Kit Manual - Alere Technologies GmbH
Contents
1. 31 LITERATURE Jw EE EE FFO FFF FERF EE EE EM ER UPDATES amp SOFTWARE ie eie bie N ee ER APPENDIX 1 FLOW CHARTS ann a a 33 APPENDIX 2 PROBE TO TARGET TABLE un na a Ee 35 APPENDIX 3 LIST OF REFERENCE EXPERIMENTS FOR PATTERN MATCH 36 APPENDIX 4 HTML REPORT OF THE REFERENCE ISOLATE DC 38 TRACHOMATIS 37 ChlamType 23S AS 4 Kit 05_16_04_0011_V01_ChlamType 23S AS 4 Kit www alere technologies com BACKGROUND The ALERE ChlamType 23S AS 4 Kit allows the rapid economic and standardised DNA based detection of all currently recognised Chlamydia species and other Chlamydiales Extracted DNA from different possible sources is exponentially amplified in a specific PCR with 5 Biotin labelled primers The resulting biotin labelled dsDNA is transferred and hybridised to DNA microarrays with 57 oligonucleotide probes for different genetic markers plus essential controls All of them are spotted three times Based on a digital image of the arrays spot recognition is performed automatically and results are provided as a html file providing species identification Two different methods for species discrimination were used 1 Pattern Match Comparison of an obtained hybridisation pattern with a set of 94 different theoretical and 14 experimental reference experiment patterns and subsequent assignment resulting in the best three matches See page 35 2 Chlamydia Species Assignment after2. Manual ChlamType 23S AS 4 Kit For the identification of Chlamydia species and other Chlamydiales 23S based Array Hybridisation Kit Kit order number 246500096 96 reactions ArrayStrip format For Research Use Only Not Intended for Use in Clinical Diagnostics www alere technologies com CONTENT BACKGROUND N ME 1 GENERAL INSTRUCTIONS FOR USE ee ee een 2 Waen AA E 2 SpeellicatiOns EE EE EE E 2 Technical ENEE a a a ee 2 Safety Presteer GE Ee OU era 3 Material Safety Data Sheets Mais 3 Shipping Hee le E 3 REAGENTS AND DEVICES E AR 4 Kit Components Storage and Stability EE 4 Suggested Reagents for DNA Labelling and Amplification Recommended but not included NEE 4 Suggested Reagents for DNA Labelling and Amplification Included 4 Suggested Reagents for Hybridisation and Detection Included sseesssss 5 Instrumentation amp Software EE 6 Components Required but Not Provided u 6 AMPLIFICATION AND INTERNAL BIOTIN LABELLING enne 8 TEE 9 General Remarks for the Handling of Arrays nennen enne nnns 9 General Remarks for the Handling of Uouide sesse esse se ees se ee ee ee ee ee ee ee GR Re ee ee HY ee 10 General Remarks The Substrate Precipitating Dye DI 11 General Remarks Thermashakers u u n ana a BAR Ao 11 Protocol for Oiiantifoil s BIGShake IO uni ER CH REANO oe oe Un Eege 12 Prot
3. e To avoid confusion make sure that worklists are named unambiguously or that worklists from earlier experiments are deleted e You may use the software tool Worklist Generator to create a Worklist easily http alere technologies com en products lab solutions software tools worklist generator html ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 17 www alere technologies com Table 1 Worklist example Please note Table head must be written exactly as shown position SamplelD assaylD assayType 1 2014 12345 010454 23s 2 2014 12346 010454 23s 3 2014 12347 010454 23s 4 2014 12348 010454 23s 5 2014 12349 010454 23s 6 2014 12350 010454 23s 7 DC48 Simkania 010454 23s 8 C caviae 010454 23s Table 2 Positions in the 96 well format 1 2 3 4 5 6 7 8 9 10 11 12 A 1 9 17 25 33 41 49 57 65 73 81 89 B 2 10 18 26 34 42 50 58 66 74 82 90 C 3 11 19 27 35 43 51 59 67 75 83 91 D 4 12 20 28 36 44 52 60 68 76 84 92 E 5 13 21 29 37 45 53 61 69 77 85 93 H 6 14 22 30 38 46 54 62 70 78 86 94 G 7 15 23 31 39 47 55 63 71 79 87 95 H 8 16 24 32 40 48 56 64 72 80 88 96 Data Acquisition in the ArrayMate Reader e Insert your flash drive containing the worklist into any of the USB ports on the lower right hand side of the ArrayMate e Press L J a folder selection dialogue will open e Select your work
4. family marker pos 56 C is positive see page B ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 28 www alere technologies com Image Quality In case of poor image quality we recommend to re check the labelled amplification product quantity and quality first by loading the remaining PCR product on an agarose gel In order to determine whether any problems originated from the DNA preparation conduct an experiment with control material DNA from a number of Chlamydia spp reference and clinical strains can be obtained from the German Collection of Microorganisms and Cell Cultures DSMZ www dsmz de or other strain collections such as ATCC or Institute Pasteur If the control experiment yields a valid result and a correct identification there was probably an issue with DNA preparation If the control experiment fails as well an error in later steps or degradation of reagents from later steps is likely DNA Quality and RNA Contamination Control The template DNA should be largely un fragmented as fragmentation reduces the amplification and labelling efficiency For this reason DNA should not be prepared by using bead beaters ultra sonication or aggressive chemicals such as those in alkaline lysis protocols The present Assay has been validated using the OIAGEN DNeasy and the Roche High Pure kits DNA should be free of any traces of ethanol as ethanol inhibits the amplification It is possible to heat the sampl
5. Signal Interpretation Discrimination of Chlamydia species and other Chlamydiales using single markers and marker combinations e Controls Staining controls using biotinylated control spots negative control spots internal amplification and hybridisation controls o DNAtemplate for internal amplification reaction target EGFP o Marker indicating E coli DNA contamination in the amplification reaction e Family and Genus markers e Chlamydia species C abortus C caviae C felis C psittaci ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 1 www alere technologies com C pecorum C pneumonia C suis C muridarum C trachomatis C avium C gallinacea e Other Chlamydiales Simkania Parachlamydia Waddlia acanthamoebae Protochlamydia amoebophila Criblamydia sequanensis Protochlamydia aegleriophila Chlamydiales Xenoturbella Neochlamydia artmannellae Estrella lausannensis ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 2 www alere technologies com GENERAL INSTRUCTIONS FOR USE Intended Use For Research Use Only Not for Use in Diagnostic Procedures This assay allows the characterisation of amplified and labelled DNA originating from samples containing Chlamydia species and other Chlamydiales The assay is made for research use and epidemiological applications It should not be applied to other targets than Chlamydia and Chlam
6. as the hourglass symbol is visible e Switch off the device by clicking Power at the bottom left on the screen D e Switch off the screen There is no need to physically switch off the ArrayMate Reader ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 24 www alere technologies com TROUBLESHOOTING AND REPORT INTERPRETATION In case of any troubleshooting make sure that reagents are within the recommended shelf life and stored appropriately In case of problems we are always happy to provide support Please e mail to cct home clondiag com and include a description of the problem as well as the array images bmp files in question Two different methods for species discrimination were used 1 Pattern Match Comparison of an obtained hybridisation pattern with a set of 94 different theoretical and 14 experimental reference experiment patterns and subsequent assignment resulting in the best three matches See page 38 The pattern match algorithm provides an initial orientation and is not fully reliable in closely related patterns Each theoretical reference pattern exists in 3 different variants assuming high medium and low stringency hybridisation conditions 2 Chlamydia Species Assignment after Signal Interpretation Discrimination of Chlamydia species and other Chlamydiales using single markers and marker combinations This method might provide more accuracy if the pattern match is not applicable If
