Home
HMPL User Manual - Case Western Reserve University
Contents
1. Process _ Thread Input Data Vv Select CG site greater than the coverage value Vv Identify Hemi methylated CG sites by the high and low cut off values Vv Add annotation for HM sites Vv Identify Singleton GO and clusters G1 G2 G3 Identify reverse clusters G2 G3 and non reverse clusters G1 from all clusters G1 G2 G3 Vv Identify consecutive reverse G2 and non consecutive reverse G3 from all reverse clusters G2 G3 by using initial input and all reverse clusters G2 G3 All HM sites Singletions GO non reverse clusters G1 consecutive reverse pairs G2 non consecutive reverse pairs G3 Output Figure 4 Detailed explanation of each Process Thread Note the HMPL manuscript Figure 1B is an example polarity or reverse cluster The polarity type cluster is generated as the G2 and G3 clusters as shown in the above Figure 4 The G2 polarity cluster only includes two consecutive CpG sites that have a polarity or reverse hemimethylation pattern while G3 polarity cluster consists of two CpG sites that are not consecutive these two CpG sites are hemimethylated and close to each other but there is a non hemimethylated CpG site between them The HMPL manuscript Figure 1 A and C are examples of clusters that are different from Figure 1B and these clusters are generated together as the
2. q represents the quality score threshold of bases L specifies the smallest value of the range of base quality scores in ASCII representation 64 for illumina format FASTQ file and 33 for sanger format FASTQ file and m is the number of allowable internal N s 2 3 2 2 2 BRAT trim output There are a few parameter options that are discussed in the BRAT user manual and the specific parameters we have implemented are briefly described in the source code notes However the output file that is important for the progression of the pipeline will be labeled prefix_reads1 txt and a sample is shown below in box 3 Box 3 prefix_reads1 txt GGGTTTGGTGGTTGGTATTTGTATGTAATITTAGTTATTTGGGAGGTTG 1 0 ATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAGCGGAAGAACGGCGTAC 1 0 ATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAGATCGGTTCAT 1 0 In the above sample output the first column contains the data from the second line of each FASTQ read followed by the number of bases trimmed at the 5 end and the 3 end in the second and third columns respectively 2 3 2 3 Fixed Trim i e trimming off fixed number bases An alternative to BRAT s dynamic trimming function is a standard fixed trimming option we have included in the pipeline While utilizing this option the user has direct control over how many bases to trim from the 5 end and the 3 end Note These options are listed under global variables in the source code and the user only has to ed
3. 53238 147974 8505 3370 Sample HM Singleton Clusters CG_in_clusters MCF10A 6712 3353 1666 3359 The basic summary of the Hemimethylation cluster size is Min Ist Qu Median Mean 3rd Qu Max 2 000 2 000 2 000 2 016 2 000 6 000 The quantile summary of the Hemimethylation cluster size is 0 50 90 95 99 100 2 00 2 00 2 00 2 00 2 35 6 00 The pattern frequencies summary cluster_pattern Freq 1 MMMMMM UUUUUU 1 2 MMMMM UUUUU 1 3 MMM UUU 1 4 MM UU 8 5 MMU UUM 2 6 MUM UMU 1 7 MUMU UMUM 2 8 MU UM 1627 9 UM MU 3 10 UMU MUM 3 11 UU MM 11 12 UUU MMM 4 13 UUUU MMMM 1 14 UUUUU MMMMM 1 2 4 3 3 Common CpG sites and Clusters in both two inputs If the user has provided two inputs i e 1 input1 2 input2 the Parse HMPL pl would provide five additional output files with suffices compare and the output files of Parse HMPL pl are explained in Table 4 Box 11 HHHHH Summary common HM lines for home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters and home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters 8 HemiMethylated lines in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters but not HemiMethylated in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters 16 HemiMethylated lines in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters but no coverage in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters 12 HemiMethylate
4. 63004 63004 CHH 0 0 chr5 63005 63005 CHH 0 0 chr5 63006 63006 CHH 0 0 CG type the CG type of a cytosine site whether it is CpG site or a nonCpG site 10 strand chromosome strand or Note that the header of the sample was added in this document for clarification and the output files of the acgt count have been well sorted by the BRAT bw software 2 3 4 Convert Select CpG sites and Combine Remaining steps are to convert the output of acgt count from O based to 1 based offset select only the CpG sites and then combine the forward and reverse strands as the final output The final output is illustrated in box 2 of section 2 2 2 The output files of Pre HMPL pl are explained in Table 3 Table 3 Description of output files from Pre HMPL pl File name Contents CG The final output of CpG files the non CpG sites have been already screened out forw txt The file of all acgt sites of forward strand rev txt The file of all acgt sites of reverse strand readsi txt The trimmed FASTQ reads for BRAT bw reads2 txt Another trimmed FASTQ reads for BRAT bw if the inputs are pair end FASTQ data matesi txt The file contains reads from the input file whose mates have shorter length after trimming mates2 txt The file contains reads from the paired input file 2 whose mates have shorter length after trimming brat mapping results The BRAT bw Mapping resu
