EZ-TAL™ Assembly Kit
Contents
1. C H Cheng B Dawid Y Chen amp H Zhao 2012 Efficient targeted gene disruption in Xenopus embryos using engineered transcription activator like effector nucleases TALENS Proc Natl Acad Sci U S A PMID 23045671 Li L M J Piatek A Atef A Piatek A Wibowo X Fang J S Sabir J K Zhu amp M M Mahfouz 2012a Rapid and highly efficient construction of TALE based transcriptional regulators and nucleases for genome modification Plant Mol Biol 78 407 16 Li T S Huang X Zhao D A Wright S Carpenter M H Spalding D P Weeks amp B Yang 2011 Modularly assembled designer TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes Nucleic Acids Res 39 6315 25 Li T B Liu M H Spalding D P Weeks amp B Yang 2012b High efficiency TALEN based gene editing produces disease resistant rice Nat Biotechnol 30 390 2 Liu J C Li Z Yu P Huang H Wu C Wei N Zhu Y Shen Y Chen B Zhang W M Deng amp R Jiao 2012 Efficient and Specific Modifications of the Drosophila Genome by Means of an Easy TALEN Strategy J Genet Genomics 39 209 15 Ma S S Zhang F Wang Y Liu Y Liu H Xu C Liu Y Lin P Zhao amp Q Xia 2012 Highly Efficient and Specific Genome Editing in Silkworm Using Custom TALENs PLoS One 7 e45035 Mahfouz M M amp L Li 2011 TALE nucleases and next generation GM crops GM Crops 2 99 103 Mahfouz M M L Li M Piatek2. it is difficult to use sequence alignment between the raw sequence data of a TALE construct and the predicted Open Reading Frame ORF sequence of the DNA binding domain for sequence verification Instead we recommend the following method to manually check that the monomers were assembled in the correct order for a given target sequence Page 16 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 1 Using vector editor software such as the free APE Plasmid Editor http www biology utah edu jorgensen wayned ape paste in your raw sequence data in a new window 2 Stretch the window until each line is approximately 104 bases the length of each repeat which will cause all of the repeats to align with each other Itis easy to visualize when the alignment has occurred at the proper width as common regions of the repeat domains will be perfectly aligned such as the GGGGGAAA domain directly after the Repeat Variable Domain See example alignment below for full length sequence Sequence confirmation CCAT CT TACCACCTT 3 Next assign a color code to the Repeat Variable Domain RVD tandem codon which represents which nucleotide will be targeted by the TALE construct The RVD tandem codon immediately precedes the GGGGGAAA anchor in all repeat domains C CATGAC G AACAAC T AACGGA A AACATC In the above example C blue G yellow T red and A green 4 Using this method one can quickl
3. CACT G Assemble into 2 hexamers and one tetramer Multimer Tube 1 Contains Monomers SERGE Multimer Tube 2 Contains Monomers RIGS AMG yIMCE Multimer Tube 3 Contains Monomers C43 Au C15 Tig 2 ul H2O Note Monomers 1 15 are obtained from the basic EZ TAL kit but monomer 16 is obtained from the Special End monomer kit B Example TALEN design against GFP target GFP sequence in plasmid 717bp ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATG GGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTAT TTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGC TTTGCGAGATACCCAGAT CATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTAC AGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGA TACCCTTGTTAATAGAAT CGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAA Page 20 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 TTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTA ACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCC AATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGAT tabia ignores TA lengik Tio encase lengh CCCAACGAAAAGAGAGACCACATGGTCCT TCTTGAGTTTGTAACAGCTGCTGGGATTA options used arcay min 19 artay max 19 spacer min 15 eee li ROSES CACATGGCATGG Spa Spa ATGAACTATACAAATAA cer cer Sequence Cut TAL2 TAL2 leng ran Name Site TAL1 start start TAL1 length length th ge TALI
4. G here designated as G19 are NOT included in the multimer assembly reaction The first binding nucleotide is always T whose binding is not mediated by the RVD binding repeats but rather by the N terminal flanking sequences The last nucleotide binding is mediated by a half repeat which is built into the vector To AONE T7 Cs To Ato G11 C12 C13 A14 Cts Tio A17 Ate Gis Red Multimer 1 Green Multimer 2 Gray Multimer 3 Number below each base refer to the order in which each nucleotide is assembled from 1 18 2 Take the corresponding color coded monomers from Box 1 of the EZ TAL kit according to the order above except To and G49 3 Centrifuge briefly and put them on ice in order 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual B Assembly of Multimers 5 T Apr pose sans ag BOX ONE 0123456 7 8 9 10 11 12 13 141516 1718 19 806 A n LA 1 ul each 1 ul each 1 ul each Select the building blocks Take 1 ul and add into PCR tube Prepare master mix of reaction Add the master mix into each of 3 tubes QOO VOVOVOU 91019010101019 VOVOVOO VOVOVVOO VOVOVOE 1C1C10191019 I2121212 1019 OO COVA BR ND Fig 6 Schematic of the workflow for building individual multimers using provided monomers from the EZ TAL kit Day 1 Bench Time 30min Total Time 3 hrs 1 In a separate tube for each multimer pipette 1 uL of each
