will be subject to the terms and conditions set out in the relevant open source license 1 2 These Terms and Conditions shall be incorporated into the Contract and shall apply to the exclusion of any conditions of the Buyer These Terms and Conditions may not be varied or waived except with the regras gerais de com rcio Se este for o caso as variantes locais v lidas podem ser visualizadas e
323. rom 5 to 100 liters or more FlexStand benchtop pilot systems Code No Part No Description 56 4107 54 FS 01S Standard FlexStand Benchtop Pilot Cartridge Support Assembly with 1 5 in Tri Clamp connections Includes Qty Description 1 Stand and support rods 1 Pressure gauge back mount 0 4 barg 0 60 psig mechanically dampened Backpressure valve pinch type Blank off cap 6 Clamp 1 5 in sanitary 6 Gasket 1 5 in sanitary silicone Tubing connector kit KTC 2 Assembly guide 56 4107 55 FS O3LVS Low void volume FlexStand Benchtop Pilot Cartridge Support Assembly with fractional Tri Clamp connections Includes Qty Description Stand and support rods Pressure gauge back mount 0 4 barg 0 60 psig mechanically dampened Backpressure valve pinch type Blank off cap 6 Clamp fractional sanitary 6 Gasket fractional sanitary silicone 1 Tubing connector kit KTC FS 03VS Assembly guide FlexStand benchtop pilot processing systems Code No Part No 56 4107 56 FS 02RLP Description Standard FlexStand Benchtop Pilot Cartridge Sup port Assembly with 1 5 in Tri Clamp connections rotary lobe pump Includes Qty Description Stand and support rods with manifold 2 Pressure gauge back mount 0 4 barg 0 60 psig mechanically dampened Rotary lobe recirculation pump FlowTech LABTOP 350 with low point drain 1 Gear box for LABTOP 350 pump Diaphragm valve 1 5 in sanitary retentate Diaphragm v
324. rong cation exchanger for capture and intermediate purification Capto MMC e Capto MMC a multimodal weak cation exchanger that enables binding of proteins at the conductivity of most standard feed materials Capto adhere e Capto adhere a strong multimodal anion exchanger for post Protein A purification of monoclonal antibodies All Capto media are now available in convenient 1 and 5 ml HiTrap columns for start up and in 10 cm prepacked HiScreen columns for easy process design in www gelifesciences com bioprocess 21 s 46 1y461y yonpoig Product highlights Chromatography media toolbox for MAb purification platforms Antibodies are a relatively homogenous group and can successfully be purified using a platform approach i e a standard set of unit operations methods and conditions Many antibodies can be purified by a 2 step chromatography process while others may need an additional step to reach desired purity Capture using Protein A media is the common standard followed by alternative routes for removal and polishing Large scale purification of MAbs normally consists of three chromatographic steps 1 Initial capture using Protein A affinity chromatography to give a product of high purity typically 99 2 Initial removal polishing involving either cationic or anionic exchange chromatography 3 Final polishing with multimodal strong cationic or anionic exchange chromatography The GE Healthcar
325. rough preprogrammed verified packing methods Maintenance is also simplified AxiChrom 50 and 70 columns have a pivot stand that allows the user to empty the column by simply tilting eliminating heavy lifting and providing easy access to bed supports and o rings For AxiChrom 400 columns and larger the swing out tube design gives quick access to the bottom bed support and enables maintenance to be done in situ Interactive guidance from the AxiChrom Master assists users through key process steps The AxiChrom column platform features Intelligent Packing Verified pre programmed packing methods that save time and assure accurate and reproducible packing results Intuitive handling Simple operation and servicing Pivot or swing out column tubes are safer and easy to handle AxiChrom Master guides users through process steps to reduce time in method creation set up and maintenance Predictable scale up Straightforward scale up and tech transfer due to a distribution system designed using the same analytical and CFD modeling tools Sanitizable columns with full technical and regulatory support gt gt For more information see page 92 gt gt During 2008 the range of AxiChrom columns will be expanded to include a range of larger sizes Media Wand New Media Wand together with the Media Handling Unit is a versatile tool that saves time and effort with a wide range of media handling tasks The Media Wand is robu
326. rs and mounting hardware 51 4106 22 PTPM12 Peristaltic pump tubing Bioprene size 82 12 7 mm 0 5 in ID 7 6 m 25 ft 51 4106 23 PTSL12 Peristaltic pump tubing silicone size 82 12 7 mm 0 5 in ID 7 6 m 25 ft 56 4106 24 FTTYO6 Flexible tubing Tygon S 50 HL 6 3 mm 0 25 in ID 15 2 m 50 ft 56 4106 25 FTTYO9 Flexible tubing Tygon S 50 HL 9 5 mm 0 375 in 56 4106 26 FTTY12 Flexible tubing Tygon S 50 HL 12 7 mm 0 5 in ID 15 2 m 50 ft Reservoirs All polysulfone reservoir kits come with associated supports gaskets clamps and adaptors Sealable top reservoirs are for use with diafiltration operations Code No Part No Description 56 4107 63 TK01 30SS Stainless steel tank ASME code adjustable legs 30 liter capacity sanitary ports for retentate return vent filter and continuous diafiltration Withstands up to 275 C for steam sterilization Electropolished 56 4107 66 RVK 1 2 Liter polysulfone reservoir kit with open top graduated Not autoclavable 56 4107 67 FRV 2A 2 Liter polysulfone reservoir kit with sealable top Autoclavable 56 4107 68 FRV PPK 2A Replacement 2 liter polysulfone reservoir Autoclavable 56 4107 70 FRV 5A 5 Liter polysulfone reservoir kit with sealable top Autoclavable 56 4107 71 FRV PPK 5A Replacement 5 liter polysulfone reservoir Autoclavable 56 4107 69 FRV CP2 5A Replacement cap for 2 and 5 liter polysulfone reservoirs Autoclavable
327. rt of an automated procedure Batch documentation Along with the chromatographic results of each run the Result File also includes the programmed method start protocols notebooks and the logbook These files are protected and cannot be manipulated Processed data generated from an evaluation procedure are stored in the Result File but separate from the original data 120 www gelifesciences com bioprocess Start protocols are user defined questions that must be answered before a run can be started Questions can vary between simple operator prompts to those requiring mandatory answers and authorized approval Notebooks permit additional text to be included in the process documentation Separate files are generated for method notes start notes run notes and evaluation notes These notes can be entered at the designated time and cannot be altered after the run is complete All programmed and manual events occurring during the run including alarms and warnings are documented in the logbook and cannot be altered Security UNICORN provides a system for password authorization and access control Operators log in by name and password The user profile includes an access level that defines system functions available to each operator Scalability Using UNICORN for method or process development on AKTAdesign systems simplifies scale up to BioProcess system Personnel retraining is minimized and continuity exists in b
328. rwise Percoll PLUS Percoll PLUS is protected by the following patents and equivalent patents and patent applications in other countries which are licensed to GE Healthcare from Dendreon Corporation US patent number 4 927 749 US patent number 4 927 750 Canadian patent number 1 338 492 Japanese patent number 2 628 509 US patent number 5 789 148 US patent number 6 015 843 and European patent number 1 047 635 A free non transferable license to use this product for density gradient separation purposes under the above mentioned patent rights accompanies the purchase of the product from a GE Healthcare company and its licensed distributors but any use of Percoll PLUS or any other organosilanized colloidal silica particle based separation media to enrich purge or isolate cells for active immunotherapy for oncology applications shall be excluded from such license Plasminogen Removal Gel The Plasminogen Removal Gel is subject to pending patent application WO 02 095019 and other intellectual property rights owned by OMRIX BIOPHARMACEUTICALS S A Belgium OMRIX Any customer wishing to use Plasminogen Removal Gel for any purpose falling under any valid claims of the said patent rights other than for research purposes needs prior to such use to a contact OMRIX directly and b sign a license agreement with OMRIX Q Sepharose XL Separating viral particles with Q Sepharose XL products may require a license under US patent 6 537 79
329. s IMAC media Immobilized Metal lon Chromatography IMAC is a versatile purification technique for proteins including histidine tagged proteins with an affinity for metal ions Ni Sepharose 6 Fast Flow is precharged with Ni ions and is designed for purification of histidine tagged proteins suitable for scale up and accompanied with a Regulatory Support File IMAC Sepharose 6 Fast Flow is the uncharged version with the possibility to charge the metal ion of your choice suitable for histidine tagged proteins as well as other recombinant proteins and native proteins Chelating Sepharose Fast Flow is the well established BioProcess IMAC medium and is being used in several approved biopharmaceutical process Pre activated media Pre activated media allow you to couple a ligand appropriate to your application The choice of medium depends on several factors for example the groups in the ligand molecule that are suitable for coupling and the chemical stability demands on the resulting affinity medium CNBr activated Sepharose 4 Fast Flow and NHS activated Sepharose 4 Fast Flow are examples of modern pre activated media suitable for attaching various ligands MabSelect media The commercial success of approved biopharmaceuticals and the growing number of protein based drug candidates has led to projections of metric tons of monoclonal antibodies MAbs being required in a few years To meet this demand cell culture capacity is increas
330. s and real time monitoring Automation Unattended working capacity for 2 x 96 well microtiter plates automatic control of sample handling and injection Flow rate range 1 100 pl min in steps of 1 l min Flow rate precision Typically lt 1 Injection volume 5 325 ul Analysis temperature 25 C 01 C Power requirements Autorange 100 230 VAC 47 63 Hz Power consumption Max 400 VA Safety standard EN 61010 1 1993 EMC EN 61326 1 with A1 gt gt For more information please visit www gelifesciences com biacore Biacore G x P Services Laboratories involved in pharmaceutical drug development and manufacturing must satisfy the G x P GLP GCP GMP regulations Computer controlled analytical systems used in G x P applications must be validated and properly maintained Failure to comply with regulatory demands is not a viable option from either a safety or economic standpoint Validation is the process of establishing documented evidence of control and is absolutely necessary for gaining product approval Computer system validation ensures that e Hardware and software function as designed e The process is controlled at all stages e Data are processed as intended Validation lifecycle model A validation life cycle model is applied to keep a system in a validated state during the entire product life cycle User __ Requirements _ _ _ lt 4 Operational D j Qualification
