GeneArt® CRISPR Nuclease Vector Kit
Contents
1. Types of Kits This manual is supplied with the products listed below Product Catalog no GeneArt CRISPR Nuclease OFP Reporter Vector Kit A21174 GeneArt CRISPR Nuclease CD4 Enrichment Vector Kit A21175 GeneArt CRISPR Nuclease CD4 Enrichment Vector Kit with Competent Cells A21177 GeneArt CRISPR Nuclease OFP Reporter Vector Kit with Competent Cells A21178 Contents The following reagents are included with GeneArt CRISPR Nuclease Vector Kits All GeneArt CRISPR Nuclease Vectors are shipped at room temperature Store at 20 C upon receipt Reagent Buffer Composition Amount CRISPR nuclease vector linearized 15 ng uL 10 mM Tris HCl pH 8 0 1x20 pL 1 mM EDTA pH 8 0 10X Oligonucleotide Annealing Buffer 100 mM Tris HCl pH 8 0 10 mM EDTA pH 8 0 250 uL 1 M NaCl DNase RNase Free Water 2x1 5mL 5X Ligation Buffer 250 mM Tris HCl pH 7 6 50 mM MgCl 5 mM ATP 80 uL 5 mM DTT 25 w v polyethylene glycol 8000 T4 DNA Ligase 1 Weiss U uL 10 mM Tris HCl pH 7 5 50 mM KCL 20 uL 1 mM DTT 5096 v v glycerol U6 Forward Sequencing Primer 0 1 ug uL TE Buffer pH 8 0 20 uL ds Cloning Control Oligo 50 uM 1X Oligonucleotide Annealing Buffer 10 uL Primer Sequences The table below provides the sequence and the amount supplied of the primers included in the kit Primer Sequence U6 Forward 5 GGACTATCATATGCTTACCG 3 continued on next pa2. Add 3 pL of the ligation reaction from step 4 page 8 into a vial of One Shot TOP10 chemically competent E coli and mix gently by swirling or tapping the tube gently Do not mix by pipetting up and down Note Transform 1 uL of the pUC19 plasmid if performing a positive control for transformation efficiency Place the tube immediately on ice and incubate for 10 30 minutes Note Longer incubations seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 uL of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 50 uL from the transformation reaction on a pre warmed LB agar plate containing 100 ug mL ampicillin Plate the remainder of the reaction on a second pre warmed LB agar plate Incubate the plates overnight at 37 C Note Plate two different volumes to ensure that at least one plate has well spaced colonies When transforming the pUC19 control plate 20 100 uL of the transformation on pre warmed LB plates containing 100 ug mL ampicillin An efficient ligation reaction may produce over a hundred colonies in total Pick 5 10 colonies for analysis see Analyze Transformants page 10 Analyze Transformants Confirm positive clones Analyze transformants Sequencing guidelines L
3. Bottom strand oligonucleotide include CGGTG on the 3 end ds oligonucleotides were degraded Store the 5 nM ds oligonucleotide stock in 1X Oligonucleotide Annealing Buffer Avoid repeated freeze thaw cycles Aliquot the 5 nM ds oligonucleotide stock and store at 20 C Oligonucleotide annealing reaction inefficient Ensure that the annealing reaction was performed as directed page 6 If ambient temperature is gt 25 C to 27 C incubate the annealing reaction in a 25 C incubator 12 Appendix A Map and Features of GeneArt CRISPR Nuclease Vector GeneArt CRISPR The figure below shows the features of the GeneArt CRISPR Nuclease Vector The Nuclease Vector vector is supplied linearized at nucleotides 7335 and 7356 CD4 or 6732 and 6752 OFP with 5 base pair 3 overhangs on each strand as indicated The complete sequence of the vector is available for downloading from our website www lifetechnologies com or by contacting Technical Support see page 16 tracrRNA CAAAA F1 origin TK pA pUC origin CD4 or OFP 2A Ampicillin GeneArt CRISPR Nuclease Vector CMV Continued on next page 13 Map and Features of GeneArt CRISPR Nuclease Vector continued Features of The GeneArt CRISPR Nuclease Vector 9822 bp CD4 and 9219 bp OFP contains GeneArt CRISPR the following elements All features have been functionally tested and the vector Nuclease Vector fully seq
4. col cells and select for expression clones Analyze transformants for the presence of insert by sequencing Prepare purified plasmid DNA and transfect the cell line of choice Figure 3 Cloning and analysis of target specific ds oligonucleotide Anneal DNA oligos that code for target specific crRNA GTTTT G TG G coU v BE S OFP or CDS Clone annealed oligos into linearized Cas nuclease reporter vector using T4 All in one vector DNA ligase Cas v m erRNA Pol Ill oP 2A Transform into E coli competent cells and screen for desired CRISPR clone Transfect enrich and screen for gene editing Design Single Stranded DNA Oligonucleotides Introduction Choose the target sequence To use the GeneArt CRISPR Nuclease Vector Kit you will first need to design two single stranded DNA oligonucleotides with suitable overhangs to complement the linearized vector one encoding the target CRISPR RNA Forward strand oligonucleotide and the other its complement Reverse strand oligonucleotide You will then anneal the top and bottom strand oligonucleotides to generate a double stranded oligonucleotide ds oligonucleotide suitable for cloning into the linearized vector provided in the kit The design of the single stranded ss oligonucleotides is critical to the success of both the cloning procedure General guidelines are provided in this section to help you choose the ta