5. U uL 100 uL Exo buffer 10 x 50 uL dNTP 25 mM each 20 uL High fidelity DNA polymerase 400 uL PCR buffer 5x 50 uL dNTP 25 mM each 12 uL Bsal restriction enzyme 20 U uL 60 uL Combo Buffer II 10 x 50 uL BSA 10x 50 uL Colony PCR primer mix 10 uM each Vials are shipped on blue ice dry ice and should be stored at 20 C upon receipt Properly stored samples are stable for 6 months from the date received F Additional Required Materials 1 Tag polymerase e g New England BioLabs Ipswich MA MO267X 2 MinElute Gel Extraction Kit Qiagen Valencia CA 28606 3 Qiaprep Spin Miniprep Kit Qiagen Valencia CA 27106 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual 4 High transformation efficiency Escherichia coli e g One Shot Stbl3 chemically competent E coli Life Technologies C7373 03 or similar competent cells compatible with ccdB vectors 5 SOC medium Life Technologies 46 0700 6 LB Carbenicillin Plates Teknova Hollister CA L1008 7 LB Broth Teknova L8000 8 Carbenicillin Teknova C2130 9 Low DNA Mass Ladder Life Technologies 10068 013 10 EZ TAL Special End Monomer Kit System Biosciences GE900A 1 Required for building TALE constructs targeting less than 20bp e g 14 19bp ll Experimental Design A Design of TALE target sequence TALE target sequences with minimal off target effects can be efficiently desig
6. Wang J M Campbell T L Poshusta C G Starker R G Krug li W Tan S G Penheiter A C Ma A Y Leung S C Fahrenkrug D F Carlson D F Voytas K J Clark J J Essner amp S C Ekker 2012 In vivo genome editing using a high efficiency TALEN system Nature doi 10 1038 nature 11537 Boch J H Scholze S Schornack A Landgraf S Hahn S Kay T Lahaye A Nickstadt amp U Bonas 2009 Breaking the code of DNA binding specificity of TAL type III effectors Science 326 1509 12 Clark K J D F Voytas amp S C Ekker 2011 A TALE of two nucleases gene targeting for the masses Zebrafish 8 147 9 Doyle E L N J Booher D S Standage D F Voytas V P Brendel J K Vandyk amp A J Bogdanove 2012 TAL Effector Nucleotide Targeter TALE NT 2 0 tools for TAL effector design and target prediction Nucleic Acids Res 40 W117 22 Hockemeyer D H Wang S Kiani C S Lai Q Gao J P Cassady G J Cost L Zhang Y Santiago J C Miller B Zeitler J M Cherone X Meng S J Hinkley E J Rebar P D Gregory F D Urnov amp R Jaenisch 2011 Genetic engineering of human pluripotent cells using TALE nucleases Nat Biotechnol 29 731 4 Huang P Z Zhu S Lin amp B Zhang 2012 Reverse genetic approaches in zebrafish J Genet Genomics 39 421 33 Page 18 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 Lei Y X Guo Y Liu Y Cao Y Deng X Chen
7. X Fang H Mansour D K Bangarusamy amp J K Zhu 2012 Targeted transcriptional repression using a chimeric TALE SRDX repressor protein Plant Mol Biol 78 311 21 Moore F E D Reyon J D Sander S A Martinez J S Blackburn C Khayter C L Ramirez J K Joung amp D M Langenau 2012 Improved somatic mutagenesis in zebrafish using transcription activator like effector nucleases TALENs PLoS One 7 e37877 Mussolino C amp T Cathomen 2012 TALE nucleases tailored genome engineering made easy Curr Opin Biotechnol 23 644 50 Perez Pinera P D G Ousterout amp C A Gersbach 2012 Advances in targeted genome editing Curr Opin Chem Biol 16 268 77 Reyon D S Q Tsai C Khayter J A Foden J D Sander amp J K Joung 2012 FLASH assembly of TALENS for high throughput genome editing Nat Biotechnol 30 460 5 Uhde Stone C J Huang amp B Lu 2012 A robust dual reporter system to visualize and quantify gene expression mediated by transcription activator like effectors Biol Proced Online 14 8 Vill Appendix A General Information and Protocol for EZ TAL End Monomer Kit Cat GE900A 1 The End Monomer kit is used in conjunction with the EZ TAL Assembly kit for the assembly of TALEs with target sizes of 14 19 nucleotides Kit Contents 7 ul of each monomer specifying a single target base A T G C for positions 12 through 17 in multimer Target Design Design your TALEs with ta