7. both results are not in concordance please stay with the result of the Chlamydia Species Assignment after Signal Interpretation Staining Control A staining control is included to check whether possible problems originate from the hybridisation or the staining procedure If the staining control has Failed proceed as follows Horseradish peroxidase conjugate may have degraded during storage Add 1 ul C3 C4 buffer to 9 ul D1 substrate If the solution turns green within 3 5 seconds the horseradish peroxidase still has sufficient enzymatic activity ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 25 www alere technologies com Enzymatic reaction is inhibited by carryover of buffer C1 Ensure proper washing of the wells with C2 buffer to remove all C1 buffer prior to adding horseradish peroxidase conjugate Negative Control Failed indicates possible problems originating from the staining procedure Marker rrl 0101 0177 10 Marker indicates E coli DNA contamination The presence of E coli DNA e g originating from the DNA polymerase production process can reduce the signal intensity of other spots and hence yield false negative results One can ignore this marker if the species identification is okay Plausibility Controls The following error messages Plausibility Controls might appear in the report Internal Amplification and Hybridisation Control EGFP At least one of three EGFP probes
8. com Target gene Internal control Amplicon 276 bp Suggested Reagents for Hybridisation and Detection Included e ArrayStrips 12 x 8 samples Protected against light and sealed under inert gas Store at 18 C to 28 C To be used within two weeks after opening Close the unused wells with caps to protect them against humidity and dust and store them in the dark Avoid any touching or scratching of the microarray surface at the bottom of the well Do not store or handle unused wells at an air humidity of more than 60 since this may irreversibly corrode the spots e StripCaps 24 strips e C1 Hybridisation Buffer Store at 18 28 C protect against sunlight Surplus 200 e C2 Washing Buffer 1 Store at 18 C 28 C protect against direct sunlight Surplus 200 e C3 HRP Conjugate 100 x Store at 2 8 C protect against direct sunlight Surplus 100 e C4 Conjugate Buffer Store at 18 C to 28 C protect against direct sunlight Surplus 200 e C5 Washing Buffer 2 Store at 18 C to 28 C protect against direct sunlight Surplus 500 e D1 Horseradish Peroxidase Substrate Store at 2 8 C protect against direct sunlight Surplus 50 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 5 www alere technologies com Instrumentation amp Software e ArrayMate Reader to be ordered separately for details see below The ArrayStrip based ChlamType 23S AS 4 Kit can b
9. has to be positive Otherwise an error message is shown Plausibility Controls control result explanation Absence indicates inhibition of DNA amplification Internal Amplification and Hybridisation Control Failed Please repeat the experiment A negative internal amplification and hybridisation control together with a negative species assignment might be due to potential inhibitors in your current DNA preparation A positive internal amplification and hybridisation control together with a negative species assignment might be due to a very low input of DNA copy numbers or fragmentation of the ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 26 www alere technologies com DNA Please repeat the amplification in two single tubes not as duplex PCR and hybridize it together in one and the same well A negative internal amplification and hybridisation control together with a positive species assignment might by due to a very high DNA copy number input The plausibility control can be ignored if you do not use INTYPE IC DNA Family and Genus Control If family or genus markers are too weak negative or does not match respectively an error message appears Plausibility Controls Weak or implausible species marker Please repeat the experiment Species Please note that other Chlamydiales will not generate family and genus signals Control e g Simkania Waddlia Protochlamydia Neochlamydia Par
10. or moved abruptly during the staining procedure or thereafter After completion of staining remove and discard reagent D1 as completely as possible and scan immediately The dye precipitate fades slowly in presence of liquids General Remarks Thermoshakers The correct temperature within the vessels is essential therefore always use the appropriate equipment for heating Because of the possibility of inhomogeneous temperature distribution within the heating block as well as possible differences between displayed and actual temperatures the use of different brands of thermoshakers might affect test performance We tested the assay with a BioShake iQ by Olnstruments http www ginstruments com equipped with a customised heating block designed to fit ArrayStrips as well as with an Eppendorf Thermomixer Comfort http www eppendorf com equipped with a heating block for microtiter plates and Deepwell plates Eppendorf Cat 5363000012 When using ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 11 www alere technologies com other devices some modifications to the protocol might be necessary Before starting routine use please test the protocol with a few known reference strains The only difference between the protocols for Olnstruments BioShake iQ and Eppendorfs Thermomixer Comfort with Microtiter Plate Adapter is the washing temperature after the hybridisation step Protocol for Quantifoil s BioShake iQ B
11. rpm for 10 min Meanwhile prepare conjugate For each experiment add 1 ul 100x HRP conjugate to 100 ul C4 Conjugation Buffer This mixture is stable at room temperature for around one working day C3 is delivered with a surplus of 100 and C4 with a surplus of 200 96 Suggested pipetting scheme 1 2 3 4 6 7 10 11 15 16 20 21 30 31 40 well wells wells wells wells wells wells wells G3 1 5 ul 3 5 ul 7 ul 11 ul 16 ul 21 ul 32 ul 42 ul C4 150 ul 350 ul 700 ul 1100 ul 1600ul 2100 ul 3200 ul 4200 ul e Remove the Washing Buffer and add 100 ul diluted conjugate to each well incubate at 30 C and 550 rpm for 10 min e Remove the conjugate add 200 ul C5 Washing Buffer Pipette the buffer 4 times up and down at room temperature e Remove the Washing Buffer add 100 ul of D1 substrate precipitating dye at 25 C see above per well e Incubate at 25 C for 5 min but do not shake e Remove liquid completely e The bottom of the ArrayStrips outside surface may be cleaned carefully with wipes Bubbles may be removed by removing and adding D1 e Scan and process see below ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 13 www alere technologies com Protocol for Eppendorf s Thermomixer Comfort with Microtiter Plate Adapter Eppendorf Thermomixer with thermoblock for MTPs and deepwell plates e Preparation of the hybridisation mixture den
12. the ArrayMate device and prepare your worklist 60 min 10 min i discard labeled DNA incubate twice in 200 ul Buffer C2 43 C 550 rpm 10 min prepare C3 C4 Conjugate C3 C4 1 100 preheat Substrate D1 25 C 25 min 5 min i discard Buffer C2 incubate in 100 ul C3 C4 Conjugate 30 C 550 rpm 10 min 15 min 3 min i discard C3 C4 Conjugate rinse with 200 ul Buffer C5 4 x up and down 2 min 2 min i discard Buffer C5 incubate with 100 ul Substrate D1 25 C 5 min 10 min 2 min discard Substrate D1 analyse ArrayMate 10 min 5 min total time requirement app 4 5h app 1h ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 33 www alere technologies com Protocol Eppendorf Thermomixer pro hands prepare ArrayStrips prepare DNA cessing on time time label genomic Chlamydia DNA in 130 20 min thermocycler min 1 ul DNA plus MasterMix preparing labeled DNA 2 min 2 min to 98 ul of Buffer C1 add 2 ul of labeled DNA U rinse ArrayStrips 200 ul water 4 x up and down denaturation of labeled DNA 10 min 2 min 5 min 95 C 2 min cool down discard water i transfer 100 ul labeled DNA to ArrayStrips 2 min 2 min Barcode Label here x LEE hybridise 58 C 550 rpm 60 min Meanwhile Login to the ArrayMate device and prepare your worklist 60 min 10 min U discard labeled DNA incubate twice in 200 ul Buffer C2 50 C 550 rpm 10 min prepare C3 C4 Conj