331. s are available on request e All M Bag Mixing Chambers are provided with a large screw cap port for the easy addition of powders and solids 46 www elifesciences com readytoprocess M Bag allows ingredients to be mixed and dissolved using the WAVE Mixer Made of a multilayer laminated clear plastic the outer layer provides high mechanical strength and a gas impermeable barrier while the fluid contact layer is typically a medical grade low density polyethylene A large screw cap port allows powders or other solids to be easily poured into the bag and also a probe to measure pH to be inserted A large outlet port allows the M Bag to be drained completely Technical specifications M Bag Film e Fluid contact layer medical grade low density polyethylene LDPE e Non contact outer layer LPDE EVA or nylon EVOH copolymer Testing is performed on irradiated film at 50 kGy e USP XXII plastic class VI test and ISO 10993 e Acute intracutaneous reactivity study in rabbit 1SO10993 10 e Acute systemic toxicity in mouse ISO 10993 11 e Muscle implantation study in rabbit ISO 10993 6 e Cytotoxicity study using ISO elution method ISO 10993 5 e Hemolysis study in vitro extraction method ISO 10993 4 Biocompatability Maximum operating pressure 0 1 bar e M Bags may be used from 0 C to 50 C Lot release requires lt 0 125 EU ml endotoxin Temperature rating Endotoxin Ordering information
332. s the first fully automated system for cross flow filtration process development and is well suited for filter screening and process optimization at small scale UNICORN software combines intelligent control with ease of use to allow consistent simulation of large scale conditions and provide data for comprehensive analysis of results The system is built with AKTAdesign components for reliability scalability and flexibility AKTAcrossflow comes complete with UV pH and conductivity monitors as well as air pressure and temperature sensors The valves and fittings are specially developed for hygienic leak free operation Electrically actuated diaphragm valves diminish hold up volumes and prevent dead volumes y fo a a cr Q gt E cr N System highlights include gt gt For more information see page 163 e Broad application range covering ultrafiltration and microfiltration e Flexible operation of hollow fiber cartridges or cross flow cassettes e Thorough and efficient process development with full TMP Trans Membrane Protein and flux scouting Transfer Flow Pressure Restrictor Sensor Transfer Pump Module A Transfer Valve Block1 ini Transfer Transfer line Purge Valve Air PS Waste 1 Sensor n2 n3 n4 Retentate Pressure Control Level amp Transfer Valve Block 2 Stirrer Permeate n5 Retenta
333. sciences com bioprocess Technical support online Users of GE Healthcare s columns and systems may need quick and easy access to information regarding their equipment To meet these needs GE Healthcare has developed an efficient and enhanced support site on the internet From its initial focus on standard process scale columns and systems the site will expand to cover laboratory scale equipment as well When entering the technical support site you quickly get access to detailed information regarding e Spare parts for columns packing stations and systems e Accessories necessary for packing and running columns e Columns and systems recommended for your scale and selected medium e Column packing e A troubleshooting section will guide you to solutions for specific issues e Certificates of Conformance for materials available for most requested process chromatography hardware products 3 Life wienas it High noone E n a rr 1 Pi nn ds z ett en m EEE a e ee eee ae Saeed Chromatography Online support sent elect topic of ieterent www gelifesciences com bioprocess 205 yoddns pup ad1nsas Service and support System and column support Installation BioProcess Service engineers deliver and assemble your system perform installation tests and get it ready for operation Validation Installation Qualification amp
334. scow Singapore Taiwan Thailand Ukraine T 55 11 3933 7300 0800 136833 F 55 11 3933 7304 Email vendas biosciences ge com T 60 3 2273 9788 F 60 3 2273 6508 T 52 55 9177 0300 Ext 9645 F 52 55 9177 0388 Email alberto suarez ge com T 30 210 96 00 687 F 30 210 96 00 693 Email biotech hvd gr See listing for Russian Federation See listing for Russian Federation T 64 9 523 5890 0800 733 893 F 64 9 522 7342 Email sales nz ge com T 7 495 956 5177 F 7 495 956 5176 Email Lsrus ge com T 65 6773 7303 F 65 6773 7302 Email lifesciences sg ge com T 886 2 2888 3570 F 886 2 2888 3580 T 662 624 8484 F 662 624 8490 See listing for Middle East Greece GE Healthcare Bio Sciences AB Bj rkgatan 30 SE 751 84 Uppsala Sweden T 46 0 18 612 00 00 F 46 0 18 612 18 00 GE Healthcare GE Healthcare GE Healthcare GE Healthcare Europe GmbH UK Ltd Bio Sciences Corp Bio Sciences KK Munzinger Strasse 5 Amersham Place 800 Centennial Avenue Sanken Bldg D 79111 Freiburg Little Chalfont P O Box 1327 3 25 1 Hyakunincho Germany Bucks HP7 9NA Piscataway NJ 08855 1327 Shinjuku ku m OBU ooe UK USA Tokyo 169 0073 T 49 761 45 43 0 T 44 0 1494 544000 T 1 732 457 8000 JAPAN F 0 800 9080 712 F 44 0 1494 542266 F 1 732 457 0557 T 81 3 5331 9336 F 81 3 5331 9370 Sales branch offices Europe Austria GE Healthcare Europe GmbH Zweigniede
335. se matrix Trypsin capacity pH stability operational CIP stability short term Pressure flow spec Benzamidine Sepharose 4 Fast Flow low sub See p 87 Pack size Code No 100 ml 28 4108 01 5 28 4108 03 Regulatory Support File 11 0028 09 Technical data Composition Particle size Coupling chemistry Ligand Ligand density Trypsin capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 4 agarose 45 165 um amide linkage carbodiimide p aminobenzamidine 6 10 umol ml drained medium 25 mg trypsin ml packed medium 2 8 2 9 min 150 cm h 100 kPa XK 50 60 column bed height 25 cm base matrix E Blue Sepharose 6 Fast Flow See p 70 72 Pack size Code No 50 ml 17 0948 01 500 ml 17 0948 02 1l 17 0948 03 Sil 17 0948 04 Data File 18 1060 75 Regulatory Support File 11 0028 10 Technical data Composition Particle size Ligand Ligand density Coupling chemistry Binding capacity pH stability operational CIP stability short term Pressure flow spec www gelifesciences com bioprocess highly cross linked 6 agarose 90 um average d y val Cibacron Blue F3G A 7 umol Cibacron Blue ml drained medium Triazine gt 18 mg HSA ml drained medium 4 12 3 13 base matrix 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm 213 jo6a7 pup saxapu Indexes and Legal E Butyl Sepharose High Performance See p 74 75 130
336. should never be greater than 20 C 3 While the maximum liquid pressure stated depends on the pressure rating of the column restrictions for the maximum pressure drop over the column depend on the packed chromatography medium in order to ensure bed stability See User Manual for details www gelifesciences com readytoprocess 61 Chromatography media lon exchange 65 Affinity 70 Hydrophobic interaction 73 Multimodal 76 Reversed phase 310 Gel filtration 82 Custom designed media 86 Media selection our strategy At GE Healthcare we are committed to supplying you with media that pass the rigorous selection requirements demanded for the downstream processing of biopharmaceuticals Consider three issues Performance The different stages in Media selection filter downstream processing from Capture to Polishing demand media with different characteristics Scalability Is the medium produced at a large enough scale Can it be packed into Sanitization Regulatory Technical intermediate PEA large production columns with retained performance systems cg O Capture scalability Columns Support Support Purification Security of supply How is quality assurance Is the producer geared up to long term industrial supply issues Compatibility with production and regulatory requirements Use only media that pass through this filter BioProcess Media made for bioprocessing This label designa
337. sive range of membrane and depth media products meet individual application requirements Clarification Range of absolute rated prefiltration products providing consistent performance with broad chemical compatibility Range of Normal flow filtration filters Sterilizing grade Bio burden reduction Formats Prefilters Syringe filters x x x x x 10 cartridges 30 cartridges x x Pore sizes 0 2 x x 0 65 x WN fo x 10 0 x m fe on E Q n Systems GE Healthcare filtration systems are engineered with consistent flow paths for straightforward scale up scale down easing the transition from research to pilot to full production In addition GE Healthcare has highly experienced technical resources available for consultation and input into process development AKTAcrossflow The purification of biomolecules normally uses filtration to concentrate and wash feed prior to chromatography AKTAcrossflow is a fully automated system for cross flow filtration ultrafiltration diafiltration and cell separation designed for process development and optimization AKTAcrossflow is suitable for installation in a laboratory environment which reduces facility and infrastructure expenditure The benchtop system is compact and has a sanitary design with changeable wetted parts Hollow fiber cartridge systems GE Healthcare provides a range of cartridge based systems from small syst
338. size 50 um Fractionation range globular proteins pH stability operational 3 11 CIP stability short term 2 13 Pressure flow spec 1x10 1 5x10 flow at 100 kPa gt 150 cm h XK 50 30 column bed height 15 cm E Sephacryl S 200 High Resolution See p 84 85 E Sephacryl S 400 High Resolution See p 84 85 Pack size Code No Pack size Code No 150 ml 17 0584 10 150ml 17 0609 10 750 ml 17 0584 01 750ml 17 0609 01 101 17 0584 05 101 17 0609 05 601 17 0584 60 Data File 18 1009 28 Data File 18 1009 28 Regulatory Support File 11 0028 36 Regulatory Support File 11 0028 36 Technical data Prepacked columns Composition allyl dextran and N N methylene HiPrep 16 60 Sephacryl S 200 HR 120 ml 17 1166 01 bisacrylamide HiPrep 26 60 Sephacryl 200 HR 320 ml 17 1195 01 _ Particle size 50 um Technical data Composition allyl dextran and N N methylene bisacrylamide Particle size 50 um Fractionation range globular proteins pH stability operational 3 11 CIP stability short term 2 13 Pressure flow spec 5x10 2 5x10 flow at 100 kPa gt 150 cm h XK 50 30 column bed height 15 cm Fractionation range globular proteins 2x104 8x10 pH stability operational 3 11 CIP stability short term 2 13 Pressure flow spec flow at 100 kPa gt 150 cm h XK 50 30 column bed height 15 cm www gelifesciences com bioprocess 231 jo6a7 pup saxapu Indexes and Legal E Sephacryl S 500
339. st easy to use and designed for removal of supernatant addition of water or buffer creation of homogenous media slurries in shipping containers and transfer of media to slurry tanks Media Wand eliminates the need for cumbersome and time consuming tasks that frequently arise during column packing or when handling large volumes of media Media Wand allows e Simplified removal of transport solutions from media containers e Addition of buffers for preparation of media slurry in media containers e Simple transfer of media slurry to a slurry tank gt gt For more information see page 113 www gelifesciences com bioprocess 25 2 e oo a or Q E y cr wn Product highlights AKTAprocess system AkKTAprocess is a chromatography system platform with thousands of configuration possibilities To meet specific process demands the system is customizable with variable construction materials flow rate ranges additional valves pumps and other instrumentation The flexibility of the system extends to post purchase modification which allows a system to be reassigned to other processes thereby increasing the versatility and working life of the system The compact design with a built in computer allows the system to fit neatly into an existing plant Security is an integral part of AkTAprocess The materials used are all USP Class VI and are traceable to their original production batches The sy
340. st two adjacent histidine residues commonly known as the histidine tag technology Any customer that wishes to use Chelating Sepharose Fast Flow Ni Sepharose 6 Fast Flow or IMAC Sepharose 6 Fast Flow for non research commercial applications under these patents is requested to contact Hoffman La Roche AG Corporate licensing attention Dr Andreas Maurer CH 4070 Basel Switzerland telephone 41 61 687 2548 fax 41 61 687 2113 for the purpose of obtaining a license Chromaflow Chromaflow nozzle is covered by U S patent numbers 5 213 683 and 5 282 973 and equivalent patents and patent applications in other countries Disposable Aseptic Connector This product is sold under licence from Bioquate Inc under patent number US 6 679 529 GST Gene Fusion Vectors A license for commercial use of GST Gene Fusion Vectors must be obtained from Chemicon International Inc 28820 Single Oak Drive Temecula California 92590 USA Histidine tagged protein purfication US patent numbers 5 284 933 and 5 310 663 and equivalent patents and patent applications in other countries assignee Hoffman La Roche Inc relate to the purification and preparation of fusion proteins and affinity peptides comprising at least two adjacent histidine residues commonly known as the histidine tag technology Any customer that wishes to use Chelating Sepharose Fast Flow Ni Sepharose 6 Fast Flow or IMAC Sepharose 6 Fast Flow for non research commercial applicatio
