pTrcHis-TOPO - Thermo Fisher Scientific
Contents
1. Restriction Enzyme pTrcHis pTrcHis2 pTrcHis TOPO lacZ pTrcHis2 TOPO lacZ BamH I 4400 bp linearizes N A N A N A Hind III 4400 bp linearizes N A N A 4371 3079 bp Xmn I Nco I 3900 700 160 bp N A N A N A Apal N A 4405 bp N A N A linearizes SnaB I N A 4405 bp N A N A linearizes Clal N A N A 4558 707 46 bp N A BamH VEcoR I N A N A 4371 940 bp N A NcoI N A N A N A 7450 bp linearizes TOPO Cloning Once pTrcHis and pTrcHis2 have been adapted with topoisomerase I they are lot Efficiency qualified using the control reagents included in the kit Under conditions described on pages 24 26 a 750 bp control PCR product was TOPO Cloned into each vector and subsequently transformed into the One Shot competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Primers All primers have been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique One Shot TOP10 All competent cells are tested for transformation efficiency using the control plasmid Competent E coli Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be 1 x 10 cfu ug DNA for chemically competent cells In addition untransformed cells are tested for appropriate2. Strong transcription termination region Orosz et al 1991 Ampicillin resistance gene lactamase Allows selection of the plasmid in E coli pBR322 derived origin Medium copy replication and growth in E coli lacI4 gene Encodes the ac repressor for regulation of the trc promoter M ller Hill et al 1968 Map and Features of pTrcHis2 TOPO pTrcHis2 TOPO The map below shows the features of pTrcHis2 TOPO For the full sequence of the Map vector you may download it from our Web site www invitrogen com or call Technical Service page 33 pTrcHis2 TOPO 4381 bp Comments for pTrcHis2 TOPO 4381 nucleotides trc promoter and 5 bases 190 382 35 region bases 193 198 10 region bases 216 221 lac operator lacO bases 228 248 rrnB antitermination signal bases 264 333 gene 10 region bases 346 354 Ribosome binding site bases 369 373 pTrcHis Forward priming site bases 370 390 Minicistron ORF bases 383 409 Reinitiation RBS bases 398 403 Initiation ATG bases 413 415 TOPOS Cloning site bases 421 422 myc epitope bases 446 475 Polyhistidine region bases 491 508 pTrcHis2 Reverse priming site bases 564 581 rrnB T1 and T2 transcriptional terminators bases 614 771 bla promoter bases 993 1050 Ampicillin resistance gene bla bases 1051 1911 pBR322 derived origin bases 2056 2729 Lac Repressor ac ORF bases 3383 4342 continued on next page 29 Map and F
3. It was constructed by amplifying the lacZ gene from pTrcHis2 lacZ and TOPO Cloned into pTrcHis2 TOPO It yields a 120 kDa expression product Map of The figure below summarizes the features of the pTrcHis2 TOPO lacZ vector For the Control Vector full sequence of the vector you may download it from our Web site 32 www invitrogen com or call Technical Service page 33 pTrcHis2 TOPO lacZ 7450 bp RIES Comments for pTrcHis2 TOPO lacZ 7450 nucleotides trc promoter and 5 UTR bases 190 382 35 region bases 193 198 10 region bases 216 221 lac operator lacO bases 228 248 rrnB antitermination signal bases 264 333 gene 10 region bases 346 354 Ribosome binding site bases 369 373 pTrcHis Forward priming site bases 370 390 Minicistron ORF bases 383 409 Reinitiation RBS bases 398 403 Initiation ATG bases 413 415 LacZ fusion protein bases 413 3580 LacZ portion of fusion bases 413 3487 myc epitope bases 3515 3544 Polyhistidine region bases 3560 3577 pTrcHis2 Reverse priming site bases 3633 3650 rrnB T1 and T2 transcriptional terminators bases 3683 3840 Ampicillin resistance gene b a bases 4120 4980 pBR322 derived origin bases 5125 5798 Lac Repressor lacl ORF bases 6327 7411 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulation
4. TOPO aussen Bere 27 Map and Features of pTicHis2 TOPO nennen la 29 PlieHis TOPO21222 nessun motu uou ma etum EC RUNE 31 PIGH TOPO ae nenn est es 32 Technical Service eU SO at ER Dee 33 Purchaser Notification nd iet HR a et eee fer der e ed reos 34 Qualifying the Product rero e rod eh ettet ete ee de te ets 35 References cccccessessesscccoceseessneucccesscevseneusecesecvesensueceesesessensuscescecessonauecescscessenaneceecevsnsnsunecesescecessneseseese 36 Kit Contents and Storage Shipping and The pTrcHis and pTrcHis2 TOPO TA Expression Kits are shipped on dry ice Each kit Storage contains a box with TOPO TA Cloning reagents Box 1 and a box with TOP10 One Shot competent cells Box 2 Store Box 1 at 20 C and Box 2 at 80 C pTrcHis and The pTrcHis TOPO TA Expression Kit contains the pTrcHis TOPO vector which pTrcHis2 TOPO allows you to clone in frame with an N terminal tag The pTrcHis2 TOPO TA TA Expression Expression Kit contains the pTrcHis2 TOPO expression vector which allows you to Kits clone in frame with a C terminal tag See the table below for ordering information Product Pack Size Catalog no pTrcHis TOPO TA Expression Kit 20 K4410 01 containing pTrcHis TOPO vector pTrcHis2 TOPO TA Expression Kit 20 K4400 01 containing the pTrcHis2 TOPO vector 40 K4400 40 TOPO TA Cloning The TOPO TA Cloning reagents Box 1 for both kits are listed below Please
5. continued on next page 21 Purifying PCR Products continued Low Melt Agarose Method 22 If you gel purify your PCR product in low melt agarose use the procedure below Please note that gel purification will result in a dilution of your PCR product and decreased cloning efficiencies 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer 2 Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts 4 Place the tube at 37 C to keep the agarose melted 5 Inafresh tube mix together 4 ul of the melted agarose containing your PCR product and 1 ul of TOPO vector Incubate at 37 C for 5 to 10 minutes 7 Transform 2 to 4 ul directly into TOP10 One Shot cells using the method on page 12 Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by Vent or Pfu polymerases into TOPO TA Cloning vectors is often difficult because of very low cloning efficiencies Proofreading polymerases lack the terminal transferase activity that adds the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform e 3M sodium acetate e 100 ethanol e 80
6. for removal of the N terminal peptide In addition to the features listed in Description of Vectors above pTrcHis2 TOPO encodes a C terminal peptide containing the c myc epitope and a 6xHis tag for detection and purification of the recombinant protein continued on next page Overview continued TOPO Cloning Induction of Expression Both pTrcHis TOPO and pTrcHis2 TOPO are supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase I covalently bound to the vector this is referred to as activated vector Taq polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector TOPO Cloning exploits the ligation activity of topoisomerase by providing an activated linearized TA vector using proprietary technology Shuman 1994 Ligation of the vector with a PCR product containing 3 A overhangs is very efficient and occurs spontaneously within 5 minutes at room temperature The TOPO Cloning reaction can be transformed into chemically competent cells provided or electroporated directly into electrocompetent cells Activated TOPO Cloning Vector Taq amplified PCR product 3 with 3 A overhangs E yecto Topolsomerase Taq amplified PCR