5. G1 cluster as shown in the above Figure 4 In order to make the above explanation clear the HMPL manuscript Figure 1 is given below A Hemimethylation on same strands B Polarity hemimethylation m pa M M M M U C2G C2G C2G CG CG 5 ee 3 Ci GC GC GC GC Gc U U U U M C Hemimethylation on different strands M U U M U M CG CG CG cG CG CG 5 3 3 Fe pe ye ya ope gt GC GC GC GC GC GC U M M U M U HMPL manuscript Figure 1 Examples of hemimethylation patterns M and CG represent a methylated site U and CG represent an unmethylated site A is an example of hemimethylation occurs on the same strand B is an example of polarity or reverse hemimethylation pattern with only two C G sites C is an example of hemimethylation on different strands with more than two C G sites 1 2 Installation Perl recommend v5 8 8 or later R recommend v2 13 0 or later and Python 2 6 are required on the user s system Then the user can simply download the HMPL package and once unzipped it is ready to go because FastQC BRAT bw and cutadapt are already pre compiled in the HMPL resources folder After downloading and unzipping the HMPL zip users can obtain the following folders and files 1 README file Includes detailed information about the HMPL package and example scripts File name README txt amp README pdf which have the same content 2 HMPL user manu
6. files which includes uncombined methylation levels If it is uncombined that means the methylation levels on the forward and reverse strands are in two files and they should be separated by comma when providing them as input files e g 1 MCF7 CG forward MCF7CG reverse 2 lt file gt Input file 2 optional If specified the pipeline will process both inputs and compare their final results Default is only to process the input file 1 and not to do the comparing Note For both Input 1 and Input 2 the user can enter two kinds of inputs as explained in the above row o lt dir gt The output directory where all the output files are created and written Default is lt current_dir gt final results c lt int gt The value for selecting the methylation coverage is greater than B Default B 0 On each strand there must be at least B reads to cover a specific C G site in order for HMPL to check if it is hemimethylated Changing the c value from a smaller value e g c 5 to a larger value e g c 10 will obtain a shorter list of hemimethylated sites and have a smaller false discovery rate I lt real gt The cutoff value for selecting low methylation level Default 0 2 range 0 05 0 4 This value corresponds to the Lo mentioned in Step 4 of the pipeline If the methylation level is less than this I value it will be claimed as unmethylated Changing I value fro
7. mcf10a 5m fastq home projects data reference hg19 chr22 fa home projects data reference hg19 refGene txt HHH HH 2 create the reference genome file hg19 chr22 txt using only chr22 in order to align and acgt count only to one chromosome chr 22 This file hg19 chr22 txt only saves the location of chr22 fa The following two scripts files are examples we used The user need to change chr22 fa path from home projects data reference hg19 to your own path name HE HE H H echo home projects data reference hg19 chr22 fa gt hg19 chr22 txt 16 more hg19 chr22 txt home projects data reference hg19 chr22 fa HHHHHHHHHHHAHHAHAHHAHHH HEAR 3 run HMPL part time perl home pxl119 HMPL_new code Pre HMPL pl 1 mcfl0a 5m fastq p MCF10A 5m chr22 r hg19 chr22 txt amp gt MCF10A 5m chr22 screen info txt The following is running time real 9m20 663s user 11m44 562s sys 1m30 170s EHH HH 4 run HMPL part II time perl home pxl119 HMPL_new code Parse HMPL pl 1 home pxl119 2015 6 6 HMPL QA CG file MCF10A 5m chr22 CG r home projects data reference hg19 refGene txt o MCF10A_5m_chr22 amp gt MCF10A 5m chr22 partll screen txt The following is running time real Om9 583s user Om9 289s sys Om0 295s Note 1 in the above script the user may need to change the code path from HH home pxl119 HMPL_new code to your own path name Note 2 the user also needs to provide a path for mcf