341. stem control unit CU 960 allows process operation even if communication with the system computer is lost due to physical or operating system faults System highlights include e Versatile user configuration with UNICORN control e Post purchase configuration increasing usability and lifespan e Full regulatory documentation with USP Class VI materials e Now available with one inch tubing gov Inlets Uptoten inlet valves Air outlet Air tray controlled Pressure sa Filter Pressure sensor be Sample pump A dedicated sample pump is available Optional filter housing for particle or sterile filration Se Pum A second pump Cond cell is available for gradient formation Air sensor Flow meter A liquid vortex at high flow rates allows the system to expel air effectively during operation and make CIP more effective Packing CIP valves Additional valves are available for automation of CIP and intelligent packing of AxiChrom columns Outlets Uptoten outlet valves PH cel x i x L X ee Column 1 SSS v X gt lt i Columns An additional branch of valves is available for connection of a second column ooN Cond cell UV cel UV cell Single or multiple wave length UV detector The liquid flow path 26 www4gelifesciences com bioprocess AKTAcrossflow system AKTAcrossflow i
342. t Flow low sub 87 Biacore C 29 Biacore G x P Services 29 Biacore T100 29 BioProcess Media 64 BioProcess system support 51 Blue Sepharose 6 Fast Flow 70 72 Books Handbook of Process Chromatography Protein Purification Principles BPG columns Butyl Sepharose 4 Fast Flow 74 75 130 Butyl Sepharose 6 Fast Flow 75 87 Butyl Sepharose High Performance 74 75 130 Butyl S Sepharose 6 Fast Flow 74 75 130 248 wwwgelifesciences com bioprocess 212 70 72 163 132 133 116 58 192 212 212 65 212 212 209 213 124 182 213 213 190 191 189 241 206 213 209 209 98 214 214 214 214 C Capto media Capto PreDictor 96 well filter plates Capto Prepacked columns Capto ReadyToProcess Capto Selection kits Capto adhere Capto Blue hs Capto DEAE Capto MMC Capto Q Capto S Capto ViralQ Cassettes and holders Cation exchanger groups CBS CCP CDM Cellbag disposable bioreactors Cell preparation and processing Change Control Protocols CCPs Chelating Sepharose Big Beads Chelating Sepharose Fast Flow Chromaflow columns Chromatography media Chromatography media toolbox CM Sephadex C 25 CM Sephadex C 50 CM Sepharose Fast Flow CM Sepharose High Performance CNBr activated Sepharose 4B CNBr activated Sepharose 4 Fast Flow COL1 Fast Trak Course Columns prepacked HiLoad HiPrep HiScreen HiTrap Columns ReadyToProcess Columns for p
343. t and no other pressure sensor is included in the chromatographic system T junction clamps and gaskets have to be ordered separately www gelifesciences com bioprocess 95 suwnjoo fiydns6bo oWos1y gt D Chromatography columns Packing extension Ordering information Column Code No NdEX 70 500 18 1115 06 NdEX 70 950 18 1115 07 dEX 100 500 18 1104 15 dEX 100 950 18 1104 16 dEX 140 500 18 1115 08 dEX 140 950 18 1115 09 dEX 200 500 18 1104 17 dEX 200 950 18 1104 18 Stand Code No NdEx 70 stand 18 1103 60 dEX 100 stand 18 1103 60 Air trap top valve dEX 140 stand 18 1103 61 pressure gauge and dEX 200 stand 18 1103 61 safety valve Stands must be ordered separately Accessories for INdEX columns Accessory INdEX 70 INdEX 100 INdEX 140 INdEX 200 Qty pack Material Air Trap Complete 18 1102 96 18 1102 96 18 1102 97 18 1102 97 SS 316 Glass Top valve 18 1121 44 18 1121 44 18 1121 44 18 1121 44 SS 316 EPDM Valves 4 port 2 way 18 5757 01 18 5757 01 8 5757 01 8 5757 01 1 SS 316L PTFE 4 port 4 way 18 5758 01 18 5758 01 8 5758 01 8 5758 01 1 SS 316L PTFE Valve sealing washer 18 1128 69 18 1128 69 8 1128 69 8 1128 69 2 PTFE T junction 18 1104 29 18 1104 29 18 1104 29 18 1104 29 SS 316 Safety valve 18 5738 01 18 5738 01 8 5738 01 8 5738 01 1 SS 316 EPDM Pressure relief valve 18 1105 36 18 1105 36 8 1105 36 8 1105 36 1 SS 316 FPM Manometer 18 1119 29 18 1119 29
344. t makes it possible to perform scalable experiments at relevant fluid velocities The HiScreen columns are part of the process development platform available from GE Healthcare All media prepacked in HiScreen columns are available in different formats and bulk packs for all scales from development work and pilot studies to routine production The volume of the HiScreen column is small 4 7 ml which reduces costs by decreasing sample and buffer consumption The 10 cm bed height of these prepacked columns makes them ideal for method optimization and parameter screening e g selectivity capacity binding and elution conditions and following scale up If possible two columns can be connected in series to give a bed height of 20 cm HiScreen columns benefits e Ideal for method optimization and parameter screening due to the 10 cm bed height e Easy connection in series to achieve 20 cm bed height e Convenient and time saving due to prepacked format e Small column volume gives fast results and minimal sample buffer consumption e Reproducible results comparable to BioProcess scale columns packed with the same media as the same linear fluid velocity can be used Ordering information Product Quantity HiScreen MabSelect 1x47ml HiScreen MabSelect Xtra 1x4 7 ml HiScreen MabSelect SuRe 1x4 7 ml HiScreen Capto Q 1x47m HiScreen Capto S 1x47m HiScreen Capto MMC 1x47m HiScreen Capto adhere 1x47m HiScreen Capto DEAE
345. te For Cytodex size is based on diameter at 50 of the volume of a sample of microcarriers d or the range between the diameter at 5 and 95 of the volume 20g 17 1271 01 A a sample of microcarriers d This size is calculated from cumulative volume 100g 17 1271 02 istributions 500 g 17 1271 03 Cytoline 1 see p 183 185 1kg ieee Data File 18 1132 68 Pack size Code No Regulatory Support File 11 0028 73 50 ml 17 1268 01 500 ml 17 1268 02 vernia data 5 17 1268 03 age diameter 200 280 nm Data File 18 1060 65 EHERING surface area 1 1 m g dry weight Regulatory Support File 11 0028 74 Pensity ee Average diameter Technical data of pore openings 30 um Sedimentation velocity 120 220 cm min Volume 40 ml g dry weight Length 1 7 2 5 mm Thickness 0 4 1 1 mm Density 1 32 g ml Pore size 10 400 um Surface area gt 0 3 m g Data from Ashai Chemical Industry Co Ltd Japan www gelifesciences com bioprocess 219 jo6a7 pup saxapu Indexes and Legal DEAE Sephadex A 25 See p 68 E DEAE Sepharose Fast Flow See p 69 130 Pack size Code No Pack size Code No 100g 17 0170 01 25ml 17 0709 10 500 g 17 0170 02 500ml 17 0709 01 5kg 17 0170 03 101 17 0709 05 40 kg 17 0170 07 601 17 0709 60 Data File 18 1117 58 IEX Selection Kit 17 0939 01 Regulatory Support File 11 0028 17 Data File 18 1020 66 Technical data Regulatory Support File 11 0028 18 Composition cross linked dextran Prepacked columns Par
346. te Valve Block Reservoir n6 Valve Block Recycle ee Out 1 n8 u Out 2 Out 3 Retentate Pressure Sensor Recirculation line Permeate line Feed Pressure Sensor Permeate Pressure Sensor Permeate Pressure Control Permeate Pump RECGRUNE Module B Out d Cartridge The KTAcrossflow flowscheme www gelifesciences com bioprocess 27 Product highlights GrandStand pilot process systems Bow The GrandStand pilot process system is designed for biological separations at scales from 50 to 10 000 liters The system accommodates ultrafiltration and microfiltration hollow fiber cartridges or flat sheet cassettes The GrandStand system is capable of concentration and or diafiltration The system is cart mounted and has a narrow profile allowing for easy movement between lab cold room and manufacturing areas The GrandStand pilot process system is designed around modularity and versatility the basic system can easily be upgraded with a range of additional modules providing enhanced flexibility to meet the needs of process development and manufacturing groups GrandStand is also backed with IQ OQ and onsite assembly service options gt gt For more information on GrandStand pilot process systems see pages 169 ULTAPuresc CUM ULTA Pure SG utilizes the unique Typical applications properties of a patented microbially retentive membrane to provide sterilizing grad
347. ted 25 60 mg a chymotrypsinogen ml drained medium 3 11 ligand dependent 3 11 ligand dependent base matrix 70 140 cm h pressure drop cm H O bed height 15 bed height 10 cm 5 cmi d E CNBr activated Sepharose 4 Fast Flow See p 70 72 Pack size Code No 10g 17 0981 01 250g 17 0981 03 2kg 17 0981 05 Data File 18 1113 55 Regulatory Support File 11 0028 16 Technical data Composition Particle size For coupling to Activation method Coupling capacity pH stability operational CIP stability short term Pressure flow spec highly cross linked 4 agarose 90 um average d NH cyanogen bromide CNBr activated 13 26 mg a chymotrypsinogen ml drained medium 3 11 ligand dependent 3 11 ligand dependent base matrix 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm 50 vol Con A Sepharose 4B See p 72 Pack size Code No 5 ml 17 0440 03 100 ml 17 0440 01 500 ml 17 0440 02 5il 17 0440 04 Technical data Composition 4 agarose Particle size Ligand Ligand density Coupling chemistry pH stability operational CIP stability short term Pressure flow spec 90 um average d vol Concanavalin A 10 16 mg Con A ml drained medium CNBr 4 9 4 9 base matrix 70 140 cm h pressure drop cm H O bed height 15 bed height 10 cm 5 cm i d Cytodex 1 See p 183 184 Cytoline 2 See p 183 185 Pack size Code No Pack size
348. tem 200 5 to 1001 e Speed angle control e Temperature control e Aeration e Loadcell e CO2MIX e O2MIX DO pH e Dual air temperature 350 kg 185 x 110 x 112 cm For installation if required unit can be tilted e 200 to 240 VAC e 50 60 Hz 15 A e 3 phase e Phase phase 5 e NEMA L2130 plug 1 System 20 50 requires selection of Kit 20 or Kit 50 2 Unit provided with casters 3 System 500 1000 requires selection of Kit 500 or Kit 1000 All BASE units are CE CSA certified System 20 50 0 1 to 251 e Speed angle control e Temperature control e Aeration e WAVEPOD e CO2MIX e O2MIX DO e pH e Loadcell e Dual air temperature 15 5 kg 573 x 465 x 179 mm with Kit 20 711 x 575 x 254mm with Kit 50 775 x 700 x 254 mm e 100 240 VAC e 50 60Hz 6 3 A System 2 10 0 1to5 e Speed angle control e Temperature control e Aeration e CO2MIX e O2MIX e DO pH e Perfusion controller 4 2 kg 489 x 330 x 200 mm 110 220 VAC Reproduced with kind permission of PacificGMP USA www gelifesciences com readytoprocess WAVE Bioreactor System 500 1000 Ordering information Product Quantity Code No SYSTEM1000EH with DO 1 28 4115 46 SYSTEM1000EH with CO O DO PH ANALOG l 28 4115 59 SYSTEM1000EH with O DO ANALOG 1 28 4115 60 SYSTEM1000EH with CO O DO PH 1 28 4115 61 SYSTEM1000EH with O DO 1 28 4115 62 SYSTEM1000EH with CO PH 1 28 41
349. terf lgende Almindelige forretningsbetingelser findes under www gelifesciences com protein_purification nogle lande kan der forekomme lokale varianter af de Almindelige forretningsbetingelser Hvis det er tilf ldet findes disse under www gelifesciences com protein_purification eller p de lokale salgskontorer Hvis de lokale varianter afviger fra de Almindelige forretningsbetingelser er det altid f rstn vnte der geelder Deutsch Ubersetzungen der nachfolgenden Allgemeinen Geschdftsbedingungen k nnen eingesehen werden unter www gelifesciences com protein_purification In einigen L ndern k nnen rtliche Varianten zu den Allgemeinen Gesch ftsbedingungen gelten Wenn dies der Fall ist so k nnen die rtlich geltenden Varianten unter www gelifesciences com protein_purification oder in dem jeweiligen Vertriebsb ro vor Ort eingesehen werden Falls die rtlich geltenden Varianten von den Allgemeinen Gesch ftsbedingungen abweichen sind die rtlichen geltenden Varianten als ma gebend anzusehen 242 www gelifesciences com bioprocess Espa ol Traducciones de las siguientes Condiciones Comerciales Generales pueden verse en www gelifesciences com protein_purification En algunos pa ses pueden tener validez variantes locales de estas Condiciones Comerciales Generales Si es as las variantes localmente v lidas pueden verse en www gelifesciences com protein_purification o en in situ en la respectiva oficina distribuido