5. GeneA rt CRISPR Nuclease CD4 Reporter Vector e Harvest live transfected cells and resuspend in a FACS buffer for the cell line being used e Stain cells with a CD4 antibody conjugated to your fluorophore of choice according to manufacturer instructions e Once stained cells transfected with the GeneArt CRISPR Nuclease CD4 Reporter Vector can be enriched by FACS see above continued on next page 18 Enrichment of GeneArt CRISPR Nuclease Expressing Cells continued Enrichment Using Cells transfected with the GeneArt CRISPR Nuclease CD4 Reporter Vector can CD4 Dynabeads be enriched using Dynabeads CD4 magnetic beads Cat no 11331D We recommend the following protocol when using this product 1 Harvest live transfected cells and centrifuge at 400 x g for 5 minutes 2 Decant supernatant and resuspend in 2 mL of Buffer I 0 2 micron sterile filtered PBS with 0 1 BSA 2 mM EDTA Centrifuge at 400 x g for 5 minutes Wash twice with 2 mL of Buffer I Resuspend cells in appropriate volume of Buffer I Qv 19r op r9 Proceed to Prepare Dynabeads CD4 magnetic beads Prepare 1 Resuspend the vial of Dynabeads CD4 magnetic beads for 3 minutes using a Dynabeads CD4 mixer allowing tilting and rotation of tubes e g HulaMixer Sample Mixer magnetic beads 2 Transfer 25 uL of beads to a sterile 1 7 mL microcentrifuge tube and place on a magnetic separator for 1 minute 3 With the tube still o
6. NA with the Detection Enzyme to allow mismatches to be detected and cleaved e Analyze resultant bands by gel electrophoresis e Quantitate bands by densitometry 21 For support visit www lifetechnologies com support or email techsupport alifetechn com www lifetechnologies com technologies 25 February 2014
7. Resemble Those of U1 and U2 Genes Even Though a Different Polymerase is Used Genes Dev 2 196 204 Mali P Aach J Stranges P B Esvelt K M Moosburner M Kosuri S Yang L Church Church G M 2013 CAS transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering Nature Biotechnology 31 833 838 Mali P Yang L Esvelt K M Aach J Guell M DiCarlo J E Norville J E Church G M 2013 RNA Guided Human Genome Engineering via Cas9 Science 339 6121 823 826 Schlossman S F L Boumsell W Gilks J M Harlan T Kishimoto C Morimoto J Ritz S Shaw R Silverstein T Springer T F Tedder and R F Todd eds 1995 Leukocyte Typing V Oxford University Press Inc New York Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 17 Appendix B Enrichment of GeneArt CRISPR Nuclease Expressing Cells Introduction Enrichment by FACS Populations of cells transfected with GeneArt CRISPR Nuclease Vectors with OFP or CD4 reporters can be enriched using fluorescence activated cell sorting FACS or in the case of vectors wit
8. USER GUIDE GeneArt CRISPR Nuclease Vector Kit Reporter vector system for expression of Guide RNA and Cas in mammalian cells Catalog Numbers A21174 A21175 A21177 A21178 Publication Part Number MANO0009424 Revision C 0 For Research Use Only Not for use in diagnostic procedures d technologies For Research Use Only Not for use in diagnostic procedures Information in this document is subject to change without notice DISCLAIMER LIFE TECHNOLOGIES CORPORATION AND OR ITS AFFILIATE S DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT TO THE EXTENT ALLOWED BY LAW IN NO EVENT SHALL LIFE TECHNOLOGIES AND OR ITS AFFILIATE S BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF NOTICE TO PURCHASER LIMITED USE LABEL LICENSE Research Use Only The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research
9. ase a target complementary CRISPR RNA crRNA and an auxiliary trans activating crRNA tracrRNA The crRNA and tracrRNA act as a short guide RNA to target the Cas9 nuclease to specific genomic loci Figure 1 Figure 1 Schematic representation of CRISPR Cas mediated target DNA cleavage Cas tracrRNA Target complementary crRNA The crRNA and tracrRNA of the GeneArt CRISPR Nuclease Vector are expressed together as a guide RNA that mimics the natural crRNA tracrRNA hybrid in bacterial systems The guide RNA expression is driven by a U6 pollII type promoter Figure 2 Figure 2 Guide RNA expression cassette in GeneArt CRISPR Nuclease Vector Target specific crRNA tracrRNA Pol Ill terminator U6 Promoter gt The system is versatile and simple to use and changing target specificity only requires a change in the design of the CRISPR RNA Experimental Outline Experimental outline Methods The following table and figure outlines the steps required to create your GeneArt CRISPR Nuclease Vector and express it in cells Step Action Page 1 Design single stranded DNA oligonucleotides 4 Anneal single stranded oligonucleotides to generate a double stranded oligonucleotide Dilute double stranded oligonucleotide to working concentration Clone double stranded oligonucleotide into CRISPR Nuclease Vector Transform One Shot Chemically Competent TOP10