8. et al 2012a Mahfouz et al 2012 An example of such system is illustrated here using a dual fluorescent and luciferase reporter system to assess TALE TA activation functionality Fig 3 em SOS cow pla High Level with TALEs Binding r SENATE PolyA LTA Luciferase Reporter M TALE Binding pres 0 1 pg 0 5 ug 1600000 1400000 9847 fold gt 1200000 gt E 1000000 lt 800000 o 600000 3673 fold q 3 400000 971 fold La 243 fold 0 a E Ea Control 0 1ug 0 5 ug 1 0 ug 2 5 ug Fig 3 Reporter data illustrating linearity of fluorescence and luciferase activity levels upon TALE TA binding to TALE response elements D Overview of the Products SBI s EZ TAL Assembly Kit consists of a simple straightforward 2 day protocol designed for rapid and accurate construction of customized TALEN and TALE TFs Fig 4 targeting DNA sequences of 20 bp in length 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Time Day Total Bench 1 Choose monomers 5 min 5 min AM 40min 2 Multimer assembly 3 5h 30 min 3 Exonuclease treatment 13h 10 min 4 Multimer amplification 1 5 h 30 min PM 40min Time Day Il Total Bench 5 Electrophoresisandgel 2h 1h AM 1hour purification of multimers 6 Assembly of multimers 4 5 h 30 min Noon 30 min into vector 7 Transformation 1 5h 30 min PM 30min
9. ALE construct validation data 16 A Validation and QC of TALE construct 16 B Sequence confirmation of final TALE construct 16 C Building TALE Construct Vector files 17 Vs Troubleshooting 22 3 ei de cuet aad se snes A eel 18 A Faint missing multimer band with high molecular smearing 18 B Colony PCR does not reveal correct band 18 C Sequence error in assembled TALE 18 VII References saia cree eee E Dao decanted aaa 18 VII AppendiX as assis rar sil transmet Arte lasser anda do m tiers 19 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual A General Information and Protocol for EZ TAL End Monomer Kit Cat GE900A 1 19 B Example TALEN design against GFP target 20 C Related Product vis css sf iiin EAR 22 D Technical Support 22 IX Licensing and Warranty information 23 Introduction A Overview of TALE technology Transcription activator like effectors TALEs are a class of naturally occurring transcription effectors that recognize specific DNA sequences to modulate gene expression First identified in the plant pathogen Xanthomonas sp the modularity of TALEs enables sequence specific perturbation of gene function and offers broad applications in genetic and epigenetic studies The TAL
10. E binding domain is defined by a simple yet elegant code of tandem repeat sequences Repeat Variable Domains or RVDs that allows for programmable generation of customized TALEs that bind to any DNA sequence with high specificity Fig 1 Compared to other gene targeting technologies such as zinc finger nucleases ZFNs and meganucleases TALEs offer the researcher more latitude in selecting potential DNA targets ease in design reliability and predictability of DNA binding and unmatched specificity Taken together these underlying features of TALEs provide a new set of powerful genetic engineering tools for studying gene function in target organisms en 00 RVD Ga EE Cm c TCTATTC ACTGACC Pathological DNA Binding Domain Nuclear Fokl Domain Reprogrammable Localization TA Dispensable Signal TR or others A NI Asparagine Isoleucine T NG Asparagine Glycine G NN Asparagine Asparagine C HD Histidine Aspartate Fig 1 Modular organization of TALE effector protein and code that specifies DNA binding Due to the modular structure of TALEs the TALE DNA binding domain can be efficiently combined with functional domains for targeted gene disruption such as the Fokl nuclease domain TALEN or gene activation such as VP64 TALE TA or gene repression such as KRAB ERA TALE TR Both TALEN and TALE TA TR modules have been successfully applied to gene disruption or gene regulation in a number of species Hockemeyer et a
11. Fig 4 General overview and workflow of TALE construction E List of Components Each EZ TAL Kit contains the following components with enough material to perform a minimum of 6 and a maximum of 12 TALE assemblies depending on the target sequence redundancy The products are supplied in two boxes Please examine the contents of each box upon receiving to verify that all of the components are present Please briefly centrifuge tubes prior to use BOX ONE ICICIS CS Monomer library Vectors a set of four and primers OOOO CO OO 00 00 OO O 00000000 OOVOOX DOU OOOL 00 VOSGES QO OOO OO OOO O Page 4 ver 4 130501 www systembio com EZ TALTM Assembly Kit BOX TWO 0000000009 Cat GExxxA 1 Enzymes buffers substrate and colony PCR primers Fig 5 Layout of the color coded components in each of the boxes for the EZ TAL kit Total volume Description Concentration 7 uL each Monomers A T G C 1 18 15 ng uL 15 uL each Vector Plasmid DNA 4 tubes 100 ng uL each 100 uL Sequencing primer SF 1 fwd 1 10 uM 100 uL Sequencing primer SF 2 fwd 2 10 uM 100 uL Sequencing primer SR rev 10 uM 50 uL Multimer primer pair 10 uM each 30 uL BsmBI restriction enzyme 10 U uL 100 uL Combo Buffer 10 x 80 uL DTT 10 mM 15 uL T7 Ligase 3000 U uL 150 uL ATP 10 mM 100 uL Exonuclease 10