7. mM of each dNTP R725 01 Xpress Forward Primer 2 ug lyophilized N576 02 Designing PCR Primers for pTrcHis TOPO Introduction Special Considerations Primer Design Note It is very important to design your PCR primers to ensure you obtain the recombinant protein you need for your studies Please use the information below and the diagram on the next page to design your PCR primers pTrcHis TOPO is designed with the initiation ATG correctly spaced from an optimized ribosome binding site to ensure maximum translation This ATG is located at bp 413 415 and is contained in the unique Nco I site The N terminal peptide can be cleaved off from partially purified or purified recombinant protein using enterokinase Please note that you will have at least four extra amino acids at the N terminus of your protein Asp Pro Thr Leu The exact number of additional amino acids will depend on your PCR product Suggestions for primer design are provided in the table below If you wish to Then clone in frame with the DNA encoding the N terminal peptide the forward PCR primer must be designed to ensure that your ORF is cloned in frame with the DNA encoding the N terminal peptide remove the N terminal leader for expression of truly native protein Note Proteins with N terminal leaders tend to express better in E coli You may wish to prepare constructs with and without the l
8. minicistron ribosomes efficiently reinitiate translation at the second initiation site Schoner et al 1986 TOPO Cloning site Allows fast insertion of your PCR product for expression C terminal myc epitope optional Allows detection of the fusion protein by the Anti Myc Antibody Catalog no R930 25 Evan et al 1985 C terminal polyhistidine region optional Forms metal binding site for affinity purification of recombinant fusion protein on metal chelating resin i e ProBond In addition it allows detection of the recombinant protein with Anti His C term Antibody see page 4 pTrcHis2 Reverse priming site Permits sequencing of your insert from the 3 end rrnB transcription termination region Strong transcription termination region Orosz et al 1991 Ampicillin resistance gene lactamase Allows selection of the plasmid in E coli pBR322 derived origin Medium copy replication and growth in E coli lacI4 gene Encodes the ac repressor for regulation of the trc promoter Miiller Hill et al 1968 pTrcHis TOPO lacZ Description pTrcHis TOPO lacZ is a 5311 bp control vector containing a fragment of the lacZ gene fused to the N terminal peptide It was constructed by amplifying a 921 bp lacZ gene fragment and TOPO Cloning it into pTrcHis TOPO It yields a 40 kDa expression product Map of The figure below summarizes the featur
9. of PCR buffer dNTPs primers and Tag polymerase Use a 20 ul reaction volume Multiply by the number of colonies to be analyzed e g 10 2 Pick 10 colonies and resuspend them individually in 20 ul of the PCR cocktail Remember to patch colonies to a separate plate to preserve the colonies 3 Incubate the reaction for 10 minutes at 94 C to lyse the cells and inactivate nucleases 4 Amplify for 20 to 30 cycles 94 C for 1 minute 55 C for 1 minute and 72 C for minute 5 For the final extension incubate at 72 C for 10 minutes Hold at 4 C Visualize by agarose gel electrophoresis continued on next page 13 TOPO Cloning and Transformation continued If you have problems obtaining transformants or the correct insert please see pages 24 26 Control reactions are described using reagents supplied in the kit This will help you important troubleshoot your experiment Please perform the control reactions before calling Technical Service Long Term Once you have identified the correct clone be sure to purify the colony and make a Storage glycerol stock for long term storage 1 Streak the original colony out for single colonies on LB plates containing 50 ug ml ampicillin and 0 596 glucose 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml ampicillin and 0 5 glucose Grow until culture reaches mid log ODeoo 0 5 0 7 3 Mix 0 85 ml of culture with 0 15 ml of sterile glycer
10. of your protein to ensure that the cells were grown and induced correctly If you find that the positive control did not express it may be that the IPTG solution is too old Prepare fresh IPTG solution see page 20 Problem Possible Cause Solution Recombinant protein is not detected on a Coomassie stained gel Low expression of recombinant protein Use western blot analysis to detect recombinant protein expression You may use antibody to your own protein or the appropriate antibody listed on page 4 Low expression of recombinant protein Recombinant plasmid is unstable or protein is slightly toxic Include glucose in the growth medium to reduce basal levels of transcription Be sure to check plasmid to ensure that no rearrange ments have occurred See page 16 for details Taq polymerase may introduce mutations Sequence your construct If you find mutations redo your PCR using a proofreading polymerase and add 3 A overhangs using the method on page 23 No expression detection of protein PCR product is out of frame with the N terminal peptide or the initiation codon and or C terminal peptide Sequence your construct to confirm the protein is in frame with the N terminal peptide or the initiation codon and the C terminal tag if the tag is desired Taq polymerase may introduce mutations Sequence your construct If you find mutations redo your PCR using a
11. proofreading polymerase and add 3 A overhangs using the method on page 23 Recipes LB Luria Bertani Medium and Plates SOB Medium with Ampicillin Appendix Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl 0 5 glucose dextrose pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Prepare a 5046 solution of glucose dextrose Filter sterilize or autoclave as described below Note Solution may turn yellowish This is normal 4 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solutions to cool to 55 C Add antibiotic to the medium if needed Add glucose to a final concentration of 0 5 5 Store at room temperature or at 4 C Shelf life with ampicillin is 1 2 weeks LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic 50 ug ml of ampicillin and glucose to 0 5 if desired Pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark Shelf life with ampicillin is 1 2 weeks SOB per liter 2 Tryptone 0 5 Yeast Extract 0 05 NaCl 2 5 mM KCl 10 mM MgCl 1 Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water 2 Makea250 m
12. Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