13. 005425 o 0 869878 0 864865 Be BE Ee 134 hp VD2 4i 0 958620 0 005606 0 0 867526 0 862360 siis leede 135 hp VD2 51 0 958620 0 002511 0 0 868119 0 865603 ee 136 hp VD2 52 0 750000 0 002343 0 0 872386 0 870215 Click on flag segmentation image and the grid alignment accuracy is shown in the window on the right pr Browse Search results results b raw data Segmentation image image E 2014 05 02 14 34 22 2014 05 02 14 39 27 New Run 2014 05 05 10 02 41 um 2014 05 05 10 03 01 dal 2014 05 05 10 03 15 2014 05 05 10 03 20 2014 05 06 11 18 58 2014 05 08 17 16 00 2014 05 08 18 04 37 2014 05 09 10 14 12 2014 05 09 10 23 46 2014 05 09 13 16 28 2014 05 09 13 39 16 2014 05 09 13 51 57 2014 05 14 10 22 04 2014 05 14 10 32 26 2014 05 14 10 36 52 j 2014 05 14 16 48 17 2014 05 14 17 04 00 j 2014 05 14 17 19 18 2014 05 14 17 28 21 j 2014 05 14 17 31 14 2014 05 23 17 39 45 2014 05 26 10 33 44 2014 05 28 15 32 20 2014 05 28 16 34 34 2014 05 28 16 44 02 2014 06 03 10 31 57 2014 06 04 10 40 41 2014 06 04 11 03 25 2014 06 04 11 12 53 2014 06 04 15 40 37 1 2014 06 04 15 41 43 2014 06 04 15 44 09 2014 06 10 10 08 48 BioChlam PCR23s C14 98 Cp pecorum BioChlam PCR23s C38 C trachomatis A BioChlam PCR23s DC11 Cp psitt AS Q BioChlam PCR23s DC25 Cp caviae mit E BioChlam PCR23s DC39 muridarum_AS BioChlam PCR23
14. 06 11 14 28 21 Software Version 2014 09 12 2014 06 12 09 36 55 2014 06 12 09 42 14 Device E 2014 06 12 09 43 47 rs Best 3 Assignments after Pattern Match with Reference 2014 06 13 16 44 01 Experiments 2014 06 20 13 46 31 B 2014 06 24 10 01 04 strain score explanation 2014 06 24 10 23 32 men d 201 sies ee C 23s rp C trachomatis 0 579222 The lowest score indicates the best 2014 06 26 11 40 05 DC38 match H 2014 06 27 13 11 18 C_23s_rt_neg ctrl 5 541616 jr 2014 0627 13 56 29 C 23s m C muridarum DCH 5 756433 2014 06 27 13 57 01 2014 07 03 10 01 21 2014 07 03 10 15 32 2014 07 03 10 20 52 Controls 2014 07 03 10 34 24 2014 07 03 10 47 12 z i F 2014 07 03 14 30 58 control result Ede BEES H 2014 07 08 13 55 03 staining control passed Failed indicates possible problems originating from the 2014 07 08 15 49 22 hybridization or the staining procedure 2014 07 10 11 33 48 Failed indicates possible problems originating from the staining 2014 07 10 11 35 58 negative control passed procedure Click on flag resultsB and the Test Report B is shown in the window on the right Browse Search kb results b raw data segmentation image image n print E 2 2014 06 10 10 08 48 New Run jioChlam ac a BioChlam PCR23s_DC11 Cp psitt_AS Q_SE S BioChlam PCR23s DC25 Cp caviae mit EG Opera
15. 14 17 28 21 2014 05 14 17 31 14 2014 05 23 17 39 45 2014 05 26 10 33 44 2014 05 28 15 32 20 2014 05 28 16 34 34 2014 05 28 16 44 02 2014 06 03 10 31 57 2014 06 04 10 40 41 2014 06 04 11 03 25 2014 06 04 11 12 53 2014 06 04 15 40 37 2014 06 04 15 41 43 2014 06 04 15 44 09 2014 06 10 10 08 48 BioChlam PCR23s_C14 98 Cp pecorum BioChlam PCR23s_C38 C trachomatis A BioChlam PCR23s DC11 Cp psitt AS Q BioChlam PCR23s DC25 Cp caviae mit E BioChlam PCR23s_DC39 muridarum AS BioChlam PCR23s DC40 pneumoniae AS BioChlam PCR23s DC6 C suis AS Q 58 BioChlam PCR23s_DC88 parrot AS Q 5 2 onta ne in fin 22 1 Archive EE EE BEE CR E E A A I E E E E E This image of the reference isolate C trachomatis shows an example for a valid test without any dust particles or non specific background The image file is automatically analysed be the ArrayMate software and a HTML report is provided that lists all markers that have been analysed Export of ChlamType 23S AS 4 Kit Test Report The generated result files in an html format will show information of all target genes Possible invalid controls that might display in this report will be explained below see Troubleshooting Other files that are generated and that can be exported include e A txt file with the raw measurements e An image file bmp with the actual photo of the array e A second image file png in which the coor
16. 33 0 944058 0 002300 0 0 875801 0 873662 e amp 2014 05 14 17 19 16 115 hp VD1 41 0 958620 0 005621 o 0 875818 0 870589 8 2014 05 14 17 28 21 116 hp VD1 42 0 779227 0 000078 0 0 874119 0 874192 2014 05 14 17 31 14 17 hp VDI 51 0 779227 0 002715 O 0 873212 0 870694 er as 118 hp VDI 52 0 944058 0 005141 D 0 873236 0 868467 EN 119 hp VO1 53 1 000000 0 002312 o 0 867402 0 865272 G 2014 05 28 16 34 34 12 simk negev 0 963950 0 004686 0 0 867672 0 863354 i 2014 05 28 16 44 02 120 hp VD1 54 0 958620 0 002581 0 0 871049 0 868660 E 2014 06 03 10 31 57 121 hp VO1 61 0 761887 0 005404 0 0 869112 0 864123 2014 06 04 10 40 41 122 hp VDI 71 0 958620 0 002323 o 0 866831 0 864691 2014 06 04 11 03 25 123 hp VD1 81 0 863636 0 006257 0 0 868091 0 862321 G 2014 06 04 11 12 53 124 hp VO2 101 0 958620 0 012902 0 0 866618 0 854740 8 2014 06 04 15 40 37 125 hp VD2 102 0 958620 0 008066 o 0 857945 0 850594 8 2014 06 04 15 41 43 126 hp VD2 11 0 944058 0 011135 o 0 861036 0 850851 E 2014 06 04 15 44 09 127 hp VD2 141 1 000000 0 004278 o 0 866481 0 862543 2014 06 10 10 08 48 123 hp_vD2 112 1 000000 0 008718 o 0 868343 0 860302 BioChlam PCR23s_C14 98 Cp pecorum 129 hp VD2 21 0 958620 0 005850 0 0 866431 0 861047 Biochlam PER23s 98 C trachomatis e 13 Cpneu TW 0 894998 0 005499 O 0 867854 0 862785 Biochlam PCRZ3s DC11 Cp psltt AS Q 130 hp VD2 31 0 827587 0
17. F 273884110454 6 C trachomatis DC38 Date of Result Tue Sep 16 08 47 24 2014 Assay Name Chlamydia 4 Assay Type 23s Assay ID 10454 Well Position Software Version 2014 09 12 Device Best 3 Assignments after Pattern Match with Reference Experiments strain score explanation C_23s_rp_C trachomatis DC38 0 579222 The lowest score indicates the best match C_23s_rt_neg ctrl 5 541616 C 23s rp C muridarum DC39 5 756433 Controls stainine c ntrol Failed indicates possible problems originating from the P hybridization or the staining procedure negative control passed Failed indicates possible problems originating from the staining procedure Internal Amplification and Hybridisation Control At least one of three EGFP probes have to be positive if you use the EGFP_588 positive Internal Amplification and Hybridisation Control EGFP 718 positive EGFP 745 positive rr 0101 0177 10 negative Marker indicating E coli DNA contamination Family affiliation classification explanation zi positive with C trachomatis C suis C caviae or C pneumoniae pos 56 A positive samples pos_56_C n gative positive with C abortus C psittaci C felis C avium or C gallinacea samples ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 37 www alere technologies com pos 56 G pos 56 T Genus marker chlamydia 1 chlamydophila 1 chlamydophila 2 negative positive with C muridarum samples
18. Switch on the ArrayMate 1 Main switch on the rear below the electric cable plug 2 4 Operating switch on the lower left corner of the front side e Switch on the screen switch is on the right hand side below the screen e Log in as R amp D User Research and Development User for full access to test specific software default password abcde If you log in as User you will obtain raw values but neither positives negatives interpretation nor strain assignment The Administrator log in default password 12345 will allow the installation of a new assay specific plug in which can be downloaded at http alere technologies com e The user interface will be loaded the ArrayMate performs internal testing This requires slightly less than a minute e Click New Run left edge of the screen A suggestion for a run name folder name for the new run appears in the top line of the screen You may modify or change the experiment name at your convenience e Type in your operator ID optional Worklist A Worklist file allows an identifier such as a laboratory or sample number to be linked to the respective array position on the ArrayStrip For privacy reasons arrays or the respective experiments should not be denoted with patient names Worklists can be generated using spreadsheet software such as EXCEL see below but must be saved in the txt file format which can be imported into the test specific ArrayMate software Do not incl
