pEco -T7-cHis, Eco cloning Kit User Manual
Contents
1. pEco T7 cHis Eco cloning Kit User Manual Cloning PCR products for E Coli expression of N term His tagged protein Cat Contents Amounts Application pEco T7 cHis vector 10 tubes x 50ul ea E Coli expression built in Eco Cloning for 10 rxn of C term His tag IC 1006 cells protein Positive PCR insert 1 x 10ul ea Sequencing primer pair Forward and reverse 15ul each 25ng ul Sto rage Eco M Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description Introduction GenTarget s proprietary fusion in vivo Patent pending Eco cloning technology is a revolutionized and the easiest PCR cloning method Simply amplifies your gene of interest with primer pair that flanked with short homologous arm to the expression vector ends then add lul of purified PCR into the engineered Ready to use Cloning cells and immediately proceed to transformation How it works Q gt _ gt Target PCR Add PCR to cells fae ap Transformation oe 2 In vivo cloning SF coe e Eco Cloning pEco T7 cHis manual Page 1 of 8 e UK amp Rest of World Switzerland Deutschland 184 Milton Park Abingdon Centro Nord Sud 2E OX14 4SE Oxon UK CH 6934 Bioggio Lugano Tel 44 0 1235 828 200 Tel 41 0 91 604 55 22 Fax 44 02. Suite 147 CH 6934 Bloggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 Vector maps The figure below summarizes the vector map of pEco T7 cHis Request the complete nucleotide sequence at contact amsbio com case the pasted sequence is ATG to last codon UK amp Rest of World 184 Milton Park Abingdon OX14 4SE Oxon UK Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Cloning site for pEco T7 cHis vector T7 promoter TCTCGATCCC GCGAAATTAA TACGACTCAC TATAGGGGAA ATGCTGAGTG ATATCCCCTT AGAGCTAGGG CGCTITAATT ATAACAATTC CCCTCTAGAA TATTGITAAG GGGAGATCTT BsrGI CACAAGTTTG TACAAAAAAG GTGTTCAAAC ATGTTTTTITC BsrGI TGTACAAAGT GGTGATCAAT ACATGTTTCA CCACTAGTTA CCTCTCCTCG GTCTCGATTC GGAGAGGAGC CAGAGCTAAG ATAATTTTGT TTAACTTTAA TATTAAAACA AATTGAAATT PCR Insert CAGGCACCNN NNNNNNNAAC GTCCGTGGNN NNNNNNNTTG TCGAAGCTTG AAGGTAAGCC AGCTTCGAAC TTICCATTCGG TACGCGTACC GGTCATCATC TTGTGAGCGG AACACTCGCC GAAGGAATAT CTTCCTTATA CCAGCTTTCT GGTCGAAAGA TATCCCTAAC ATAGGGATTG 6His ACCATCACCA ATGCGCATGG CCAGTAGTAG TGGTAGTGGT TTGAGTITGA TCCGGCTGCT AACAAAGCCC GAAAGGAAGC TGAGTTIGGCT AACTCcAAACT AGGCCGACGA TIGITTCGGG CTTTCCTTCG ACTCAACCGA Eco Cloning pEco Switzerland Centro Nord Sud 2E CH 6934 Bloggio L
3. 19 23591 El Toro Rd Suite 147 CH 6934 Bioggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 ji Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 United States amsbio m
4. sequences corresponding to the built in vector Design your primer pair as follows Fwd 5 tttgtacaaaaaagcaggcacc 20bp of 5 end gene specific forward sequence Rev 5 tttgtacaagaaagctggett 20bp of 3 end gene specific reverse sequence Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example for PCR primer design To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgcttacctgttg ccaacattgggccaacccgaattcttcccaatctttatcttggctgccagcgagatgtcctcaac aaggagctgatgcagcagaatgggattg sttatetgttaaatgccagcaatacctgtccaaage ctgacttttta Its PCR primer for vector pEco T7 cHis will be Fwd 5 tttgtacaaaaaagcaggcaccatgecctctgtgaaggaaaa Rev 5 tttgtacaagaaagctggettaaagtcagectttggacage In the case of inserting a protein cleavage site the Rev primer will be Rev 5 tttgtacaagaaagctggsttNNNNNNaaagtcaggctttggacagg where the NNNNNN is the in framed cleavage site codon reverse sequence Note 1 Gentarget s different Gentarget cloning kits share same PCR Insert For example the three Eco cloning cells Cat IC 1001 IC 1002 and IC 1003 can use the same PCR to make different expression clones And other three cloning cells Cat IC 1005 IC 1006 and IC 1007 can use the same PCR product for making different expression 2 Do not include the Stop codon in the Rev primer The stop codon is p
