HAPLOSEARCH SOFWARE
Contents
1. mitochondrial lineages delineate early human expansions BMC Genet 2 13 Parson W Bandelt HJ 2007 Extended guidelines for mtDNA typing of population data in forensic science Forensic Sci Int Genet 1 1 13 19 Richards M Macaulay V Hickey E Vega E Sykes B Guida V et al 2000 Tracing European founder lineages in the Near Eastern mtDNA pool Am J Hum Genet 67 5 1251 1276 Torroni A Achilli A Macaulay V Richards M Bandelt HJ 2006 Harvesting the fruit of the human mtDNA tree Trends Genet 22 6 339 345 21 van Oven M Kayser M 2009 Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation Hum Mutat 30 2 E386 394 222. 4a mom HAPLOSEARCH SOFWARE User s Manual http www haplosite com haplosearch c INDEX Mc INTRODUCTION rem 3 2 DATA FORMAT csi ranas a dias ais 4 2 Eadcm iii dl di a Dt A 4 2 2 IBAPLOTYBES editae testet 5 aj POINT MUTATIONS ccoo oia ira prnl 5 b BEIDEROPLASMY ctt aaa 6 ce UNDELS D A 7 de UNPUTDATA FILES 8 3 1 TRANSFORMING SEQUENCES 9 32 TRANSFORMING HAPLOTYPES INTO SEQUENCES sss 10 4 OUIPUTDATATIDES an tt eter iem a e i n ai n ie AERA adn rh 11 5 IMPORTANT INFORMATION 12 5 1 ALIGNMENT c X 12 5 2 PARTIAL SEQUENCES POPULATIONS 8 13 5 3 NOMENCLATURE OF DELETIONS FORENSIC 8 14 IHAPLOSEARGH INTEREAGE titre ttti tierna tht eb thin iniii 15 ausus 20 c 1 INTRODUCTION Human mitochondrial DNA mtDNA has several characteristics that makes it an invaluable tool for population genetic studies as high copy
3. Haplosearch gt Home This application lets you get haplotypes from sequences and the other way round Pr Help 15 Then you have to click Browse button and select the input data file E HAPLOSITE Haplosearch Resources Carga de archivos Buscar en E Archivos ejemplo em 2 E ABO gene example haplotype txt E ABO gene example sequences txt Documentos mtDNA example haplotype Forensic Genetic nomenclature txt recientes amp mtDNA example haplotype Population Genetic nomenclature txt B e mtDNA_example_sequences txt Escritorio Mis documentos Nombre miDNA_example_sequences txt Mis sitios de red Tipo Todos los archivos Cancelar Once the input data file is selected you have to select the type of transformation PE HaPLosite Haplosearch Resources Haplosearch gt Pre Through the next form you can get haplotypes or sequences Input file DAMis documentosiDepartementoVArt culos nuestros Examinar Operation R Get haplotype Oo Get sequence Nomenclature Population Genetics O Forensic Genetics Process Sent data will not be stored in our servers 16 Then you have to select the type of nomenclature Haplosearch Resources Opciones Haplosearch gt Process Through the next form you can get haplotypes or sequences Input file DAMis d
4. SEC1 6del 7del 11del 3 INPUT DATA FILES Input data files could be written on any text processor as long as the file is saved as a txt file However if a text processor with autocorrection tools such as Microsoft Word OpenOffice Writer or Vim is used this function has to be disabled in order to avoid modifications that could affect the HaploSearch operation Indels are prone to be affected by autocorrection tools as consecutive hyphens are exchanged for only one This could cause the lost of alignment and sometimes the use of characters that are not recognised by HaploSearch Therefore it is encouraged to disable the autocorrection tool or to use unformatted text processors 3 1 Transforming sequences into haplotypes The input file for transforming sequences into haplotypes has to be a txt file containing the aligned sequences in fasta format Moreover we have to indicate what is the reference sequence and the position number for the first nucleotide in the sequence as follows The first line must indicate the nucleotide position for the first base of the reference sequence with the following format START This position would be 1 for complete sequences or to begin with the corresponding number for partial sequences In this line it is also possible to choose some haplotype nomenclature features See 5 2 and 5 3 chapters for more information The second line must contain the reference sequence in fasta