13. DNA Template 10 100 ng 10X PCR Buffer Sul 50 mM dNTPs 0 5 ul Primers 100 200 ng ul each 1 ul each Sterile water add to a final volume of 49 ul Taq Polymerase 1 unit ul 1 ul Total Volume 50 ul 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If not see the Note below 3 Use the PCR product immediately in a TOPO Cloning reaction next page or store the product at 20 C until ready for use PCR products may be stored at 20 C for about 1 week Long term storage may result in removal of the 3 A overhangs from your PCR product This will decrease cloning efficiency in the TOPO Cloning reaction If you do not see a single discrete band from your PCR use one of the options below to Note ensure a single PCR species in your TOPO Cloning reaction Please note that small PCR products will clone preferentially over larger ones Gel purify your fragment before using either the pTrcHis or pTrcHis2 TOPO TA Cloning Kit see page 21 Take special care to avoid sources of nuclease contamination Optimize your PCR to eliminate multiple bands and smearing Innis er al 1990 The PCR Optimizer Kit Catalog no K1220 01 from Invitrogen can help you optimize your PCR Please call Technical Service for more information page 33 10 TOPO Cloning and Transformation Introduction Materials Supplied by the User Mechanism of Glucose Repression Preparation TOPO Cloning
14. Hill B Crapo L and Gilbert W 1968 Mutants That Make More lac Repressor Proc Natl Acad Sci USA 59 1259 1262 Mulligan M E Brosius J and Clure W R 1985 Characterization in vitro of the Effect of Spacer Length on the Activity of Escherichia coli RNA Polymerase at the tac Promoter J Biol Chem 260 3539 3538 Olins P O Devine C S Rangwala S H and Kavka K S 1988 T7 Phage Gene 10 Leader RNA a Ribosome binding Site the Dramatically Enhances the Expression of Foreign Genes in Escherichia coli Gene 73 227 235 Orosz A Boros I and Venetianer P 1991 Analysis of the Complex Transcription Termination Region of the Escherichia coli rrnB Gene Eur J Biochem 201 653 659 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Schoner B E Belagaje R M and Schoner R G 1986 Translation of a Synthetic Two cistron mRNA in Escherichia coli Proc Natl Acad Sci USA 83 8506 8510 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 1999 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 36 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue
15. Invitrogen pTrcHis and pTrcHis2 TOPO TA Expression Kits Five minute cloning of Taq polymerase amplified PCR products for expression in E coli Catalog no K4410 01 pTrcHis TOPO Catalog nos K4400 01 and K4400 40 pTrcHis2 TOPO Version J 23 February 2006 25 0209 A Limited Label License covers this product see Purchaser Notification By use of this product you accept the terms and conditions of the Limited Label License ii Table of Contents Table of Contents avis etic id a abel ee eee Aen iii Kat Contents and Storage een pee eret a a a bit NE iv Methods emm E 1 Overview E cohen AIRES Rots Rie Pies ER le bene deemed 1 Designing PCR Primers for pTreHis TOPO ar eed ai eto ea ide re Gri rore ba deb 6 Designing PCR Primers for pTrcHis2 TOPO c cssscsscsssssssssssscssessssssseasessesssssocercssssenscessenesseseneeacenses 8 Prod cing PCR Products x t oe eee et bese Sian o cote he 10 TOPO Cloning and Transformation iet iR 11 Expression of the PER Prod ct 2 2 tata o n D EGER cp egent 15 Troubleshoot 2 3 29 e coa ded be e P ae PED Ete in 18 l i 19 RECIPES pe 00 ae 19 Puntying PCR Products he ea a einen bert Rp eee o EP eure in tas 21 Addition of 3 A Overhangs Post Amplification eese nennen ener nenne 23 TOPO TA Cloning Control Realtek sea Blei ma t ecu t d 24 Map and Features of pIreHis
16. License No 22 Vectors and Clones Encoding Histidine Hexamer 34 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Cor
17. M KCI solution by dissolving 1 86 g of KCl in 100 ml of deionized water Add 10 ml of this stock KC solution to the solution in Step 1 3 Adjust pH to 7 5 with 5 M NaOH and add deionized water to 1 liter 4 Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCl You may also add ampicillin to 50 ug ml 5 Store at 4 C Medium is stable for only 1 2 weeks continued on next page 19 Recipes continued 1MIPTG 1 To prepare a 1 M stock solution dissolve 2 38 g of IPTG in 10 ml of deionized water 2 Filter sterilize and store in 1 ml aliquots at 20 C 20 Purifying PCR Products Introduction Note Using the S N A P MiniPrep Kit Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products 21 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Please refer to Current Protocols in Molecular Biology Unit 2 6 for the most common protocols Ausubel et al 1994 Two simple protocols are provided below that work for most people Please note that cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band see Producing PCR Products page 10 The S N A P MiniPrep Kit Catalog no K1900 01 allows yo
18. Product 5 3 5 Topoisomerase 1 5 minutes at room temperature Topoisomerase PCR A Product A Topoisomerase I Ligation complete ready for transformation The strong trc promoter regulates expression in E coli The product of the lacI gene encoded in both vectors represses this promoter To induce expression IPTG is added to a final concentration of 1 mM and the culture monitored for expression of the protein of interest continued on next page Overview continued Experimental The flow chart below outlines the general steps needed to express your protein Outline Design Primers for PCR Produce PCR product TOPO Cloning Reaction Mix together PCR product and TOPO vector at room temperature Transform into TOP10 E coli cells Incubate 5 minutes Select and analyze colonies CC Select and analyze colonies gt Select a positive transformant and induce expression with 1mM IPTG continued on next page Overview continued Detection of Recombinant Proteins Purification of Recombinant Protein Expression of your recombinant protein can be detected using an antibody to the protein itself or to the appropriate epitope The table below describes the antibodies available for use with pTrcHis TOPO or pTrcHis2 TOPO Horseradish peroxidase HRP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection meth
19. an SDS PAGE gel 1 Stain the gel with Coomassie blue and look for a band of increasing intensity in the expected size range for the recombinant protein Note The tags contribute 3 to 4 kDa to your protein 2 Use the negative control to distinguish recombinant proteins from background proteins 3 Use the positive control to confirm that growth and induction was done properly pTrcHis TOPO lacZ should yield a 40 kDa protein and pTrc His2 TOPO lacZ should yield a 120 kDa protein with maximum expression occurring between 3 4 hours 4 You should be able to determine the optimal time point for maximum expression If you do not see your protein of interest please see the Troubleshooting section page 18 You may find that your recombinant protein may be slightly toxic or unstable because of high levels of basal transcription Use glucose to further repress transcription see page 11 Supplementing LB medium with 25 mM glucose 0 5 w v prior to induction will repress basal level transcription from the trc promoter To induce expression pellet the cells and resuspend them in LB without glucose and add IPTG to induce Use the conditions determined previously to grow and induce 50 ml of cells This is the largest culture volume to use with the 2 ml prepacked columns included in the ProBond Purification System If you need to purify larger amounts of recombinant protein you may need more ProBond resin See page 4 for ordering i