8. will be used as inputs for the remaining steps 2 2 2 Combined CpG Sites Input File the initial input for Parse HMPL pl see section 2 1 2 The file with combined CpG sites as input is produced using the acgt count function in the BRAT bw software package The sample file shown in box 2 has 8 columns without header The 1 4 columns are the chromosome names positions coverage and methylation for the forward strand The 5 8 columns are the chromosome names positions coverage and methylation for the reverse strand Box 2 forward strand reverse strand chr position coverage methyl chr position coverage methyl chr10 50089 20 0 1 chr10 50089 10 0 9 chr10 50109 0 0 chr10 50109 0 0 chr10 50140 0 0 chr10 50140 0 0 chr chromosome name position chromosome position of a cytosine site values in 1 based offset coverage number of reads methyl this column displays the methylation data that the bisulfite rate is based on i e bisulfite rate 1 methylation ratio forward strand forward chromosome strand reverse strand reverse chromosome strand Note that the header of the sample was added in this document for clarification The input has been well sorted in the original output 2 3 Pre HMPL pl Hemimethylation preprocessing pipeline 2 3 1 FastQC FastQC is already detailed online so this section will only briefly describe the input and output for this step of the pipe
9. you have If you do not have Perl then you can download the latest version from http www perl org get html e R Installed on system you can download R from http www r project org e Python2 6 Installed on system you can download the Python2 6 environment from http www python org download releases 2 6 e The user will also need a reference genome to do alignment 3 2 Running Time For the MCF10A and MCF7 datasets each has about 50 million raw sequencing reads Using the Linux server with dual quad core 2 66Ghz Xeon E5430 processor that has 4GB RAM for each core it takes about 4 hours in fact 250 270 minutes to run the Part the preprocessing part of HMPL pipeline Pre HMPL pl if the reference index is provided If the index is not provided it would take about 3 to 4 additional hours to build index As for the Part Il of HMPL that is the parsing pipeline Parse HMPL pl it would take 19 minutes for each uncombined input with default coverage If the users have a faster Linux server or cluster that has more memory it will take much less time e g just a couple hours to run the HMPL preprocessing pipeline Pre HMPL p and it will just take a few minutes to get the results of parsing and comparing two samples using HMPL Part II Parse HMPL pl 4 References 1 Gillespie T Effective perl programming Library Journal 1998 123 4 121 121 2 R Core Team R A language and environment for statistical compu
10. 00 bp on a chromosome the promoter region of this gene is defined as from X D 4 000 to X 5 000 Note the r options in the Pre HMPL and Parse HMPL pl are different and this difference is explained below 1 For the r in Pre HMPL pl e g r home s_s355 tsu research data reference hg19 hg19 fa filename txt the contest in hg19 fa file name txt is like home s_s355 tsu research data reference hg19 chr10 fa home s_s355 tsu research data reference hg19 chr11 fa 2 For the r in Parse HMPL pl e g r emer s355 tsu research data reference hg19 refGene txt it is like 585 NR_026818 chr1 34610 36081 36081 36081 3 34610 35276 35720 35174 35481 36081 0 FAM138A unk unk 1 1 1 585 NR_026820 chr4 34610 36081 36081 36081 3 34610 35276 35720 35174 35481 36081 0 FAM138F unk unk 1 1 1 2 2 Initial Input 2 2 1 FASTQ Input File The FASTQ input file contains the raw data that will be analyzed in the upcoming steps A sample of a FASTQ formatted file is shown below Box 1 FASTQ input file 1 read methy MCF10A SRRO97806 1 HWW EAS217_0007 6 2 0 815 length 50 NGGTGTITITITGGGTTTTAGTAGTTNNGGTTCGTGGTTAGTNNGATTITGT methy MCF10A SRRO97806 1 HWW EAS217_0007 6 2 0 815 length 50 9768 8547 989526 HHHHHHHHHH AHHH HHH With FASTQ format there should be 4 lines attributed for every read The FASTQ input file is the direct input for Steps 1 and 2 and from there the output files produced
11. 10a 5m fastq if it is HH not in the current working directory path Note 3 the user also needs to replace the refGene txt path from HH home projects data reference hg19 to your own path folder name Note 4 home pxl119 2015 6 6 HMPL QA CG file is the location of the HMPL part I output folder HEHEHE 5 Final output directory part I output home pxl119 2015 6 6 HMPL QA CG file part Il output home pxl119 2015 6 6 HMPL QA MCF10A_5m_chr22 In addition in order for users to explore the different options and arguments of HMPL we have prepared an example script file named README txt and README pdf In this README file we have provided example scripts of running HMPL and explained what to expect in the screen output which will help users with trouble shooting In addition we have also given detailed explanation of the code and input folder The example script file i e README txt or README pdf is included in the HMPL zip file that can be downloaded from the following web link http hal case edu sun HMPL HMPL zip Once users unzip the HMPL zip they will be able to find this file 17 3 Additional Notes 3 1 System Requirements To run the HMPL pipeline the user will need the following software packages and environment e A Unix or Linux environment e Perl Installed on system in many cases Perl comes pre installed in Linux and Mac systems so please enter perl v to see what version