350. tes our media that have been specifically designed to meet the demands of industrial biotechnology e Secure Supply Large capacity production integrated with clear ordering and delivery routines mean BioProcess Media are available in the right quantity at the right place at the right time Future supplies of BioProcess Media are assured making them a safe nvestment for your long term production e Safety Stock Our media safety stock agreements offer the right quantity of media manufactured to specified quality levels and delivered at the right time For more nformation on Safety Stock agreements contact your local GE Healthcare office e Validated Manufacture Produced following validated methods and tested under strict quality control BioProcess Media fulfill performance specifications A certificate of analysis is available with each order e Regulatory Support Regulatory Support Files contain details of performance stability extractable compounds and analytical methods available The essential information in these files is an invaluable starting point for process validation as well as support for clinical and marketing applications submitted to regulatory authorities e From Capture to Polishing Specific BioProcess Media have been designed for each chromatographic stage in a process from Capture to Polishing Using BioProcess Media for every stage results in a systematic approach to method development e High Productivity High flow rat
351. that are different from those of traditional ligands and have in many cases been designed for a specific purpose GE Healthcare s multimodal ligands also offers new selectivities that may be beneficial in other types of purification challenges where more traditional ligands do not offer the required selectivity Capto MMC o OH OH o Z aoa a 07 o The multimodal ligand of Capto MMC designed for protein binding at high feed conductivities Capto adhere OH OH MAL KAM a Ai The multimodal ligand of Capto adhere designed for selective removal of contaminants after a Protein A capture step Capto MMC is a weak multimodal cation exchanger belonging to the Capto family of BioProcess media for fast and cost efficient protein purification Capto MMC allows for increased productivity and reduced cost with e High capacity at high conductivity e High productivity e New selectivity Capto MMC combines recent base matrix developments with a new innovative ligand chemistry Capto MMC is salt tolerant meaning that binding of proteins can be performed at the conductivity of the feed material thus avoiding costly and time consuming dilutions of large volumes of water for injection in order to lower the conductivity prior to binding the protein to the column Capto MMC has a multimodal ligand that may interact with the target molecule in multiple ways It contains a carboxylic group and thus has Capto adhere
352. the containers 6 Risk and Title 6 1 The Buyer shall bear all the risks of loss of and damage to the Products on delivery Full title to the Goods and Equipment shall pass to the Buyer on full payment The Buyer agrees not to dispose of or resell the Equipment until it has been paid for in full 6 2 In relation to any Equipment used for clinical or diagnostic purposes the Buyer shall keep adequate written records of the identity of any person or entity to whom the Equipment is transferred and of the location of such Equipment and shall procure that any purchaser of such Equipment is subject to the same requirement in respect of any onward sales 7 Services Where GEHC is to provide Services the Buyer shall ensure that adequate and safe facilities exist at its premises and that GEHC is properly notified of any relevant regulations 244 www gelifesciences com bioprocess 8 Restricted Use With respect to certain Products use restrictions are a condition of the purchase which Buyer must satisfy by strictly abiding by the restriction as set forth in GEHC s catalogue and or on the Product and or accompanying documentation Buyer is solely liable to ensure compliance with any regulatory requirements related to the Buyer s use of the Products Any warranty granted by GEHC to the Buyer shall be deemed void if any Products covered by such warranty are used for any purpose not permitted hereunder In addition the Buyer shall indemni
353. tic Tubing OD range Tubing condition Fusing cycle e 2min Weight 8kg Dimensions e 356 x 165 x 203 mm Power e 110 220 VAC 6 A maximum e Autoswitching gt gt Visit us on the web at www gelifesciences com wave www gelifesciences com readytoprocess 53 ssa001go fippay ReadyToProcess 54 ReadyToProcess filtration products ReadyToProcess filters are a range of single use cartridges and assemblies for both cross flow and normal flow filtration NFF operations Preconditioned and ready for immediate use they enable simpler and faster drug development Factory prepared to Water for Injection quality for endotoxins TOC and conductivity they ensure maximum safety www gelifesciences com readytoprocess Applications include aseptic processing clarification ultrafiltration and diafiltration in vaccine and MAb production media filtration and NFF prefiltration for bioreactors and columns A wide range of capacities and pore selections are available gt gt Visit us on the web at www gelifesciences com readytoprocess ReadyToProcess Hollow Fiber Cartridges w Y SO OA y a7 Fa 4 gt B gt n ReadyToProcess Hollow Fiber Cartridges enable simpler safer and faster drug development by minimizing device preparations steps such as wetting and sanitizing The cartridges are designed to wet the membrane lower total organic carbon TOC and conductivity and minimize endotox
354. ticle size wet in 0 15 M NaCl 45 190 um HiTrap DEAE FF 5x1 ml 17 5055 01 pH stability operational 2 10 HiTrap DEAE FF 5x5 ml 17 5154 01 CIP stability short term 2 13 HiTrap IEX Selection Kit 7x1 ml 17 6002 33 Pressure flow spec min 120 cm h HiPrep 16 10 DEAE FF 20 ml 17 5090 01 pressure drop cm H O bed height 5 bed height 10 cm 5 cm i d DEAE Sephadex A 50 See p 68 Pack size Code No 100g 17 0180 01 500 g 17 0180 02 5kg 17 0180 03 Data File 18 1117 58 Regulatory Support File 11 0028 17 Technical data cross linked dextran wet in 0 15 M NaCl 100 370 um 2 10 2 13 min 60 cm h pressure drop cm H O bed height 10 bed height 10 cm 5 cmi d Composition Particle size pH stability operational CIP stability short term Pressure flow spec 220 www gelifesciences com bioprocess Technical data Composition highly cross linked 6 agarose 45 165 um 110 mg HSA ml drained medium 0 11 0 16 mmol Cl ml medium 2 12 2 14 300 600 cm h 100 kPa XK 50 30 column bed height 15 cm Particle size Binding capacity lon capacity pH stability operational CIP stability short term Pressure flow spec ECH Lysine Sepharose 4 Fast Flow See p 72 87 Pack size Code No 500 ml 17 0902 02 5 17 0902 04 Regulatory Support File 11 0029 28 Technical data Composition highly cross linked 4 agarose Particle size 90 um average d NHS L lysine 50 vol Coupling chemistry L
355. tics all with high chemical resistance All polymeric materials are approved according to USP Class VI tests for toxicity IQ and OQ documentation packages available Validation support documentation available on request Packing devices available for long bed heights www gelifesciences com bioprocess Overview of BPG columns Bed height cm Column Column Column Packing Running Diameter Area Height with with mm cm cm Min Max extension extension Min 100 78 5 50 0 26 34 45 0 0 100 78 5 T5 25 4 55 65 2 0 100 78 5 95 45 54 72 78 35 140 154 50 0 26 34 45 0 0 140 154 75 25 4 55 65 3 9 140 154 95 45 54 72 78 6 9 200 314 50 0 26 34 45 0 0 200 314 75 25 41 55 65 7 8 200 314 95 45 54 72 78 14 1 296 688 50 0 26 34 45 0 0 296 688 75 25 41 55 65 17 2 296 688 95 45 54 72 78 31 0 446 1562 50 1 22 30 45 17 2 446 1562 75 36 38 51 62 56 2 446 1562 100 61 64 72 78 95 3 Volume I Packing Running Max Total Adapter Overall with with pressure weight weight dimensions Max extension extension bar g kg kg cm DxWxH 2 0 27 3 5 8 15 7 48x48x127 3a 4 3 SI 8 16 7 48x48x152 4 2 57 6 1 8 17 Fi 48x48x172 4 0 5 2 6 9 6 25 11 59x59x127 6 3 8 5 10 0 6 26 11 59x59x152 8 3 11 1 12 0 6 27 11 59x59x172 8 2 10 7 14 1 6 34 13 59x59x127 12 9 173 20 4 6 36 13 59x59x152 17 0 22 6 24 5 6 39 alk 59x59x172 17 9 23 4 31 0 4 68 29 69x69x133 28 2 37 8 44 7 4 J3 29 69x69x158 37 2 49 5 53 7 4 78 29 69x69x178 34 4 46 9
356. ting using GEHC s published performance specifications and using its standard instruments and procedures Upon the satisfactory completion of such final testing demonstrating compliance with the above specifications with any permitted variations tolerances GEHC may issue a Test Certificate which shall be conclusive evidence of such compliance and thereupon installation of the Equipment shall be deemed to be complete and in compliance with GEHC s obligations under the Contract Buyer agrees that the Equipment is accepted i seven 7 days after the date on which GEHC notifies Buyer that final testing was successfully completed or issues the Test Certificate or ii on the date Buyer first uses he Product for operational use whichever is earlier 5 8 Buyer at its reasonable request shall be entitled to be present at and o witness the testing and shall not be entitled to raise any objection to esting carried out or to the results thereof if Buyer failed to attend when advised that testing was to take place 5 9 Where Products are supplied by GEHC in returnable containers hese must be returned at the Buyer s expense and in good condition if requested by GEHC Title to these containers shall remain with GEHC at all times but they shall be held at the risk of the Buyer until returned to GEHC Failure by the Buyer to comply with the above provision shall entitle GEHC to invoice the Buyer for the full replacement value of
357. tion needs OligoPilot 400 OligoPilot 400 is specifically developed for synthesizing oligonucleotides in quantities suitable for pre clinical and early phase clinical trials The system uses flow through column technology UNICORN software and comes with the same level of technical support as AKTA oligopilot plus and OligoProcess Systems to allow seamless scale up scale down Synthesis scale range is from 4 to 30 mmol using column diameters of 70 and 100 mm As much as 150 gram crude 20 mer oligo per run can be produced with the 100 mm column EN The synthesizer is designed in an integrated manner with reagent bottles and column reactors forming a single unit in the system The system reduces facility expenditure since it can be installed in a laboratory The tilted bottle holder allows organized and cost efficient use of amidite A rotating column holder that simplifies unpacking of the columns is also included Ordering information Product Code No KTA oligopilot plus 10 18 1140 42 Akta oligopilot plus 100 18 1136 79 For OligoPilot 400 and OligoProcess contact your local representative OligoProcess OligoProcess systems are custom designed for reliable and cost effective industrial production They use the same flow through column technology as the other synthesizers Production range is from 50 mmol to over 1 mol or more of therapeutic oligonucleotides The systems are explosion proof
