Home

AquaStool

1. rrnnrnnnnnnnnnnnnnannnvnnnnnnnnnnnnnnnnnnnnnnennnnnsnnennsnnsenn 12 MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 3 General Information Application DNA RNA extraction from fecal amp other specimens For in vitro research use only Size The kit is sufficient for the preparation of 7001MT 1 ml for 2 extractions 7030MT 30 ml for 60 extractions Kit Contents The AquaStool Kit includes the following items 7001MT 1 ml AquaStool Solution Instruction Manual 7030MT 30 ml AquaStool Solution Instruction Manual Specification AquaStool is a multifunctional aqueous solution for DNA and RNA isolation and purification from fecal biospecimens This single solution functions to stabilize preserve extract fecal DNA RNA and remove contaminating PCR and RT PCR inhibitors abundant in these biospecimens It streamlines stool collection stabilization preservation DNA RNA extraction and molecular analysis Approximately 150 200 ug total nucleic acids can be isolated from 50 mg of human feces Enabling Technology Stool is a readily accessible abundant under utilized and noninvasive source of biospecimen It contains trillions of microorganisms living in our aerodigestive and gastrointestinal tracks millions of human cells sloughed from these organs every day and numerous macrophages and lymphocytes migrating between our gut l
2. AquaStool extracts intact fecal DNA and RNA It recovers not only large RNAs but also small RNAs including 5S rRNA tRNA and microRNA 2 Reverse transcription Anneal RT primer to its complimentary RNA by incubating 2 ul of 5 uM RT primer with 4 ul of DNasel treated RNA and 12 ul of nuclease free water at 80 C for 4 min and then on ice Following primer annealing add 2 ul of 10 x buffer you may use PCR reaction buffer 0 2 ul of 25 mM dNTPs and 0 5 ul of 100 U ul MMLV Reverse Transcriptase to the mix and incubate at 42 C for 60 min to synthesize the cDNA Heat inactivate the MMLV Reverse Transcriptase by incubating at 94 C for 10 min 3 PCR amplification Assemble a 30 ul PCR reaction by mixing 3 ul of 10 x PCR reaction buffer with 2 5 mM MgClz 0 3 ul of 25 mM dNTPs 2 ul of 5 uM PCR primer pair 25 ul of nuclease free water 0 3 ul of DNA polymerase and 2 5 ul of the above RT reaction for RT PCR or 0 5 ul of 200 ng ul AquaStool purified DNA for PCR Run 30 cycles of PCR reaction 1 2 3 49 6 7 8 5 10 41 12 Bacteria Plant Huir arn a MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 9 Figure 2 PCR and RT PCR amplification of fecal DNA and RNA Human fecal DNA and RNA were extracted with AquaStool Bacterial plant food and host DNA and RNA in the fecal specimens were analyzed by 30 cycles of PCR and RT PCR Lane 1 and
3. Extract DNA and RNA of the Host and Microbes in Feces AquasStool extracts total nucleic acids in feces including DNA and RNA from the host commensal bacteria any invasive viruses fungi or parasites and incompletely digested food enabling forensic identifications the study of human and animal microbiome and diagnosis of bacterial viral fungal and parasitic infections Not only for Fecal Specimens The challenges we face in DNA and RNA extraction from fecal specimens exceed the challenges we encounter in most other biospecimens Therefore AquaStool protocols can be readily modified and adapted to DNA and RNA preservation and extraction from other biomaterials such as microbes culture cells animal and plant tissues and even insects making AquaStool a universal reagent for the study and correlation of genetic mutation and gene expression of any life form Comparison Comparison of Techniques for Biospecimen Stabilization Formalin Rister AquaStoo Mechanism of e High Salt a Stabilization Cross linking Dehydration Enzyme Inactivation enzym DIG Irreversible Reversible Irreversible Activity Ethanol Specimen Inactivation of Yes No Yes Pathogens Removal Stabilization and No No Yes Extraction MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 5 Protocols Streamlined Fecal Specimen Preservation Preparation and Analysis
