Home

Cellecta-Manual-shRNA-sgRNA

image

Contents

1. ANY PARTICULAR PURPOSE AND ALL WARRANTIES ARISING FROM ANY COURSE OF DEALING COURSE OF PERFORMANCE OR USAGE OF TRADE Other Uses Except for the limited use expressly specified above no other license is granted no other use is permitted and CSHL retains all rights title and interests in and to the shRNA or sgRNA IP Rights Nothing herein confers to Customer by implication estoppel or otherwise any right or license under any patent patent application or other proprietary intellectual property right of CSHL other than the shRNA or sgRNA IP Rights For information on purchasing a license to use the Product for longer time periods in greater quantities or for other purposes or to practice more broadly under the shRNA or sgRNA IP Rights or to practice under other CSHL intellectual property rights please contact the CSHL Office of Technology Transfer at 516 367 8301 Definitions Affiliate means at the time of reference thereto any corporation company partnership joint venture or other entity which controls is controlled by or is under common control with the subject entity where control means direct or indirect ownership of more than 5096 of i the outstanding stock or other voting rights entitled to elect directors or ii all ownership interests or in any country where the local law shall not permit foreign equity participation of 5096 or more then the direct or indirect ownership or control of the maximum percentage of such outstand
2. to a commercial third party contractor who pursuant to a written agreement with Customer and only for non royalty based payment s undertakes on behalf of Customer to use the Product solely for Customer s benefit and internal research purposes which third party shall not after termination of such work retain or receive subsequent rights to possess access or use any Product or any results of such work and from whom Customer receives no payments pursuant to such agreement Compliance Customer may only use the Product in compliance with all local state federal and other applicable laws regulations and rules including without limitation for uses in the United States EPA FDA USDA and NIH guidelines Customer may not directly or indirectly use the Product or allow the transfer transmission export or re export of all or any part of the Product or any product thereof in violation of any export control law or regulation of the United Sates or any other relevant jurisdiction Disclaimers THE PRODUCT IS PROVIDED AS IS WITHOUT WARRANTY OF ANY KIND NO WARRANTY IS MADE THAT THE PRODUCT WILL MEET CUSTOMER S REQUIREMENTS OR THAT ANY RESULT CAN BE ACHIEVED OR THAT USE OF THE PRODUCT WILL NOT INFRINGE ANY PATENT OR OTHER PROPRIETARY RIGHT ALL WARRANTIES EXPRESS OR IMPLIED ORAL OR WRITTEN ARE HEREBY EXPRESSLY DISCLAIMED INCLUDING WITHOUT LIMITATION ALL IMPLIED WARRANTIES OF NON INFRINGEMENT QUIET ENJOYMENT MERCHANTABILITY OR FITNESS FOR
3. A lt ie A LU 1 red e du DM gp ASF Jj a 2 us LS AET ESY T 4 1 qf Discovery is yours 4 CELLECTA Cloning of shRNA and sgRNA Templates into Cellecta Expression Vectors User Manual V5 7 16 15 ATA Ae UCSTed Wee 11 shRNA amp sgRNA Cloning www cellecta com Contents As BACKECOUIN e PH 2 B Required Materials rre ore Ue ei ne Ue PEE Qe ER ES a EUNT NEATE Yee geben e PUn o 2 C Design of shRNA Template Oligonucleotides for ShRNA Expression Vectors eeeeee 3 els IceRelll o mL H O 3 REVElSS OUS Os EP 3 D Design of sgRNA Template Oligonucleotides for CRISPR Expression Vectors eeeeeee 3 Sensex NSO eniin od cutie rhein tea ves A Ea S x Te eV EDS TEPDAN PER E PIRE E e REF E E ES REL CHEAVEREESE 3 P elsE aEisselprem EE 4 E Cloning of shRNA or sgRNA Template Oligonucleotides into an Expression Vector 4 F Identify clones with the target shRNA or sgRNA template sseeeeeeeeeeeenennene nennen 6 G Purify Plasmid shRNA or sgRNA Construct seeseseseeseeee ener nennen enne ener nnne nennen 7 H Technical iugo ToJo ndm 8 I Safety GUIGeliNG Siiiacdachiatienihiniennind dala ET 8 Je Temis and COMIC OMS EHE 10 A Background The protocols below provide the instructions on how to phosphorylate shRNA or sgRNA template oligos
4. ance and all terms and conditions of this License sale of the Product to Customer by Seller acting under its license from CSHL an Authorized Sale conveys to Customer only the nonexclusive nontransferable right under the shRNA or sgRNA IP Rights to use the Product solely for Customer s internal research purposes and only at its facility where the Products are delivered by Seller Unlicensed Products Any Product that is acquired other than pursuant to an Authorized Sale including without limitation any Product not acquired from Seller shall be deemed to be an Unlicensed Product This License shall be void and of no effect for Unlicensed Products and shall not convey any express or implied right to make use or sell Unlicensed Products for any purpose Restrictions Customer obtains no right to sublicense it rights or to use the Product for the benefit of any third party for any commercial purpose including without limitation using the Product in connection with providing services to any third party or generating commercial databases The Product may not be used in vitro or in vivo for any diagnostic preventative therapeutic or vaccine application or used directly or indirectly in humans for any purpose Customer may not isolate extract reverse engineer derive copy or separately use any component of the Product such as for example any shRNA or sgRNA component for any commercial purpose including without limitation for the purpose