5. the reference sequence following the required guidelines Bandelt and Parson 2008 Each sequence must be written continuously without spaces or new paragraphs For this reason after performing the alignment it is encouraged to review the sequences as some aligning programs create new paragraphs into the sequence Removing spaces or new paragraphs could be easily performed by using the Replace tool which is available for the majority of text processors As an example gt CRS AAAACCCCCTCCCC ATGCC gt SEC1 AAAACCCCCCCCCCCATGCC gt SEC2 AAACCCCCCTCCCC ATGCC 2 2 Haplotypes Mutations of haplotypes must be arranged from smaller to higher position and separated with spaces lf there are sequences that are exactly the same as the CRS reference their haplotype would be CRS This designation for non mutated sequences could be changed when other DNA types are studied Using HaploSearch software mutations could be written using two formats Population Genetics Nomenclature and Forensic Genetics Nomenclature following the DNA Commission of the International Society for Forensic Genetics recommendations as detailed in Carracedo et al 2000 a Point mutations Point mutations are caused when exchanging a single nucleotide for another Freese 1959a in respect to the CRS or other reference sequence These changes are classified as transitions or transversions Freese 1959b a Transition is a mutation
6. 5 1C This problem could be overcome by checking the alignment previous to the HaploSearch analysis for instance using a sequence editor as BioEdit 12 http www mbio ncsu edu BioEdit BioEdit html and placing the variable indels in the most used place A later modification of the output file is also possible For alignment guidelines see Bandelt and Parson 2008 5 2 Partial sequences Population Genetics nomenclature Sometimes in population genetic studies when only the hipervariable region HVRI is analysed positions between 16024 16365 the 16 notation could be omitted for clarity reasons For example haplotype SEQ1 16069 16126 would be SEQ1 069 126 If you want to use this notation in HaploSearch you should place an asterisk in the START number For example If you use the current notation START 16090 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 TATCTCGTACATTACTGCCAGACACCATGA The output would be START 16090 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 16093 16111A In other hand if you eliminate the 16 and add an asterisk to the start number START 90 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 TATCTCGTACATTACTGCCAGACACCATGA 13 The output would be START 90 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 093 111A This kind of notation is only possible for Populations Genetic Nomenclature 5 3 Nomenclature of deletions F
7. AACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAA gt SEC1 16183C 16187T 16189C 16193 1C 16193 2C 16223T gt SEC2 16224C gt SEC3 16189C 16192del 16193del Now if these output files are used as input file we could obtain the original data source 11 5 IMPORTANT INFORMATION ABOUT DATA FORMAT 5 1 Alignment HaploSearch recognises the indels that are determined by the aligned input sequences When sequences containing indels are aligned by alignment programs the gaps are not always placed in the same position as in the commonly used nomenclature For instance SEC1 has four inserted Cs between 301 to 320 mtDNA positions START 301 gt rCRS AACCCCCCCTCCCCCGC gt SEC1 AACCCCCCCCCCTCCCCCCGC As there are several Cs in this position the alignment could be shown in several ways all of them being corrected However every one would originate different haplotypes rCRS AA CCCCCCCCT CCCCCGC 302iCC 310iC 302 1C 302 2C 310 1C SEC1 AACCCCCCCCCCTCCCCCCGC rCRS AACCCCCCCC TCCCCC GC 3097CC 3151 7309 16 309 20 318 16 SEC1 AACCCCCCCCCCTCCCCCCGC rCRS AAC CCCCCCCTC CCCCGC 303iCC 311iC 303 1C 303 2C 311 1C SEC1 AACCCCCCCCCCTCCCCCCGC We do not know what mutational event caused these insertions so all the different alignments are possible However certain indels are commonly named in a determined way In the above example the correct nomenclature would be 309iCC 315iC or 309 1C 309 2C 31
8. aplotypes should be written in a similar way to the fasta format When sequences do not include mutation their haplotype would be the reference name For example when a mtDNA sequence is identical to the CRS its haplotype would be CRS Example START 16180 gt CRS AAAACCCCCTCCCCATGCC gt SEC1 16189 gt SEC2 16183C 16189 16193dC gt SEC3 CRS IMPORTANT INFORMATION Reference sequence in haplotype input files would be written without hyphens as HaploSearch automatically adds gaps when indels are present 10 4 OUTPUT DATA FILES HaploSearch output data files have the same format as the input data file for the opposite transformation This feature allows you to obtain the original data from the output file checking if any mistakes were introduced during data manipulation and or HaploSearch have worked properly If the input file is as follows START 16180 gt CRS AAAACCCCCTCCCC ATGCTTACAAGCAAGTACAGCAATCAACCCTCAA gt SEC1 AAACCCCTCCCCCCCCATGCTTACAAGCAAGTACAGCAATCAACCTTCAA gt SEC2 AAAACCCCCTCCCC ATGCTTACAAGCAAGTACAGCAATCAACCCCCAA gt SEC3 AAAACCCCCCCC ATGCTTACAAGCAAGTACAGCAATCAACCCTCAA The output file for Population Genetic Nomenclature will be START 16180 gt CRS AAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAA gt SEC1 16183C 16187 16189 161931CC 16223 gt SEC2 16224 gt SEC3 16189 16192dCC Or this one for Forensic Genetic Nomenclature START 16180 gt CRS AA