19. a hartmannellae 0 001 E 01 Parachlamydia acanthamoebae 0 004 i 02 Parachlamydia acanthamoebae 0 003 aM 01 Criblamydia sequanensis 0 001 B 02 Criblamydia sequanensis 0 001 E 01 Chlamydiales Xenoturbella 0 003 Ei 02 Chlamydiales Xenoturbella 0 001 E Estrella lausannensis 0 002 aM ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 41
20. achlamydia Criblamydia Chlamydiales or Estrella Mixed Infection Control This error message appears if more than one species is found from chlamydia species assignment after signal interpretation or if more than one genus marker chlamydia and chlamydophila is positive Plausibility Controls Mixed Infection Positive indicates a mixed infection comprising two or more Chlamydia strains or Control DNA contamination Special case If the species C caviae AND C felis or C pecorum AND C abortus give a mixed hybridisation pattern a special mixed infection control statement appears ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 27 www alere technologies com Plausibility Controls If all probes for C caviae AND C felis give a signal there are two possibilities of interpretation Mixed Infection i presence of C caviae only while the C felis signals are due to cross Control hybridisation if family marker pos 56 C is negative ii mixed infection of both species in this case family marker pos 56 C is positive see page B Or Plausibility Controls If all probes for C pecorum AND C abortus give a signal there are two possibilities of interpretation Mixed Infection i presence of C pecorum only while the C abortus signals are due to cross Control hybridisation if family marker pos 56 C is negative ii mixed infection of both species in this case
21. amydophila pneumoniae U68425 U68425 1 C_23s_rt_Chlamydophila pneumoniae U68426 Chlamydophila pneumoniae U68426 U68426 2 C 23s rt Chlamydophila psittaci AFA81048 Chlamydophila psittaci AFA81048 AF481048 1 C 23s rt Chlamydophila psittaci U68419 Chlamydophila psittaci U68419 U68419 2 C 23s rt Chlamydophila psittaci U68447 Chlamydophila psittaci U68447 U68447 2 C 23s rt Chlamydophila psittaci U68449 Chlamydophila psittaci U68449 U68449 1 C 23s rt Parachlamydia acanthamoebae Y07555 Parachlamydia acanthamoebae Y07555 Y07555 1 C 23s rt Candidatus Protochlamydia amoebophila BX908798 Candidatus Protochlamydia amoebophila BX908798 BX908798 1 practical reference experiment Strain affiliation C 23s rp C abortus S26 3 DC59 Chlamydophila abortus S26 3 DC59 C 23s rp C avium DC88 Chlamydophila avium DC88 C 23s rp C caviae DC25 Chlamydophila caviae DC25 C 23s rp C felis DC26 Chlamydophila felis DC26 C 23s rp C gallinacea DC63 Chlamydophila gallinacea DC63 C 23s rp C pecorum DC50 Chlamydophila pecorum DC50 C 23s rp C pneumoniae DC40 Chlamydophila pneumoniae DC40 C 23s rp C psittaci 6BC DC45 Chlamydophila psittaci 6BC DC45 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 36 www alere technologies com APPENDIX 4 HTML REPORT OF THE REFERENCE ISOLATE DC 38 TRACHOMATIS Page 1 For Research Use Only Not For Use In Diagnostic Procedures Operator Sample ID 03 F 273884110454 6 C trachomatis DC38 Experiment ID 03
22. and Hybridisation Control ml 0101 0177 10 111740 rr 0101 0177 10 111740 Marker indicating E coli DNA contamination ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 35 www alere technologies com APPENDIX 3 LIST OF REFERENCE EXPERIMENTS FOR PATTERN MATCH theoretical reference experiment Strain affiliation GenBank ID C 23s rt Chlamydophila abortus AY027873 Chlamydophila abortus AYO27873 AY027873 1 C 23s rt Chlamydophila abortus AY027874 Chlamydophila abortus AYO27874 AY027874 1 C_23s_rt_Chlamydophila abortus CR848038 Chlamydophila abortus CR848038 CR848038 1 C_23s_rt_Chlamydophila avium LCL_10071 Chlamydophila avium LCL_10071 LOL 1006714 C 23s rt Chlamydophila caviae AE016997 Chlamydophila caviae AE016997 AE016997 1 C_23s_rt_Chlamydophila felis U68458 Chlamydophila felis U68458 U68458 1 C 23s rt Chlamydophila felis U68459 Chlamydophila felis U68459 U68459 1 C 23s rt Chlamydophila galinacea AWUSO1000004 Chlamydophila galinacea AWUS01000004 AWUSO01000004 1 C 23s rt Chlamydophila ibidis APJWO1000003 Chlamydophila ibidis APJWO1000003 APJW01000003 1 C_23s_rt_Chlamydophila pecorum U68434 Chlamydophila pecorum U68434 U68434 4 C_23s_rt_Chlamydophila pneumoniae AE017160 Chlamydophila pneumoniae AE017160 AE017160 1 C 23s rt Chlamydophila pneumoniae BA000008 Chlamydophila pneumoniae BA000008 BA000008 3 C_23s_rt_Chlamydophila pneumoniae U68423 Chlamydophila pneumoniae U68423 U68423 1 C_23s_rt_Chlamydophila pneumoniae U68425 Chl
23. aturation e Pipette 98 ul of C1 buffer into a 1 5 ml tube and add 2 ul labelled duplex amplification product or 2 x 1 ul amplification product in case of two single runs Close the tube and mix gently e Incubate the mixture at 95 C for 5 min in a water bath or in a thermocycler e Cool down the tube on ice for 2 min e Pre washing the arrays e Switch on the thermoshaker and let it pre heat to 58 C e Remove the ArrayStrip s from the pouch e Insert the ArrayStrip s into the white frame Make sure the orientation is correct data matrix barcode close to row A and the strips fit properly e Pre wash the array s with 200 ul PCR grade distilled water per well pipette the water 4 times up and down at room temperature Remove the water from the well e Transfer the denaturated amplification product 100 ul to one well of the prepared strip e Incubate at 58 C and 550 rpm for 60 min Meanwhile login to the ArrayMate device and prepare your worklist see Data Analysis section p 18 e Remove the liquid and add 200 ul C2 Washing Buffer Incubate at 50 C and 550 rpm for 10 min remove and discard ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 14 www alere technologies com e Add another 200 ul C2 Washing Buffer Incubate at 50 C and 550 rpm for 10 min Meanwhile prepare conjugate For each experiment add 1 ul 100x HRP conjugate to 100 ul C4 Conjugation Buffer This mixture is stab
24. bility tested for short term shipment lt 1 week at ambient temperature lt 37 C The assay components with limited stability are D1 and C3 The other kit components have been proven to be stable for six months after expiry Suggested Reagents for DNA Labelling and Amplification Recommended but not included e Taq Polymerase S 5 U ul 10x Amplification buffer and 25 mM MgCl Genaxxon Taq Polymerase S high specificity Genaxxon BioScience GmbH http www genaxxon de Cat M3001 0500 e dNTPs 10 mM each Genaxxon PCR dNTP Mix Na salt Genaxxon BioScience GmbH http www genaxxon de Cat M3016 1010 e Double distilled dd water e INTYPE IC DNA QIAGEN Leipzig GmbH Cati 05 902 1 http www lab leipzig de as EGFP template 2 x 10 copies ul Suggested Reagents for DNA Labelling and Amplification Included e 23S Forward Primer 100 uM Forward primer Metabion 5 ATTGAMAGGCGAWGAAGGA 3 e 23S_Reverse Primer BIOTIN 100 uM Reverse primer Metabion 5 Bio GCYTACTAAGATGTTTCAGTTC 3 Target gene Chlamydia 23S rRNA Amplicon 171 bp e EGFP Forward Primer 10 uM Forward primer for internal amplification and hybridisation control Metabion 5 CAGCCACAACGTCTATATCATG 3 e EGFP Reverse Primer BIOTIN 10 uM Reverse primer for internal amplification and hybridisation control Metabion 5 Bio CTTGTACAGCTCGTCCATGC 3 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 4 www alere technologies
25. dinate grid is superimposed and the recognised spots are circled and e A XML xml files that contains the same information as the html result sheets for future export into databases etc ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 23 www alere technologies com Please note Only complete runs can be exported The export of individual ChlamType 23S AS 4 Kit Test Reports is not possible e Right click on the selected run a menu appears with the option Export Run Reports e Right click on Export Run Reports a file browser opens O M Browse Q Search E ARCHIVE 2009 02 05 09 00 42 expe v sample ID order37x order37x23 order37x order37x78 order37x order37x82 Mew Run s order42x01 Browse For Folder vee order42x02 del T order42x03 Choose a directory order42x06 order42x07 Order78x01 O Desktop Order78x01 a M 4 order78x08 ly Documents B 9 My Computer ee Local Disk C E Se Local Disk D e Removable Disk E m Ke e Folder My Computer e Click My Computer then Removable Disk and choose the folder where to save or click Make New Folder on the bottom a new folder icon appears e Rename the new folder e g with the experiment name or date e Click Ok data are exported into the new folder on your flash drive e Do NOT remove the flash drive as long