5. equences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov biosafety publications bmbl5 bmbl5 sect iv pdf It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include e Wear gloves and lab coat at all times when conducting the procedure e Always work with lentiviral particles in a Class Il laminar flow hood All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory tech cellecta com 9 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com J Terms and Conditions Cellecta Inc Limited License Cellecta grants the end user the Recipient of the CRISPR Pooled Lentiviral sgRNA Libraries and Vector the Product a non transfe
6. h well or tube from B 2 b Mix d Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 25 cycles 68 C 2 min 1 cycle e Take 5 ul of PCR product from Step d and run it on a 396 agarose EtBr gel in 1X TAE buffer f Confirm identity of ShRNA or sgRNA template inserts by sequence analysis of positive PCR products using the Forward PCR primer tech cellecta com 6 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com G Purify Plasmid shRNA or sgRNA Construct 1 Take 15 ul of each positive bacteria culture inoculate each clone in 10 ml of LB broth media with 100 ug ml ampicillin or carbenicillin and grow overnight at 37 C with shaking Purify ShRNA or sgRNA lentivector construct plasmid DNA in Midi or Maxi scale using an Endotoxin free plasmid purification kit tech cellecta com 7 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com H Technical Support For additional information or technical assistance contact us by phone or email Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta com Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 For the latest technical news and updates visit Cellecta s blog at http www cellecta com company blog news l Safety Gu
7. idelines The HIV based lentivector system is designed to maximize its biosafety features which include e A deletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of lentiviral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev are present in the packaged lentiviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Lentiviral particles will carry only a copy of your expression construct tech cellecta com 8 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous lentiviral s
8. ing stock voting rights or ownership interests permitted by local law Commercial Entity means any entity or organization other than a Non Profit Entity CSHL means Cold Spring Harbor Laboratory Customer means the company or other entity or organization that orders pays for and takes delivery of the Product Non Profit Entity means any college university or governmental entity including without limitation governmental and quasi governmental institutes and research laboratories or any non profit scientific research or educational organization that is of the type described in section 501 c 3 of the Internal Revenue Code or that is qualified under a state non profit organization statute Product means a product including without limitation expression vectors encoding an shRNA or sgRNA the design manufacture or use of which in whole or in part is the subject of the shRNA or sgRNA IP Rights and is deemed to include all components progeny reproductions modified versions and other derivatives thereof Seller means Cellecta Inc 2015 Cellecta Inc All Rights Reserved Terms and Conditions are also available online at http www cellecta com company legal information terms and conditions Trademarks CELLECTA is a registered trademark of Cellecta Inc tech cellecta com 11 of 11 v5 7 16 15
9. l License for the use of lentiviral sgRNA constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com Cold Spring Harbor Laboratory CSHL shRNA or sgRNA Product End User Label License for use of expression vectors encoding an shRNA or sgRNA Acceptance This Limited Use License License contains the exclusive terms and conditions between CSHL and Customer for use of the Product By opening the Product container or in any other way accessing or using the Product Acceptance you will create a binding legal contract upon the terms and conditions herein without modification Customer s purchase order or similar terms shall not apply to this License If you are not authorized by Customer to enter into this License or do not agree to all terms and conditions in this License then you are prohibited from opening the Product container or otherwise accessing or using the Product Permitted Use Portions of the Product are covered by US and foreign patent applications or patents and other proprietary intellectual property rights owned by CSHL shRNA or sgRNA IP Rights Subject to Accept