9. changing a purine to another purine nucleotide AC or a pyrimidine to another pyrimidine nucleotide CT This is the most common mutation and for the Population Genetic Nomenclature it is only designated by the nucleotide position 0000000001111 1234567890123 Q RS CGACCCCTGTATC EC1 CGACCCTTGTGTC un In this example haplotype would be SEC1 7 11 showing that SEC 1 has two transitions in position 7 and 11 respectively However for the Forensic Genetic Nomenclature the haplotype should be designated by the nucleotide position and the mutated base In this case it would be SEC1 7T 116 b Transversion refers to the substitution of a purine for a pyrimidine or vice versa For both haplotype formats they are designated by the nucleotide position and the changed base 0000000001111 1234567890123 CRS CGACCCCTGTATC SECI CGCCCCCTTTATC Thus haplotype would be SEC1 3C 9T showing that SEC 1 has one transversion to cytosine in position 3 and one transversion to thymine in position 9 b Heteroplasmy The presence of more than one mtDNA haplotype in a sample is referred to as heteroplasmy This phenomenon could be due to differential segregation of pre existing heteroplasmic variants to accumulation of new somatic mutations or to a combination of both In this situations it is necessary the use of a single symbol to designate a variety of possible nucleotides at a single posi
10. format The reference sequence must be named gt reference_name and would be the gt CRS for mtDNA or any consensus sequence for other DNA types In the following lines the studied sequences have to be introduced in fasta format Example START 16180 gt CRS AAAACCCCCTCCCCATGCC gt SEC1 AAAACCCCCCCCCCATGCC gt SEC2 AAACCCCCCTCCCCATGCC When sequences include indels they have to be aligned for a correct HaploSearch analysis START 16180 gt CRS AAAACCCCCTCCCC ATGCC gt SEC1 AAAACCCCCCCCC ATGCC gt SEC2 AAACCCCCCTCCCCCATGCC 3 2 Transforming haplotypes into sequences The input file for transforming haplotypes into sequences is similar to the previous file but using haplotype data with whatever Population Genetic or Forensic Genetic nomenclature As in the previous file it has to be indicated what is the reference sequence and the position number for the first nucleotide in the reference sequence The first line must indicate the nucleotide position for the first base of the reference sequence with the following format START This position would be 1 for complete sequences or to begin with the corresponding number for partial sequences The second line must contain the reference sequence in fasta format The reference sequence must be named gt reference_name and would be gt CRS for mtDNA or any consense sequence for other DNA types n the following lines the h
11. ge reference sequence for human mitochondrial DNA Nat Genet 23 2 147 Ballard JW Whitlock MC 2004 The incomplete natural history of mitochondria Mol Ecol 13 4 729 744 Bandelt HJ Parson W 2008 Consistent treatment of length variants in the human mtDNA control region a reappraisal Int J Legal Med 122 1 11 21 Cann RL Stoneking M Wilson AC 1987 Mitochondrial DNA and human evolution Nature 325 6099 31 36 Carracedo A Bar W Lincoln P Mayr W Morling N Olaisen B et al 2000 DNA commission of the international society for forensic genetics guidelines for mitochondrial DNA typing Forensic Sci Int 110 2 79 85 Cornish Bowden A 1985 Nomenclature for incompletely specified bases in nucleic acid sequences recommendations 1984 Nucleic Acids Res 13 9 3021 3030 20 Excoffier L Lischer HEL 2010 Arlequin suite ver 3 5 A new series of programs to perform population genetics analyses under Linux and Windows Mol Ecol Resour in press Freese E 1959a The Difference between Spontaneous and Base Analogue Induced Mutations of Phage T4 Proc of NAS 45 4 622 633 Freese E 1959b The Specific Mutagenic Effect of Base Analogues on Phage T4 J Mol Biol 1 87 105 Ingman M Kaessmann H Paabo 5 Gyllensten U 2000 Mitochondrial genome variation and the origin of modern humans Nature 408 6813 708 713 Maca Meyer N Gonzalez AM Larruga JM Flores C Cabrera VM 2001 Major genomic