20. antibiotic sensitivity and lack of phage contamination 35 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brosius J Erfle M and Storella J 1985 Spacing of the 10 and 35 Regions in the tac Promoter J Biol Chem 260 3539 3541 Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Taq DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Egon A Brosius J and Ptashne M 1983 Vectors Bearing a Hybrid trp lac Promoter Useful for Regulated Expression of Cloned Genes in Escherichia coli Gene 25 167 178 Evan G I Lewis G K Ramsay G and Bishop V M 1985 Isolation of Monoclonal Antibodies Specific for c myc Proto oncogene Product Mol Cell Biol 5 3610 3616 Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Jacob F and Monod J 1961 Genetic Regulatory Mechanisms in the Synthesis of Proteins J Mol Biol 3 318 328 Li S C Squires C L and Squires C 1984 Antitermination of E coli rRNA Transcription is Caused by a Control Region Segment Containing Lambda nut like Sequences Cell 38 851 860 Miiller
21. d ultra pure plasmid DNA for automated or manual sequencing we recommend the S N A P MiniPrep Kit Catalog no K1900 01 or the S N A P MidiPrep Kit K1910 01 3 Analyze the plasmids by restriction analysis or by sequencing For pTrcHis TOPO use the Xpress Forward and the pTrcHis Reverse sequencing primers for sequencing For pTrcHis2 TOPO use the pTrcHis Forward and Reverse sequencing primers to sequence your insert For the sequence surrounding the TOPO Cloning site please refer to the diagram on page 7 for pTrcHis TOPO or page 9 for pTrcHis2 TOPO If you need help with setting up restriction enzyme digests or DNA sequencing please refer to general molecular biology texts Ausubel et al 1994 Sambrook et al 1989 Alternative Method You may wish to use PCR to directly analyze positive transformants Use either the of Analysis Forward or Reverse sequencing primer and a primer that hybridizes to your insert as PCR primers If this is the first time you have used this technique we recommend that you perform restriction analysis in parallel to confirm that PCR gives you the correct result False positive and false negative results can be obtained because of mispriming or contaminating template The following protocol is provided for your convenience Other protocols are suitable Note Additional primers and nucleotides are available separately See page 5 for ordering information 1 Prepare a PCR cocktail consisting
22. eader and compare expression the forward PCR primer can be designed to include a unique Nco I site which contains the first ATG of your protein Ex 1 5 ACC ATG G After TOPO Cloning your PCR product the vector can be digested with Nco I and religated assuming there are no internal Nco I sites in your PCR product include the native stop codon for your protein include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site Do not add 5 phosphates to your primers for PCR This will prevent ligation into pTrcHis TOPO continued on next page Designing PCR Primers for pTrcHis TOPO continued pTrcHis TOPO The diagram below is supplied to help you design appropriate PCR primers to correctly Cloning Site 191 261 331 395 449 503 551 621 691 761 clone and express your PCR product Restriction sites are labeled to indicate the actual cleavage site The complete sequence is available by downloading from our Web site www invitrogen com or by calling Technical Service see page 33 35 10 lac operator lacO p L 34 TGTTGACAAT TAATCATCCG GCTCGTATAA TGTGTGGAAT TGTGAGCGGA TAACAATTTC ACACAGGAAA rrnB antitermination sequence i CAGCGCCGCT GAGAAAAAGC GAAGCGGCAC TGCTCTTTAA CAATTTATCA GACAATCTGT GTGGGCACTC pTrcHis Forward priming site gene 10 tra
23. eatures of pTrcHis2 TOPO continued The important elements of pTrcHis2 TOPO 4381 bp are described in the following table All features have been functionally tested Features of pTrcHis2 TOPO Feature Benefit trc promoter region Provides high level inducible expression of recombinant proteins in coli It is a hybrid promoter consisting of the 35 region from trpB and the 10 region from the lacUV5 promoter Egon ef al 1983 lac operator lacO Binding site of the lac repressor to provide regulated expression of the trc promoter Jacob and Monod 1961 rrnB antitermination signal Sequence from the rrnB gene that reduces the level of premature transcription termination Li et al 1984 T7 gene 10 translational enhancer Sequence from bacteriophage T7 gene 10 that optimizes translation initiation Olins et al 1988 pTrcHis Forward priming site Permits sequencing of your insert from the 5 end Minicistron RBS and Initiation ATG A short open reading frame containing nucleotide sequences that is efficiently translated in prokaryotic cells A ribosome binding site RBS is present within the coding sequence 5 to the translation termination codon This RBS and termination codon are positioned in frame and three nucleotides upstream from the translation initiation codon used to express the fusion protein of interest Following translation of the open reading frame of the
24. es of the pTrcHis TOPO lacZ vector For the full Control Vector sequence of the vector you may download it from our Web site www invitrogen com or call Technical Service page 33 eae ea uid Nhe o o zZ mini SEE cistron g ATG 6xHis ebtope EK lacZfrag rrnB term g10 RBS Comments for pTrcHis TOPO JlacZ 5311 nucleotides pTrcHis TOPO lacZ trc promoter and 5 UTR bases 190 382 5311 bp 35 region bases 193 198 10 region bases 216 221 lac operator lacO bases 228 248 rrnB antitermination sequence bases 264 333 T7 gene 10 translational enhancer bases 346 354 Ribosome binding site 369 373 pTrcHis Forward priming site bases 370 390 Minicistron bases 383 409 Reinitiation RBS bases 398 403 lacZ fusion protein bases 413 1480 Initiation ATG bases 413 415 6xHis tag bases 425 442 Xpress epitope bases 482 505 Xpress forward priming site bases 445 463 Enterokinase cleavage site bases 491 505 lacZ gene fragment bases 518 1438 pTrcHis reverse priming site bases 1495 1512 rrnB T4 and T2 transcription termination sequence bases 1545 1702 bla promoter bases 1923 1980 Ampicillin resistance gene bla bases 1981 2841 pBR322 derived origin bases 2986 3659 Lac Repressor acl bases 4188 5272 3l pTrcHis2 TOPO lacZ Description pTrcHis2 TOPO lacZ is a 7450 bp control vector containing the gene for B galacto sidase fused to the C terminal peptide
25. esentatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 33 Purchaser Notification Limited Use Label License No 5 Invitrogen Technology Limited Use Label
26. ethanol e TE buffer Procedure This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with Veni or Pfu polymerase place vials on ice and add 0 7 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place the vials on ice Use immediately in a TOPO Cloning reaction Note If you plan to store your sample s overnight before proceeding with TOPO Cloning you may want to extract your sample s with phenol chloroform to remove the polymerases After phenol chloroform extraction precipitate the DNA with ethanol and resuspend the DNA in TE buffer to the starting volume of the amplification reaction You may also gel purify your PCR product after amplification with Vent or Pfu see previous page After purification add Tag polymerase buffer dATP and 0 5 unit of Taq polymerase and incubate 10 15 minutes at 72 C Use 4 ul in the TOPO Cloning reaction Note Vent is a registered trademark of New England Biolabs 23 TOPO TA Cloning Control Reactions Introduction If you have trouble obtaining transformants or vector containing insert please perform the following control reactions to help troubleshoot your experiment Performing the control reactions involves producing a 750 bp control PCR product and TOPO Cloning it using the reagents included in the kit Successful TOPO Clo