358. tions team can help introduce Lean enabling and Six Sigma concepts into your processes to improve efficiences In addition we offer customized safety stock for media membranes and spare parts as well as service agreements to ensure trouble free operation To secure GMP compliance RSFs Regulatory Support Files are available for all BioProcess media and similar documentation is available for process hardware Secure supply Over the past decades GE Healthcare has supported the rapid growth in biophar maceutical production we currently deliver approximately 500 000 laboratory and pilot scale columns per year and over the years we have supplied more than 4 250 000 liters kgs of chromatographic media more than 12 000 process scale columns 2000 BioProcess systems 200 000 membrane devices and 1000 filtration skids We have recently increased our production capacity and services to match demands We believe security of supply is about quality as well as timely delivery of the right quantity thus we have validated production processes and manufacture according to ISO 9001 Over the past years we have invested over US 100 million in business continuity systems processes training and equipment We have worked with a combination of market leading safety and business continuity consulting firms Customers and regulatory authorities also closely scrutinize our production routines through on site audits an important catalyst in our continuous
359. tivity cannot always be predicted on the basis of the ligand To help industrial users compare media small samples are available on request Please ask for details Many of the media described in this section can be ordered as laboratory sized packs or as easy to use prepacked columns The small HiTrap columns operated with a syringe a peristaltic pump or a chromatography system allow a particularly fast and simple way of screening key HIC media They are available as a Selection kit HiLoad and HiPrep prepacked columns are convenient and give reproducible results making them well suited for method development The method wizard in UNICORN controlled AKTAdesign systems supports the most common scouting procedures such as automatic media screening 74 wwwa gelifesciences com bioprocess purification A tool for screening different HIC media The HiTrap HIC Selection Kit consists of seven ready to use 1 ml prepacked columns for screening different types of ligands and for method development work at small scale e Phenyl Sepharose High Performance e Phenyl Sepharose 6 Fast Flow low sub e Phenyl Sepharose 6 Fast Flow high sub e Butyl S Sepharose 6 Fast Flow e Butyl Sepharose 4 Fast Flow e Butyl Sepharose High Performance e Octyl Sepharose 4 Fast Flow Code No 28 4110 07 Sepharose Big Beads Media for capture steps handling very large volumes of clarified feedstock Mi Phenyl Sepharose Big Beads The large particle size
360. to meet industrial demands e Regulatory support Product support information available for regulatory compliance e For therapeutic oligonucleotide production Reagents and instrumentation for process development to full production scale Test 20mer sequence used 5 ATACCGATTAAGCGAAGTTT www gelifesciences com oligo Oligosynt prepacked disposable columns Long oligonucleotides 30 to 90 or more bases are used as probes in analytical or diagnostic methods for applications such as blood testing gene expression studies and genetic profiling or identification To ensure optimal purity and yield of long oligonucleotides GE Healthcare provides Primer Support 200 loaded at nucleoside densities of 40 umol g For convenience and ease of use the solid support is prepacked in disposable Oligosynt columns that run on AKTA oligopilot instruments Oligosynt combined with AKTA oligopilot is well suited for GMP production of long oligonucleotides e High quality and yield of long oligonucleotides More than 50 pure full length product Less than 4 n 1 contamination t More than 300 OD umol crude yield tt Convenience Columns are prepacked and disposable UNICORN method templates simplify operation On column cleavage possibility Reproducibility and reliability Reproducible performance with each batch of prepacked columns All batches of solid support certified for use in long oligonucleotide synthesis Long oligon
361. tration cartridges 56 4102 26 56 4102 28 56 4102 29 56 4102 30 56 4102 31 56 4102 33 56 4102 34 56 4102 35 56 4102 36 56 4102 37 56 4102 38 56 4102 39 56 4102 40 56 4102 41 56 4102 42 56 4102 43 56 4102 44 56 4102 45 56 4102 51 56 4102 52 56 4102 53 56 4102 54 56 4102 55 56 4102 56 56 4102 57 56 4102 58 56 4102 59 56 4102 60 56 4102 61 56 4102 62 56 4102 63 56 4102 64 56 4102 65 56 4102 66 56 4102 67 56 4102 68 56 4102 74 56 4102 76 56 4102 77 56 4102 78 56 4102 79 56 4102 80 56 4102 81 56 4102 82 56 4102 83 56 4102 84 56 4102 85 56 4102 91 56 4102 92 56 4102 93 56 4102 94 56 4102 95 56 4102 96 56 4102 97 56 4102 98 56 4102 99 56 4103 00 56 4103 01 56 4103 02 56 4103 03 56 4103 04 56 4103 05 56 4103 06 56 4103 07 56 4103 08 Code number Model number P 1 C 5 P 3 C 5A P 3 E 5A P 5 C 5A P 5 E 5A P 10 C 5A P 10 E 5A P 30 C 5A P 30 E 5A P 50 C 5A P 50 E 5A P 100 C 5A P 100 E 5A P 300 C 5A P 300 E 5A P 500 C 5A P 500 E 5A P 750 E 5A P 1 C 6 P 3 C 6A P 3 E 6A P 5 C 6A P 5 E 6A P 10 C 6A P 10 E 6A P 30 C 6A P 30 E 6A P 50 C 6A P 50 E 6A P 100 C 6A P 100 E 6A P 300 C 6A P 300 E 6A P 500 C 6A P 500 E 6A P 750 E 6A P 3 C 8A P 10 C 8A P 30 C 8A P 50 C 8A P 100 C 8A P 100 E 8A P 300 C 8A P 300 E 8A P 500 C 8A P 500 E 8A P 750 E 8A P 1 C 9 P 3 C 9A P 3 E 9A P 5 C 9A P 5 E 9A P 10 C 9A P 10 E 9A P 30 C 9A P 30 E 9A FP 50 C 9A P 50 E 9A P
362. tration products pressure transducers and a dual digital panel meter size 16 tubing 140 ml min 140 ml min Optional autoclavable reservoirs are shown Materials of construction Reservoir Polystyrene std Polystyrene std Polycarbonate Polycarbonate e Rapid processing of volumes up to 200 ml idutocl vable igutoelivdblei e Quick and easy cartridge change out using Luer Lok Reservoir fittings tubing PVC nylon PVC nylon fittings silicone silicone CE Compatible Components Yes Yes e Low system hold up volume for concentration down to 2 to 5 ml cartridge hold up volume 0 5 ml e Easy scale up to pilot and process volumes e Perfect sizing for MidGee and MidGee Hoop hollow fiber cartridges e Attaches to syringe for easy removal of retentate Basic and Advanced MidJet 1 peristaltic recircualtion pump 1 mounting platform 1 backpressure tubing valve 1 accessory kit includes reservoirs 1 assembly guide Advanced MidJet only 1 digital panel meter MidJet Labscale System enables you to separate concentrate and diafilter small volumes up to 200 ml of biological solutions Using hollow fiber cartridges processing is easy and fast compared to other techniques In addition hollow fiber cartridges let you scale your laboratory data linearly to pilot and production scale systems The Basic MidJet System includes a peristaltic pump reservoirs tubing fittings a back pressure valve and a stand to mount the system
363. trol e Requires second set of gas mixers Features include and instrumentation if desired 7 B Di i e 185 x 110 x 112 e Stainless steel construction with fully gasketed chamber aa ie i tae and linear motor rocking control system oe SSON e Integrated heaterpad with temperature controller e 50 60 Hz 15 A e 3 phase operation e Phase Phase 5 e Adjustable color touch panel operator interface NEMA L2130 plug e Integrated loadcell e Aeration controller e Dual Cellbag controller systems available Cell Culture Bag in Switzerland gt gt For information on Cellbags for use with WAVE 200 systems see page 48 gt gt Visit us on the web at www gelifesciences com wave 42 www elifesciences com readytoprocess WAVE Bioreactor System 20 50 WAVE Bioreactor System 20 50 is a versatile modular system designed for R amp D and production use It consists of a base unit with various options suitable for culture of multiple cell lines The WAVE Bioreactor System 20 50 has an extensive line of instrumentation including weight controllers for perfusion culture dissolved oxygen amplifiers and pH controllers These are available in integrated WAVEPOD configuations or as stand alone options For benchtop operation covering the Cellbag with a lid is recommended A filter heater for the exhaust filter is strongly recommended otherwise water will condense in the filter and may lead to clogging and overpressure
364. ts 144 www gelifesciences com bioprocess Ordering information Product CFP 1 C MMO1A CFP 2 C MMO6A UFP 100 C MMO01A UFP 100 E MM06A UFP 10 E MMO1A UFP 1 C M06 UFP 30 C MMO1A UFP 30 E MMO6A UFP 500 E MMO1A UFP 750 E MM06A idGee Cartridge 10 kD 1 0 mm lumen idGee Cartridge 1 kD 0 5 mm lumen idGee Cartridge 30 kD 0 5 mm lumen idGee Cartridge 30 kD 1 0 mm lumen Quantity idGee Cartridge 0 1 micron 0 5 mm lumen idGee Cartridge 0 2 micron 0 5 mm lumen idGee Cartridge 100 kD 0 5 mm lumen idGee Cartridge 100 kD 1 0 mm lumen idGee Cartridge 500 kD 1 0 mm lumen idGee Cartridge 750 kD 1 0 mm lumen 6 Code No 56 4 56 4 56 41 56 41 56 4 56 4 56 41 56 41 56 4 56 4 00 60 00 69 00 36 00 41 00 16 00 01 00 20 00 25 00 56 08 07 Order online at www gelifesciences com orderonline This table shows examples of MidGee cartridges currently available For complete product lists and ordering information please contact your local GE Healthcare representative Technical specifications MidGee Cross Flow Cartridges Diameter Length Endfitting connections Permeate connections Membrane area nominal Hold up volume nominal Lumen side Shell side Autoclavable Materials of construction Hollow fibers Shell Luer Lok fittings Potting 0 3 cm 0 125 in 30 8 c
365. ually all other crossflow Retentate hold up volume 1 4 ml instruments Operating Conditions ba a pH range long term Storage 2 13 Minimal working volume and minimum hold up volume oHrange short ten Cleaning 1 14 gives maximum product recovery Maximum operating temperature 50 C e USP XXVIII Biological Test for Plastics Class VI compliant pina inlet pressure spaniel psig Typical operating cross flow 27 36 ml min e Low extractables e PES polyethersulfone membrane resists a wide range of chemicals e Precise reproducibly selective membranes with a macrovoid free structure for superior performance Kvick Start cassettes maximize product recovery by offering a small area device capable of handling low working volumes with minimal hold up The cassettes offer easy setup and linear scalability to facilitate membrane evaluation trials product screening process development work and optimization of UF processes in downstream purification When manifolded together they allow concentration or diafiltration of product from less than 15 milliliters to over two liters s npoud uoo Highly selective membranes provide reproducible and precise separations thus maximizing yields The cassettes are provided with UNF fittings for use with KTAcrossflow and with luer lok adapters for use with other systems Kvick Start cassettes are available with 50 or 100 square centimeters of membrane surface area and five molecular weight cut offs 5
366. ucleotide production Reagents and instrumentation from process development to production syntheses Primer Support regulatory support files available for product registration 1Q 0Q installation service available for AKTA oligopilot instruments tt Test 60mer sequence used 5 ATACCGAT TAAGCGAAGTT TATACCGAT TAAGCGAAGTTTATACC GATTAAGCGAAGTTT Custom Primer Support 200 GE Healthcare offers Custom Primer Support 200 to meet your exact needs by coupling with linkers labels modified bases alternative protecting groups or almost any molecule of your choice The support can be loaded at 20 to 250 umol g and delivered in bulk or in prepacked disposable Oligosynt columns The A Z listing at the end of this catalog gives the most frequently requested Custom Primer Support 200 products that are kept in stock for immediate delivery Nucleoside Loading pmol g DNA A C2 G4 T 40 80 200 RNA A Cz Gu U 40 80 gt gt For more information please visit www primersupport com or contact your local GE Healthcare office Note Use of THF based synthesis reagents from other vendors is NOT recommended for GE Healthcare synthesizers They may cause irreparable instrument damage www gelifesciences com oligo 195 sisayyufis apijoajanuobijo Service and support Fast Trak BioPharma Services Life Science Performance Solutions Online regulatory and technical support System and column support