10. ation of constructs to express non coding guide RNA including CRISPR RNA and tracrRNA as well as Cas9 nuclease for use in CRISPR mediated target gene cleavage or gene editing in mammalian cells The Cas nuclease is based on the type II CRISPR Cas system from the bacterium Streptococcus pyogenes and has been engineered for genome editing in mammalian systems Jinek et al 2012 Mali et al 2013 Cong et al 2013 GeneArt CRISPR Nuclease Vectors with OFP allow for FACS based sorting of Cas9 and CRISPR RNA expressing cell populations while the GeneArt CRISPR Nuclease Vectors with CD4 enables bead based enrichment of Cas9 and CRISPR RNA expressing cells The linearized GeneArt CRISPR Nuclease Vectors provide a rapid and efficient way to clone double stranded oligonucleotides encoding a desired CRISPR RNA target into an expression cassette that allows targeting of the Cas9 nuclease in a sequence specific manner Although the kit has been designed to express Cas9 and guide RNA representing a particular target sequence in the simplest most direct fashion use of the kit for genome editing and target loci cleavage analysis assumes that users are familiar with the principles of CRISPR system vector based production of CRISPR RNA and transfection in mammalian systems We highly recommend that users possess a working knowledge of the CRISPR system The CRISPR system is a prokaryotic adaptive immune system that uses a RNA guided DNA nuc
11. e complement Bottom strand oligo 3 GTGGCGTAAAGAGTCACGATATCT 5 3 overhang Annealing the two single stranded oligonucleotides results in a double stranded oligonucleotide with compatible ends for cloning into the GeneArt CRISPR Nuclease Vector 3 overhang needed for cloning 5 CATTTCTCAGTGCTATAGAGTTTT S 3 GTGGCGTAAAGAGTCACGATATCT 5 Annealed ds oligo 3 overhang needed for cloning Generate Double Stranded Oligonucleotide Introduction Materials needed Annealing procedure Anneal equal amounts of each single stranded oligonucleotide to generate a double stranded ds oligonucleotide After annealing dilute an aliquot of the ds oligonucleotide from 50 uM to a working concentration of 5 nM Forward strand oligonucleotide 200 uM in water or TE Buffer Reverse strand oligonucleotide 200 uM in water or TE Buffer 50 uM stock of ds control oligonucleotide thaw on ice 10X Oligonucleotide Annealing Buffer DNase RNase Free Water supplied with kit 1 5 mL sterile microcentrifuge tubes 95 C heat block Add the following reagents to a clean microcentrifuge tube at room temperature Forward strand oligonucleotide 200 uM 5 uL Reverse strand oligonucleotide 200 uM 5uL 10X Oligonucleotide Annealing Buffer 2 pL DNase RNase Free Water 8 pL Total volume 20 pL Re anneal the ds Cloning Control Oligo Centrifuge the tube briefly 5 s then transfer 5 uL to a clean microcentrifuge tube and proce
12. e construct is identified make a glycerol stock for long term storage 1 Streak the original colony out f on an LB plate containing 100 ug mL ampicillin and incubate overnight at 37 C 2 Isolate a single colony and inoculate in 1 2 mL of LB medium containing 100 pg mL ampicillin 3 Incubate at 37 C until the culture reaches stationary phase Mix 0 85 mL of the culture with 0 15 mL of sterile glycerol and transfer to a cryovial 5 Store the glycerol stock at 80 C 10 Transfection of Mammalian Cell Lines Methods of transfection Plasmid preparation Transfection guidelines Cleavage efficiency Controls 11 Methods of transfecting plasmids into the mammalian cell lines include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated techniques Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cell lines we recommend using the cationic lipid based Lipofectamine 2000 Reagent Cat no 11668 027 Ciccarone et al 1999 Consult original references or the supplier of your cell line for the optimal method of transfection Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Plasmid DNA for transfection in eukaryotic cells must be pure and free from contamination with phenol and sodium ch