12. NA For example if the DNA target ends with T use the T version of the vector Centrifuge the vector tube briefly before usage 2 Combine the multimers vector and components of the EZ TAL kit as specified in Table 8 in a PCR tube Total volume 10 uL Please include a negative control reaction contains no multimers per setup in Table 8 Table 8 Components for assembly of multimer into vector Component Volume to add uL Negative Ctrl uL Backbone vector 1 1 100ng uL 3 Purified multimers 5 0 each at 10 20ng uL ATP 1 1 T7 ligase 0 25 0 25 Combo buffer II 1 1 Bsal enzyme 0 75 0 75 BSA 1 1 DNA grade H 0 0 5 Total 10 10 3 Place tubes in a thermocycler and use the cycling conditions specified in Table 9 Table 9 Thermocycler conditions for multimer assembly into vector Cycle Number Temperature 1 Temperature 2 Temperature 3 1 20 37 C 5 min 20 C 5 min 21 80 C 20 min Page 12 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 Hold at 4 C G E coli transformation Day 2 Bench Time 30min Total Time 1 5 hrs 1 In separate tubes transform 5ul of each assembly reaction and negative control product in 50 of competent E coli cells per manufacturer s instructions Negative control is optional 2 Plate recommended volume of transformed E coli on LB plates containing carbenicillin 100 ug mL or ampicillin 100 ug mL 3 Incubate the plates O N in a 37 C incubator 4 Next
13. RVDs In order to design a single target as for NN NI NNNGNINI TALE TFs or a TALEN pair choose the NL NN NN NI NN NI dde ONT CS ee appropriate tool on the start page of GFP 28 2 54 19 19 15 35 NG Targeter 2 0 E g to design a TALEN pair Unique RE the TALEN targeter tool was selected To sitesin design single TALE targets the TAL TAL2 RVDs Plus strand sequence spacer Effector Targeter tool would be chosen HD NG NI NI NG NG HD GAGTAAAGGAGAAGAACTT BpmESIG i NINI HD NI NINN NI NI ttcactagagttgtc GAGICICC The DNA input sequence can be copied and NG NG NN NN ARSE A pasted in FASTA format into the sequence window The default options can be used or customized options can be selected The latter allows to specify the exact target and spacer length Note that for 20 bp target sequences RVD length of 19 bp should be selected as the first T is not included in the RVD count After submitting the input sequence a table and file are generated The file can be down loaded and the tab deliminated table can be opened in excel Among the generated output the plus strand information gives the actual DNA target sequence Plus strand TAL Effector Nucleotide Targeter 2 0 software T GAGTAAAGGAGAAGAACTT ttcactggagttgtc CCAATTCTTGITGAATTAG A The 2 TALEN target sequences are in upper case letters the spacer between these is shown in lower case letters From this information the TALEN design for the EZ TAL assembl
14. SBI System Biosciences EZ TAL Assembly Kit Cat GExxxA 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual EZ TALTM Assembly Kit Cat GExxxA 1 Contents B IMtrOdUCHON DEODORO 2 A Overview of TALE technology 2 B TALEN technology 52228 jan gti ml min 2 GC TALE TF tecnologi nuore e sis sagia ti dia sasianto 3 D Overview of the Producis 3 E List of Components 4 F Additional Required Materials o 5 ll Experimental D sign 22 462 2 a24 rain li 6 A Design of TALE target sequence 6 B Choice of your TALEN and TALE TF vectors 6 Ill TALE assembly protocol 7 A Selection of Monomers sra 7 B Assembly of Multimers 8 C Exonuclease Treatment 9 D PCR Amplification of Multimers nene 9 E Gel purification and normalization of multimer amplicons 10 F Assembly of multimers into vector 11 G E colitransformation era 13 IV Confirmation of TALE assembly 13 A Colony PCR and agarose gel analysis 13 B TALE construct sequencing eeeeeeeeeeeeeeeeeeeeeeeeteeeaeeeeeenaees 16 V T
15. ction please scale up for additional reactions dNTP 0 25 ul Colony PCR primer mix 0 25 ul Taq Polymerase 5 U uL 0 1 ul Page 14 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 Taq Polymerase buffer 10x 2 5 ul 4 Add 24 ul of mix to 1 uL of diluted template DNA grade H O 20 9 ul colony suspension or negative control in 100 uL H20 for a total reaction volume of 25 uL Total volume 24 ul 5 Place tubes in thermocycler and run using cycling conditions as specified in Table 11 Table 11 Thermocycler conditions for colony PCR Cycle Number Denature Anneal Extend 1 94 C 3min 2 31 94 C 30sec 60 C 30sec 72 C 2min 32 72 C Smin Hold at 4 C 6 After completion of the PCR reaction run all 25 uL of the colony PCR samples and negative control on a 1 5 agarose gel including a suitable 1 kb molecular weight marker The expected size of the bands can be approximated as the number of inserted monomers x 103 bp plus 250 bp For example a 20 base TALE construct excluding the 5 T and last half repeat would be 18 x 103 bp 250 bp or 2100bp in size MM 72 3 4 5 6 7 Negative Control MM Positive 2 1 Kb Screening Neg amp Pos Controls Fig 10 Agarose gel results of correct sized multimer bands 2 1kb after colony PCR reaction 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual B TALE construct sequencing 1 Inoculate 2 colonies that