367. ue added or other taxes All quotations issued by GEHC for the supply of Products and or Services shall remain open for acceptance for the period stated in the quotation or if none is stated for sixty 60 days In all other cases prices payable are those currently in effect in GEHC s then current pricelist 3 Payment 3 1 Unless otherwise agreed in writing payment in full shall be made to GEHC in the currency invoiced no later than thirty 30 days from the date of invoice 3 2 In the event of late payment GEHC reserves the right i to suspend deliveries and or cancel any of its outstanding obligations and ii to charge interest at the lower of a an annual rate equal to twelve 12 and b any applicable maximum statutory rate on all unpaid amounts calculated on a day to day basis until the actual date of payment 4 Changes and Returns 4 1 GEHC reserves the right subject to prior written notice to make any change in the specification of the Products which does not materially affect the installation performance or price thereof 4 2 Products may only be returned with prior authorization from GEHC www gelifesciences com bioprocess 243 jo6a7 pup saxapu Indexes and Legal 5 Delivery Installation Acceptance 5 1 Any term of delivery shall be construed according the latest edition of Incoterms If no other term of delivery has been specified in the Contract the Products will be delivered CIP to Buyer s prem
368. uick and easy analysis with an AKTAdesign system Code no 28 4052 69 e Starter Kit Prepacked columns for convenient process development Code no 28 4052 68 e Bulk media PlasmidSelect Xtra Sepharose 6 Fast Flow and SOURCE 30Q are BioProcess media available in large quantities for scale up and manufacturing See A Z of media and chemicals section of this catalog fermentation cell harvesting lysis PlasmidSelect Xtra SOURCE 30Q oe ce ok B Zz Tm clarification concentration Sepharose 6 Fast Flow pipaw fiydpibo owo1yD formulation concentration polishing supercoiled plasmid RNA removal DNA capture The PlasmidSelect Xtra process designed for the purification of high quality supercoiled plasmid DNA www gelifesciences com bioprocess 79 Chromatography media 80 Reversed phase chromatography Technique description Reversed phase chromatography RPC is in theory closely related to hydrophobic interaction chromatography Both techniques are based on the interaction between hydrophobic patches on the surface of biomolecules and the hydrophobic groups covalently attached to the surface of the matrix In practice however they are different Media for RPC are typically highly substituted with hydrophobic ligands and the binding of substances to RPC media is usually stronger Organic solvents are usually required for elution The technique is mainly applicable for peptides protei
369. uirements vary greatly Process development to purify plasmid DNA at large scale must thus be e Flexible e Easily scalable e Robust e Cost efficient PlasmidSelect Xtra combines agarose base matrix technology allowing for low non specific interactions with a multimodal ligand designed for selective separation between supercoiled plasmid DNA and open www gelifesciences com bioprocess option to reduce the overall number of chromatographic steps in the purification of monoclonal antibodies by combining a highly efficient Protein A step based on MabSelect SuRe with a second step based on Capto adhere Cell culture Cell removal MabSelect SuRe Virus inactivation amp filtration SP Sepharose Fast Flow eres AIEX Capto Q Capto adhere Capto adhere Capto adhere Final UF DF and Sterile Filtration Toolbox concept in the downstream purification of monoclonal antibodies using Capto adhere to reduce the total number of unit operations circular plasmid DNA PlasmidSelect Xtra has a ligand that may interact with the target molecule in many different ways It contains both a thioether and a pyridyl functional group and its features partly resemble those of a phenyl based HIC medium However in addition to the hydrophobic interactions several other types of interactions are involved including thiophilic bonding and aromatic interactions N The multimodal ligand of PlasmidSelect Xtra showing a high sele
370. ules These membranes exhibit sharp rejection curves leading to reproducible precise separations and maximized protein yield Each of these membranes is identical to membranes in the GE Healthcare s pilot and process scale hollow fiber cartridges to ensure relevance of performance data generated by using hollow fiber Start AXM and Start AXH cross flow cartridges Ordering information Product Quantity Code No Start AXM UFP 3 C 2U 11 0005 43 Start AXM UFP 10 C 2U 11 0005 44 Start AXM UFP 30 C 2U 11 0005 45 Start AXM UFP 100 C 2U 11 0005 46 Start AXM UFP 300 C 2U 11 0005 47 Start AXM UFP 500 C 2U 11 0005 48 Start AXM UFP 500 E 2U 11 0005 49 Start AXM UFP 750 E 2U 11 0005 50 Start AXM CFP 1 E 2U 11 0005 51 Start AXM CFP 2 E 2U 11 0005 52 Start AXM CFP 4 E 2U 11 0005 53 Start AXM CFP 6 D 2U 11 0005 54 Start AXH UFP 3 C H24U 1 11 0005 37 Start AXH UFP 10 C H24U 1 11 0005 38 Start AXH UFP 30 C H24U 1 11 0005 39 Start AXH UFP 100 C H24U 1 11 0005 40 Start AXH UFP 300 C H24U 1 11 0005 41 Start AXH UFP 500 C H24U 1 11 0005 42 Technical specifications Start AXM Start AXH Diameter 0 6 cm 0 25 in 0 3 cm 0 125 in Path length 30 cm 12 in 60 cm 24 in Connections Feed retentate UNF fitting UNF fitting Permeate UNF fitting UNF fitting Membrane area nominal 50 cm 7 75 in 40 cm 6 2 in Hold up volume nominal Lumen side 1 15 ml lt 1ml S
371. umber Model Number Pore Size NMWC Fiber ID mm Membrane Surface Area Nominal Flowpath m ft Length cm 56 4110 37 RTPUFP 10 C 3X2M 10 000 0 5 0 029 0 31 60 56 4110 38 RTPUFP 30 C 3X2M 30 000 0 5 0 029 0 31 60 56 4110 39 RTPUFP 50 C 3X2M 50 000 0 5 0 029 0 31 60 56 4110 40 RTPUFP 100 C 3X2M 100 000 0 5 0 029 0 31 60 56 4110 41 RTPUFP 300 C 3X2M 300 000 0 5 0 029 0 31 60 56 4110 42 RTPUFP 500 C 3X2M 500 000 0 5 0 029 0 31 60 56 4110 43 RTPUFP 750 E 3X2M 750 000 1 0 023 0 24 60 56 4110 52 RTPUFP 10 C 4X2M 10 000 0 5 0 14 15 60 56 4110 53 RTPUFP 30 C 4X2M 30 000 0 5 0 14 15 60 56 4110 54 RTPUFP 50 C 4X2M 50 000 0 5 0 14 LS 60 56 4110 55 RTPUFP 100 C 4X2M 100 000 0 5 0 14 15 60 56 4110 56 RTPUFP 300 C 4X2M 300 000 0 5 0 14 LS 60 56 4110 57 RTPUFP 500 C 4X2M 500 000 0 5 0 14 15 60 56 4110 58 RTPUFP 750 E 4X 2M 750 000 1 0 085 0 9 60 56 4110 67 RTPUFP 10 C 6 10 000 0 5 0 48 5 2 60 56 4110 68 RTPUFP 30 C 6 30 000 0 5 0 48 52 60 56 4110 69 RTPUFP 50 C 6 50 000 0 5 0 48 5 2 60 56 4110 70 RTPUFP 100 C 6 100 000 0 5 0 48 5 2 60 56 4110 71 RTPUFP 300 C 6 300 000 0 5 0 48 52 60 56 4110 72 RTPUFP 500 C 6 500 000 0 5 0 48 52 60 56 4110 73 RTPUFP 750 E 6 750 000 il 0 28 3 60 56 4110 82 RTPUFP 10 C 9 10 000 0 5 1 15 125 60 56 4110 83 RTPUFP 30 C 9 30 000 0 5 LIS 12 5 60 56 4110 84 RTPUFP 50 C 9 50 000 0 5 1 15 12 5 60 56 4110 85 RTPUFP 100 C 9 100 000 0 5 1 15 12 5 60 56 4110 86 RTPUFP 300 C 9 300 000 0 5 1 15 12 5 60 56 4110 87 RTPUFP 500 C 9 500 000 0 5 1
372. ure I 28 4115 16 Electric Rocker Base for 20 50EHT includes CO2MIX20 for mammalian cell culture with Loadcell module installed 1 28 4115 18 Electric Rocker Base for 20 50EHT includes O2MIX20 for insect cell culture 1 28 4115 20 Electric Rocker Base for 20 50EHT includes O2MIX20 for insect cell culture with Loadcell module installed 1 28 4115 22 Kit 2OEHT for BASE20 SOEHT units includes mounting plate HOLDER20T HEATERPAD20 SRTDX temperature probe T 28 4115 26 Kit 2OEHTD for BASE20 50EHTD units Dual version includes mounting plate HOLDER2OT HEATERPAD20 SRTDX temperature probe 1 28 4115 27 Kit SOEHT for BASE20 S0EHT units includes mounting plate HOLDERSOT HEATERPADSO SRTDX temperature probe s 1 28 4115 28 Kit SOEHTD for BASE20 SOEHTD units Dual version includes mounting plate HOLDERSOT HEATERPADSO SRTDX temperature probe s 1 28 4115 30 Protective rigid clear PVC lid for use with KIT 20 series 1 28 4115 34 Protective rigid white PVC lid for use with KIT 20 series opaque version for light sensitive applications 1 28 4115 35 Protective rigid clear PVC lid for use with KIT 50 series 1 28 4115 37 Protective rigid white PVC lid for use with KIT 50 series opaque version for light sensitive applications 1 28 4115 38 Electric exhaust filter heater 5 VDC 4 W LED indicator 1 28 4116 39 1 Accommodates 1 x 20 2 x 101 2 x 2 Cellbags 2 Accommodates 1 x 50 or 2 x 22 Cellbags gt gt F
373. ure flow spec cross linked 6 agarose 45 165 um 1x10 4x10 3 13 2 14 100 200 cm h pressure drop cm H O bed height 15 bed height 10 cm column 5 cm i d E Sepharose 4 Fast Flow See p 84 85 Pack size Code No 1l 17 0149 01 101 17 0149 05 Data File 18 1020 52 Regulatory Support File 11 0028 41 Technical data Composition Particle size pH stability operational CIP stability short term Pressure flow spec highly cross linked 4 agarose 45 165 um 3 13 2 14 150 250 cm h 100 kPa XK 50 60 column bed height 25 cm 234 www gelifesciences com bioprocess Technical data Composition Particle size pH stability operational CIP stability short term Pressure flow spec highly cross linked 6 agarose 45 165 um 3 13 2 14 200 400 cm h 100 kPa XK 50 60 column bed height 25 cm E SOURCE 15ETH Pack size Code No 50 ml 17 0146 01 200 ml 17 0146 02 11 17 0146 04 Data File 18 1128 86 Regulatory Support File 11 0028 46 Prepacked columns RESOURCE ETH 1 ml 17 1184 01 RESOURCE HIC Test kit 17 1187 01 Technical data Composition polystyrene divinylbenzene Particle size 15 um monosized Typical flow rate 150 900 cm h pH stability operational 2 12 CIP stability short term 1 14 Pressure flow spec 400 cm h 1000 kPa FineLINE 100 column bed height 10 cm i d 10 cm E SOURCE 15IS0 Pack size Code No 50 ml 17 0148 01 200 ml 17 0148 02 11 17 0148 04
374. ure of 40 C 104 F at line pressures up to 5 0 barg 72 psi or liquids and 4 0 bar 58 psi in air gas Materials of construction Filtration media Glass Microfiber Prefilter layer Polyester Upstream support Polypropylene Downstream support Polypropylene Inner support core Polypropylene Outer protection cage Polypropylene End caps Polypropylene End cap insert 316 stainless steel Standard o ring gaskets Silicone EPDM Capsule body Polypropylene Capsule vent seals Silicone Filling bell Polycarbonate Literature Data file ULTA Prime GF 11 0026 26 Validation guide ULTA Prime GF capsule and cartridge filters 28 9094 72 For ordering information contact your local GE Healthcare sales representative ULTA Prime PP The all polypropylene construction of ULTA Prime PP cartridges ensures a wide range of chemical compatibility and makes them particularly suitable for filtering viscous and aggressive and chemicals and solvents Cartridges do not hydrolyze in aggressive solutions and thus do not contaminate process fluids Filter media of continuously graded fiber density provide progressively finer particulate retention throughout the depth of the media This combined with optimized media pleating density gives ULTA Prime PP cartridges am exceptional lifetime performance Retention characteristics have been determined by a single pass technique using suspensions of ISO 12103 Part 1 A2 Fine and A4
375. ustness and to minimize the need for additional optimization during further clinical development Conceptual visualization of a workflow for process development Parallel screening using PreDictor plates makes it possible to explore a large experimental space left Once optimal conditions have been identified fine tuning and verification are carried out on columns using AKTAdesign systems middle The design space shown in blue middle is identified and scaled up to a robust production scale process right Increased throughput with parallel operation High Throughput Process Development HTPD is a new way of working that shortens development time and increases the amount of information available during early process development while keeping sample consumption low Chromatographic conditions are evaluated in parallel using 96 well filter plates As a result a large number of experimental conditions may be evaluated simultaneously This allows screening of a large experimental space to identify the subspace that is most favourable with respect to one or several defined responses Once this subspace has been found optimization and scale up may be done on columns using AKTAdesign systems Media Wash Sample Wash Elution in well Equilibration addition 1 3 times 1 3 times A batch uptake experiment occurring in the wells of PreDictor filter plates The steps in PreDictor plate experiments are the same as in a typical