10. l ampicillin or carbenicillin and grow overnight at 37 C d You should expect to get at least 10 fold more colonies in experimental samples in comparison with negative control vector only ligation reaction tech cellecta com 5 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com F Identify clones with the target shRNA or sgRNA template 1 Prepare colony cultures a Randomly pick up 10 well separated colonies from each plate and grow each clone in 100 ul of LB Broth with 100 ug ml ampicillin or carbenicillin at 37 C for 2 hours with shaking b Take 1 ul of each bacteria culture for PCR screening and continue to grow the culture for another 6 hours c Store the bacterial culture at 4 C 2 Screen for shRNA or sgRNA template inserts a Prepare a PCR master mix for each clone you would like to screen for the presence of an shRNA or sgRNA template insert as follows 1 rxn 10 rxn Composition 0 5 ul 5 ul Forward PCR Primer 10 uM 0 5 ul 5 ul Reverse PCR Primer 10 uM 0 5 ul 5 ul 50X dNTP mix 10 mM of each 2 5 ul 25 ul 10X PCR Reaction Buffer 19 5 ul 195 ul Deionized water 0 5 ul 5 ul Taq DNA Polymerase 5 U ul 24 0 ul 240 ul Total volume See the Product Analysis Certificate for your plasmid to find the required primer sequences b Mix the master mix very well and aliquot 24 ul into each well of a 96 well PCR plate or individual tubes c Add 1 ul of each bacterial culture from B 1 into eac
11. ligate them to cloning vectors transform competent cells and grow plasmid DNA to generate plasmid expression constructs For packaging of constructs into lentiviral particles please refer to the User Manual for Packaging and Transduction of Lentiviral Constructs Please read the entire user manual before proceeding with your experiment B Required Materials For Digestion of Uncut Cloning Vector Bbsl enzyme Recommended New England BioLabs Cat RO539L For Phosphorylation and Annealing of shRNA or sgRNA Template Oligonucleotides e T4 Polynucleotide Kinase and 10X Reaction Buffer Recommended New England BioLabs T4 Polynucleotide Kinase 10 U ul Cat M02015S e ATP Recommended GE Amersham Cat 27 2056 01 For Ligating and Transforming shRNA or sgRNA Constructs e Linearized Cellecta shRNA Expression Vector or CRISPR Expression Vector tech cellecta com 2 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com e T4 DNA Ligase and 10X Ligation Reaction Buffer Recommended New England BioLabs T4 DNA Ligase 400 U ul Cat M02025 Before using dilute T4 DNA ligase 10 fold with 1X T4 DNA ligase buffer to 40 U ul e Competent E coli cells RecA Recommended Invitrogen OmniMAX 2 T1 Phage resistant cells Cat C8540 03 Petri plates containing LB Agar media with 100 ug ml Ampicillin or Carbenicillin For Screening shRNA or sgRNA Inserts e Taq DNA polymerase and 10X reaction buffer Recommended BDB Cl
12. lined herein The Recipient may refuse these licenses by returning the enclosed Product unused By keeping or using the enclosed Product you agree to be bound by the terms of these licenses The laws of the State of California shall govern the interpretation and enforcement of the terms of these Licenses Limited Use Label Licenses The Recipient acknowledges that the Product has been developed by Cellecta based on licenses from Third Parties and agrees with the Terms of Limited Use for the Recipient provided by the Third Parties Life Technologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this technology to make or sell products or offer services for consideration in the research market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Evrogen IP JSC End User Labe
13. of making Products other than solely for Customer s internal research purposes Non Profit Customers If Customer is a Non Profit Entity then the following additional restrictions shall apply Customer obtains no right to use the Product for any commercial purpose tech cellecta com 10 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com Commercial Customers If Customer is a Commercial Entity unless Customer has already entered into a separate written agreement that has been executed by CSHL that covers the shRNA or sgRNA IP rights and that is then currently in effect then the following additional restrictions shall apply This License and Customer s rights hereunder automatically terminate 1 year after delivery of Product to Customer After 1 year of Product use customer must enter into a separate written agreement with CSHL that covers the shRNA or sgRNA IP rights or Customer shall immediately stop using and destroy all Product in its possession The Product may not be used to make any mouse that is of a strain of mice for germ line transmission by embryonic transfer of a gene encoding an shRNA or sgRNA that induces suppression of a gene or genes by RNAi No Transfers Customer may not distribute or transfer the Product by license sale loan lease rental or any other means to any commercial partner or any other third party for any commercial purpose except only in the following case Customer may transfer the unmodified Product