26. e prior to adding it to the labelling mix 5 10 min at 70 C to evaporate the ethanol Physical Damage to the Array Scratching the array surface with a pipette tip may damage array spots which may lead to the impairment or absence of a valid signal In this case the respective marker will not be assigned as negative but instead the message none appears next to the marker name Report Unavailable If the ArrayMate indicates that no report is available for an array or multiple arrays on one strip please check that the strip has been positioned properly in the frame Scratches or drops of condensed water might render the barcode identifier unreadable so please wipe it carefully or try to identify the test manually If no obvious reason for the fault can be detected please contact the technical service ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 29 www alere technologies com ADDITIONAL INFORMATION Warranty Alere Technologies guarantees the performance as described in this user guide The usage of the kit was successfully tested at ambient temperatures up to 37 C A guarantee is limited to ambient temperatures in the laboratory between 18 to 28 C Assay components comprise the arrays and their caps the lysis enhancer the reagents for DNA labelling and for detection of labelled DNA products on the array the ArrayMate reader and its software In case one of these components fails within the expi
27. e processed on the ArrayMate reader only Alternative devices ATRO1 03 are not suitable for reading ArrayStrips If you have questions please contact us e conoclust software provided with the reader e Test specific software plug in can be downloaded from Alere Technologies website check periodically for updates for details see below Specific information such as spot names marker names location of the spots on the array and size of the image taken by the reader s camera is delivered with the reader or can be downloaded from our website These test specific plug ins will be updated occasionally Please check the NEWS section of our website www alere technologies com e Support is available via cct home clondiag com Components Required but Not Provided e DNA preparation kits The assay has been tested using the DNeasy Blood amp Tissue Kit by Qiagen Cat 69504 and the High Pure PCR Template Preparation Kit from Roche Cat 11796828001 Kits from other suppliers can be used if validated for the assay Please note The DNA specimen needs to be sufficient in quality for PCR reactions e Equipment for DNA isolation e g pipettes centrifuge thermoshaker or automated device e Photometer OD 260 nm for measuring the DNA concentration e Equipment for non denaturing agarose DNA gel electrophoresis for quality control of DNA e Thermocycler for PCR e Thermoshaker for hybridisation Please note We strongly recommend the BioSha
28. eference strains as positive control and in addition double distilled water as negative control Prepare a master mix by combining the following components per sample Volume Final 23s PCR Components in ul concentration water double distilled water buffer 10x Genaxxon Amplification Buffer d 1x MgCl 25 mM MgCl Genaxxon 1 5 mM dNTP Mix dNTPs 10 mM each Genaxxon i 0 2 mM Primer P1 23S Forward Primer 100 uM 500 nM Primer P2 23S Reverse Primer BIOTIN 100 uM 500 nM Primer P3 EGFP Forward Primer 10 uM 50 nM Primer P4 EGFP Reverse Primer BIOTIN 10 uM 50 nM Polymerase Genaxxon Taq Polymerase S high specificity 5U ul O 1U 10 EGFP Template INTYPE IC DNA 2 x 10 copies ul 1x10 copies ul Replace with dd water if you don t use the control v osoalu pPlwinw ir e Add 1 ul of Chlamydia DNA to 19 ul of the master mix Do not forget to label the vial properly e Conduct amplification in a programmed thermocycler e g Eppendorf Mastercycler gradient with heated lid according to the following temperature time profile ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 8 www alere technologies com Pre heat cover lid to 105 C 60 sec at 96 C 30 sec at 94 C 40 cycles with 30 sec at 60 C 30 sec at 72 C 240 sec at 72 C Cool down to 4 C hold e The samples can be stored at 20 C un
29. ents do not require a Material Safety Data Sheet MSDS They do not contain more than 1 of a component classified as hazardous and do not contain more than 0 1 of a component classified as carcinogenic Therefore MSDS are not provided Nevertheless the buffers may cause irritation if they come into contact with eyes or skin and may cause harm if swallowed The regular precautions associated with laboratory work should be obeyed e g wear protective goggles gloves and lab coat and avoid contact with the reagents If liquids have been spilled clean with a disinfectant and or laboratory detergent and water Alere assumes no liability for damage resulting from the handling of or contact with these products If you have any questions please contact our Technical Support see above Shipping Precautions RID ADR Kein Gefahrgut No dangerous goods IMDG No dangerous goods IATA No dangerous goods ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 3 www alere technologies com REAGENTS AND DEVICES Kit Components Storage and Stability All reagents are provided in surplus see below If necessary all components may be ordered separately Please refer to the catalogue reference numbers Cat at page 32 of this manual For pricing please contact your local representative or our customer service respectively The expiry date can be found on each bottle and on the outer packaging All components have been sta
30. er Alere Technologies GmbH Loebstedter Str 103 105 07749 Jena Germany Contact If you require any further information on this product please e mail to cct home clondiag com ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 31 www alere technologies com LITERATURE http alere technologies com en products lab solutions chlamydia html UPDATES amp SOFTWARE Notifications on database software updates and freeware tools can be found at http alere technologies com en science technologies publications downloads html and or http alere technologies com en news html ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 32 www alere technologies com APPENDIX 1 FLOW CHARTS The figures summarise the test procedure However please refer to the text section of this manual at any step of the test protocol for further important details Protocol Quantifoil BioShake iQ pro hands prepare ArrayStrips prepare DNA cessing on time time label genomic Chlamydia DNA in 130 20 min thermocycler min 1 ul DNA plus MasterMix preparing labeled DNA 2 min 2 min to 98 ul of Buffer C1 add 2 ul of labeled DNA i rinse ArrayStrips 200 ul water 4 x up and down denaturation of labeled DNA 30 min 2min 5 min 95 C 2 min cool down discard water transfer 100 ul labeled DNA to ArrayStrips 2 min 2 min Barcodes i ee here EE hybridise 58 C 550 rpm 60 min Meanwhile Login to
31. icroarray strip and keep it clean General Remarks for the Handling of Liquids We recommend the use of a multichannel pipette and reagent reservoirs We strongly recommend that the liquid is removed by pipetting rather than inverting the strips and pouring the liquids out Disposable fine tipped soft Pasteur pipettes such as VWR Cat 612 2856 are suited best Always place the pipette tip at the space between the array and the wall of the reagent well If you touch the array surface probes may be scratched off and this may cause errors Pasteur pipette plastic with a flexible tip HE T flexible tip ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 10 www alere technologies com oa Pipette tip Use the space between the array and the wall of the tube Do never touch the array Array General Remarks The Substrate Precipitating Dye D1 An appropriate amount of D1 substrate precipitating dye should be transferred into an Eppendorf tube and taken out of the refrigerator when starting the procedure to allow it to pre warm to room temperature 25 C Cold D1 may yield weak signals D1 should be centrifuged prior to use to remove bubbles as well as possible precipitates quick spin Triggered by peroxidase in the case of positive reactions the dye precipitates but it is not covalently bound The precipitate can be dissolved by vigorous shaking Thus the arrays must not be shaken dropped