13. ed to the next step Note This procedure is also applicable when re annealing other 50 uM ds oligonucleotides Incubate the tube at 95 C for 4 minutes in a heat block Remove the tube from the heat block and allow the reaction mixture to cool to 25 C for 5 10 minutes Centrifuge the tube briefly 5 seconds Mix gently Proceed to Dilute double stranded oligonucleotide page 7 For long term storage keep the 50 uM ds oligonucleotide stock solution at 20 C continued on next page Generate Double Stranded Oligonucleotide continued Prepare diluted double stranded oligonucleotides Prepare 500 nM stock solution Prepare 5 nM working solution Handling double stranded oligonucleotide solutions After the single stranded oligonucleotides and Cloning Control Oligos are annealed perform two 100 fold serial dilutions of the 50 uM ds oligonucleotide stock to prepare a 500 nM ds oligonucleotide stock solution 100 fold dilution and a 5 nm ds oligonucleotide working solution 10 000 fold dilution Prepare a 500 nM ds oligonucleotide stock solution by diluting the 50 uM ds oligonucleotide stock 100 fold 1 Mixthe following reagents in a clean microcentrifuge tube 50 uM ds oligonucleotide stock 1 uL DNase RNase Free Water 99 uL Total volume 100 uL 2 Vortex to mix thoroughly For long term storage keep the 500 nM ds oligonucleotide stock solution at 20 C Prepare a 5 nM ds oligonucleotide wo
14. es com At the website you can e Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities e Search through frequently asked questions FAQs e Submit a question directly to Technical Support techsupport lifetech com e Search for user documents SDSs vector maps and sequences application notes formulations handbooks certificates of analysis citations and other product support documents e Obtain information about customer training e Download software updates and patches Safety Data Sheets SDSs are available at www lifetechnologies com support The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www lifetechnologies com support and search for the Certificate of Analysis by product lot number which is printed on the box Life Technologies Corporation and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support 16 References Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Elect
15. ge Contents and Storage continued Double stranded ds Control Oligo The sequences of the two strands for the ds Cloning Control Oligo are listed below The ds Cloning Control Oligo comes annealed and is supplied in the kit as Sequences a 50 uM double stranded oligonucleotide The ds Cloning Control Oligo needs to be re annealed and diluted before use in the ligation reaction see page 7 ds Cloning Control Oligo Sequence Top strand 5 CATTTCTCAGTGCTATAGAGTTTT 3 Bottom strand 5 TCTATAGCACTGAGAAATGCGGTG 3 Competent cells GeneArt CRISPR Nuclease Vectors Kits A21177 and A21178 include One Shot TOP10 Chemically Competent E coli sufficient for 10 reactions Transformation efficiency is 21 x 10 cfu ug plasmid DNA One Shot TOP10 Chemically Competent E coli are shipped on dry ice Store Box 2 at 80 C upon receipt Reagent Composition Amount S 0 C Medium 2 Tryptone 6 mL may be stored at 4 C or room temperature 0 5 Yeast Extract 10 mM NaCl 2 5 mM KCL 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells 11x 50 uL pUC19 Control DNA 10 pg uL in 5 mM Tris HCl 0 5 mM 50 uL EDTA pH 8 Genotype of TOP10 Cells F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 rec A1 araD139 A ara leu 7697 galU galK rpsL Str end A1 nupG Introduction Product Information Introduction The CRISPR system GeneArt CRISPR Nuclease Vector Kits facilitate the gener
16. ge 9 Note You may store the remaining ligation reaction at 20 C overnight Transform Competent E coli Cells Introduction Materials needed One Shot TOP10 transformation procedure Once you have completed the ligation reaction transform One Shot TOP10 chemically competent E coli with the resulting CRISPR nuclease construct Cloning of the GeneArt CRISPR Nuclease Vectors was optimized using One Shot TOP10 chemically competent E coli These cells are ideal for high efficiency cloning and plasmid propagation and allow stable replication of high copy number plasmids The genotype of TOP10 cells is similar to that of the DH10B strain Note using competent cells of different genotype may lower cloning efficiency and can also result in a higher proportion of vectors without insert One tube of One Shot TOP10 E coli is required for each ligation reaction Ligation reaction from step 4 page 8 Optional pUC19 control supplied with kit One Shot TOP10 chemically competent E coli cells supplied with kit or available separately see page 15 S O C Medium warm to room temperature before use LB plates containing 100 ug mL ampicillin two for each transformation warm at 37 C for 30 minutes 42 C water bath 37 C shaking and non shaking incubator 9o cas CO UTE ais Thaw One Shot TOP10 chemically competent E coli on ice and proceed to the next step immediately after the cells are thawed