4. by agarose gel electrophoresis Save the digital gel image and record the positive or negative RT PCR amplification result for each fecal sample Figure 3 Concurrent extraction of fecal DNA and RNA from a single mouse fecal pellet Mouse fecal DNA RNA were extracted from a single fecal pellet with AquaStool 20 ul of the 100 ul fecal 285 DNA RNA prep was treated with 0 3 ul of TE Ambion s Turbo DNase at 22 C for 40 min 5 ul of the DNasel digested sample Lane 3 and 5 ul of the undigested fecal DNA RNA Lane 2 were separated in a 0 8 agarose gel electrophoresis As shown in the gel 55 image fecal DNA and RNA can be extracted from a single mouse fecal pellet with AquaStool UV spectrophotometry analysis indicated that the Adzgo Azgo ratio of the extracted fecal DNA RNA was 1 8 and the DNA RNA yield was 25 ug pellet DNA RT Stored 7 Days Freshly Collected Figure 4 PCR and RT PCR amplification of AquaStool extracted mouse fecal DNA and RNA Mouse fecal pellets were collected freshly or stored at room temperatures for 7 days The AquaStool extracted fecal DNA RNA were either amplified by PCR Lane 3 and 7 or by RT PCR Lane 5 and 9 PCR amplification was conducted using the primer pair of Rig S15f 5 TTCCGCAAGTTCACCTACC and Rig S15r 5 CGGGCCGGCCATGCTTTACG The results indicate that mouse feces can be stored at room temperatures up to 7 days without affecting DNA genotyping however Lane 1 10 100 bp DNA ladder f
5. times Tap the tube on a clean paper towel to remove residual ethanol and air dry the DNA RNA pellet for 1 2 min Add 100 ul of nuclease free water vortex vigorously if needed pipet to dislodge the DNA RNA pellet to fully suspend the pellet Incubate on ice or at 22 C for 10 15 min to solubilize the DNA RNA Centrifuge again for 5 minutes to pellet the insoluble and transfer the clear DNA RNA solution to a new tube Quantitate the fecal DNA RNA with a UV spectrophotometer and inspect it by agarose gel electrophoresis MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 10 3 PCR genotyping Set up a 30 ul PCR reaction using 0 5 1 ul of the fecal DNA RNA and respective primer pair After a 35 cycles of PCR amplification separate the PCR products by agarose gel electrophoresis Save the digital gel image and record the positive or negative PCR amplification result for each fecal sample 4 RT PCR RNAtyping Digest the DNA in the fecal DNA RNA prep by incubating 20 ul of the DNA RNA with 0 3 ul of Ambion s Turbo DNasel at 22 C for 40 min and then inactivate the DNasel with 2 ul of Ambion s DNaseI Removal Reagent Use 4 ul of the DNasel treated fecal RNA in a 20 ul cDNA synthesis reaction with MMLV Reverse Transcriptase Subsequently use 3 ul of the cDNA in a 30 ul PCR reaction After a 35 cycles of PCR amplification separate the RT PCR products
6. 12 are 100 bp DNA ladder Lane 2 is no DNA RNA negative control Lane 3 PCR 4 no RT control and 5 RT PCR were amplified with a bacterial primer pair forward primer AGAGTTTGATCCTGGCTCAG and reverse primer GGTTACCTTGTTACGACTT Lane 6 PCR 7 no RT control and 8 RT PCR were amplified with a plant primer pair forward primer GCGTGGACCTGGAATGACTA and reverse primer AGGTTGTATTAAAGTTTCGATCG Lane 9 PCR 10 no RT control and 11 RT PCR were amplified with a human primer pair forward primer TITCCGCAAGTTCACCTACC and reverse primer CGGGCCGGCCATGCTTTACG Arrows point at RT PCR products The data indicate that it is possible to extract both fecal DNA RNA with AquaStool for genotyping and RNAtyping of bacterial food and host DNA and RNA biomarkers from a single fecal specimen Mouse Fecal DNA RNA Extraction for Genotyping and RNAtyping AquaStool may be used as a non invasive method for concurrent extraction of DNA and RNA from a single mouse fecal dropping for genotyping determination of the genetic status and RNAtyping determination of the RNA expression status It may be used to identify and characterize transgenic animals that not only carry but also express the intended genetic modifications Timely identifying animals expressing the desired transgene would avoid the production and use of unwanted animals and prevent wasted effort time and money This non invasive concurrent genotyping and RNAtyping method could become a signifi