16. day you should expect to see tens to hundreds of colonies on plates with transformed bacteria containing the assembled product while there should be minimal number of colonies on the negative control plates see Fig 4 Usually lt 10 colonies eee Ss ing no su Usually gt gt 10 colonies Fig 8 Transformation data showing expected colonies of bacteria containing assembled multimers vs negative control IV Confirmation of TALE assembly A Colony PCR and agarose gel analysis Day 2 Bench Time 30min Total Time 1 5 hrs 1 Pick 5 10 colonies per TALE assembly for colony PCR reaction For colonies containing the template pick a single colony with a sterile pipette tip and then place the pipette tip into a tube containing 100 uL of sterile PCR grade H20 As negative control for colony PCR touch agar plate where there are no colonies using a sterile pipette tip and process as above 2 Streak each bacterial clone suspension on new LB Ampicillin Carbenicillin plates and incubate overnight at 37 C Save the plates by parafilming the sides and store at 4 C 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual Fig 9 Overnight streak culture of candidate clones on LB plates containing carbenicillin 100 ug mL or ampicillin 100 pg mL 3 Set up a colony PCR reaction as specified in Table 10 Table 10 Components for colony PCR For a single colony PCR rea
17. e in the sequence specific TALE construct are listed in Table 1 The choice of the vector backbone and promoter is dependent on the specific desired application e g gene disruption or activation repression Please note that since the last base of each full TALE construct is vector encoded all vectors come in four versions containing an A T G or C specific half repeat sequence Table 1 List of available TALE TF and TALEN vector backbones TALE Vector Promoter Catalog CMV TALEN XX XX NI CMV GE100A 1 NG HD or NN EF1a TALEN XX XX NI EFia GE120A 1 Page 6 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 NG HD or NN MSCV TALEN XX XX NI MSCV GE140A 1 NG HD or NN CMV TALE TF XX XX NI CMV GE500A 1 NG HD or NN EF 1a TALE TF XX XX NI EFla GE520A 1 NG HD or NN MSCV TALE TF XX XX NI MSCV GE540A 1 NG HD or NN Specifies RVD for the last DNA base of the target sequence encoded in the TALE construct where NI A NG T HD C NN GorA lll TALE assembly protocol A Selection of Monomers Day 1 Total Time 5min 1 Divide the target sequence of 14 20 nucleotides from the output of TALE software tool into three sets of multimers excluding the first 5 T and the last 3 nucleotide which is vector encoded Example 20 nucleotide TALE target Please note that the first 5 T here designated as To and the last 3
18. elivery of plasmid and siRNA into cells D Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 Page 22 ver 4 130501 www systembio com EZ TAL Assembly Kit Cat GExxxA 1 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com IX Licensing and Warranty information Limited Use License Use of the EZ TAL Assembly kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product may not be resold modified for resale or used to manufacture commercial products without prior wri
19. imer band with high molecular smearing This particular result may be due to incomplete or failed exonuclease treatment Please check the following i Ensure proper storage conditions for exonuclease enzyme and ATP substrate ii Double check addition of correct amounts of each component iii Make sure that exonuclease incubation time is correct do not skip or shorten exonuclease incubation time B Colony PCR does not reveal correct band i This result may be due to inefficient assembly of multimers whose concentration dictates efficiency of assembly If concentration of multimers is lower than recommended below 20 ng uL reduce vector concentration in the assembly step step 6 accordingly If necessary repeat assembly of multimer of low concentration and or quality as assessed through gel electrophoresis C Sequence error in assembled TALE i Less than 10 of sequenced clones may display some sequence errors such as an incorrect repeat or mutations One shall make sure the mutations would not results in amino acid change or frame shift Otherwise we recommend sequencing additional 2 5 clones If this does not reveal an error free sequence we recommend to redo the multimer that contains the error and re assemble into the vector Note that the half repeat RVD in the EF1 TALE TF NG vector is encoded by AATGGC instead of AACGGA and that of the TALE TF NN vector is encoded by AATAAC instead of AACAAC Vil References Bedell V M Y