17. h the CD4 reporter using Dynabeads CD4 magnetic beads Use the following guidelines to enrich for cells transfected with the GeneA rt CRISPR Nuclease OFP Reporter Vector e Harvest live transfected cells and resuspend in a FACS buffer for the cell line being used For example a 0 2 micron sterile filtered FACS buffer 1X PBS containing 1 mM EDTA 25 mM HEPES 1 FBS works well for adherent cell line such as HEK 293 e OFP has a peak excitation of 548 nm and emission of 560 nm o A488 nm laser is recommended for efficient excitation o Standard 530 30 574 26 and 603 48 emission filters are recommended for detection The optimal collection buffer will depend on the downstream application of choice but RPMI media with 2 FBS and FACS buffer above are all viable options Figure 1 The AMFI median Fluorescence intensity of cells transfected with GeneArt CRISPR Nuclease OFP vector when excited by a 488 laser and measured by different detectors 100 90 4 80 4 70 4 60 4 50 4 40 4 30 4 20 4 10 4 Count 0 Delta MFI 10 10 10 10 10 10 10 BL1 H 530nm 30m Detector 140 80 4 Delta MFI 1 elta MFI 2 704 120 4 60 4 100 4 t 50 t 80 3 40 4 S 60 30 4 40 20 10 20 0 0 10 40 10 10 10 10 10 BL3 H 640nm Long Pass Detector 10 40 10 10 40 10 10 BL2 H 575nm 24nm Detector Use the following guidelines to enrich for cells transfected with the
18. h tube Resuspend the beads in 500 uL of Buffer II Place the tube on a magnetic separator and add the supernatant to the tube containing the recovered CD4 cells Repeat steps 13 14 a total of 3 times to obtain the maximum yield of recovered CD4 4 cells Bring the tube containing recovered CD4 cells to a final volume of 4 mL Centrifuge at 400 x g for 6 minutes Resuspend enriched cells in a solution appropriate for your downstream application e g staining solution flow cytometry buffer media 20 Determining CRISPR Cas9 Cleavage Efficiency Introduction CRISPR Cas9 mediated double stranded cleavage efficiency can be detected using a mismatch cleavage assay This technique leverages mismatch detection endonucleases e g T7E1 to detect genomic insertions or deletions indels incorporated during cellular NHEJ repair mechanisms GeneART The GeneART Genomic Cleavage Detection Kit see page 15 for ordering details Genomic Cleavage offers a complete workflow that helps you analyze the cleavage efficiency of your Detection Kit CRISPR targets A brief description of the assay follows e Extract Genomic DNA from cells transfected with your CRISPR nuclease construct e Amplify loci where the gene specific double strand breaks occur by PCR e Denature and reanneal the PCR product so that mismatches are generated as strands with an indel re anneal to strands with no indel or a different indel e Incubate heteroduplex D
19. lease to silence viral nucleic acids Jinek et al 2012 In bacteria CRISPR loci are composed of a series of repeats separated by segments of exogenous DNA of 30bp in length called spacers The repeat spacer array is transcribed as a long precursor and processed within repeat sequences to generate small crRNAs that specify the target sequences also known as protospacers cleaved by the CRISPR nuclease CRISPR spacers are then used to recognize and silence exogenous genetic elements at the RNA or DNA level Essential for cleavage is a sequence motif immediately downstream on the 3 end of the target region known as the protospacer adjacent motif PAM The PAM is present in the target DNA but not the crRNA that targets it Product Information continued Genome editing Genome editing involves the use of engineered nucleases in conjunction with endogenous repair mechanisms to insert delete or replace DNA sequences from a specific location in genomic DNA Engineered nucleases induce a double stranded break DSB at a specific location in the genome after which endogenous repair mechanisms repair the break via non homologous end joining NHEJ or homology directed repair The type II CRISPR system has been shown to function as a gene editing tool in various organisms including mammalian cells Mali et al 2013 Cong et al 2013 It consists of three components the CRISPR associated Cas9 nuclease a double stranded DNA endonucle
20. li 14 Accessory Products Introduction Ordering oligonucleotides Additional products 15 The products listed in this section may be used with the GeneArt CRISPR Nuclease Vectors For more information refer to our web site www lifetechnologies com or contact Technical Support see page 16 Custom oligonucleotides for use with the GeneArt CRISPR Nuclease Vectors can be ordered from Life Technologies For additional details visit our web site at www lifetechnologies com oligos or contact Technical Support see page 16 Many of the reagents suitable for use with the vectors are available separately from Life Technologies Ordering information for these reagents is provided below Item Quantity Catalog no T4 DNA Ligase 100 units 15224 017 One Shot TOP10 Chemically Competent E coli 20 reactions C4040 03 PureLink HiPure Plasmid MiniPrep Kit 25 preps K2100 02 PureLink HiPure Plasmid MidiPrep Kit 25 preps K2100 04 PureLink HiPure Plasmid MaxiPrep Kit 25 preps K2100 07 Lipofectamine 2000 O st aad Dynabeads CD4 Positive Isolation Kit 5 mL 11331D HulaMixer Sample Mixer 1 unit 15920D GeneART Genomic Cleavage Detection Kit 20 reactions A24372 Technical Support Obtaining support Safety Data Sheets SDS Certificate of Analysis Limited product warranty For the latest services and support information for all locations go to www lifetechnologi