7. AquaStool Mo Bi Tec MOLECULAR BIOTECHNOLOGY MoBiTec GmbH 2010 Page 2 Contents General Information rarrrarrrnnrraneranernnnranrrnnrrnnnnnnrnnnnnnnennnnnannnnnnnen 3 Specification sesesessesesesserrsinnsrerererenrninrnrnrrrnnnrnrnrunnnnnunenenenenenne 3 e Enabling TeChnolog ccccsccseccecceeceeceeceeceesaeeaseceesaesasesensass 3 e Multifunctionalities ccc cec cc eeeceeeceeese esse esse esse eeseeesaeesaeesaees 3 e Extract both Fecal DNA and RNA rerarnnernnnnnnrnnrrvnrnnernnnrnnennsennrn 3 e Extract DNA and RNA of the Host and Microbes in Feces 4 e Not only for Fecal SPECIMENS rrarrnarnnernanrnarnnnevannnernnnnnernnnnnnnn 4 e CompariSon mmnunnunnunnnnnnnnnnnnnnnnnnunnnnnnnunnnnnnnnnnunnnnnnnnnnnennennnnenuene 4 a PFK ooreo i EEE ee D e Stool Collection and Preservation arrrnnrnnnrnnnannnrnnnennnennnennnrnnnrn D e Stool SPECIMEN Storage rrrranrnnnnnnnnannnnrnannnernnnnnnrnnnnnannnnnnnnnnnse 5 e Fecal DNA Extraction earanrnsrrnnraanonnrnvrnnnnannnrennnnannnnnnernnnannnnesene 6 e Fecal RNA Extraction pciniccsccsrenanssnencesacicemoenenansaccesteastoseadenbeniencten 6 e PCR and RT PCR Amplification rrarrarvarnarvarvnrvnrrnrvnnnnrvnnnnsenennn T e Mouse Fecal DNA RNA Extraction for Genotyping and RNAtyping EEE EE 11 Order Information Shipping and Storage arrrnrranerannnnrvnnnnnnnnn 12 Contact and Support
8. Protocols These protocols describe the use of AquaStool to collect stabilize preserve ship and store fecal specimens extract fecal DNA and RNA and analyze the purified fecal DNA and RNA by PCR and RT PCR Stool Collection and Preservation AquasStool stabilizes and preserves DNA and RNA by inactivating degradative enzymes Unlike cross linking reagents e g formalin AquaStool preserves the specimen without damaging the DNA and RNA and unlike high salt preservatives e g Ambion s RNAlater it irreversibly inactivates DNases and RNases and pathogens This protocol describes the use of 10 ml of AquaStool solution to collect one gram of human feces However using 0 5 ml of AquaStool solution to collect 50 mg of feces is sufficient for most applications In addition to preserving fecal specimens AquaStool may also be used to preserve other biospecimens such as microbes culture cells animal and plant tissues and even insects for DNA RNA and protein extractions Because of AquaStool s ability to lyse and inactivate bacteria viruses fungi and parasites it reduces the biohazards of biospecimens and improves biosafety to research workers 1 Transfer a level spoonful 1 gram of fresh stool into a 15 ml stool collection tube SARSTEDT 80 734 311 containing 10 ml of AquaStool solution using the spoon attached to the cap of the stool collection tube 2 Stir and smash the stool with the spoon to facilitate the contact of the specime
9. cant contribution to animal welfare and the transgenic research community 1 Fecal dropping collection Lift a mouse by its tail from its cage Mouse often excretes a fecal pellet at the moment it is lifted from the cage or within 1 2 minutes thereafter Use a clean toothpick to transfer a fresh fecal pellet into a 1 5 ml microfuge tube preloaded with 50 yg 1 2 scoop with the cap of 0 2 ml PCR tube of sand Sigma 274739 white 50 70 mesh and 250 ul of AquaStool Label the tube with the mouse ID Remove any additional mouse droppings from the counter before starting the next animal to prevent any chance of fecal ID mislabeling 2 Extract fecal DNA RNA Let the fecal pellet soak in AquaStool solution for 15 30 min and vortex at top speed beadbeating for 1 2 min to fully homogenize the fecal material Optional If you are not interested in fecal RNA you may incubate the sample at 65 C for 10 15 min and vortex again for 1 min after the incubation to increase the DNA yield Centrifuge at 14 000 x g for 5 min to pellet the debris Transfer the supernatant 200 ul to a 0 5 ml microfuge tube and add 200 ul of isopropanol Vortex for 10 seconds to mix well and centrifuge at 14 000 x g for 5 min to pellet the DNA RNA Flip the tube to discard the supernatant and fill the tube with 70 ethanol by shooting the ethanol solution at the cap of the tube from a squirt bottle and then flip to discard the ethanol Repeat the 70 ethanol rinse 3