14. oning www cellecta com Sense Oligo 5 accgNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaact tgaaaaagtggcaccgagtcggtgctttt 3 Antisense Oligo 5 cgaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctag ctctaaaacNNNNNNNNNNNNNNNNNNNN 3 Guide NNNNNNNNNNNNNNNNNNNN Scaffold tracrRNA 5 gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtg c 3 E Cloning of shRNA or sgRNA Template Oligonucleotides into an Expression Vector 1 Phosphorylate and Anneal the shRNA Template Oligonucleotides Note This protocol was developed for regular non phosphorylated oligos If your oligonucleotides are already phosphorylated dilute them to 10 uM in 1X T4 polynucleotide kinase buffer heat at 95 C for 2 min and anneal as in steps 1 d 1 e below a Dissolve the shRNA or sgRNA template oligonucleotides in an appropriate amount of deionized water to a final concentration of 20 uM b Setup 20 ul phosphorylation annealing reactions for each shRNA or sgRNA template 1 ul Sense Strand shRNA or sgRNA template oligo 20 uM 1 ul Antisense Strand shRNA or sgRNA template oligo 20 uM 2 ul 10X T4 Polynucleotide Kinase Buffer 2 ul SmMATP 13 ul Deionized water 1 ul T4Polynucleotide Kinase 10 U ul 20 ul Total volume For the insert minus control use 2 ul deionized water in place of the sense and antisense strands c Incubate the phosphorylation reaction at 37 C for 30 min
15. ontech Titanium Taq DNA polymerase Cat 639208 e dNTP mix Recommended GE Amersham dNTP set Cat 27 2035 01 e Thermal Cycler e 396 1X TAE Agarose gel e PCR Screening Primers for your vector Please check the Product Analysis Certificate PAC that came with your product For Purifying shRNA and Constructs after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale preparation of endotoxin free DNA QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Maxi Kit Cat 12362 QIAfilter Plasmid Midi Kit Cat 12243 and EndoFree Plasmid Buffer Set Cat 19048 Please visit the QIAGEN website to download the specialized protocol that is not contained in the user manual http www1 giagen com literature protocols pdf QP15 pdf C Design of shRNA Template Oligos for shRNA Expression Vectors The general design of shRNA template oligonucleotides is 5 ACCGG 21sense Stem Loop Stem 21antisense TTTT 3 Sense oligo 5 accgGNNNNNNNNNNNNNNNNNNNNNGTTAATATTCATAGCNNNNNNNNNNNNNNNNNNNNNTTTT 3 Antisense oligo 5 cgaaAAAANNNNNNNNNNNNNNNNNNNNNGCTATGAATATTAACNNNNNNNNNNNNNNNNNNNNNC 3 D Design of sgRNA Template Oligos for CRISPR Expression Vectors The general design of sgRNA template oligonucleotides is 5 ACCG 20nt guide scaffold tracrRNA TTTT 3 tech cellecta com 3 of 11 v5 7 16 15 shRNA amp sgRNA Cl
16. rable non exclusive license to use the reagents for internal research use only as described in the enclosed protocols in particular research use only excludes and without limitation resale repackaging or use for the making or selling of any commercial product or service without the written approval of Cellecta Inc separate licenses are available for non research use or applications The Product is not to be used for human diagnostics or included used in any drug intended for human use Care and attention should be exercised in handling the Product by following appropriate research laboratory practices Cellecta s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price Cellecta s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty Cellecta does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned Cellecta disclaims any and all responsibility for injury or damage that may be caused by the failure of the Recipient or any other person to use the Product in accordance with the terms and conditions out
17. utes in a thermal cycler d Heat the reaction mix to 95 C for 2 min in a thermal cycler e Turn off the thermal cycler and let it cool to room temperature tech cellecta com 4 of 11 v5 7 16 15 shRNA amp sgRNA Cloning www cellecta com f Take a 2 ul aliquot from the reaction 1 uM shRNA or sgRNA template and make a 1 5 dilution by adding 8 ul of 1X T4 Kinase buffer Mix well g Use 0 5 ul of the diluted shRNA or sgRNA template 0 2 uM for the following ligation reaction 2 Ligate the shRNA or sgRNA Template into Linearized shRNA or sgRNA Lentivector a Setup 10 ul ligation reactions for each phosphorylated shRNA or sgRNA template as follows 1 0 ul Linearized shRNA or sgRNA Expression Vector 10 ng ul see Required Materials 0 5 ul Phosphorylated ds shRNA or sgRNA template step 1 0 2 uM 1 0 ul 10X T4 DNA Ligase Buffer 6 5 ul Deionized water 1 0 ul 4 DNA ligase 40 U ul 10 0 ul Total volume For negative control use insert minus Dilute T4 DNA ligase 400 U ul 10 fold to 40 U ul with 1X T4 DNA ligase buffer if you are using New England BioLabs enzyme b Incubate the ligation reaction at 16 C for 1 2 hrs 3 Transform E coli with the ligation product a For each shRNA or sgRNA template use the whole volume of ligation product for transformation b Follow the manufacturer s protocol for transforming the competent cells c Plate an appropriate amount of cells on LB plates with 100 ug m

Download Pdf Manuals

image

Related Search

Cellecta Manual shRNA sgRNA cellranger scrna-seq

Related Contents

USER'S GUIDE PQ-40  EVGA GTX 780 Ti Classified Backplate    QPAD MK85  MMGen2D_M_elliptic 2D elliptic and algebraic Mesh  Avision AV176U  VPL-HW40ES - Intelware  Ferramenta de Diagnóstico à Distância do ipLDK  Hikvision Digital Technology DS-7216HWI-SH  Baureihe 1402-01 - Sander Fördertechnik  

Copyright © All rights reserved.
Failed to retrieve file