21. loride We recommend using high quality maxi prep DNA for transfection Store plasmid DNA stocks at 20 C The following general guidelines are recommended for performing transfection in a standard 6 well plate e Perform transfection with Lipofectamine 2000 with most cell lines e Seed cells to so that they are 70 confluent on the day of transfection Note Seeding density varies with cell type e Perform transfection with 3 ug of CRISPR Cas9 expression vector Note Results will vary depending upon cell type and passage number and optimization of lipid DNA concentrations may be required for best results For details on enriching for populations transfected with GeneArt CRISPR Nuclease Vectors using either OFP or CD4 reporters refer to Appendix B page 18 The GeneART Genomic Cleavage Detection Kit is recommended for performing cleavage efficiency analysis see page 21 We recommend that you include a positive control and a negative control mock transfection in your experiment to evaluate your results Troubleshooting Observation Reason Solution Few ampicillin resistant colonies obtained on the selective plate Single stranded oligonucleotides designed incorrectly Make sure that each single stranded oligonucleotide contains the 5 nucleotides on the 3 end required for cloning into the GeneArt CRISPR Nuclease Vector Top strand oligonucleotide include GTTTT on the 3 end
22. n the magnet decant the supernatant Resuspend beads in 100 uL of Buffer I 5 Place the tube on a magnetic separator for 1 minute and with the vial still on the magnet decant the supernatant 6 Resuspend beads in 25 uL of Buffer I Proceed to Incubate cells with Dynabeads CD4 magnetic beads page 20 continued on next page 19 Enrichment of GeneArt CRISPR Nuclease Expressing Cells continued Incubate cells with A 1 1 bead to cell ratio is recommended 25 uL of beads 10 beads though this Dynabeads CD4 number may need to be optimized based on application magnetic beads 1 Qo n Qv gr dae cp S 10 11 12 13 14 15 16 17 18 Add harvested cells to resuspended beads and bring to a final volume of 1 mL with Buffer I Incubate at 4 C for 30 minutes on a mixer allowing tilting and rotation of tubes Place the tube on a magnetic separator for 1 minute With the tube still on the magnet decant the supernatant Resuspend the cells and beads with 500 uL of Buffer I Incubate on a mixer for 2 minutes Repeat steps 3 6 a total of 5 times After the final wash resuspend the cells and beads in 100 uL of Buffer II 0 2 micron sterile filtered RPMI with 2 FBS Add 10 pL of DETACHaBEAD CD4 provided with 11331D kit Incubate on a mixer at room temperature for 45 minutes Place the tube on a magnetic separator for 1 minute Transfer the supernatant containing CD4 cells to a fres
23. ong term storage Confirm the identity of the ds oligonucleotide insert in positive transformants by sequencing Analyze each CRISPR nuclease construct to verify e That the ds oligonucleotide insert is present and in the correct orientation e That the ds oligonucleotide insert has the correct sequence Note Restriction analysis is not recommended due to the small size of the ds oligonucleotide insert 1 Pick5 10 ampicillin resistant colonies and culture them overnight in LB medium containing 100 pg mL ampicillin at 37 C 2 Isolate plasmid DNA using your method of choice We recommend using the PureLink HQ Mini Plasmid Purification Kit 3 Perform sequencing of the CRISPR nuclease construct using the U6 Forward Primer supplied with kit 4 Make glycerol stocks of desired CRISPR nuclease expression plasmids see Long term storage 5 Proceed to Transfection page 11 If a particular CRISPR nuclease construct is difficult to sequence follow these recommendations to improve results e Use high quality purified plasmid DNA for sequencing We recommend preparing DNA using the PureLink HQ Mini Plasmid Purification Kit Cat no K2100 01 e Add DMSO to the sequencing reaction to a final concentration of 5 e Increase the amount of template used in the sequencing reaction up to twice the normal concentration e Usea7 1 molar ratio of dITP dGTP in your sequencing reaction Once the correct CRISPR nucleas