5. 1235 820 482 Fax 41 0 91 605 17 85 Bockenheimer Landstr 17 19 60325 Frankfurt Main Tel 49 0 69 779099 Fax 49 0 69 13376880 23591 El Toro Rd Suite 147 Lake Forest CA 92630 Tel 1 800 987 0985 Fax 1 949 265 7703 United States amsbio Gentarget s Eco PCR Cloning Kit utilizes an engineered E Coli strain with enhanced homologous recombination machinery for an Jn Vivo end homologous jointing reaction between PCR product and vector The vector was pre processed with the cloning cell using a proprietary protocol to obtain high cloning efficiency and low background It does not need any kinds of Jn Vitro tube reaction such as ligation Topo jointing or In fusion reaction and so on Let the E Coli do the job for you In Vivo pEco T7 cHis cloning cells was built in with a pET based T7 expression vector PCR insert will be cloned in framed with a C terminal His tag Key Features 1 The most cost effective and the easiest PCR cloning method simply add 1ul of PCR insert into provided cells for transformation regardless of the insert s size and concentration No need to buy expression vectors The vector was built in with cloning cells No need to buy cloning competent cells The cloning cells is the competent cells No need for the tedious bench works for preparing vector backbone No need for any enzymes or any tube reactions Precisely directional cloning of PCR products in frame with C term His ta
6. eimer Landstr 17 19 23591 El Toro Rd Suite 147 OX14 4SE Oxon UK CH 6934 Bloggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 Tel 44 0 1235 828 200 Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 44 0 1235 820 482 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 amsbio Confirm the positive by restriction digestion PCR inset can be cut out by BsrGI Run 1 2 agarose two bands 5 79 kb backbone the PCR insert or multiple bands if BsrGI has extra cuts within the PCR insert Final sequencing verification Use provided sequencing primer pair Note sequencing primer was provided as ready to use dilution use lul for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector Forward primer Reverse primer IC 1006 pEco T7 cHis IC 1006 fwd IC 1006 rev 5 taatacgactcactataggg 5 tgctagttattgctcagcgg 5 Protein expression Transformation transform the sequencing verified plasmid DNA into any strain containing a T7 RNA polymerase such as BL21 DE3 or BL21 DE3 pLys from which protein are expressed upon IPTG induction Transformation uses standard heat shock protocol such as add lul DNA into 50ul competent cell set ice 5 15min heat shock at 420C for 30 seconds back to ice for 2min add 250ul SOC recovery at 370C shaking for 1 hour Plate 10 to 100ul onto LB plates containing 100ug ml ampicillin Grow colonie
7. g Flexible to add any cleavage site for removal of C term His if desired High efficient gt 90 positive rate and low background Works fine with any PCR products with or without a 3 end s A overhung the extra A overhang if exists will be removed in cloning step 10 Good for different PCR sizes from 200bp to 6 kb 11 Engineered E Coli and mammalian expression vectors for high protein yields 12 Great for high through put cloning ee ot Pee eS Protocol Outline Produce PCR products and clean them v Add 1 2ul of PCR product into provided Cloning cells Briefly mixing and immediately proceed to transformation v Pick colonies and miniprep plasmids to verify the positive clones v Protein expression from sequencing verified clones Eco Cloning pEco T7 cHis manual Page 2 of 8 UK amp Rest of World Switzerland Deutschland United States Centro Nord Sud 2E Bockenheimer Landstr 17 19 23591 El Toro Rd Suite 147 CH 6934 Bioggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 184 Milton Park Abingdon OX14 4SE Oxon UK amsbio Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Detailed protocols 1 PCR primer design d The PCR primers used for generating inserts for Eco Cloning must contains a 20 25bp homologous