20. l 2011 Li et al 2011 Li et al 2012b Liu et al 2012 Mahfouz and Li 2011 Moore et al 2012 B TALEN technology When fused to a Fokl cleavage domain TALE nucleases TALENS recognize specific DNA sequences as specified Page 2 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 by the internal tandem repeats present in the TALES Binding of target DNA by two TALENS typically spaced 15 to 30 bp apart allows Fokl to dimerize and create a targeted chromosome break This process leads to recruitment of cellular machinery involved in the non homologous end joining NHEJ pathway to repair the damaged duplex resulting in either small deletions or insertions that leads to disruption of target gene function Fig 2 By fully leveraging TALEN based gene targeting researchers have been able to successfully knockout genes in cultured somatic cells with targeting efficiencies ranging from 20 80 single or biallelic modification DNA Binding Domain Nuclease TCTATTCACTGACC O ec GD 000000004 rota Wom T TT Fig 2 Schematic of TALEN based gene targeting C TALE TF technology Another key application for TALEs is the targeted activation and repression of target genes in cells by fusing of a transactivation or a repression domain to TALE DNA binding domain The resulting construct TALE TF is a powerful tool to selectively modulate endogenous gene expression in eukaryotic cells with exquisite specificity Li
21. monomer per example shown below Example Multimer Tube 1 Contains Monomers MERE Multimer Tube 2 Contains Monomers Mep m A CC Multimer Tube 3 Contains Monomers Cy Aja Cys 146 Ay HA 2 Prepare a master mix with components specified in Table 2 Reaction volumes are for 3 multimers 1 to account for pipetting differences 3 Add 4 uL of mix to each multimer tube for a total of 10 uL Mix contents of each tube by pipetting up and down several times DO NOT VORTEX Table 2 Components for multimer assembly for 3 multimers 1 for overage 4 reactions in total Combo Buffer 4ul DTT 4ul ATP 4ul BsmBI restriction enzyme 3 ul T7 Ligase lul Total 16 ul 3 Place each multimer tube in a thermocycler and use cycling conditions specified in Table 3 for 2 5 hours Table 3 Thermocycler conditions for multimer assembly Page 8 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 Cycle Number Temperature 1 Temperature 2 1 15 37 C 5 min 20 C 5 min Hold at 4 C C Exonuclease Treatment Day 1 Bench Time 10min Total Time 1 2 hrs 1 To degrade any noncircular ligation products prepare master mix from components specified in Table 4 Table 4 Components for exonuclease treatment for 3 multimers 1 for overage 4 reactions in total Exo buffer 6 ul ATP 8 ul Exonuclease 6 ul Total 20 ul 2 Mix well by pipeting up and down several times DO NOT VORTEX and add 5 uL of master mix to each
22. multimer tube for a total volume of 15 uL IMPORTANT Follow the above procedure exactly Do not change the reaction ratio and volume 3 Place each multimer tube in a thermocycler and use cycling conditions specified in Table 5 for 1 hour Table 5 Thermocycler conditions for exonuclease treatment Cycle Number Temperature 1 Temperature 2 1 37 C 30 min 70 C 30 min Hold at 4 C D PCR Amplification of Multimers Day 1 Bench Time 30min Total Time 1 3 hrs 1 To amplify each multimer prepare master mix consisting of components specified in Table 6 Table 6 Components for multimer amplification for 3 multimers 1 for overage 4 reactions in total 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual PCR buffer 40 ul DNA grade Water 148 ul Multimer primer mix 4ul dNTP 2 ul High fidelity DNA polymerase 2 ul Total 196 ul 2 Mix well by pipeting up and down several times DO NOT VORTEX Add 49 uL of mix to 1 uL of each multimer template mix well by pipeting up and down several times 3 Perform PCR of each multimer mix using conditions specified in Table 7 Table 7 Multimer PCR conditions Cycle Number Denature Anneal Extend 1 95 C 2 min 2 36 95 C 20 s 61 C 20s 72 C 30s 37 72 C 3 min Hold at 4 C E Gel purification and normalization of multimer amplicons Day 2 Bench Time 1 hr Total Time 2 hrs 1 Load 50 uL of each amplified multimer in 1 large well o