27. hat optimizes translation initiation Olins et al 1988 Minicistron RBS and Initiation ATG A short open reading frame containing nucleotide sequences that is efficiently translated in prokaryotic cells A ribosome binding site RBS is present within the coding sequence 5 to the translation termination codon This RBS and termination codon are positioned in frame and three nucleotides upstream from the translation initiation codon used to express the fusion protein of interest Following translation of the open reading frame of the minicistron ribosomes efficiently reinitiate translation at the second initiation site Schoner et al 1986 6xHis tag Forms metal binding site for affinity purification of recombinant fusion protein on metal chelating resin i e ProBond HisG epitope Allows detection of the fusion protein by the Anti HisG Antibodies see page 4 Xpress Forward priming site Permits sequencing of your insert from the 5 end Xpress epitope Allows detection of the fusion protein by the Anti Xpress Antibodies see page 4 Enterokinase recognition site Encodes the binding site for bovine enterokinase to permit removal of the N terminal peptide from your protein TOPO Cloning site Allows fast insertion of your PCR product for expression pTrcHis Reverse priming site Permits sequencing of your insert from the 3 end rrnB transcription termination region
28. he DNA Adding glucose to the medium can reduce intracellular cAMP levels Supplementing LB medium and agar plates with glucose will repress basal level transcription from the trc promoter For each transformation you will need one vial of competent cells and one or two selective plates e Equilibrate a water bath to 42 C e Thaw the vial of SOC medium from Box 2 and bring to room temperature e Warm LB plates containing 50 ug ml ampicillin and 0 5 glucose at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot cells for each transformation continued on next page 11 TOPO Cloning and Transformation continued TOPO Cloning Reaction One Shot Transformation Reaction Transformation by Electroporation 12 In general 0 5 to 4 ul of a typical PCR sample 10 20 ng ul with an average insert length of 400 to 1000 bp will give the proper insert vector ratio for TOPO Cloning 1 Set up the following 5 ul TOPO Cloning reaction Fresh PCR product 0 5 to 4 ul Sterile Water add to a final volume of 4 ul TOPO vector lul Final Volume Sul Mix gently and incubate for 5 minutes at room temperature 25 C For the best possible results do not leave for more than 5 minutes or the transformation efficiencies may decrease If needed the TOPO Cloning reaction may be stored on ice or frozen at 20 C for up to 24 hours You may see a decrease in the transformation efficiency but the cloning efficiency s
29. hould remain high We recommend that you proceed immediately to Transformation below ON SUA GPS qp Add 2 ul of the TOPO Cloning reaction into a vial of One Shot cells and mix gently Do not mix by pipetting up and down Incubate on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature SOC medium Cap the tube tightly and shake the tube horizontally at 37 C for 30 minutes Spread 10 50 ul from each transformation on a prewarmed selection plate and incubate overnight at 37 C We recommend that you plate two different volumes to ensure well spaced colonies For plating smaller volumes add 20 ul of SOC to ensure even spreading An efficient TOPO Cloning reaction will produce hundreds of colonies Pick 10 colonies for analysis Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the TOP10 One Shot chemically competent cells for electroporation continued on next page TOPO Cloning and Transformation continued Analysis of 1 Take the 10 colonies and culture them overnight in LB medium containing Positive Clones 50 ug ml ampicillin and 0 5 glucose Note If you use a rich broth like SOC or Terrific Broth grow the cells for 4 hours before performing a miniprep do not grow overnight We obtain less DNA with overnight growth 2 Isolate plasmid DNA using your method of choice If you nee
30. itiation codon EcoRI BstB Hind III SnaB myc epitope 413 ATG GCC ONE GGC GAA TTC GAA GCT TAC GTA GAA CAA AAA CTC ATC TCA GAA GAG GAT TAC CGG GAW Product TIC CCG CIT iia Met Ala Leu Lys Gly Glu Phe Glu Ala Tyr Val Glu Gln Lys Leu Ile Ser Glu Glu Asp 6xHis tag Soa 473 CTG AAT AGC GCC GTC GAC CAT CAT CAT CAT CAT CAT TGA GTTTAAACG GTCTCCAGCT TGGCTGTTTT Leu Asn Ser Ala Val Asp His His His His His His pTrcHis Reverse priming site l Ferne 541 GGCGGATGAG AGAAGATTTT CAGCCTGATA CAGATTAAAT CAGAACGCAG AAGCGGTCTG ATAAAACAGA ATTTGCCTGG rrnB T4 and T2 transcription terminators 621 CGGCAGTAGC GCGGTGGTCC CACCTGACCC CATGCCGAAC TCAGAAGTGA AACGCCGTAG CGCCGATGGT AGTGTGGGGT 701 CTCCCCATGC GAGAGTAGGG AACTGCCAGG CATCAAATAA AACGAAAGGC TCAGTCGAAA GACTGGGCCT TTCGTTTTAT Producing PCR Products Introduction This section describes a procedure for PCR using the primers you designed Please note that other procedures are suitable Materials Supplied You will need the following reagents and equipment by the User e Tag polymerase e Thermocycler e DNA template Primers for PCR product Producing PCR 1 Set up the following 50 ul PCR reaction Use the cycling parameters suitable for Products your primers and template Be sure to include a 7 to 30 minute extension at 72 C to ensure that all PCR products are full length and 3 adenylated Use 10 ng template for plasmids and 100 ng template for genomic DNA
31. ive control 1 For each strain inoculate 2 ml of SOB or LB containing 50 ug ml ampicillin with a single recombinant E coli colony 2 Grow overnight at 37 C with shaking 225 250 rpm 3 The next day inoculate 10 ml of SOB or LB containing 50 ug ml ampicillin with 0 2 ml of the overnight culture 4 Grow the culture at 37 C with vigorous shaking to an ODgoo 0 6 the cells should be in mid log phase 5 Remove a 1 ml aliquot of cells centrifuge at maximum speed in a microcentrifuge for 30 seconds and aspirate the supernatant Freeze the cell pellet at 20 C This is the zero time point sample 6 Add IPTG to a final concentration of 1 mM 9 ul of a 1 M IPTG stock to 9 ml and grow at 37 C with shaking 7 Take 1 ml samples every hour for 5 hours or more and treat as described in Step 5 Label each tube to correspond to the number of hours postinduction continued on next page 15 Expression of the PCR Product continued Preparation of Time Point Samples Analysis of Time Point Samples Reducing Basal Levels of Recombinant Protein Scale Up of Expression 16 Before starting prepare SDS PAGE gels to analyze all the time points you collected 1 When all the time points have been collected resuspend each pellet in 100 ul of 1X SDS PAGE sample buffer 2 Boil 5 minutes and centrifuge briefly If solution is viscous sonicate briefly and centrifuge again 3 Analyze 5 ul of each sample on