12. 2 Part II shows how to parse the large amount of data and identify hemimethylation patterns see Figure 3 The detailed information of Process Thread used in Figure 3 is explained in Figure 4 Step 1 Assess sequencing qualities using FastQC Step 2 Trim sequencing data Part I Preprocessing Step 3 Align reads using BRAT bw and obtain methylation ratios at all cytosine sites Step 4 Identify hemimethylated patterns and compare these Part I patterns in two samples Parsing Step 5 Provide genetic annotation and report findings Figure 1 Workflow of the Hemimethylation Pipeline HMPL Assess sequencing qualities using FastQC Adaptor Trimming Fixed Length Trimming Dynamic Trimming Align sequencing data using BRAT ACGT count Convert the position from 0 based offset to 1 based offset Select the CG sites Combine the forward and reverse strands Figure 2 HMPL workflow Part I Get the input options One input sample Two input et Initialize two Process_Threads y Process Process Thread 1 Process_Thread 2 Sample 1 Processing Processing sample 1 sample 2 y Wait for all threads to finish Compare the two samples EndofHMPL Figure 3 HMPL workflow Part II
13. HMPL User Manual Shuying Sun ssun5211 yahoo com or s_s355 txstate edu Texas State University Peng Li pxl119 case edu Case Western Reserve University June 18 2015 Contents 1 General Overview and Installation 1 1 General Overview 1 2 Installation 2 Pipeline Walkthrough 2 1 Usage 2 2 Initial Input 2 3 Pre HMPL pl Hemimethylation preprocessing pipeline 2 4 Parse HMPL pl Hemimethylation data parsing pipeline 2 5 Testing HMPL using a small dataset and example scripts in the README file 3 Additional Notes 3 1 System Requirements 3 2 Running Time 4 References 11 16 18 18 18 18 1 General Overview and Installation 1 1 General Overview The HMPL HemiMethylation PipeLine is meant to assist the user in identifying hemimethylated HM CpG sites and clusters for each of the two different samples e g cancerous vs normal individuals and then compare them It achieves this goal by utilizing efficient Perl and R scripts to align raw reads and then parse the data and summarize the final results To execute this process the user enters a command line in a Unix Linux environment and then the pipeline will begin to update the user with the overall progress of the tasks By the end of the process the user receives output files The workflow of the HMPL is explained in two parts see Figure 1 Part shows how to preprocess sequencing reads e g quality assessment and sequencing alignment see Figure
14. KRD30BL MIR663B chr6 151704347 151704394 151704424 MUM UMU 30 21 22 31 8 17 0 966667 0 0 0 967742 1 0 MUM UMU 25 35 15 47 12 27 0 88 0 0 0 829787 0 916667 0 037037 AKAP12 NA chrY 10644075 10644103 MM UU 11 13 11 21 1 0 0 909091 0 am MM UU 21 11 21 13 0 904762 0 1 0 NA NA Table 4 The description of output files of Parse HMPL pl File names Contents orx The CpG sites with coverage greater than X all HM sites The hemimethylated CpG sites identified by the high and low cut off values all HM sites annotated The annotated hemimethylated sites i e gene names are provided all labelled CG The CpG sites with coverage greater than X and with the labels of methylation states P partially methylated M methylated U unmethylated Summary The summary file for all the methylation states of single hemimethylation sites and clusters all HMClusters All hemimethylated clusters all Rev Clusters All of the polarity or reverse clusters including both consecutive and non consecutive polarity clusters non Rev Clusters G1 The hemimethylated clusters that are not polarity patterns Singleton GO Single hemimethylated CpG sites consec revs Clusters G3 The consecutive polarity or reverse clusters i e with just two consecutive CpG sites non consec revs Clusters The non consecutive polarity clusters i e with two CpG sites that are not consecutive G2
15. al pdf The HPML user manual 3 code folder Includes all R and Perl code files 4 resources folder Includes all available software packages 5 test HMPL A test dataset with 5 million reads human chromosome 22 reference gene file and scripts The test data 5 million sequencing reads can be downloaded from the following web link http hal case edu sun HMPL mcf10a 5m fastq zip It is 1 2 GB after unzipping 6 MCF7 532gene ge3HM txt 532 genes that have 3 hemimethylated sites in the MCF7 sample More detailed information about these folders and files are given in the above README file We demonstrate the use of HMPL using two publicly available bisulfite treated methylation sequencing datasets for the two cell lines MCF10A and MCF7 in section 2 In this user manual we mainly show the results of getting hemimethylation patterns for MCF10A and the results of comparing MCF10A with MCF7 are shown in the Results section of the manuscript 2 Pipeline Walkthrough 2 1 Usage 2 1 1 Using the preprocessing pipeline part Pre HM Pipeline pl The Part pipeline runs the preprocessing analysis as shown in section 1 1 with the following usage and options Table 1 perl lt the_diretory_of HMPL gt code Pre HMPL pl 1 lt FASTQ_input_file gt p lt prefix gt r lt reference_name gt OPTIONS Table 1 The command options of HMPL Part I Pre HMPL pl Options Explanation 1 lt file gt Requi