32. ioChlam PCR23s_C14 98 Cp pecorum AS C gt New Run BioChlam PCR23s C38 C trachomatis_A5 Q_ em BioChlam PCR23s_DC11 Cp psitt_AS Q_58 4 ES BioChlam PCR23s DC25 Cp caviae mit EGFP BioChlam PCR23s DC39 muridarum AS Q St Archive BioChlam PCR23s DC40 pneumoniae AS Q BioChlam PCR23s DC6 C suis AS Q 58 43 BioChlam PCR23s DC88 parrot AS Q 58 43 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 20 www alere technologies com Click on a Sample ID and the ChlamType 23S AS 4 Kit test report flag results for this array is shown in the window on the right Browse QQ Search results results b raw data segmentation image image Da nn E E 2014 06 10 10 08 48 BioChlam PCR23s C14 98 Cp pecorum AS For Research Use Only Not For Use In Diagnostic Procedures New Ri aS Operator BioChlam PCR23s_DC11 Cp psitt AS Q 5t E E BioChlam PCR23s_DC25 Cp caviae mit EG Sample ID 03 F 273884110454_6_C trachomatis DC38 BioChlam PCR23s DC39 muridarum AS Q Experiment ID 03 F 273884110454_6_C trachomatis DC38 Archive BioChlam PCR23s DC40 pneumoniae AS C ES BioChlam PCR23s_DC6 C suis AS Q 58 4 Date of Result Tue Sep i 08 47 24 2014 BioChlam PCR23s_DC88 parrot AS Q 58 Assay Name Chlamydia 4 E see A Assay Type 23s 2014 06 10 10 26 36 HE 2014 06 10 13 38 09 Assay ID 10454 2014 06 10 13 43 26 Well Position GH 2014
33. ioShake iQ by Olnstruments equipped with a customised heating block designed to fit ArrayStrips e Preparation of the hybridisation mixture denaturation e Pipette 98 ul of C1 buffer into a 1 5 ml tube and add 2 ul labelled duplex amplification product or 2 x 1 ul amplification product in case of two single runs close the tube and mix gently e Incubate the mixture at 95 C for 5 min in a water bath or in a thermoshaker e Cool down the tube on ice for 2 min e Pre washing the arrays e Switch on the thermoshaker and let it pre heat to 58 C e Remove the ArrayStrip s from the pouch e Insert the ArrayStrip s into the white frame Make sure the orientation is correct data matrix barcode close to row A and the strips fit properly e Pre wash the array s with 200 ul PCR grade distilled water per well pipette the water 4 times up and down at room temperature Remove the water from the well ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 12 www alere technologies com e Transfer the denaturated amplification product 100 ul to one well of the prepared strip e Incubate at 58 C and 550 rpm for 60 min Meanwhile login to the ArrayMate device and prepare your worklist see Data Analysis section p 18 e Remove the liquid and add 200 ul C2 Washing Buffer Incubate at 43 C and 550 rpm for 10 min remove and discard e Add another 200 ul C2 Washing Buffer Incubate at 43 C and 550
34. ke iQ by QInstruments www ginstruments com equipped with a customised heating block designed to fit ArrayStrips Alternatively you may use Eppendorf s Thermomixer Comfort equipped with a heating block for microtiter plates ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 6 www alere technologies com e Pipettes Suitable for 1 ul 5 ul volumes 90 ul 100 ul 200 ul and 1000 ul e Multichannel pipettes for 100 200 ul e Sterile reaction vials suitable for PCR VWR Cat 732 0098 e Ultrapure PCR grade water e Pasteur pipettes VWR Cati 612 2856 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 7 www alere technologies com AMPLIFICATION AND INTERNAL BIOTIN LABELLING We provide all primers All other recommended components should be purchased from a supplier of your choice EGFP Forward Primer EGFP Reverse Primer BIOTIN and INTYPE IC DNA are necessary if you use the Internal Amplification and Hybridisation Control EGFP If you don t use the control please ignore the error message on the report page 1 If you use field samples or other samples with very low initial DNA concentrations please make sure to run the PCR amplification reactions in two single runs instead of running them as duplex PCR combine the 2 PCR reactions afterwards and hybridize them against one and the same microarray We recommend including external amplification controls that contain DNA of Chlamydia r
35. la lausannensis negative Page 2 For Research Use Only Not For Use In Diagnostic Procedures Operator Sample ID 03 F 273884110454 6 C trachomatis DC38 Experiment ID 03 F 273884110454 6 C trachomatis DC38 Date of Result Tue Sep 16 08 47 24 2014 Assay Name Chlamydia 4 Assay Type 23s Assay ID 10454 Well Position Software Version 2014 09 12 Device Controls marker value o o 0 1 0 2 0 3 0 4 O S 0 6 0 7 0 8 0 9 0 1M NaPP Standard pH 9 0 002 i W MEE rr 0101 0177 10 0 001 E EGFP 745 0394 rr os A ors us WENNNNNEEEEEEEE Family ie e on oa o2 oa oa os a 107 os os NM MN psc oo pos ssc oom poset oos Genus marker value o o 0 1 0 2 0 3 04 0 5 0 6 0 7 0 8 0 9 Gmi oss RE chlamydophila 1 0 045 B ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 39 www alere technologies com chlamydophila 2 0006 ME Chlamydia Species _ 2 EE sess BR Gamma oo A Cube 55 oo NE canin oo NE ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 40 www alere technologies com Other Chlamydiales marker value 0 0 0 1 0 2 0 3 0 4 0 5 0 6 10 7 0 8 0 9 S negev 0 002 aM simk negev 1961 0 003 W chon 1 0 002 B waddlia chondr 1870 0 0 aM 01 Protochlamydia amoebophila 0 001 ss 02 Protochlamydia amoebophila 0 002 Protochlamydia naegleriophila Knic 0 003 B Neochlamydi
36. le at room temperature for around one working day C3 is delivered with a surplus of 100 and C4 with a surplus of 200 96 Suggested pipetting scheme 1 2 3 4 6 7 10 11 15 16 20 21 30 31 40 well wells wells wells wells wells wells wells C3 1 5 ul 3 5 ul 7 ul 11 ul 16 ul 21 ul 32 ul 42 ul C4 150 ul 350 ul 700 ul 1100 ul 1600ul 2100 ul 3200 ul 4200 ul e Remove the Washing Buffer and add 100 ul diluted conjugate to each well incubate at 30 C and 550 rpm for 10 min e Remove the conjugate add 200 ul C5 Washing Buffer Pipette the buffer 4 times up and down at room temperature e Remove the Washing Buffer add 100 ul of D1 substrate precipitating dye at 25 C see above per well e Incubate at 25 C for 5 min but do not shake e Remove liquid completely e The bottom of the ArrayStrips outside surface may be cleaned carefully with wipes Bubbles may be removed by removing and adding D1 e Scan and process see below ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 15 www alere technologies com Data Analysis Starting the ArrayMate Reader We recommend launching the ArrayMate Reader after starting the hybridisation this allows the worklist file to be imported prior to the beginning of manual operations Please note that this is a short instruction only For more detailed information please refer to the ArrayMate User Manual e
37. list path My Computer Removable Disk e Open your selected worklist by pressing Enter or Open e Press your imported worklist opens in a separate window Proofread If the new window is empty or if it was the wrong worklist repeat the import e Press OK the worklist window will close ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 18 www alere technologies com e Leave the flash drive in the ArrayMate if you intend to export ChlamType 23S AS 4 Kit reports afterwards Check the flash drive regularly for computer viruses and malware using an appropriate program e Press Next at the bottom right on the screen reader is opening e Carefully insert the appropriate metallic adapter frame into the ArrayMate Do not apply strong force Ensure proper fit otherwise the images may be out of focus e Carefully insert the white frame with the array strips into the metallic adapter Ensure the correct orientation Position A1 in the frame next to the data matrix barcode on the adapter and proper fit otherwise the images may be out of focus ArrayStrip frame with inserted strips Strips are inserted in accordance with the Worklist Please note ArrayStrips must be clean They should not contain any liquids during analysis Data matrix codes must be clean There must be no Array StripCaps on the wells to be analysed however unused wells should remain capped e Press Next at the bo