8. in mammalian expression vector with neomycin selection marker in provided cloning cells The vector containing an engineered super CMV i promoter for high yield mammalian IC 1002 PCR cloning kit kit expression of N term His tagged protein PCR cloning kit with a built in vector non T7 promoter based in provided cloning cells for E Coli expression of N term His tagged IC 1003 PCR cloning kit kit protein specially designed for toxic proteins PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term GST tagged IC 1004 PCR cloning kit kit protein P gg PCR cloning kit with a built in Gateway Entry vector in provided cloning cells for making i your target in Gateway Entry clone without IC 1005 PCR cloning kit kit using BP clonase PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for i mammalian expression of C term His tagged IC 1007 PCR cloning kit kit protein References 1 Oliner etal 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz etal Nucl Acids Res 1992 20 4369 4370 Eco Cloning pEco T7 cHis manual Page 8 of 8 UK amp Rest of World Switzerland Deutschland 184 Milton Park Abingdon OX14 4SE Oxon UK Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Centro Nord Sud 2E Bockenheimer Landstr 17
9. laced behind the C term His tag from the vector Eco Cloning pEco T7 cHis manual Page 3 of 8 oe UK amp Rest of World Switzerland Deutschland United States 184 Milton Park Abingdon Centro Nord Sud 2E Bockenheimer Landstr 17 19 23591 El Toro Rd Suite 147 a sbio OX14 4SE Oxon UK CH 6934 Bioggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 into arr com Tel 44 0 1235 828 200 Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 44 0 1235 820 482 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 2 Target amplification by PCR Using any PCR amplification protocols that work for you to amply your targets To minimize the PCR errors we recommend using high fidelity DNA polymerase Using any PCR purification column to clean your PCR products If you do not obtain a single discrete band from your PCR you need gel purify your fragment Important if your PCR template can generate background clones having Amp resistance you need treat your PCR product by DPNI or do gel purification of PCR product 3 Transformation Thaw Eco Cloning cells in ice water After completely thawed add 1 2ul purified PCR product from 20ng to 150ng into each vial of cells brief mixing by taping the tube with your finger For control vials add lul positive PCR insert provided as positive control and add lul water to a a negative control vial cel
10. ls Put tubes back on ice and then proceed for heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250ul of SOC medium incubated at 37 C shaking for 1hr Plating take 50ul 200ul aliquot spread out on pre warmed LB agar plates containing100ug ml ampicillin And grow colonies at 37 C incubator for overnight Note usually in the absence of PCR insert cells force some background colonies the no insert negative control generates a few colonies But in the presence of PCR insert greater than 90 colonies are positive Colony number varies dependent the quality and quantity of PCR products The concentration of purified PCR product can be from 20ng ul to 150ng ul with sizes from 200bp to 10kb For the simplicity and high through put cloning purpose we recommend simply add 1 2ul of PCR into cloning cells regardless of the PCR s concentration and sizes it will generate enough colonies 5 100 colonies in general for downstream works 4 Verification of positive clones Pick 2 5 colonies propagate in LB Amp incubate at 370C overnight Isolate the plasmid DNAs using DNA miniprep kit such as Eco Plasmid DNA Miniprep Kit Cat DP 100 Eco Cloning pEco T7 cHis manual Page 4 of 8 e UK amp Rest of World Switzerland Deutschland United States 184 Milton Park Abingdon Centro Nord Sud 2E Bockenh