24. orientations provided that it meets the PAM requirements on the 3 ends 19 20 bp target sequence PAM sequence Genomic DNA target 5 CATTTCTCAGTGCTATAGANGG 3 continued on next page Design Single Stranded DNA Oligonucleotides continued Sequences required for directional cloning After choosing a 19 20 base pair target sequence proceed to designing the crRNA specific oligonucleotide primers Important Do not include the PAM sequence in the oligonucleotide primers To enable directional cloning of the ds oligonucleotide into the GeneArt CRISPR Nuclease Vector you must add the following 5 nucleotides to the 3 end of the corresponding ss oligonucleotides e Top strand oligonucleotide Add GTTTT to the 3 end of the oligonucleotide The GTTTT is complementary to the overhang sequence CAAAA in the linearized CRISPR Nuclease Vector see Figure 3 and constitutes the first 5 bases of the tracrRNA 19 20bptargetsequence 4 overhang MM r Tapsirona pigo 5 CATTTCTCAGTGCTATAGAGTTTT 3 e Bottom strand oligonucleotide The bottom strand oligonucleotide should be the reverse complement of the target sequence Add CGGTG to the 3 end of the oligonucleotide This sequence is complementary to the overhang sequence CACCG in the linearized GeneArt CRISPR Nuclease Vector see Figure 3 and constitutes the last 4 bases of U6 promoter and the first base required for PollII transcription start site Target specific revers
25. purposes only and is not for use in commercial applications of any kind including without limitation quality control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing alifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Limited Use Label License No 177 In vivo oligonucleotide generator Notice to Purchaser This product is for non clinical research use only It is not to be used for commercial purposes Use of this product to produce products for sale or for diagnostic therapeutic or high throughput drug discovery purposes the screening of more than 10 000 compounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This product or the use of this product is covered by US patents owned by The Regents of the University of California TRADEMARKS Life Technologies is a Thermo Fisher Scientific brand 2014 Thermo Fisher Scientific Inc All rights reserved All trademarks are the property of Thermo Fisher Scientific and its subsidiaries Contents Contents and StOrage se oen ote utes m ete dete eret e eno eR ene een e ti e ERE a eh iv INTFOGUCHON e P 1 Product Jaformation 3455525 ac m ee ed shee ERR TERR e
26. r thaw on ice before use e 5X Ligation Buffer supplied with kit e DNase RNase Free Water supplied with kit e T4 DNA Ligase supplied with kit We recommend including the ds control oligonucleotide supplied with the kit as a positive control in your ligation experiment The ds control oligonucleotide is supplied as a 50 uM stock in 1X Oligonucleotide Annealing Buffer and needs to be re annealed and diluted 10 000 fold before use in a ligation reaction see page 6 If you wish to include a negative control set up a separate ligation reaction but omit the ds oligonucleotide Set up a 20 pL ligation reaction at room temperature for each ds oligonucleotide to be cloned 1 Addthe following reagents to a clean microcentrifuge tube in the order shown 5X Ligation Buffer 4 uL Linearized GeneArt CRISPR Nuclease Vector 2 pL ds oligonucleotide 5 nM 2 pL DNase RNase Free Water 11 uL T4 DNA Ligase 1 uL Total volume 20 uL 2 Mix reaction well by pipetting up and down Note The presence of PEG and glycerol supplied by the Ligation Buffer and the T4 DNA Ligase will make the reaction mixture viscous Be sure to mix the reaction thoroughly by pipetting up and down Do not vortex 3 Incubate for 10 minutes at room temperature 25 27 C Note The incubation time may be extended up to 2 hours and may result in a higher yield of colonies 4 Place the reaction on ice and proceed to Transform One Shot TOP10 Competent E coli pa
27. rget sequence and to design the ss oligonucleotides Note that for a given target gene you may need to generate and screen multiple crRNA sequences to identify one that is active in efficiently cleaving your target genomic loci When performing CRISPR Cas9 induced DNA double stranded break on a particular gene or genomic loci of interest your choice of target sequence can significantly affect the degree of cleavage observed We recommend following the guidelines below when choosing your target sequence These are general recommendations only exceptions may occur Length Choose a target sequence ranging from 19 to 20 nucleotides in length that is adjacent to a NGG proto spacer adjacent motif PAM sequence on the 3 end of the target sequence Note the 5 G required for transcription initiation from the U6 PollII promoter is already included in the overhangs and does not need to be included in the target sequence Homology Make sure that the target sequence does not contain significant homology to other genes as this can increase off target effects Recently published work has shown that guide gRNA Cas9 complexes can potentially tolerate up to 1 3 mismatches Refer to published articles for more insights into choosing target sequence Fu et al 2013 Mali et al 2013 Orientation You may choose a target sequence encoding the sense sequence of the target Loci or the antisense sequence Thus you can generate CRISPR RNA in two possible