23. ned using a number of online tools such as TALENTargeter 2 0 Doyle et al 2012 and idTALE http idtale kaust edu sa An example of using the TALENTargeter 2 0 software to design specific TALEN pairs against Green Fluorescent Protein GFP gene is illustrated in the Appendix Section VIII A In general the design of TALENs requires a pair of proteins that bind adjacent DNA sites that are spaced approximately 15 30bp apart for optimal binding dimerization and cutting of the targeted sequence by Fokl endonuclease Cermak et al 2011 By contrast TALE TF applications requires the design of only a single effector protein The length of DNA binding sequences may vary typically ranging from 14 to 20 bp In humans designing of longer TALEN and TALE TF constructs e g 18 20 bp appears to increase targeting specificity resulting in more relevant phenotypes Reyon et al 2012 SBI s standard EZ TAL Assembly Kit is designed for target sequences which are 20 bp in length For target sequences less than 20 bp e g 14 19 bp we offer a special End Monomer Kit Cat GE900A 1 which allows flexibility in the length of the sequence being targeted by the use of specially designed terminal monomers that define the end of the multimer Please refer to the description and detailed protocol for the End Monomer kit located in Section VIII Appendix for additional details B Choice of your TALEN and TALE TF vectors The appropriate vector backbone to clon
24. r 2 medium sized wells on a 1 5 agarose gel and include a molecular size marker preferably one with known DNA mass for each band in the marker for normalization see below 2 Run gel at 15V cm or until there is clean separation of each band in the ladder distinct bands appears when the blue dye is near the edge of gel Page 10 ver 4 130501 www systembio com EZ TALTM Assembly Kit Cat GExxxA 1 MM L L 2 L 3 R R 2R 3 t edi Before Purification After Gel Purification Fig 7 Agarose gel images of multimer amplicons pre and post gel purification showing distinct multimer bands 3 Capture gel image using a high quality imaging system Select a suitable exposure that clearly shows all bands w o reaching pixel saturation 4 Using a suitable image acquisition software e g ImageJ or equivalent individually gate bands representing 10 to 100ng of the DNA mass ladder and the multimer bands and quantitate their pixel counts 5 Establish a standard curve using the pixel values obtained for the bands in the mass ladder and determine the estimated mass of the multimer bands Since the gel loading volume is known calculate concentrations of each multimer band 6 Using a gel extractor or a sterile scalpel excise multimer bands of correct size To estimate the correct band size multiply the number of assembled monomers by 103 bp and add 20 bp For example a hexamer will run at about 640 700 bp on the gel Caution Please
25. rget sizes of 14 19 as described in section II A of the EZ TAL user manual For example if you are interested in assembling a TALE with a final target length of 18 nucleotides you need to assemble 16 monomers into your vector of choice keeping in mind that the first 5 T and the last 3 nucleotide are defined by the vector 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Choosing monomers Step 1 Divide your target sequence of 14 19 nucleotides into multimers excluding the first 5 T and the last 3 nucleotide The first two multimers should be hexamers the last multimer is variable in size and contains however many monomers remain excluding the vector encoded last nucleotide Step 2 Take the corresponding color coded monomers from the EZ TAL kit except for the last monomer shown with an asterisk in the examples below Use a special end monomer from the End Monomer Kit Cat GE900A 1 for that last position Proceed assembly as described in the EZ TAL kit manual adjusting the last multimer to 6 uL with H20 if necessary Example for a 14 nucleotide target TIATCGCC TCTAGC C Assemble into 2 hexamers Multimer Tube 1 Contains Monomers ESSES Multimer Tube 2 Contains Monomers ree en aera Note Monomers 1 11 are obtained from the basic EZ TAL kit but monomer 12 is obtained from the End Monomer kit Example for an 18 nucleotide target TIATCGCC ITCTAGC
26. show a single band of correct size in 2 ml of LB Carbenicillin 100 ug mL or Ampicillin 100 pg mL 2 Incubate cultures overnight for plasmid isolation 3 Next day perform standard DNA miniprep using manufacturer s recommended protocol to isolate plasmid DNA 4 Sequence confirm the TALE constructs using the sequencing primers provided in the EZ TAL kit Please refer to Section V Part A for sequence alignment and confirmation protocol EZ TAL SF1 fwd 1 EZ TAL SF2 fwd 2 and EZ TAL SR rev Note For TALEs with DNA target sites of 14 15 bp primer EZ TAL SF2 can be omitted V TALE construct validation data A Validation and QC of TALE construct The components in SBI s EZ TAL kit has been rigorously tested to meet product specifications for quality and performance The monomer library hexamer assembly and final TALE assembly into donor vector has been verified for proper size using agarose gel electrophoresis as detailed below monomer library M EEE SEE me 150 170 bp C 150 170 bp G 150 170 bp monomer assembly into hexamers CEHE MS ATH er gt b 700 b i u LL 1 win 16 Colony PCR 75 efficiency hexamers into vector TALEN in Backbone Vector Fig 11 Quality control verification of individual monomers hexamers and assembly into TALE vector backbone B Sequence confirmation of final TALE construct Because of the number of repeats in a TALE DNA binding domain