32. nformation 1 Inoculate 2 ml of SOB or LB containing 50 ug ml ampicillin with a single recombinant E coli colony Grow overnight at 37 C with shaking 225 250 rpm The next day inoculate 50 ml of SOB or LB containing 50 ug ml ampicillin with 1 ml of the overnight culture Grow the culture at 37 C with vigorous shaking to an OD 0 6 the cells should be in mid log phase Add IPTG to a final concentration of 1 mM 50 ul of 1 M IPTG stock to 50 ml Grow at 37 C with shaking until the optimal time point is reached Harvest the cells by centrifugation 3000 x g for 10 minutes at 4 C At this point you may proceed directly to purification please refer to the ProBond Purification System manual or store the cell pellet at 80 C for future use continued on next page Expression of the PCR Product continued Enterokinase Cleavage For recombinant proteins expressed from pTrcHis TOPO you may wish to remove the N terminal tag from your partially pure or purified protein We recommend using EnterokinaseMax Catalog no E180 01 a recombinant form of bovine enterokinase For more information please see our Web site www invitrogen com or contact Technical Service page 33 17 Troubleshooting Troubleshooting Table 18 If you have trouble expressing your protein try some of the suggestions listed below Please be sure to include the positive and negative controls when testing for expression
33. ng Reactions Analysis of Results Transformation Control Using the control PCR product produced on the previous page and the pTrcHis TOPO or pTrcHis2 TOPO vectors set up two 5 ul TOPO Cloning reactions as described below 1 Setup control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Control PCR Product lul Sterile Water 4ul 3 ul TOPO vector Iul Iul 2 Incubate at 25 C room temperature for 5 minutes and place on ice Do not incu bate longer than 5 minutes at room temperature 3 Transform 2 ul of each reaction into separate vials of TOP10 One Shot cells page 12 4 Spread 10 50 ul of each transformation mix onto LB plates containing 50 u g ml ampicillin and 0 5 glucose We recommend that you plate two different volumes of the transformation reaction to ensure well spaced colonies For plating small volumes add 20 ul SOC to ensure even spreading 5 Incubate overnight at 37 C Hundreds of colonies from the Vector PCR Insert reaction should be produced Select 10 colonies and culture in LB containing 50 ug ml ampicillin and 0 5 glucose Isolate plasmid DNA and analyze by restriction enzyme digestion For pTrcHis TOPO use EcoR I and BamH I For pTrcHis2 TOPO use Nco I and EcoR I Digestion of each recombinant vector will yield 3 fragments 100 bp 650 bp and 4 4 kb vector backbone Greater than 85 of the transformants will yield this dige
34. ning large inserts 3 to 10 kb try the TOPO XL PCR Cloning Kit Catalog no K4700 01 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Cloning blunt end PCR products Add 3 A overhangs by incubating with Tag polymerase page 23 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments lt 100 bp present in certain PCR reactions Gel purify your PCR product page 21 or optimize your PCR PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase Taq polymerase is less efficient at adding a nontemplate 3 A next to another A Taq is most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Map and Features of pTrcHis TOPO pTrcHis TOPO The map below shows the features of pTrcHis TOPO For the full sequence of the Map vector you may download it from our Web site www invitrogen com or call Technical Service page 33 g10 RBS ATG 6xHis Xs pTrcHis TOPO 4390 bp Comments for pTrcHis TOPO 4390 nucleotides trc promoter and 5 UTR bases 190 382 35 region bases 193 198 10 region bases 216 221 lac operator site bases 228 248 rrnB anti termination sequence bases 264 333 T7 gene 10 translational enhancer bases 346 354 Ribosome binding
35. ning of the control PCR product will yield gt 85 recombinants Before Starting Be sure to prepare LB plates containing 50 ug ml ampicillin and 0 5 glucose before performing the control reaction Use two plates per transformation Tip If you already have LB plates containing 50 ug ml ampicillin only you may spread 20 ul of a 2 M or a 50 glucose solution onto the plate Incubate the plate at 37 C for 30 minutes to allow the glucose to diffuse into the plate Please note that the concen tration of glucose does not have to be exact Producing Control 1 To produce the 750 bp control PCR product set up the following 50 ul PCR PCR Product Control DNA Template 100 ng Iul 10X PCR Buffer Sul 50 mM dNTPs 0 5 ul Control PCR Primers 0 1 ug ul each lu Sterile Water 41 5 ul Taq Polymerase 1 unit ul lul Total Volume 50 ul 2 Overlay with 70 ul 1 drop of mineral oil Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C IX Denaturation minute 94 C Annealing 1 minute 55 C 25X Extension minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 750 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page 24 continued on next page TOPO TA Cloning Control Reactions continued Control TOPO Cloni
36. note Reagents that the user must supply Taq polymerase Store Box at 20 C Item Concentration Amount pTrcHis TOPO OR 10 ng ul plasmid DNA in 1 tube of 25 pTrcHis2 TOPO vector 50 glycerol ul 50 mM Tris HCl pH 7 4 at 25 C 1 mM EDTA 2 mM DTT 0 196 Triton X 100 100 ug ml BSA phenol red 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 100 ul 42 C 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 12 5 mM dCTP 10 ul 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water continued on next page lv Sequences of Kit Contents and Storage continued pTrcHis TOPO TA Cloning Reagents continued for both vectors Item Concentration Amount 1 M IPTG 1 M IPTG in sterile water 1 ml Xpress Forward Sequencing Primer 0 1 ug ul in TE Buffer 20 ul for pTrcHis TOPO pTrcHis Forward Sequencing Primer 0 1 ug ul in TE Buffer 20 ul for pTrcHis2 TOPO pTrcHis Reverse Sequencing Primer 0 1 ug ul in TE Buffer 20 ul Control PCR Primers 0 1 ug ul each in TE Buffer 10 pl pTrcHis TOPO lacZ or pTrcHis2 TOPO lacZ Control PCR Template 0 1 ug ul in TE Buffer 10 ul Sterile Water 1 ml Expression Control Plasmid 0 5 ug ul in TE Buffer 10 ul The table below provides the sequences and pmoles supplied of the Forward and Reverse sequencing primers Two micrograms of each primer are supplied Primer Seq