28. rking solution by diluting the 500 nM ds oligonucleotide stock solution 100 fold Note 5 nm ds oligonucleotide working solution is not suited for long term storage and should be prepared fresh each time 1 Mixthe following reagents in a clean microcentrifuge tube 500 nM ds oligonucleotide solution luL 10X Oligonucleotide Annealing Buffer 10 uL DNase RNase Free Water 89 uL Total volume 100 uL 2 Vortex to mix thoroughly e Thaw frozen ds oligonucleotide solutions on ice e Do not heat or allow the temperature of ds oligonucleotide solutions to rise above room temperature Heating of ds oligonucleotide solutions results in partial denaturation and a reduction in cloning efficiency o If the 500 nM stock solution or 5 nM working solution become heated prepare new diluted solutions o If the 50 uM ds oligonucleotide stock becomes heated re anneal the oligonucleotides page 6 continued on next page Ligation Reaction Introduction Materials needed Controls Ligation procedure Once you have generated your ds oligonucleotide and prepared the appropriate stock solutions clone the ds oligonucleotide into the GeneArt CRISPR Nuclease Vector Double stranded oligonucleotide 5 nM in 1X Oligonucleotide Annealing Buffer thaw on ice before use e Double stranded control oligonucleotide 5 nM in 1X Oligonucleotide Annealing Buffer thaw on ice before use e Linearized GeneArt CRISPR Nuclease Vecto
29. roporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cong L Ran F A Cox D Lin S Barretto R Habib N Hsu P D Wu X Jiang W Marraffini L A Zhang F 2013 Multiplex Genome Engineering Using CRISPR Cas Systems Science 339 6121 819 823 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Fu Y Foden J A Khayter C Maeder M L Reyon D Joung J K Sander J D 2013 High frequency off target mutagenesis induced by CRISPR Cas nucleases in human cells Nature Biotechnology 31 822 826 Jinek M Chylinski K Fonfara I Hauer M Doudna J A Charpentier E 2012 A Programmable Dual RNA Guided DNA Endonuclease in Adaptive Bacterial Immunity Science 337 6096 816 821 Kunkel G R Maser R L Calvet J P and Pederson T 1986 U6 Small Nuclear RNA is Transcribed by RNA Polymerase III Proc Natl Acad Sci USA 83 8575 8579 Kunkel G R and Pederson T 1988 Upstream Elements Required for Efficient Transcription of a Human U6 RNA Gene
30. rtt D EUR OR EIE II CREER hU etai us 1 MGTh OOS mr M TM 3 Experimental O tlin niniin skaon na dese pi Doo e Ris e bate He Decree rt n bees 3 Design Single Stranded DNA Oligonucleotides essere 4 Generate Double Stranded Oligonucleotide sssssssssseeeeeenenenenenrtnete tenete 6 igation Reaction nnne M 8 Transform Competent E colt Cells ee pu ee LAT pee P tei eee o Fee te ee ire Phan ete 9 Analyze Transformants sss ences tii ere sete erae n toe e des e dbi ie eben S aes 10 Transfection of Mammalian Cell Lines s seesssesesssseseeeeee eene eene tnnt nette trennen enne teen ntes nne nn nenne 11 hisdem anaa 13 Map and Features of GeneArt CRISPR Nuclease Vector ssseeeeeetettettettnttnnttnnttnnttnnttnntenntennts 13 Accessory Products 1 5 si5 ciate eoe utei Re ee mete tiet eer onde e E rre tee tere s 15 Technical Support ie en ette eii eerte HD pee a send pa ag e ETE ReaL 16 References eng nene pe GT OR GET PEE rea Re EB E ORITUR RR OF ERE aia 17 Appendix B acest ata tata us aia e RR Rude sda COLERA M aieo Bue OC vu du OR o eaaeo Pd A Rn RE Ca Co E CU ud 18 Enrichment of GeneArt CRISPR Nuclease Expressing Cells sse 18 Determining CRISPR Cas9 Cleavage Efficiency sssssssseeeee eene eene nennen 21 Contents and Storage
31. uenced Feature Benefit tracrRNA Auxiliary trans activating crRNA allows loading of Cas9 nuclease onto the gRNA F1 origin of replication Origin of replication TK pA Polyadenylation signal CD4 Reporter gene for bead based enrichment Can be used for monitoring transfection efficiency when stained with a fluorescently labeled anti CD4 antibody Schlossman et al 1995 OFP Reporter gene for FACS based sorting The fluorescent protein can also be used for monitoring transfection efficiency 2A peptide linker A self cleaving peptide linker connecting CD4 or OFP reporter genes to the C terminal end of Cas9 nuclease Following translation the two proteins flanking the 2A peptide are separated from each other CMV promoter Allows expression of Cas9 nuclease and CD4 or OFP reporter genes Human U6 promoter Allows RNA Polymerase III dependent expression of the guide RNA gRNA Kunkel et al 1986 Kunkel and Pederson 1988 U6 forward priming site Allows sequencing of the insert 3 overhangs Allows ligase mediated directional cloning of the double stranded oligonucleotide of interest Pol III terminator Allows efficient termination of RNA Polymerase III dependent transcription Ampicillin resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Permits high copy replication and maintenance in E co
Download Pdf Manuals
Related Search