27. take extra precaution in excision of gel bands to prevent cross contamination of multimers intended for the assembly of unrelated TALES Please use fresh gel extractor tools if available for each band excision 7 Extract and purify multimer amplicons using the manufacturer s recommended protocol for MinElute Gel Extraction kit For optimal results please pre warm Buffer EB in the kit to 55 C and elute DNA in column using 20 pL of elution buffer 8 Adjust individual multimer concentrations to 10 20 ng uL using Buffer EB Each multimer should have the same estimated concentration after adjustment with Buffer EB Alternatively after Step 7 quantitate DNA concentration and yield of eluted multimers using a suitable UV Vis spectrophotometer e g NanoDrop ND 1000 or a fluorescent assay e g Qubit per manufacturer s directions Based on these results please adjust multimer concentrations to target concentration of 10 20 ng uL with Buffer EB with each multimer having the same concentration after adjustment with Buffer EB F Assembly of multimers into vector Day 2 Bench Time 30min Total Time 4 5 hrs 1 Select an EZ TAL backbone vector according to the intended downstream application see Table 1 pg 10 for a list of available backbone vectors The vector should contain the half repeat that specifies the last nucleotide of the 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual target D
28. ties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual 2013 System Biosciences SBI All Rights Reserved Page 24 ver 4 130501 www systembio com
29. tten consent of SBI This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warran
30. y can be derived The 5 T is not recognized by tandem repeats but by the vector encoded TALE N terminus thus it is not part of the assembly The 3 nucleotide is targeted by a vector encoded half repeat TALEN target sequences for assembly TALEN er G A G T A A G G A G A AGA CT T vector eS eS D 2 SS CATIA 13 147715 16 17 18 TALEN ien CTAATT CA AC ALA GAATT Go G vector reverse complemented Note the target sequence for the right TALEN has to be reverse complemented 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual C Related Products PiggyBac Homology Arm Cloning Vector cat no PBHR100A 1 A Piggybac based vector for HR Homologous Recombination applications allowing for cloning of homologous sequences flanking TALEN cutting sites and seamless excision when used in conjunction with the SuperPiggybac transposase plasmid cat no PB200PA 1 Part of the PrecisionX HR Donor Vector Collection scheduled for release by June 2013 Minicircle DNA Vectors cat no MN1xx to MN5xx A plasmid transfection based system designed for high level sustained transgene expression for in vitro and in vivo applications MC Easy Kit cat no MN910 MN920 Designed for production of optimal minicircle yields from parental minicircle constructs PureFection Transfection Reagent A non toxic nanoparticle based formulation for efficient and reproducible d
31. y confirm that the order of RVDs in the raw sequence data for a new TALE construct is consistent with the target sequence This method can be repeated for each overlapping raw sequence to confirm the entire target sequence is correct 5 Note that the half repeat RVD in the TALE TF NG vector T is encoded by AAT GGC instead of AAC GGA for the final T the half repeat RVD in the TALE TF NN vector G is encoded by AAT AAC instead of AAC AAC for the final G and the TALE TF NI vector A uses AAT ATC instead of AAC ATC for the final A These sequences are encoded in the TALE TF vector but may be present in your raw sequencing results of the final hexamer C Building TALE Construct Vector files SBI is developing a web based program to produce predicted TALE ORF sequences in order to assist with the generation of custom TALE vector files The web based software is expected to be available in sometime in the Summer of 2013 In the meantime if you would like assistance with generating a fully annotated vector file specific for any TALE constructs you are building using the EZ TAL Assembly Kit please send an email to tech systembio com with the 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual target sequence and details on which vector backbone you are using and we will be glad to make and send you vector files for your TALE constructs VI Troubleshooting A Faint missing mult
Download Pdf Manuals
Related Search