16. compare The results of comparing two samples 2 5 Testing HMPL using a small dataset and example scripts in the README file In order to make it easy for users to test the HMPL we have prepared a small dataset with 5 million reads a FASTQ fastq file the human chromosome 22 reference sequence a FASTA fa file and the example scripts to run this small methylation dataset by aligning it to chromosome 22 and identify hemimethylated sites using both Part and Part Il of HMPL The user simply needs to download the data install the HMPL package and then change the data path directory in the example script accordingly to be able to run the HMPL It only takes 11 minutes to run this small dataset using a Linux computer with 4 GB RAM The 5 million read small dataset human chromosome 22 and the example script are included in a folder named test HMPL Once users 15 download the HMPL zip file from the web link http hal case edu sun HMPL HMPL zip and unzip it they will be able to see this test HMPL folder This folder includes the following files 1 Test data txt explains how to download the small dataset of 5 million sequencing reads file name mcf10a 5m fastq In fact the test data 5 million sequencing reads can be downloaded from the following web link http hal case edu sun HMPL mcf10a 5m fastq zip It is 1 2 GB after unzipping 2 Related genome reference files file name chr22 fa and refGene tx
17. d lines in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters but not HemiMethylated in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters 21 HemiMethylated lines in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters but no coverage in home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters 53 HHHHH 14 common HM lines for home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF10A gr5 non Rev Clusters and home pxl119 8 10 2013 MCF10 MCF7 gr5 MCF7 gr5 non Rev Clusters chr12 131845661 131845705 131845749 131845792 MUMU UMUM 71 30 45 34 21 21 15 24 0 915493 0 0 0 970588 0 952381 0 0 1 il MUMU UMUM 88 55 55 56 28 27 13 28 0 988636 0 0363636 0 0181818 0 982143 0 964286 0 0 0 928571 ANKLE2 NA chr19 2082837 2082839 2082848 UUU MMM 32 34 32 34 32 38 0 03125 0 970588 0 03125 1 0 03125 1 UUU MMM 22 27 22 29 22 30 0 1 0 0 965517 0 0 966667 AP3D1 NA chr19 38979454 38979463 UU MM 20 9 12 9 0 1 0 1 ane UU MM 28 9 20 9 0 1 0 0 888889 NA KCTD15 chr1 9181489 9181519 9181565 UMU MUM 9 12 18 31 9 34 0 0 916667 1 0 0322581 0 0 911765 ve UMU MUM 16 13 19 31 10 37 0 0 923077 0 947368 0 0322581 0 0 891892 NA NA chr2 53940411 53940424 53940473 UMU MUM 17 26 27 35 24 40 0 1 1 0 0571429 0 0833333 0 925 UMU MUM 16 23 39 56 29 61 0 1 1 0 0357143 0 0689655 0 967213 GPR75 GPR75 ASB3 NA chr2 132731365 132731375 MM UU 53 123 53 121 0 981132 0 0162602 0 962264 0 X MM UU 63 155 62 155 0 920635 0 0 951613 0 AN
18. ecutive reversed clusters Only the first one has the last two additional columns as shown in Box 10 The output files with suffices summary is the summary of HM sites and clusters for this input It includes four kinds of information separated by two new lines as shown in box 10 The first table summarizes the number of M U and P in each strand and the number of each combination of M U and P in both strands all_CG_gr5 indicates the number of all the CpG sites which has the coverage greater than 5 The 5 was specified by the user HM the number of all the hemimethylated CpG sites MU the number of all the hemimethylated CpG sites that are methylated in the forward strand and unmethylated in the reverse strand UM the number of all the hemimethylated CpG sites which are unmethylated in the forward strand and methylated in the reverse strand Singleton hemimethylated CpG sites exist as singletons 13 Clusters the number of HM clusters CpG _sites_as_in_clustering the number of CpG sites existed in all the clusters Two summaries of the HM cluster sizes basic summary and the quantile summary are generated as shown in the example in box 10 Here the HM cluster size means the number of CpG sites in a cluster The last part of box 10 summarizes the frequencies of all HM state patterns of clusters Box 10 Sample M U P M U P UU UP UM MCF10A 73558 159849 53027 73501 159695
19. it the value corresponding to each variable to set the fixed trim The input and the output for the fixed trim option are the same as the input and output for BRAT bw alignment so see section 2 4 1 for more information Please note that it is good to use this trimming option if users know exactly how many bases they want to trim off and no adapter sequences have been trimmed yet However if the users have already trimmed the adapter sequences then the reads length varies and it is NOT good to use this trimming option any more 2 3 3 BRAT bw Alignment and ACGT count 2 3 3 1 BRAT bw BRAT bw handles the alignment of the data The input is the output from Step 2 and the output will be labeled brat a sample of which is shown below in box 4 For more information see the BRAT bw user manual Box 4 trim single 1M brat 1 CGGGGAGTTAGCGTGAGAGGGGGGTTGGGTTAGTTAGTGTTCTTTTTTIT chr2 3296772 1 3296771 TGGGAAATTATAATGAGATTTGGTTTTCGAGAGTATT chr2 74594669 0 74594669 13 TGGGTTTAAGTAATT TGTTTTAGTT AAGTAGTTGAGATC chr2 45050947 0 45050947 2 3 3 2 acgt count The input for this part of the pipeline is a bit unusual Even though it utilizes the output from BRAT bw the input that is supposed to be included in the execution is actually a one line file containing the name of the output from BRAT bw The output of acgt count is illustrated below in box 5 Box 5 chr start position end position CG type Coverage methyl Strand chr5