38. negative positive with C pecorum or C ibidis samples classification explanation positive positive with C trachomatis C suis or C muridarum samples positive with C abortus C psittaci C felis C avium C gallinacea negative S Ge C caviae C pneumonia C ibidis or C pecorum samples positive with C abortus C psittaci C felis C avium C gallinacea negative C caviae C pneumonia C ibidis or C pecorum samples Chlamydia Species Assignment after Signal Interpretation marker abortus caviae felis psittaci pecorum pneumoniae suis muridarum trachomatis avium alalalalalalalalalalea gallinacea Other Chlamydiales marker Simkania Waddlia 01 Protochlamydia amoebophila 02 Protochlamydia amoebophila Protochlamydia naegleriophila Knic Neochlamydia hartmannellae 01 Parachlamydia acanthamoebae 02 Parachlamydia acanthamoebae 01 Criblamydia sequanensis 02 Criblamydia sequanensis 01 Chlamydiales classification explanation negative negative negative negative negative negative negative negative positive negative negative classification explanation negative negative negative negative negative negative negative negative negative negative negative ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 235 AS 4 Kit 38 www alere technologies com Xenoturbella 02 Chlamydiales Xenoturbella g Estrel
39. ntation image image Spot ID Substance Confidence Signal Valid Background Mean E 2014 05 02 14 34 22 1 Ctracho 1885 0 958620 0 750610 o 0 840087 0 170261 TUM 2014 05 02 14 39 27 10 Ccav GPIC 0 894998 0 006376 0 0 870907 0 865009 AMP 2014 05 05 10 02 41 100 hp rnpB 606 0 944058 0 004041 0 0 849999 0 846351 iE 2014 05 05 10 03 01 101 hp mp 607 0 958620 0 007530 0 0 860491 0 853608 F 2014 05 05 10 03 15 102 hp rpB 608 0 969587 0 012014 o 0 866278 0 855223 mE en no 103 hp_mpB_609 1 000000 0 005699 0 0 865348 0 860109 a 2014 0 08 17 16 00 104 re ap 0 958620 0 009656 0 0 866424 0 857537 E 2014 05 08 10 04 37 105 p rmpB 611 1 000000 0 005101 0 0 869031 0 864322 i 2018 05 09 10 14 12 106 hp FPB 612 0 779227 0 002083 o 0 869438 0 867515 E 2014 05 09 10 23 46 107 hp VDI 1 0 915591 0 005719 0 0 870865 0 865574 i 2014 05 09 13 16 28 108 hp VO1 12 0 833223 0 005335 0 0 870328 0 865395 i 2014 05 09 13 39 16 109 hp VO1 13 0 863636 0 008393 o 0 867298 0 859566 2014 05 09 13 51 57 u waddia ch 1 000000 0 005860 0 0 868343 0 862938 2014 05 14 10 22 04 110 hp VDI 21 1 000000 0 001700 o 0 863529 0 865088 8 2014 05 14 10 32 26 111 hp VD1 22 0 749234 0 005006 0 0 869915 0 865289 ig 2014 05 14 10 36 52 112 hp VO1 81 0 944058 0 005025 o 0 873427 0 868765 ig 2014 05 14 16 48 17 113 hp VD1 32 0 944058 0 007281 0 0 874311 0 867549 2014 05 14 17 04 00 114 hp VD1
40. ocol for Eppendorf s Thermomixer Comfort with Microtiter Plate Adapter 14 BO CN n 16 Starting the ArrayMate Reader 0i ieeui line 16 WOrklist ee ee ee 16 Data Acquisition in the ArrayMate Reader E 18 GIE 20 Export of ChlamType 23S AS 4 Kit Test Report 23 TROUBLESHOOTING AND REPORT INTERPRETATION ese ees se se ee es se ee ee ee ee ee ee ee ee se ee ee ee ee ge ee ee ee ge de 25 Staining Control EE RE OE RE N N 25 Negative 809 RE 26 Marker rr 0101 0177 ds E 26 Plausibility Controls see be vee GE EE ea 26 Internal Amplification and Hybridisation Control EGER see sees se esses 26 Family and Genus Control 27 Keeseren deene 27 Image Oud eer ee 29 DNA Quality and RNA Contamination Control 29 Physical Damage to the Array esses ennemi nnnnnn nennen nnne ee ee ELF I ILL nenu 29 Report Unavailable ssssssssssssseeesesee eene eene enne ne ee ee assess Ee ee sanas ee ee nennen 29 ABBITIONALINFORMATION Se ee ven 30 Warranty is DE 30 ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit www alere technologies com DiselaimMe EER Mr EE EF FA ON m 30 Q ality CONtrOl pc 30 List of Components for Separate Order u 31 Legal Marufacturer P 31 Contact
41. ry date due to reasons other than misuse contact Alere Technologies for replacement or refund Terms and conditions apply If you have any problem or question please contact the technical service Disclaimer This system is for research use only We do not accept any liability for damages caused by misuse That includes the use for diagnostic applications and for the guidance of therapy We shall not be held liable for damages caused by an inappropriate use of the device as a personal computer for instance related to the use of additional software to network connections or to a breach of privacy related to the storage of confidential information such as names of patients on its hard disk and or to the use of external storage devices that might be contaminated with spyware Quality Control Each batch is stringently tested for good performance and correctness of results ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 30 www alere technologies com List of Components for Separate Order If required these reagents for the ChlamType 23S AS 4 Kit may be ordered separately component name Late Jo Cat storage 23S FP 23S Forward Primer 20 ul LOO MI 246503501 23S_RP 23S_Reverse primer 20 ul 20 C Primer BIOTIN 100 uM EGFP FP EGFP Forward Primer 20 ul UM l 246503502 EGFP_RP EGFP_Reverse primer 20 ul 20 C Primer BIOTIN 10 uM For prices please contact us Legal Manufactur
42. s_DC40 pneumoniae AC BioChlam PCR23s DC6 C suis AS Q 58 BioChlam PCR23s DCB8 parrot AS i eg 2N14 NA 1N 10 22 17 gt Archive lolol9 e sii de o o GR S Q i DIololeFP ele 1E BE Dfe felek ob o o o o c e o o o o o o BE Oo oe OO olo o O EN E lolo l5 e O lolol lolol eio L3 O lolo elo Ds ojo jo Ojo o e e O lo O o o O 3 ole e o o a oo lo Qe 12 CL O of O21 o Olo o P o o olo o 9 O JoJo o jo o o Click on flag image and the image file bmp is shown in the window on the right ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 22 www alere technologies com quu Browse Search results results b raw data segmentation image image Ce 2014 05 02 14 34 22 2014 05 02 14 39 27 New Run 2014 05 05 10 02 41 2014 05 05 10 03 01 KS 2014 05 05 10 03 15 2014 05 05 10 03 20 2014 05 06 11 18 58 2014 05 08 17 16 00 amp 2014 05 08 18 04 37 2014 05 09 10 14 12 2014 05 09 10 23 46 2014 05 09 13 16 28 2014 05 09 13 39 16 2014 05 09 13 51 57 2014 05 14 10 22 04 2014 05 14 10 32 26 2014 05 14 10 36 52 2014 05 14 16 48 17 2014 05 14 17 04 00 2014 05 14 17 19 18 2014 05
43. til use Please note When using another thermocycler minor adaptations to the program might be necessary Proper validation involving reference samples and controls is indispensable before routine use of the assay Hybridisation General Remarks for the Handling of Arrays e Never touch the array surface e Avoid complete drying of the array surface during processing e Do not allow the array to stay without liquid for more than two minutes e Never rinse the wells with distilled water after the hybridisation step only use C2 Washing Buffer Unused wells should remain capped during the whole procedure The strips may be processed up to three times without loss of quality of properly capped unused arrays Close all wells that will not be used with a cap and leave them there until use for storage conditions after use see section Kit components storage and stability Hybridisation and Detection Always label your array strips with a laboratory marker at the recommended position Never label them on the bottom or across the data matrix barcode This may cause errors ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 9 www alere technologies com Data Matrix code keep it clean label here Ca Avoid contact of data matrix barcode with organic solvents The ArrayMate needs the information encoded in the data matrix to perform the assay and the analysis afterwards Avoid touching the bottom of the m