376. ut process development HTPD is a new way of working that shortens development time and increases the amount of information available during early process development PreDictor 96 well filter plates pre filled with GE Healthcare BioProcess chromatography media support HTPD by allowing parallel screening of chromatographic conditions either in a manual or in an automated workflow As a result a large number of experimental conditions may be evaluated simultaneously There are different types of prepacked columns containing various types of BioProcess media The new 10 cm bed height HiScreen columns contain media from the Capto and MabSelect families as well as Sepharose Fast Flow HIC media AkKTAexplorer and AKTApilot are members of the AKTAdesign family of chromatography systems and are well suited for process development As well as operating a wide range of prepacked columns AKTAexplorer can also operate FineLINE Pilot 35 and AxiChrom 50 columns FineLINE 70 AxiChrom 50 70 and 100 and BPG 100 can be connected to AKTApilot The control software for AKTAdesign systems is UNICORN which can also be used for pilot scale systems and full production UNICORN combines the flexibility needed for method and process development with the stringent requirements for commercial ReadyToProcess is our new platform of ready to use products engineered for convenience and speed The product line is designed to meet the biopha
377. ve analysis of biomolecules Biacore C is unique in quality control QC applications combining the advantage of Biacore s label free Surface Plasmon Resonance SPR technology with advanced instrumentation The SPR based system provides high quality real time data meeting the highest demands for precision accuracy and reproducibility Key application areas Biacore C has been designed for concentration analysis in Good Laboratory Practice GLP Good Manufacturing Practice GMP regulated key areas of drug development and manufacturing e Manufacturing QC and IPC In Process Control e Release assays System design and evaluation support Biacore C Control Software is designed to support the GLP GMP regulated working processes with built in validation features for compliance with worldwide regulations Assay development concentration analysis and evaluation of test data are straightforward with the user friendly Wizard based software 190 www gelifesciences com biacore Validation support Biacore C is fully supported with validation services including Installation and Operational qualification IQ OQ documentation upon system delivery and on site 1Q OQ performance by a certified GE Healthcare engineer To maintain the system in a validated state a maintenance re qualification service is also included Technical specifications Detection technology Surface Plasmon Resonance SPR Data presentation Result tables plot
378. vity readytoprocess 50 wwwelifesciences com readytoprocess ReadyMate Disposable Aseptic Connectors Available 2008 Ordering information The ReadyMate Disposable Aseptic Connector DAC provides safe connections for high fluid throughput and offers a secure simple and economical connection for upstream and downstream applications ReadyMate DAC is autoclave and gamma compatible and can be part of a Sterile circuit It can be used to connect unit operations and assemblies upstream and downstream ReadyMate DAC is manufactured in compliance with the current Good Manufacturing Practices of the FDA and ISO 9000 2000 Strap clamps are disposable and easy to use clamps ensuring leak proof traceable connections and meet ISO standard 2852 ReadyMate provides e Safe dry to dry aseptic connections made quickly and easily in non aseptic environments e Genderless design coupled with cross size connectivity reduces inventory and increases flexibility e Scalable from bench top to production Available in a variety of hose barb sizes and mini TC with the same smooth uninterrupted flow path design e Large inner diameter for high flow rates e Validated closure mechanism using standard sanitary clamps ISO 2852 or a disposable clamp to make a tamper evident single use light weight connection gt gt Visit us on the web at www gelifesciences com readytoprocess Sizes Outside clamp profile Wetted mat
379. w filtration system which includes a miniature peristaltic pump with exchangeable saddles to accommodate size 14 and 16 tubing reservoirs for retentate diafitrate and permeate precision backpressure control valve and a convenient platform for mounting the cartridge and pump with recesses to accommodate three reservoirs Ordering information Product idGee Hoop Cartridge 0 1 micron 1 0 mm lumen 60 cm CFP 1 E H22LA idGee Hoop Cartridge 0 2 micron 1 0 mm lumen 60 cm CFP 2 E H22LA idGee Hoop Cartridge 0 45 micron 1 0 mm lumen 60 cm CFP 4 E H22LA idGee Hoop Cartridge 0 65 micron idGee Hoop Cartridge 100kD idGee Hoop Cartridge 100kD 1 0 mm lumen 60 cm idGee Hoop Cartridge 10kD idGee Hoop Cartridge 10kD idGee Hoop Cartridge 300kD idGee Hoop Cartridge 300kD idGee Hoop Cartridge 30kD idGee Hoop Cartridge 30kD idGee Hoop Cartridge 3kD 0 5 mm lumen 60 cm UFP 3 C H42LA idGee Hoop Cartridge 3kD 1 0 mm lumen 60 cm UFP 3 E H22LA idGee Hoop Cartridge 500kD idGee Hoop Cartridge 50kD idGee Hoop Cartridge 750kD 0 75 mm lumen 60 cm CFP 6 D H22LA 1 0 5 mm lumen 60 cm U FP 100 C H 24LA 1 U FP 100 E H 22LA 0 5 mm lumen 110 cm UFP 10 C H42LA 1 0 mm lumen 110 cm UFP 10 E H22LA 1 0 5 mm lumen 60 cm U FP 300 C H42LA 1 1 0 mm lumen 60 cm U FP 300 E H 22LA 0 5 mm lumen 110 cm UFP 30 C H42LA 1 0 mm lumen 60 cm UFP 30 E H22LA 1
380. ween products batches and validation of cleaning procedures is not required Replacing flow paths between projects is simple and when used together with ReadyToProcess columns the risk for cross contamination is removed The AkTAready system is biocompatible and hygienic and meets all GLP and cGMP demands for Phase I III in drug development and full scale production AKTAready is controlled by UNICORN software including a www gelifesciences com readytoprocess complete guide and documentation for installation of Flow Kits and columns Highlights of AKTAready systems include e Simple exchange of the complete flow path removes the need for system cleaning e Improved economy and productivity due to simpler procedures e Single use eliminates risk of cross contamination between products batches e Scalable processes using UNICORN gt gt Visit us on the web at www gelifesciences com readytoprocess AKTAready is ReadyToProcess AkTAready is a part of the ReadyToProcess platform consisting of plug and play ready to use solutions for entire processes After the completion of a purification task the columns and the flow path i e the Flow Kits can be either disposed of or exchanged for reuse The ReadyToProcess concept can speed up processes considerably due to fewer operations there is no need to establish and validate cleaning procedures and no complex setup The flow path can be changed quickly with a d
381. words high scales of synthesis per reaction volume and are suitable for synthesis chemistries that are incompatible or ineffective with glass beads Our supports are produced in large quantities and are available world wide via our global distribution network These solid supports not only exceed what you can achieve with glass beads they also enable the synthesis of substantially higher yields of pure gt gt For more information please visit www primersupport com Primer Support 200 Primer Support 200 is polystyrene based solid support for synthesizing oligonucleotides The 30 um beads are loaded at 200 umol g as our standard offering for cost effective production of therapeutic oligonucleotides lt 30 mer The advantages of this high degree of substitution in the same column volume include larger scale synthesis per reaction volume plus lower consumption of reagents and solvents This can reduce the cost of synthesis by up to 30 compared with conventional controlled pore glass beads Primer Support 200 is guaranteed to be free from BSE TSE contamination e Cost effective synthesis Minimal reagent consumption High synthesis scale per reaction volume Typically gt 125 OD umol synthesis scale e High quality oligonucleotide Typically gt 75 full length t Typically lt 4 n 1 contamination e Scalable and secure material supply Process development to production scale synthesis Manufacturing capacities
382. ww gelifesciences com contact GE Healthcare Bio Sciences AB Bj rkgatan 30 751 84 Uppsala Sweden www gelifesciences com bioprocess imagination at work 28 9356 08 AA 06 2008
383. x5 ml 28 4058 46 HiTrap Capto DEAE 5x5 ml 28 9165 40 HiScreen Capto adhere 4 7 ml 0 77 x 10 cm 28 9269 81 HiScreen Capto DEAE 4 7 ml 0 77 x 10 cm 28 9269 82 HiTrap Capto IEX Selection Kit 5x1 ml 28 9343 88 HiTrap Capto IEX Selection Kit 5x1 ml 28 9343 88 96 well filter plates 96 well filter plates PreDictor Capto adhere 6 ul 4 x 96 well plates 28 9258 17 PreDictor Capto DEAE 2 ul 4 x 96 well plates 28 9258 11 PreDictor Capto adhere 20 ul 4 x 96 well plates 28 9258 18 PreDictor Capto DEAE 20 ul 4 x 96 well plates 28 9258 12 PreDictor Capto adhere 50 ul 4 x 96 well plates 28 9258 19 PreDictor Capto DEAE 50 ul 4 x 96 well plates 28 9258 13 Technical data Technical data Ligand type multimodal strong anion exchanger Ligand type weak anion exchange Composition highly cross linked agarose Composition highly cross linked agarose Particle size 75 UM doo a Particle size 90 um average d lon capacity 0 09 0 12 mmol Cl ml medium lon capacity 0 29 0 35 mmol Cl ml pH stability operational 3 12 pH stability operational 2 12 CIP stability 2 14 CIP stability 2 14 Pressure flow spec 300 kPa at 600 cm h 1 m diameter Pressure flow spec 300 kPa at 700 cm h 1 m diameter column 20 cm bed height column 20 cm bed height in water Capto Blue hs See p 87 Pack size Code No 25 ml 17 5452 01 500 ml 17 5452 02 Technical data Composition highly crosslinked agarose Particle size 75 um average d Ligand Cibacron B
384. xStand system consists of a cartridge support stand inlet and outlet pressure gauges and 400 ml and 1 liter reservoirs The self contained system also incorporates a precision back pressure control valve and a convenient sampling drain valve An optional peristaltic pump with a nominal maximum recirculation rate of 2 liters minute is available Ordering information Product Quantity Code No QuixStand in Case KCQSMO3SP 1 56 4108 05 QuixStand System QSM 02S 56 4107 41 QuixStand System 50 Hz pump QSM 02SP 50 56 4107 77 QuixStand System Sanitary QSM 03S 56 4107 42 QuixStand System Sanitary 50 Hz pump QSM 03SP 50 56 4107 78 QuixStand System Autoclavable QSM O04SA 56 4107 43 QuixStand System Autoclavable 50 Hz pump QSM 04SAP 50 56 4107 79 Accessories QuixStand Reservoir Kit 0 4 KQRVA 0 4 56 4107 48 QuixStand Reservoir Kit 1 KQRVA 1 0 56 4107 49 QuixStand Accessory Kit QAK 2 56 4107 50 QuixStand Reservoir 2 5 QRV 2 5 56 4107 47 QuixStand Carrying Case QSM CC 56 4109 57 QuixStand Reservoir Replacement Cap QSM RCP 56 4107 51 Peristaltic pump dual voltage PRP O9WM 56 4106 53 Technical specifications Basic QuixStand system Adv QuixStand system Max process volume 101 101 Min working volume n a 30 50 ml Pump power requirement n a 110V 60 Hz or 220 V 50 Hz Max recirculation rate size 17 tubing n a 1 4 min size 18 tubing n a 2 0 l min CE Compatible n a Yes Compone
385. xygen transfer resulting in a robust environment for cell growth The Bioreactor requires no cleaning or sterilization providing ease of operation and protection against cross contamination gt gt Visit us on the web at www gelifesciences com wave Cell Culture Bag in Switzerland Features benefits of the WAVE Bioreactors include e Single use eliminating cross contamination and the need for cleaning and validation Closed system Cellbag bioreactors including fittings and filters are delivered sterile and ready for use Validated suitable for use in cGMP production Multiple configurations specifically designed for suspension microcarrier batch fed batch or perfusion culture Scalability WAVE Bioreactors are scaleable over a wide volume range from 50 ml up to 500 www gelifesciences com readytoprocess Applications Monoclonal antibodies The WAVE Bioreactor has been used extensively for monoclonal antibody production Culture can be started at low volume and then fresh media added whenever the cell count is sufficiently high This enables inoculum scale up without transfers Batches ranging from 100 ml to 580 have been run with cell densities over 10 x 10 cells ml and productivity and product quality comparable to stirred tank bioreactors Dissolved oxygen concentrations are not limiting and remain above 50 saturation Anchorage dependent cells Agitation in the WAVE Bioreactor is powerfu