20. line For more information the documentation for the FastQC software is located at www bioinformatics bbsrc ac uk projects fastqc The input for the FastQC software is a FASTQ file This will be the initial input for the complete pipeline The output for the FastQC software will be packaged in a zip folder in the output directory 2 3 2 Trim 2 3 2 1 Adapter Trimming An adapter trimming algorithm removes adapter sequences from high throughput sequencing data The user will be able to utilize the adapter trimming tool cutadapt to trim off adapter sequences The user could also opt to skip the adapter trimming by entering a string NO note that the default setting is no adapter trimming For more information on cutadapt the user can visit the website code google com p cutadapt For adapter trimming pair end data the pipeline would compare the pair end data and choose the reads in both pairs after the adapter trimming 2 3 2 2 BRAT Trim Documentation on the BRAT trim function can be found in the BRAT user manual which can be found at http compbio cs ucr edu brat 2 3 2 2 1 BRAT Trim input The input file for BRAT trim is the initial FASTQ file used in Step 1 of the pipeline Although detailed information can be found in the BRAT user manual we will briefly describe some of the default parameter settings in the pipeline as demonstrated in script line 3 Script Line 3 trim s SARGV O P Spref q 1 L 64 m 2 In this command
21. lts 2 4 Parse HMPL pl Hemimethylation data parsing pipeline The data parsing steps are developed by our research team and as such will contain more detail regarding input output parameters as well as a description for each step and sub step 2 4 1 Data Parsing Input The input for hemimethylation data parsing pipeline is described in section 2 2 2 2 4 2 Data Parsing Description The first step for hemimethylation data parsing pipeline is to select the CpG sites that have the coverage greater than a pre determined coverage value The next step is to identify the hemimethylated CpG sites by examining the methylation level and some HM CpG sites would be identified as clusters if their mutual distances are less than the specified distance The pipeline would also summarize the clusters length In our pipeline the polarity or reverse hemimethylation clusters would also be identified Here polarity or reverse clusters mean that the clusters have the following features for two or several consecutive CpG sites if they have reversed hemimethylation pattern That is if one CpG site is methylated in the forward strand and unmethylated in reverse strand and its consecutive CpG sites is unmethylated in forward strand and methylated 11 in the other strand or vice versa then these two CpG sites would be identified as a polarity or reverse cluster as shown in box 6 Box 6 Chromosome Methylation State Cove
22. m a smaller value e g I 0 1 to a larger value e g 1 0 2 may give a longer list of hemimethylated sites but there may be a larger false discovery rate h lt real gt The cutoff value for selecting high methylation level Default 0 8 range 0 6 1 This value corresponds to the Hy mentioned in Step 4 of the pipeline If the methylation level is greater than this h value it will be claimed as methylated Changing h value from a smaller value e g h 0 7 to a larger value e g h 0 9 may give a shorter list of hemimethylated sites but there may be a smaller false discovery rate d lt int gt The maximum distance between two C G sites to be selected as a cluster with default 50 If the maximum distance is changed from a smaller value e g d 50 to larger value e g d 100 the number of C G sites in a cluster will be larger but the total number of hemimethylation clusters will become smaller r lt file gt The reference gene file not the genome reference sequence files This file is used to provide genetic annotation i e gene names to the hemimethylation sites For example we set it as r home reference hg19 refGene txt This refGene txt file contains the gene names and gene information downloaded from the UCSC genome browser D lt int gt The distance of promoter region Default D 1000 That is if the transcript starting position is located at X 5 0