10. e cap of a 0 2 ml PCR tube to scoop and add the sand into the 1 5 ml tubes One capful of sands is 90 100 ug 3 Transfer 0 5 ml of the homogenized stool specimen into the 1 5 ml microfuge tubes pre loaded with sands Use a 1 ml blue pipet tip with its very tip been cut off for specimen transferring so it would not be clogged by fecal debris 4 Label the tubes and store the samples at 20 or 70 C for long term storage Fecal DNA Extraction 1 Extract the DNA Retrieve 0 5 ml stool specimen in a 1 5 ml microfuge tube pre loaded with 100 ug of sand from storage Vortex the tube upside down at top speed for at least 60 s i e beadbeating Incubate at 65 C for 15 min may incubate at 22 C with slightly lower DNA yield Vortex again for 60 s after the incubation and centrifuge at 14000 x g for 5 min to pellet the debris 2 Precipitate the DNA Transfer 0 4 ml of cleared lysate to a 1 5 ml tube pre loaded with 0 4 ml of isopropanol Vortex for 10 s to mix Centrifuge at 14000 x g for 5 min to pellet the DNA Decant to discard the supernatant Rinse the pellet by filling up the tube with 70 ethanol using a squirt bottle be sure to rinse the entire interior of the tube including the cap and the mouth of the tube and decant to discard the ethanol solution Repeat the ethanol rinse 3 4 times Tap the tube on a clean paper towel to remove residual ethanol and air dry the pellet for 1 2 min 3 Solubilize the DNA Add 0 4 ml nuclease
11. e head of generator Consult your user manual to identify the location of the generator head or do a test extraction to identify the position that produces the best RNA yield For Branson 2510 the two generator heads are positioned just outside of the left and right sides of the MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page OPERATING LEVEL mark in the middle of the tank Sonicate for 30 min at 22 C Note You may place the sonicator in a ventilation hood with its door closed to reduce the noise during operation Vortex again for 60 s after the sonication and centrifuge at 14000 x g for 5 min to pellet the debris 2 Precipitate the RNA Transfer 0 4 ml of cleared lysate to a 1 5 ml tube pre loaded with 0 4 ml of isopropanol Vortex for 10 s to mix Centrifuge at 14000 x g for 5 min to pellet the RNA DNA is sheared by sonication in the presence of sands Fig 1 Decant to discard the supernatant Rinse the pellet by filling up the tube with 70 ethanol using a squirt bottle be sure to rinse the entire interior of the tube including the cap and the mouth of the tube and decant to discard the ethanol solution Repeat the ethanol rinse 3 4 times Tap the tube on a clean paper towel to remove residual ethanol and air dry the pellet for 1 2 min 3 Solubilize the RNA Add 0 4 ml nuclease free water to the pellet pipet to dislodge the pelle
12. emoval AquaStool purified fecal DNA and RNA are suitable for various downstream applications The PCR and RT PCR protocols provided here may be adjusted for your specific application 1 DNase I digestion AquaStool extracted fecal RNA contains large amount of sheared DNA RT PCR can be performed without removing the contaminating DNA if appropriate primer pair is designed to avoid the amplification of genomic DNA sequence or produce different amplicon size Otherwise DNasel treatment is required prior to reverse transcription To digest the DNA 40 ul of the 400 ul of AquaStool purified RNA is incubated with 0 5 ul of DNasel in its 1 x buffer at 22 C for 40 60 min Note Almost all commercial DNasel products have RNase activity Using minimal amount of DNase and incubating at room temperature for extended period helps reduce RNA loss Even if the DNA digestion is incomplete and there are still a lot of lt 250 bp fragments they would not likely affect your PCR or RT PCR Following DNase digestion the DNase is removed with 4 ul of DNase Inactivation Reagent Ambion AM1906 MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 8 DHA 235 16s sheared DANA 55 Figure 1 AquaStool purified fecal DNA and RNA Aliquots 5 ul of the extracted DNA Lane 2 RNA Lane 3 and DNasel treated RNA Lane 4 were run in a 0 8 agarose gel As shown