37. nslational enhancer RBS Minicistron r Da j GACCGGAATT ATCGATTAAC TTTATTATTA AAAATTAAAG AGGTATATAT TA ATG TAT CGA TTA Met Tyr Arg Leu HisG epitope RBS Nco 6xHis tag r ae AAT AAG GAG GAA TAA ACC ATG GGG GGT TCT CAT CAT CAT CAT CAT CAT GGT ATG Asn Lys Glu Glu Met Gly Gly Ser His His His His His His Gly Met Nhe TM i Xpress Forward priming site Apress epitope 1 GCT AGC ATG ACT GGT GGA CAG CAA ATG GGT CGG GAT CTG TAC GAC GAT GAC GAT Ala Ser Met Thr Gly Gly Gln Gln Met Gly Arg Asp Leu Tyr Asp Asp Asp Asp ____ 2c EK recognition sequence rem HI Eco RI Bst Bl Hindll AAG GAT CCA ACC CTT PCR EXAG GGCGAATTCA ATTCGAAGCT TGGCTGTTTT TTC CTA GGT TGG GARN Product TTC CCGCTTAAGT TAAGCTTCGA ACCGACAAAA Lys Asp Pro Thr Leu gt gt gt HE EK cleavage site A A pTrcHis Reverse priming site r ll GGCGGATGAG AGAAGATTTT CAGCCTGATA CAGATTAAAT CAGAACGCAG AAGCGGTCTG ATAAAACAGA rrnB T and T transcription termination sequence MCCC ATTTGCCTGG CGGCAGTAGC GCGGTGGTCC CACCTGACCC CATGCCGAAC TCAGAAGTGA AACGCCGTAG CGCCGATGGT AGTGTGGGGT CTCCCCATGC GAGAGTAGGG AACTGCCAGG CATCAAATAA AACGAAAGGC _ TCAGTCGAAA GACTGGGCCT TTCGTTTTAT CTGTTGTTTG TCGGTGAACG CTCTCCTGAG TAGGACAAAT Designing PCR Primers for pTrcHis2 TOPO Introduction Special Considerations Primer Design Note It is very important to design your PCR primers to ensure you obtain the recombinant protein you need fo
38. ods Vector Epitope Antibody Catalog No pIrcHis TOPO Xpress Anti Xpress R910 25 Anti Xpress HRP R911 25 HisG Anti HisG R940 25 Anti HisG HRP R941 25 pTrcHis2 TOPO c myc Anti myc R950 25 Anti myc HRP R951 25 C terminal Anti His C term R930 25 polyhistidine tag Anti His C term HRP R931 25 The metal binding domain encoded by the 6xHis tag allows simple easy purification of your recombinant protein by Immobilized Metal Affinity Chromatography IMAC using Invitrogen s ProBond Resin see below To purify proteins expressed using pTrcHis TOPO or pTrcHis2 TOPO the ProBond Purification System is available separately TM Additional ProBond resin is available in bulk See the table below for ordering information Product Quantity Catalog no ProBond Metal Binding Resin 50 ml R801 01 precharged resin provided as a 5096 slurry in 2096 ethanol 150 ml R801 15 Purification Columns 50 R640 50 10 ml polypropylene columns ProBond Purification System 6 purifications K850 01 includes six 2 ml precharged prepacked ProBond resin columns and buffers for native and denaturing purification continued on next page Overview continued Reagents Some of the reagents in this kit are available separately Use the table below for ordering Available information Separately Product Amount Catalog no 10 mM dNTPs 1 ml 2 5
39. ol transfer to a cryovial and store at 80 C 14 Expression of the PCR Product Introduction Note Before Starting Positive and Negative Controls Pilot Expression Since each recombinant protein has different characteristics that may affect optimum expression it is helpful to run a time course of expression to determine the best conditions for maximum expression of your particular protein Use the positive control vector included in each kit as an expression control see pages 31 32 TOP10 cells may be used as a general host for expression Remember that inclusion of the N or C terminal tag will increase the size of your recombinant protein by 3 to 4 kDa Be sure to have the following reagents solutions and equipment on hand before starting the experiment e Positive control TOP10 cells containing pTrcHis TOPO lacZ or pTrcHis2 TOPO lacZ see below e Negative control TOP10 cells only see below e SOB or LB containing 50 ug ml ampicillin see Recipes page 19 Note For expression you generally do not need to include glucose see the next page for more information e 37 C shaking incubator e Thaw1 M IPTG stock e IX SDS PAGE sample buffer e Reagents and apparatus for SDS PAGE gel Details of each positive control vector are provided on pages 31 32 Transform the plasmid into TOP10 One Shot cells as you did for your construct TOP10 cells that do not contain any vector are used as a negat
40. poration will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany Qualifying the Product Restriction Digest Supercoiled pTrcHis pTrcHis2 pTrcHis TOPO lacZ and pTrcHis2 TOPO lacZ are qualified by restriction digest The table below lists the restriction enzymes and the expected fragments
41. r your studies Please use the information below and the diagram on the next page to design your PCR primers pTrcHis2 TOPO is designed with the initiation ATG correctly spaced from the optimized ribosome binding site to ensure optimum translation This ATG is located at bp 413 415 and is contained in the unique Nco I site Please note that there are two more amino acids encoded in the DNA between the initiation codon and the TOPO Cloning site Please note that the C terminal tag cannot be cleaved off If you wish to express your protein without the C terminal tag see the table below Suggestions for primer design are provided in the table below If you wish to Then include the c myc epitope and polyhistidine region the reverse PCR primer must be designed to remove the native stop codon in the gene of interest and preserve the reading frame through the C terminal tag NOT include the c myc epitope and polyhistidine region include the native sequence containing the stop codon in the reverse primer or make sure the stop codon is upstream from the reverse PCR primer binding site clone in frame with the initiation codon the forward PCR primer must be designed to ensure that your ORF is in frame with the initiation codon remove the small N terminal leader for expression of truly native protein Note Proteins with N terminal leaders tend to express better in E coli You may wish to prepa
42. re constructs with and without the leader and compare expression the forward PCR primer can be designed to include a unique Nco I site which contains the first ATG of the protein Ex 1 5 ACC ATG G After TOPO Cloning your PCR product the vector can be digested with Nco I and religated assuming there are no internal Nco I sites in your PCR product Do not add 5 phosphates to your primers for PCR This will prevent ligation into pTrcHis2 TOPO continued on next page Designing PCR Primers for pTrcHis2 TOPO continued pTrcHis2 TOPO The diagram below is supplied to help you design appropriate PCR primers to correctly Cloning Site clone and express your PCR product Restriction sites are labeled to indicate the actual cleavage site The complete sequence is available by downloading from our Web site www invitrogen com or by calling Technical Service see page 33 35 10 lac O fee eal r 1 1 181 TGAAATGAGC TGTTGACAAT TAATCATCCG GCTCGTATAA TGTGTGGAAT TGTGAGCGGA TAACAATTTC ACACAGGAAA rrnB antitermination sequence r 1 261 CAGCGCCGCT GAGAAAAAGC GAAGCGGCAC TGCTCTTTAA CAATTTATCA GACAATCTGT GTGGGCACTC GACCGGAATT pTrcHis Forward priming site T7 gene 10 translational enhancer region RBS Minicistron RBS Nco Kor rer Tr r 1 l 341 ATCGATTAAC TTTATTATTA AAAATTAAAG AGGTATATAT TA ATG TAT CGA TTA AAT AAG GAG GAA TAA ACC Met Tyr Arg Leu Asn Lys Glu Glu In
43. s citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech serviceQinvitrogen com jpinfo invitrogen com eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Repr