23. ojects data reference hg19 chr11 fa oy f lt sanger or illumina gt FASTQ format HMPL accepts sanger or illumina format FASTQ files as input data default is sanger a lt yes or no gt Adapter trimming Users can select whether or not to utilize cutadapt for adapter trimming default is no adapter trimming A lt stirng gt Adapter sequences HMPL accepts two adapter sequence inputs separated by a comma and default is AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT T lt fix or brat gt Quality trim flag Specifies whether to use BRAT dynamic trimming function default is BRAT trim or the user can specify fix to apply fixed quality trimming i e trim off a fixed number of bases N lt int gt Fixed quality trimming Specifies the number of bases to be trimmed at the 5 end default is 5 n lt int gt Fixed quality trimming Specifies the number of bases to be trimmed at the 3 end default is 10 Q lt yes or no gt Whether or not to do the quality assessment using FastQC default is no I lt dir gt The index directory for BRAT bw alignment If the index folder is provided it will be automatically used Otherwise it will build index which is the default setting i lt positive To specify minimum insert size for paired end mapping the minimum distance allowed between the integer gt leftmost ends of the mapped mates on the fo
24. rage Methylation Ratio positions chr10 346512 346558 MU UM 20 30 18 33 1 0 0 0 939394 chr10 861689 861694 MU UM Delp ek 1 0 0 1 chr10 1272632 MU UM 12 46 13 58 1 0 0 0769231 0 896552 1272681 chr10 1576754 MU UM 2A G2 sil Pee Oe 1576787 After the identification steps described above the pipeline would provide annotation for those identified clusters and single sites There are two kinds of information provided as the annotation gene information and gene promoter information The gene names would be annotated for each singleton or clusters if the singleton or cluster is in the range of the gene For the specified distance L e g L 500 bp the promoter information is provided as follows 1 For positive strands if the single HM site or cluster is in the range interval of txtStart L txtStart of a gene where txtStart is the transcription starting position of this gene then the gene s name would be annotated as the promoter That is this CpG site is located at the promoter region of this gene 2 For negative strands if the single HM site or cluster is in the range interval of txtEnd txtEnd L of gene where txtEnd is the transcription ending position of this gene then the gene s name would be annotated as the promoter If the user has provided two input files to our data parsing pipeline then after all the previous steps the pipeline would compare the two inputs and find the common and different HM CpG site
25. red FASTQ format single end input file or pair end input file 1 e g 1 MCF7 fastq which is the file name of a fastq dataset 2 lt file gt FASTQ format pair end input file 2 By default when there is no input 2 it only processes the input file 1 and processes it as a single end file o lt dir gt The output directory The default output directory is the user s current directory For example if the current directory in which the user runs HMPL is home user check folder then when running HMPL command line without specifying o the user would have all the output files in nhome user check folder p lt string gt Required The prefix written to the output file names e g p MCF7 then the output file will have the prefix MCF7 e g MCF7 site or MCF7 cluster r lt file gt The name of the file that lists the genome reference sequence i e fa files that users will use to do alignment Please note that this r option must be provided whether or not the i e alignment index option is provided Otherwise the acgt count function in the BRAT bw package will not generate proper output files For example we set it as r home reference hg19 hg19 fa filename txt This hg19 fa filename txt may include the following lines that show the location of the fasta files for chromosomes 10 and 11 or other chromosomes as shown below home projects data reference hg19 chr10 fa home pr
26. rward strand default is 0 m lt positive To specify maximum insert size for paired end mapping the maximum distance allowed between the integer gt leftmost ends of the mapped mates on the forward strand default is 1000 The preprocessing pipeline ties the software and source code together with the appropriate dataflow to ensure correct output is achieved At this point users need to have Perl Python2 6 R FastQC and BRAT bw software installed on their system and be able to enter commands in a Unix Linux environment The initial FASTQ input files will be discussed in section 2 2 The output directory is the current path or the path specified by the user where the output files will be written 2 1 2 Using the parsing pipeline part II Parse HMPL pl If the user has finished the hemimethylation preprocessing pipeline and has obtained the files of combined CpG sites s he may only run the parsing analysis using our Parse HMPL pl pipeline with the following usage and options listed in Table 2 perl lt the_diretory_of_HMPL gt code Parse HMPL pl 1 lt input 1 gt OPTIONS Table 2 The command options of HMPL Part II Parse HMPL pl Options Explanation 1 lt file gt Input file 1 is required Note For both Input 1 and Input 2 see next row the user can enter two kinds of inputs One is the combined methylation level data e g 1 MCF7 CG combine and the other is the acgt count output