11. mpicillin if applicable 4 aa Satellite colonies Do not incubate plates longer than 16 hours At colony pick try to avoid the tiny satellite colonies Eco Cloning pEco T7 cHis manual Page 7 of 8 UK amp Rest of World Switzerland Deutschland United States 184 Milton Park Abingdon OX14 4SE Oxon UK Centro Nord Sud 2E Bockenheimer Landstr 17 19 23591 El Toro Rd Suite 147 a sbio CH 6934 Bloggio Lugano 60325 Frankfurt Main Lake Forest CA 92630 info amsbio con Tel 41 0 91 604 55 22 Tel 49 0 69 779099 Tel 1 800 987 0985 Fax 41 0 91 605 17 85 Fax 49 0 69 13376880 Fax 1 949 265 7703 m Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Related Products Cat Product Name Amount Application DP 100 Eco Plasmid DNA 100 High pure Plamsid DNA isolation Miniprep Kit miniprep CC03 Eco E Coli expression 20 Competent cells for T7 vector protein CC03p Competent Cells rxn pack expression RM1000 Eco Expression 1000ml ea Auto induction High yield protein RichMedium expression medium EB S100 Eco Buster E Coli 100ml ea Protein extraction from cell pellets EB L100 protein extraction reagent PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term His tagged IC 1001 PCR cloning kit kit protein P 99 PCR cloning kit with a built
12. s at 37 C incubator for overnight Propagation Pick one clone grow in LB medium with ampicillin at 370C shaking overnight Add overnight culture into appropriate amount of LB medium containing 100ug ml of ampicillin by making 1 40 dilution keep medium volume at 20 of flask volume for better aeration vigorously shake at 30 C 300rpm Induction measure growth OD600 at the time when OD600 0 5 add an appropriate amount of IPTG continue grow for 17 24 hours with vigorously shaking at 30 C 300rpm Note for best expression results use Gentarget s auto induction medium Eco RichMedium Cat RM1000 for propagation it does not need to add IPTG for induction Harvest cells by centrifugation QC Cell pellet was lysed using lysis reagent Note we recommend use Gentarget s Eco Buster protein extract reagents Cat EB S100 or EB L100 Following the lysis protocols run protein gel for analysis Purification use your favorite protocols and reagent to purify the expression His tagged protein by His tag affinity column Purity and function analysis of the expressed protein using your favorite protocols Eco Cloning pEco T7 cHis manual Page 5 of 8 UK amp Rest of World Switzerland Deutschland United States 184 Milton Park Abingdon OX14 4SE Oxon UK Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Centro Nord Sud 2E Bockenheimer Landstr 17 19 23591 El Toro Rd
13. ugano Tel 41 0 91 604 55 22 Fax 41 0 91 605 17 85 T7 cHis manual Page 6 of 8 Deutschland Bockenheimer Landstr 17 19 60325 Frankfurt Main Tel 49 0 69 779099 Fax 49 0 69 13376880 United States 23591 El Toro Rd Suite 147 Lake Forest CA 92630 Tel 1 800 987 0985 Fax 1 949 265 7703 amsbio pEco T7 cHis vector BsrGl T7 promoter GOI cloning ends T7 promoter 318 334 a lacO 337 361 GOI cloning ends 428 429 6His 525 542 T7 term 557 685 Amp 1085 1942 pBR322 ori 2763 2091 pBR322 ori lacl 5728 4637 Trouble shooting Problems Solution No colony Be sure to set up a positive control transformation using provided positive PCR insert1 which should give you 10 100 colonies Spread all transformation mixture on plate Background Be sure to set up a background control plate in which no colonies PCR was added into cells it should generate 0 5 colonies or less than 10 compared to plates with insert Noticed in the absence of PCR insert cells forces vector self ligation resulted in a few background colonies Make sure that the PCR s template do not cause background colony If it does clean PCR products by gel isolation or treated by DPNI Plate less transformation mixture on plate Be sure to use right amount of antibiotics in LB plate and make fresh LB plates if necessary Use carbenicillin instead of a
Download Pdf Manuals
Related Search