44. s TOPO Cloned into either pTrcHis TOPO or pTrcHis2 TOPO the construct is transformed into E coli and expression induced with isopropyl B thiogalactoside IPTG pTrcHis TOPO and pTrcHis2 TOPO are designed to facilitate expression of eukaryotic proteins in E coli Both vectors contain the following e The trc promoter a hybrid promoter containing the 35 region from the trpB promoter and the 10 region from the JacUV5 promoter for high level expression in E coli Brosius et al 1985 Egon et al 1983 Mulligan er al 1985 e The acO sequence for binding the Lac repressor encoded by the acf gene In the absence of IPTG Lac repressor binds to the JacO sequence repressing transcription Upon addition of IPTG expression is induced Jacob and Monod 1961 Miiller Hill et al 1968 e rrnB antitermination sequence that reduces premature transcription termination Li ef al 1984 e T7 gene 10 translational enhancer sequence for more efficient translational initiation Olins et al 1988 e A minicistron containing nucleotides that are efficiently translated in prokaryotic cells for enhanced translational efficiency Schoner et al 1986 In addition to the features above pTrcHis TOPO contains the following additional elements e An N terminal peptide containing the HisG epitope the Xpress epitope and a 6xHis tag for detection and purification of the recombinant protein e Anenterokinase recognition site
45. site 369 373 pTrcHis forward priming site bases 370 390 Minicistron bases 383 409 Reinitiation RBS bases 398 403 Initiation ATG bases 413 415 6xHis tag bases 425 442 Xpress epitope bases 482 505 Xpress forward priming site bases 445 463 Enterokinase cleavage site bases 491 505 TOPO Cloning site bases 517 518 pTrcHis reverse priming site bases 574 591 rrnB T4 and T transcription termination sequence bases 624 781 bla promoter bases 1002 1059 Ampicillin resistance gene bla bases 1060 1920 pBR322 derived origin bases 2065 2738 Lac Repressor acl bases 3392 4351 continued on next page Map and Features of pTrcHis TOPO continued Features of pTrcHis TOPO 28 The important elements of pTrcHis TOPO 4390 bp are described in the following table All features have been functionally tested Feature Benefit trc promoter region Provides high level inducible expression of recombinant proteins in coli It is a hybrid promoter consisting of the 35 region from trpB and the 10 region from the lacUV5 promoter Egon ef al 1983 lac operator lacO Binding site of the lac repressor to provide regulated expression of the trc promoter Jacob and Monod 1961 rrnB antitermination signal Sequence from the rrnB gene that reduces the level of premature transcription termination Li et al 1984 T7 gene 10 translational enhancer Sequence from bacteriophage T7 gene 10 t
46. stion pattern The Vector Only plate should contain very few colonies 1096 of the number of colonies on the Vector PCR Insert plate pUC19 plasmid is included to check the transformation efficiency of the One Shot competent cells Transform with 10 pg per 50 ul of cells using the protocol on page 12 Plate 10 ul of the transformation reaction plus 20 ul SOC on an LB plate containing 50 ug ml ampicillin The transformation efficiency should be 1 x 10 cfu ug DNA continued on next page 25 TOPO TA Cloning Control Reactions continued Factors Affecting Cloning Efficiency 26 Please note that lower cloning efficiencies will result from the following variables Most of these are easily correctable but if you are cloning large inserts you may not obtain the expected 90 or more cloning efficiency Variable Solution TOPO Cloning reactions longer than 5 minutes at room temperature Be sure to incubate for only 5 minutes Incubations longer than 5 minutes will decrease transformation efficiency pH gt 9 in PCR amplification reaction Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCl pH 8 Incomplete extension during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Cloning large inserts 21 kb Increase amount of insert Or gel purify as described on page 21 For clo
47. technology allows you to produce your PCR products ligate them into the appropriate TOPO vector and transform the recombinant vector into E coli all in one day It is important to have everything you need set up and ready to use to ensure the best possible results If this is the first time you have TOPO Cloned you may wish to perform the control reactions on pages 24 26 in parallel with your samples In addition to microbiological supplies i e plates and spreaders you will need the following reagents and equipment e 42 C water bath e 37 C shaking and non shaking incubator e Two LB plates containing 50 ug ml ampicillin and 0 5 glucose per transformation see page 19 for recipe Tip If you already have LB plates containing 50 ug ml ampicillin only you may spread 20 ul of a 2 M or a 50 glucose solution onto the plate Please note that the concentration of glucose does not have to be exact We recommend that you include glucose 25 mM 0 5 in the selection medium to ensure stability of your insert Promoters based on the ac promoter i e trc tend to have higher basal levels of transcription If your insert is toxic to E coli DNA rearrangement may occur Glucose represses basal level transcription to stabilize your construct A transcriptional activator protein called CAP catabolite activator protein normally binds upstream of the trc promoter and activates transcription This protein requires cAMP to bind to t
48. u to rapidly purify PCR products from regular agarose gels You will need to prepare a 6 M sodium iodide 10 mM sodium sulfite solution in sterile water before starting l Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cutout the gel slice containing the PCR product and melt it at 65 C in 2 volumes of 6 M Nal Add 1 5 volumes Binding Buffer provided in the S N A P MiniPrep Kit Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant A W If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Buffer provided in the S N A P MiniPrep Kit Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant Centrifuge again at maximum speed for minute to fully dry the resin Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described on page 8 CON 9 t An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the TOPO Cloning reaction page 12 Be sure to make the gel slice as small as possible for best results
49. uence pMoles Supplied Xpress Forward 5 TATGGCTAGCATGACTGGT 3 342 pTrcHis Forward 5 GAGGTATATATTAATGTATCG 3 309 pTrcHis Reverse 5 GATTTAATCTGTATCAGG 3 363 continued on next page Kit Contents and Storage continued One Shot Reagents Genotype vi The table below describes the items included in the One Shot competent cell kit Store at 80 C Item Composition Amount SOC Medium 2 Tryptone 6ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO4 20 mM glucose TOP10 cells 21x 50ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 pl 0 5 mM EDTA pH 8 0 TOP10 Use this strain for general cloning and expression of PCR products in pTrcHis TOPO or pTrcHis2 TOPO Please note that this strain cannot be used for single strand rescue of DNA F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recAl araD139 A ara leu 7697 galU galK rpsL Str endAl nupG Overview Introduction Description of the Vectors pTrcHis TOPO pTrcHis2 TOPO Methods The pTrcHis and pTrcHis2 TOPO TA Expression Kits provide a highly efficient rapid cloning strategy TOPO Cloning for direct insertion of Taq polymerase amplified PCR products into a plasmid vector for expression in E coli No ligase post PCR procedures or PCR primers containing specific sequences are required Once the PCR product of interest i
Download Pdf Manuals
Related Search