27. s singletons and clusters and then summarize the comparison information in a text file 2 4 3 Data Parsing Output 2 4 3 1 Hemimethylation CpG sites Output The output files with the suffices all HM sites are the text files containing all HM CpG sites identified by high and low cut off values and a sample output is shown in box 7 Box 7 chr position coverage methyl chr position coverage methyl mu um chri0 358372 18 1 chr10 358372 6 0 MU chri0 358421 6 0 chr10 358421 7 1 UM chr10 516259 7 0 chr10 516259 15 1 UM chr10 624525 15 0 chr10 624525 16 0 875 UM 12 The output files with suffices annotated are the annotated HM CpG sites as shown below The last two columns are the gene and promoter information for CpG sites Box 8 chr position patterns coverage methyl Gene Promoter chr10 46519904 M U 13 90 0 923077 0 LOC643650 NA chr10 49335628 M U 6 16 1 0 ARHGAP22 NA chr10 49335675 U M 6 28 0 0 857143 ARHGAP22 NA chr10 49886908 M U 12 6 0 916667 0 NA NA chr10 50488280 U M 19 30 0 0 833333 CHAT SLC18A3 chr10 50503668 U M 14 53 0 0 830189 CHAT NA The output files with suffices Singleton GO have the similar output format as shown in Box 9 but it is the selected single CpG sites 2 4 3 2 Hemimethylation Clusters Output The output files with suffices Clusters are the hemimethylation clusters Box 9 gives an example of this output It has the similar output format as Box 8 in spite of
28. t 3 The scripts of testing how to run HMPL using the small dataset The test script file name is small data script txt and small data script pdf these two files have the same content To make it easier for user the content of this test script file is provided in the following box HORTA HAH RES ERASERS AOR EERE Ee Pao e RR ee PS SAREE ea ee See ae eae 1 download and unzip the latest HMPL weet http hal case edu sun HMPL HMPL zip unzip HMPL zip d HMPL_new HAHAHAHA ERA RA HARRAH A AREA EA RARE AEH RAR RRRA A ARREARS HAR eas 2 Create a folder to run HMPL mkdir 2015 6 6 HMPL QA cd 2015 6 6 HMPL QA pwd check the present working directory then get home pxl119 2015 6 6 HMPL QA EHH 3 The following are step by step scripts and notes about how to run HMPL on a small data set HEHEHE 1 The three datasets that the user needs are mcf10a 5m fastq MCF10A 5 million sequencing reads chr22 fa human genome chromosome 22 fasta file refGene txt the human reference gene information hg19 this file can be downloaded from UCSC genome browser Next the user may align the mcf10a 5m fastq i e 5 million reads to the chromosome 22 and then identify hemimethylated sites and clusters The user needs to save them in a folder path and then provide the corresponding path when use these datasets For example the following are path used in this example script file home pxl119 2015 6 6 HMPL QA
29. the additional last two columns that indicate the length of the clusters in bps and the number of CpG sites within the clusters Box 9 Chr positions Pattern coverage methyl gene promoter length ofCG chr17 11084428 11084474 MU UM 21 11 24 13 0 952381 0 0909091 0 125 0 846154 NA SHISA6 47 2 chr17 15795888 15795934 MU UM 19 17 17 23 1 0 0 0 869565 ADORA2B NA 47 2 chr17 16547718 16547766 MU UM 22912 ple a3 gt 107084 CCDC144A NA 49 2 chr17 16857943 16857989 MU UM 33 16 732 16 0 939394 0 0 1 NA NA 47 2 chr17 17553158 17553206 MU UM 23 8 22 8 ESO POST RAIL NA 49 2 chr17 18516721 18516724 18516727 18516731 18516740 MMMMM UUUUU 28 6 28 6 23 6 16 6 11 6 0 928571 0 1 0 0 956522 0 0 9375 0 0 909091 0 FOXO3B ZNF286B NA 20 5 chr17 22781527 22781574 MU UM Pedy Fsb3 0 818182 0 0909091 0 142857 0 923077 LOC440419 NA 48 2 chr17 26743508 26743557 MU UM 3911972926 L10701 RAB11FIP4 NA 50 2 chr17 26865386 26865435 MU UM 8 10 7 11 0 875 0 0 0 818182 RAB11FIP4 NA 50 2 chr17 30327477 30327526 MU UM LIG PAT ST 1 0 0 1 NA NA 50 Z chr17 31973165 31973210 MU UM Ts 19 9 302 1 0 0 1 NA NA 46 2 chr17 33738671 33738718 MU UM 9 21 8 20 13 07 01 GPR179 NA 48 2 There are in total four kinds of Clusters output files as shown below all HM Clusters All the HM clusters all Rev Clusters All reversed clusters non Rev Clusters G1 non reversed clusters non consec revs Clusters G2 non consecutive reversed clusters consec revs Clusters G3 cons
30. ting R Foundation for Statistical Computing Vienna Austria 2014 3 Andrews S FastQC http www bioinformatics bbsrc ac uk projects fastqc 2010 4 Harris EY Ponts N Le Roch KG Lonardi S BRAT BW efficient and accurate mapping of bisulfite treated reads Bioinformatics 2012 28 13 1795 1796 5 Martin M Cutadapt removes adapter sequences from high throughput sequencing reads EMBnet journal 2011 17 1 6 Sun Z Asmann YW Kalari KR et al Integrated analysis of gene expression CpG island methylation and gene copy number in breast cancer cells by deep sequencing PLoS One 2011 6 2 e17490 18
Download Pdf Manuals
Related Search
Related Contents
Copyright © All rights reserved.
Failed to retrieve file