386. y Designed to maximize productivity in cross flow filtration UniFlux works in concert with other GE Healthcare components to provide consistent repeatable and validatable results UniFlux was developed with input from several GE Healthcare customers with needs ranging from research and development to biopharmaceutical manufacturing thus helping ensure the relevance of each feature All UniFlux systems are skid mounted mobile and can fit through a standard doorway The automated systems include the following features e Rotary lobe pump for reliable shear sensitive operation diaphragm pump for UniFlux 10 e Sanitary diaphragm valves e Overpressure protection e Zero dead leg piping in stainless steel e Product contact material 316L stainless steel e Monitoring of all major process parameters Automated systems also include the additional benefit of GE Healthcare UNICORN control system UNICORN software a single interface for the control of both filtration and chromatography systems has become a standard in the industry with over 25 000 systems in use many in approved manufacturing operations The UNICORN operating system is an extremely powerful tool for process development and production control providing flexibility to control processes with automatic TMP control or regulated flow control spnpod uoo www gelifesciences com bioprocess 141 wn s gej fo x Q 5 pz 5 fa ira Scale
387. y Sepharose High Performance Robust medium for difficult purification problems when high resolution is the main objective Is also very efficient for polishing monoclonal antibodies B Phenyl Sepharose High Performance Robust medium for difficult purification problems when high resolution is the main objective Is also very efficient for polishing monoclonal antibodies E BioProcess Media Custom Designed Media produced on receipt of order Column Dimensions 10 mm x 10 cm Packed bed volume 5 9 ml Buffer A 0 02 M Tris HCl 1 7 M ammonium sulphate pH 7 5 Buffer B 0 02 M Tris HCl pH 7 5 Flow 1 ml min 76 cm h Gradient 0 100 B 10 CV System AKTAFPLC Aceon MAU 150 A Butyl S Sepharose 6 Fast Flow Octyl Sepharose 4 Fast Flo Butyl Sepharose 4 Fast Flow 400 Phenyl Sepharose 6 Fast Flow low sub 100 Butyl Sepharose High Performance Phenyl Sepharose High Performance Phenyl Sepharose 6 Fast Flow high sub The HIC product portofolio based on Sepharose was screened for selectivity and separation ability for Cytochrome C RNAse A Lysozyme and a a Chymotrypsinogen eluting in this order Butyl S Sepharose 6 Fast Flow is the least hydrophobic medium and Phenyl Sepharose 6 Fast Flow high sub the most hydrophobic medium produced by GE Healthcare www gelifesciences com bioprocess 75 pipaw fiydpibo owo1yD Chromatography media Multimodal See p P lt w Ge chromatog
388. y beds e Materials include electropolished stainless steel borosilicate glass and polymers e Packing devices for longer bed heights Overview of INdEX columns Tube Cross inner Tube sectional diam height area Column mm cm cm dEX 70 500 70 50 38 dEx 70 950 70 95 38 dEX 100 500 100 50 79 dEX 100 950 100 95 79 dEX 140 500 140 50 154 dEX 140 950 140 95 154 dEX 200 500 200 50 314 dEX 200 950 200 95 314 Max Bed height cm Bed volume pressure min max min max bar 3 32 41 0 1 1 2 1 6 3 48 61 79 1 8 2 3 3 0 3 3 32 41 0 2 2 5 3 2 3 48 61 79 3 8 4 8 6 2 3 3 32 41 0 5 4 9 6 3 3 48 61 79 74 9 4 12 2 3 3 32 41 0 9 10 0 12 9 3 48 61 79 15 1 19 2 24 8 3 1 Maximum bed volumes and bed heights are based on a slurry concentration of 75 and a packing compression of 15 The figures within brackets are achievable using a packing device 3 Use a manometer to monitor the pressure www gelifesciences com bioprocess What do I need Stands and wheels INdEX 70 and 100 stands have adjustable feet Castors with brakes are available INdEX 140 and 200 stands have castors with brakes as standard Useful spare parts Nets The column is delivered with 23 um polypropylene nets For media with an average particle diameter lt 70 um change to 10 um polyamide in both adaptors and end pieces Seals Inspect the seals on a regular basis for signs of wear Spare parts to k
389. yet thorough steam penetration of the membranes Furthermore all cartridge components are USP 24 Biologicals Test for Plastics Class VI tested Cartridges are available in both ultrafiltration UF and microfiltration MF pore sizes in a choice of cartridge lengths 154 www gelifesciences com bioprocess STM cartridge ordering information STM ultrafiltration cartridges Code No Model No Fiber ID Membrane area NMWC mm m ft 56 4104 12 UFP 10 E 35STM 10 000 1 0 8 8 5 56 4104 13 UFP 30 E 35STM 30 000 1 0 8 8 5 56 4104 14 UFP 100 E 35STM 100 000 1 0 8 8 5 56 4104 15 UFP 500 E 35STM 500 000 1 0 8 8 5 56 4104 21 UFP 10 E 55STM 10 000 1 2 1 23 56 4104 23 UFP 30 E 55STM 30 000 1 2 1 23 56 4104 26 UFP 100 E 55STM 100 000 1 2 1 23 56 4104 27 UFP 500 E 55STM 500 000 1 2 1 23 56 4104 19 UFP 3 C 55STM 3000 0 5 3 25 35 56 4104 20 UFP 10 C 55STM 10 000 0 5 3 25 35 56 4104 22 UFP 30 C 55STM 30 000 0 5 3 25 35 56 4104 24 UFP 50 C 55STM 50 000 0 5 3 25 35 56 4104 25 UFP 100 C 55STM 100 000 0 5 3 25 35 Nominal molecular weight cut off STM microfiltration cartridges Code No Model No Pore size Fiber ID Membrane area micron mm m ft 56 4104 16 CFP 1 E 35STM 0 1 1 0 8 8 5 56 4104 17 CFP 2 E 35STM 0 2 1 0 8 8 5 56 4104 18 CFP 4 E 35STM 0 45 1 0 8 8 5 56 4104 28 CFP 1 E 55STM 0 1 1 2 1 23 56 4104 29 CFP 2 E 55STM 0 2 1 2 1 23 56 4104 30 CFP 4 E 55STM 0 45 1 2 1 23 56 4109 25 CFP 6 D 55STM 0 75 1 2 5 27
390. your local GE Healthcare sales representative ULTA Prime CG Liquid column guard filters for reducing bioburden and prefiltering upstream solutions e Can be repeatedly steam sterilized in situ autoclaved at up to 130 C or sanitized with hot water at up to 90 C e Compatible with a wide range of chemicals e Materials conform to the relevant biological safety requirements of 21 CFR Part 177 and current USP Plastics Class VI 121 C and 1SO10993 equivalents e Meet current USP quality standards for oxidizable substances e Aqueous extracts from ULTA Prime CG contain lt 0 125 EU ml when tested in accordance with the standard LAL test for endotoxins e Effluent quality conforms to the requirements of USP 28 lt 643 gt TOC and USP 28 lt 645 gt conductivity e Full pharmaceutical validation guide available on request ULTA Prime CG filter cartridges and capsules are specifically designed for bioburden control and particle retention in a variety of pH ranges and feed streams They can act immediately before chromatography columns and prefilter solutions upstream of the sterilizing grade filter For general bioburden control they give log reduction of bacteria when sterility is not required The cartridges are validated to give an LRV gt 5 when challenged with Brevundimonas diminuta in accordance with methods specified in ASTM F838 05 107 organisms cm minimum Pleated polyethersulfone PES membranes combined wit
391. ypro 102 pylene PTFE polytetrafluoroe www gelifesciences com bioprocess BPG 100 BPG 140 BPG 200 BPG 300 BPG 450 18 0251 01 8 1112 95 18 1152 01 8 1012 28 18 1103 14 18 0251 02 18 1152 02 8 1012 29 18 1103 15 18 0251 03 18 1112 96 18 1152 03 18 1012 30 18 1103 16 18 8494 01 18 1113 06 18 8489 01 18 1012 26 18 1105 33 18 0019 41 8 1113 07 18 0019 51 8 1012 27 18 1117 67 18 8475 01 18 1113 10 18 0275 01 18 1012 51 18 1017 47 18 0019 40 18 1113 11 18 0019 50 18 1012 52 18 1117 66 18 1104 40 18 1117 55 18 1103 04 8 1112 99 18 0252 56 8 1012 53 18 1104 34 18 0251 55 18 1112 98 18 0252 55 18 1012 36 18 1104 35 18 1103 05 8 1113 03 18 0252 76 8 1012 55 18 1017 46 18 0251 77 8 1113 02 18 0252 77 8 1012 35 18 1103 18 18 1148 37 18 1148 39 18 1148 41 18 1148 43 18 1148 45 18 1148 38 8 1148 40 18 1148 42 8 1148 44 18 1148 46 18 1103 08 18 1113 01 18 9253 01 18 1012 54 18 1001 62 18 9252 01 8 1113 00 18 9254 01 8 1012 34 18 1103 19 18 1126 96 18 1126 98 18 1127 00 18 1127 02 18 1127 04 18 1126 97 18 1126 99 18 1127 01 18 1127 03 18 1127 05 breviations EPDM ethylene propylene diene FEP fluoroethenepropene FP hene PVC polyvinyl chloride SS stainless steel fluorocarbon rubber PA polyamide PFR perfluor rubber Data Files Literature BPG Columns 100 140 200 300 and 450 series Application Notes Sanitization of BPG Columns Sanitization of BPG 450 Column Code No 18 1115 23 1
392. zed to form two types 1 and 3 Cytodex 3 has been coated with porcine collagen gelatin Cytodex microcarriers are designed for use in stirred tank cultures homogeneous environments for cell growth in which culture parameters are easily monitored and controlled Cells grow on the surface of Cytodex which facilitates inspection harvesting and infection of the cells The microporosity of Cytodex enables nutrient supply to all sides of the cells Cytodex microcarriers are autoclavable at 121 C for 20 minutes Application areas Cytodex is intended for the culture of truly anchorage dependent cells a large proportion of which are used in the production of viral vaccines Another major application for Cytodex is in the production of recombinant proteins Epithelial and endothelial cells connect through tight junctions and form a cellular layer around the microcarriers Cytodex microcarriers are used in batch and perfusion systems in stirred cultures and wave bioreactors as well as to increase the surface area of traditional stationary monolayers and roller cultures Transmission electron micrograph of pig kidney cells growing on Cytodex 1 Original photograph by B Meignier and J Tektoff IFFA M rieux Lyon France reproduced with kind permission 184 www gelifesciences com cellcult Cytopore 1 and 2 Cytopore microcarriers are hydrophilic DEAE exchangers with a mean diameter of 230 um and a density of 1 03
393. zyl alcohol e Temperature stability 4 to 40 C e Regulatory Support File e Shelf life 3 years e Simple scale up to production sized columns e Available in HiTrap format for convenient media screening e Large scale quantities available on request Like all our BioProcess media MabSelect meets every requirement for process design and scale up Prepacked columns and bulk quantities are available For large scale packing we recommend AxiChrom Chromaflow or BPG columns pipaw fiydpibo owo1yD MabSelect For high purity and throughput at production scale e Prioritized volume throughput e Optimized matrix and ligand coupling e The antibody purification standard MabSelect SuRe Withstands rigorous and cost effective CIP protocols e g 0 1 to 0 5 M NaOH e Alkali stabilized rProtein A ligand e Generic and economic CIP sanitization e Product safety and process robustness MabSelect Xtra For capturing high titer antibody feedstocks and reducing processing costs e Outstanding dynamic binding capacity e Improved process economics and reduced raw material costs e High purity capture due to minimal non specific binding www gelifesciences com bioprocess 71 Chromatography media Product application guide Getting started Target molecules Affinity media NHS activated Sepharose 4 Fast Flow Applications Ligand immobilization Testing the performance of separation NA CNBr activated Sepharose 4 Fast Flow Lig

Download Pdf Manuals

image

Related Search

New news newsmax new york times newegg news today new balance new iphone 17 new york post new york yankees news charlie kirk newgrounds new pope newrez login new innovations new orleans pelicans news nation new york times games news google newark new york new york times wordle newsmax news newsela new era new orleans

Related Contents

  HP VT/643AA User's Manual  manual de instruções ttl055n - 110/220vca - p054  Manual de instruções  StarTech.com External HDD Enclosure  ASUS DSL-N12E C1  ficha datos técnicos limpiador circuito refrigeración  Audiovox Rampage VBP1000 User's Manual  Mode d`emploi - Visitez mon site  MANUEL D`INSTRUCTIONS  

Copyright © All rights reserved.
Failed to retrieve file