12. introduce gaps into the reference sequence to maintain the alignment 0000000 001 111 1234567 890 123 RS CGACCCC TGT ATC SEC CGACCCCCCTGTCATC To name the insertions in the Population Genetic Nomenclature you must indicate the base position in which the insertion has occurred and the bases that are inserted preceded by letter In the above example haplotype would be SEC1 7iCC 10iC For the Forensic Genetic Nomenclature insertions are independently named by first noting the site immediately to the insertion followed by a decimal point and a T for the first insertion a 2 if there is a second base inserted and so on and then by the nucleotide that is inserted In the above example haplotype would be 7 1C 7 2C 10 1C Carracedo et al 2000 b Deletions as deletions remove one or more nucleotides from the DNA it is necessary to introduce gaps into the studied sequence to maintain the alignment 0000000001111 1234567890123 CRS CGACCCCTGTATC un EC1 CGACC TGT TC To designate deletions in the Population Genetic Nomenclature you have to write the first base position of the gap and the bases that are deleted preceded by letter d In the above example haplotype would be SEC1 6dCC 11dA For the Forensic Genetic Nomenclature deletions should be recorded by listing the missing sites followed by a del In the example it would be
13. ion or matches between populations require haplotype data On the contrary others such as genetic diversity calculations are designed for nucleotide sequences In all cases although some data analysis software allow you to use both formats like Arlequin Excoffier and Lischer 2010 the transformation between them is usually needed as published mtDNA results could alternatively appear in both types HaploSeach software transforms haplotype and sequence data between them in a quick and easy way allowing a fast and reliable data comparison This program admits both partial and complete mtDNA sequences and recognises substitution mutations transitions and transversions heteroplasmies and indels insertions and deletions Although HaploSearch was designed to analyse mtDNA sequences it is suitable for transforming haplotypes and sequences in any kind of DNA sources The program only requires a reference sequence from which extract the information as occurs with the revised Cambridge Reference sequence CRS for mtDNA Andrews et al 1999 2 DATA FORMAT 2 1 Sequences Sequences must be introduced into the commonly used fasta format following the IUPAC code Cornish Bowden 1985 Using this format in HaploSearch allows you to obtain the complete and partial mtDNA data directly from the main databases as GeneBank mtDB To be correctly analysed all sequences have to be equal in length so they have to be previously aligned with
14. number small size 216 500 bp and higher mutation rate than nuclear DNA Furthermore mtDNA is maternally inherited without recombination allowing for the reconstruction of the evolutionary history of populations Ballard and Whitlock 2004 In 1981 the complete sequence of the human mtDNA was published for the first time Anderson et al 1981 Since that populations from almost everywhere have been studied from the mtDNA point of view The comparison of these large sets of mtDNA data have allowed to construct a robust phylogenetic tree Torroni et al 2006 van Oven and Kayser 2009 and to estimate the global distribution and origin of each human mtDNA lineage Cann et al 1987 Ingman et al 2000 Maca Meyer et al 2001 Richards et al 2000 MtDNA analysis has also become an useful tool in forensic genetics as its mode of inheritance allows testing for a putative exclusion scenario in human identification On the other hand when only very limited or severely degraded DNA is present in a sample mtDNA constitutes the last chance for successful DNA typing Parson and Bandelt 2007 However published data comparison is frequently complicate as mtDNA results could appear in two different formats haplotype detected mutations respect to a reference sequence and nucleotide sequence data Manual transformation between formats is time consuming complex and likely to introduce mistakes Moreover some data analyses like haplogroup classificat