44. tor Bochlam PERE CX mundarum A Sample ID O3 F 273884110454 B C trachomatis DC38 Archive BioChlam PCR23s_DC40 pneumoniae AS C BioChlam PCR23s_DC6 C suis AS Q 58 4 Experiment ID U3 F 273884110454 6 C trachomatis DC38 Bochlam PCRZ3s DOS parrot A5 Q 58 Date of Result Tue Sep 16 08 47 24 2014 2014 06 10 10 22 17 2014 06 10 10 26 36 Assay Name Chlamydia 4 2014 06 10 13 38 09 Assay Type 23s 2014 06 10 13 43 26 2014 06 11 14 28 21 Assay ID 10454 2014 06 12 09 36 55 Well Position Nu 2014 06 12 09 42 14 2014 06 12 09 43 47 Software Version 2014 09 12 2014 06 13 11 45 33 Device S 2014 06 13 12 20 56 2014 06 13 16 44 01 E 2014 06 20 13 46 31 Controls EF 2014 06 24 10 01 04 2014 06 24 10 23 32 Eh 2014 06 25 15 36 19 marker value 00 i P 5 a X E P Pe P 2014 06 26 11 40 05 2014 06 27 13 11 18 0 1M NaPP Standard pH 2014 06 27 13 56 35 9 2014 06 27 13 57 01 2014 07 03 10 01 21 biotin 2014 07 03 10 15 32 ml DID1 D177 10 2014 07 03 10 20 52 2014 07 03 10 34 24 EGFP 745 2014 07 03 10 47 12 EGFP 718 2014 07 03 14 38 58 2014 07 08 13 55 03 EGFP 588 Click on flag raw data and the raw data is shown in the window on the right ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 21 www alere technologies com Browse Search results results b raw data segme
45. ttom right on the screen reader closes analysis program starts it takes about 2 10 min depending on the number of strips the reader takes images and automatically analyses the data The progress of the reading is indicated by the following symbols photographed in analysis ready e The reader indicates the end of the entire process with an acoustic signal beep e Press Next at the bottom right on the screen reader is opening e Remove the white frame with the ArrayStrip s e Press Next at the bottom right on the screen reader is closing ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 19 www alere technologies com Results On the left hand side of the screen there you will see a list showing all runs stored on the ArrayMate s hard disk A run contains the results from all arrays analysed together within one frame If this list is not displayed e Press Archive left hand side and activate the flag Browse at the top left The runs are organised like folders in Windows Explorer and named by default according to the date of acquisition Example There is one experiment run in this archive Browse d Search E i ARCHIVE 42013 02 06 13 22 37 Mew Run Archive If you click on the plus symbol left to the run name the folder opens and you will see a list of the individual arrays alphabetically ordered by Sample ID monse suh Ea 2014 06 10 10 08 48 B
46. ude special characters such as OO V etc ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 16 www alere technologies com e Create a list with at least three columns having headers written in the first line The following headers are obligatory in this order position samplelD assaylD Table 1 e Positions are consecutively numbered from 1 to a maximum of 96 Position 1 would correspond to A1 8 to H1 9 to A2 and 96 to H12 Table 2 Do not leave empty lines in the worklist If you use EXCEL position numbers should be entered into column A e Sample IDs are strain sample laboratory numbers e g as exported from your LIMS or designated in any different way Patient names should not be used as sample IDs e _ The Assay ID allows the system to identify the current test and to correctly use information on layout spot number and identity etc The ChlamType 23S AS 4 Kit has the Assay ID 10454 Please note When entering assay IDs manually make sure to enter the correct number as this could lead to errors or loss of data e You may add further columns and headers with notes and comments at your convenience Information from these columns will neither appear on the result screen nor in the Test Report e Werecommend the use of a printout of the worklist as a template for pipetting e Save the worklist as tab separated txt file on the memory stick provided together with the ArrayMate
47. ugate C3 C4 1 100 preheat Substrate D1 25 C 25 min 5 min discard Buffer C2 incubate in 100 ul C3 C4 Conjugate 30 C 550 rpm 10 min 15 min 3 min l discard C3 C4 Conjugate rinse with 200 ul Buffer C5 4 x up and down 2 min 2 min discard Buffer C5 incubate with 100 ul Substrate D1 25 C 5 min 10 min 2 min discard Substrate D1 analyse ArrayMate 10 min 5 min total time requirement app 4 5h app 1h ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 34 www alere technologies com APPENDIX 2 PROBE TO TARGET TABLE Tagegees Je femen OSOS C muridarum C mur 1 pm C mur 2 mm Cmur MoPn 552 genetic marker for C muridarum C suis C suis 1 C suis 2 Csu H5 549 Csu S45 1878 genetic marker for C suis C trach 1 pm C trach 2 mm C trach 3 mm C mur 2 mm Ctracho 1885 Cabots Cabo B577 533 Cp abortus 2 genetic marker for C abortus o cavae Ccav GPIC 535 Cp caviae 3 Cp caviae 4 genetic marker for C caviae C felis Ciel Baker 535 OCp felis 2 genetic marker for C felis C pecorum Cp pecorum 1 Cp pecorum 2 Cpec IPA 538 genetic marker for C pecorum Cp pneu 1 Cp pneu 2 Cpneu TW 183 568 neu Cpneu TW 183 siteG Cp psittaci 3 Cp psittaci 4 Cpsi 6BC 1869 Cpsi WC 535 genetic marker for C psittac C trachomatis genetic marker for C trachomatis C pneumoniae genetic marker for C pneumoniae 01 C avium A1 04 C avium A2 03 C avi
48. um gall genetic marker for C avium 02 C gallinacea B1 05 C gallinacea B2 i genetic marker for C gallinacea 03_C_avium gall simk_negev_1961 S_negev_1 genetic marker for simkania waddlia_chondr_1870 W_chon_1 genetic marker for waddlia 00102 Protochlamydiaamoebophila UWE25_00093 00119 00119 Protochlamydiaamoebophila 03_Protochlamydianaegleriophila Knic_00084 00106 04_Neochlamydiahartmannellae _00086 00110 Neochlamydiahartmannellae 05 Parachlamydiaacanthamoeba genetic marker for e 00098 00127 05 Parachlamydiaacanthamoebae 00098 00127 Parachlamydiaacanthamoebae 06_Parachlamydiaacanthamoeba genetic marker for e 00114 00142 06 Parachlamydiaacanthamoebae 00114 00142 Parachlamydiaacanthambebae 07_Criblamydiasequanensis_00096 00120 genetic marker for Criblamydiaseguanensis 08_Criblamydiasequanensis_00123 00146 genetic marker for Criblamydiaseguanensis 09_ChlamydialesXenoturbella_00102 00132 genetic marker for ChlamydialesXenoturbella 6 genetic marker for Protochlamydianaegleriophila Knic genetic marker for 03_ProtochlamydianaegleriophilaKnic_00084 0010 04_Neochlamydiahartmannellae_00086 00110 10 ChlamydialesXenoturbella 0 0110 00140 10 ChlamydialesXenoturbella 00110 00140 genetic marker for Chlamydiales Xenoturbella 16 Estrellal i hs alausannensis 00096 16 Estrellalausannensis 00096 00118 genetic marker for Estrellalausannensis EGFP EGFP 745 EGFP 718 EGFP 588 Internal Amplification
49. ydiales Specifications Upon receipt the assay components need to be stored at different temperatures as specified in the package insert The assay has to be performed at an ambient temperature of 18 C to 28 C Technical Support If you require any further information on this product please contact Email cct home clondiag com Phone 49 0 36 41 3111 0 Fax 49 0 36 41 3111 120 For up to date information regarding the kit please visit our website http www alere technologies com ChlamType 23S AS 4 Kit 05 16 04 0011 VO1 ChlamType 23S AS 4 Kit 2 www alere technologies com Safety Precautions e The assay is intended for use by personnel trained in microbiological and molecular methods Preparation of DNA from Chlamydia requires expertise in microbiology molecular biology and the local regulations for handling pathogenic microorganisms biosafety level 2 avian C psittaci biosafety level 3 are to be obeyed e Extracted chlamydial DNA from the different sources may be processed without further biosafety precautions although contamination needs to be ruled out e Always wear protective clothing as required for laboratory work according to your specific regulations on laboratory safety Material Safety Data Sheets MSDS According to OSHA 29CFR1910 1200 Commonwealth of Australia NOHSC 1005 1008 1999 and the latest amendments to the European Union Directives 67 548 EC and 1999 45 EC the enclosed reag
Download Pdf Manuals
Related Search