15. ocumentos Departamento Ariculos nuestros Examinar Operation O cet haplotype O cet sequence Nomenclature O Population Genetics Genetics Process Sent data will not be stored in our servers And finally press Process Haplosearch O Resources Opciones Through the next form you can get haplotypes or sequences Input file DAMis documentosiDepartamento Art culos nuestros Examinar Operation Get haplotype O Get sequence Nomenclature O Population Genetics Forensic Genetics Sent data will not be stored in our servers 17 If the input data file is correct the output data file will be ready in a very short time LIAR IMA A Abriendo haplotype txt Login Bi Ha escogido abrir Haplosearch Resources haplotype txt que es de tipo Documento de texto de http beta haplosite com Qu deber a hacer Firefox con este archivo O Abrir con WORDPAD EXE Y Guardar archivo El Hacer esto autom ticamente para estos archivos a partir de ahora a L sale Cancelar Operation O cet haplotype O Get sequence Nomenclature Population Genetics Forensic Genetics Process Sent data will not be stored in our servers When the input data file has some format mistakes an error message will appear indica
16. orensic Genetics nomenclature As recommended by the EMPOP database deletions are named as del in HaploSearch see Indels section in Chapter 2 However Carracedo et al 2000 recommends the use of d instead of del For this reason there is the possibility of using d in HaploSearch In this case it is extremely important to use D for the heteroplasmy consisting of a mixture of A G and T following IUPAC code and d for deletions See the example For implementing this feature in HaploSearch you only have to place a d next to the start number For example If you use the current notation START 16090 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 TAT TCGTACATTACTGCCAGACACCDTGA The output would be START 16090 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 16093del 16111A 16116D 14 In other hand if you add the letter d to the start number START 16090d gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEOl TAT TCGTACATTACTGCCAGACACCDTGA The output would be START 16090 gt CRS TATTTCGTACATTACTGCCAGCCACCATGA gt SEQ1 16093d 16111A 16116D This feature is only possible for Forensic Genetic Nomenclature 6 HAPLOSEARCH INTERFACE Using HaploSearch interface http www haplosite com haplosearch is simple and intuitive To run HaploSearch you have to select Process in Topics box ZA MANO ae Haplosearch Resources
17. ting the origin of the error If an unexpected error occurs pleased contact us See below some examples GE nmo Haplosearch Resources Haplosearch gt Process Through the next form you can get haplotypes or sequences The submitted file is empty Input file 1 Examinar Operation O Get haplotype o Get sequence Nomenclature O Population Genetics Forensic Genetics Process Sent data will not be stored in our servers 18 SAL HAPLOSITE Home Haplosearch Resources Haplosearch gt Process Through the next form you can get haplotypes or sequences This field is required Input file Examinar Operation O Get haplotype Get sequence Nomenclature Population Genetics Forensic Genetics ty Sent data will not be stored in our servers 7 A HAPLOSITE O Home Haplosearch O Resources Syntax error on input file i Back 7 A HAPLOSITE O Haplosearch O Resources Base position is not defined on input file Back 19 7 REFERENCES Anderson S Bankier AT Barrell BG de Bruijn MH Coulson AR Drouin J et al 1981 Sequence and organization of the human mitochondrial genome Nature 290 5806 457 465 Andrews RM Kubacka Chinnery PF Lightowlers RN Turnbull DM Howell N 1999 Reanalysis and revision of the Cambrid
18. tion Table 1 TABLE 1 The IUPAC nucleotide code Cornish Bowden 1985 IUPAC nucleotide code Base Adenine Cytosine Guanine Thymine AorG CorT GorC AorT GorT Aor C CorGorT AorGorT AorCorT AorCorG any base Z lt TOIOZ AS M lt IDA c For both haplotype formats they are designated by the nucleotide position and the corresponding IUPAC nucleotide code 0000000001111 1234567890123 Q RS CGACCCCTGTATC ECL CGACCCTTGTKTC un Thus haplotype would be SEC1 11K showing that SEC1 has heteroplasmy in position 11 where nucleotides G and T are present Indels The term indel includes insertions and deletions as these two types of genetic mutation are often considered together because of the inability to distinguish between them when comparing two sequences This problem does not exist when sequences are compared with a reference insertions add one or more extra nucleotides into the DNA in respect to the reference and deletions remove one or more nucleotides from the DNA compared with the reference sequence Due to indels the sequences have to be aligned before using HaploSearch in order to designate a correct haplotype To perform the alignment it is recommended to use alignment programs as ClustalW htto www ebi ac uk Tools clustalw2 index html a Insertions as insertions add one or more extra nucleotides it is necessary to
Download Pdf Manuals
Related Search