13. er from the specimen as completely as possible 3 Add 90 100 ug of white sand and 0 5 ml AquaStool solution to the fecal pellet 50 mg in a 1 5 ml microfuge tube Vortex the tube up side down at top speed for at least 60 s beadbeating to fully homogenize the specimen 4 Incubate tube at 65 C for 15 min for fecal DNA extraction or sonicate at 22 C for 30 min for fecal RNA extraction At the end of the incubation or sonication vortex again at top speed for 60 s 5 Centrifuge at 14 000 x g for 5 min to pellet the fecal debris and transfer 0 4 ml clear lysate to a new tube Add 0 7 vol i e 0 28 ml of isopropanol to the lysate 6 Vortex vigorously for 10 s to mix well and centrifuge at 14 000 x g for 5 min to pellet the DNA or RNA Note f there are too much RNAlater carryover you may see two phases and a thin DNA RNA interphase In that case remove the top layer and add 1 ml of 70 ethanol to reprecipitate the DNA or RNA 7 Rinse the DNA or RNA pellet with 70 ethanol 3 4 times by filling up the tube with the ethanol solution from a squirt bottle and then decanting to discard the ethanol solution Tap the tube on a piece of clean paper towel to remove residual ethanol and air dry the pellet for 1 2 min 8 Add 200 ul of nuclease free water to the DNA or RNA pellet Pipet to dislodge the pellet and vortex vigorously to fully suspend the pellet Incubate on ice for 10 min and then centrifuge at 14000 x g for 5min to pe
14. free water to the pellet pipet to dislodge the pellet and then vortex at top speed to fully disperse the pellet Incubate on ice for 10 min to release the DNA Centrifuge at 14000 x g for 5 min to pellet the insoluble Transfer the DNA supernatant to a new 1 5 ml microfuge tube the DNA solution may appear light yellowish but it no longer contains PCR inhibitors The concentration of the DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer pH 8 for OD2zg9 and OD2g9 reading and then calculating the concentration using the formula of DNA concentration ng ul 50 dilution factor x 50 ng ul x ODs The expected DNA concentration should be around 200 ng ul and the total DNA yield from 0 5 ml of AquaStool preserved stool specimen 50 mg of feces should be about 80 100 ug which is 5 10 times higher than the DNA yield obtained with other fecal DNA extraction kits Store the DNA solution at 4 C or 20 C Fecal RNA Extraction 1 Extract the RNA Retrieve 0 5 ml stool specimen in a 1 5 ml microfuge tube pre loaded with 100 ug of sand from storage Vortex the tube upside down at top speed for at least 60 s i e beadbeating Place the tube on a foam floater and immerse the tube in the water bath of a bath sonicator Branson Ultrasonic Cleaner 2510 40 kHz Danbury CT Note It is critical to position the tube right on top of the head of the ultrasonic generator as the ultrasonic strength decreases from th
15. llet the insoluble Transfer the clear DNA or RNA solution to a new tube and store at 20 to 70 C MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Order Information Shipping and Storage Order Product Quantity 7001MT AquaStool 1 ml 7030MT AquaStool 30 ml shipped at RT store at 70 C Contact and Support MoBiTec GmbH Lotzestrasse 22a amp D 37083 Goettingen Germany Customer Service General inquiries amp orders Technical Service Product information phone 49 0 551 707 22 0 phone 49 0 551 707 22 70 fax 49 0 551 707 22 22 fax 49 0 551 707 22 77 e mail order mobitec com e mail info mobitec com MoBiTec in your area Find your local distributor at www mobitec com MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com
16. n with AquaStool solution Securely screw tight the cap and shake the content vigorously a few times 3 Bring or mail the stool specimen to the laboratory Note AquaStool preserved sample is stable at room temperatures and should have no problem with shipping in mild ambient temperatures However we have not studied if it is Stable at extremely high temperatures such as in an unventilated shipping container on a hot summer day Therefore shipment in blue ice gel packs should be considered to ensure all specimens from different climate regions will be exposed to the same shipping temperatures Stool Specimen Storage Upon receiving the stool specimens in the laboratory the samples can be stored at 4 C for a week before processing or in a 20 or 70 C freezer However for the convenience and streamlining of subsequent fecal DNA and RNA extractions the sample is preferably divided into 0 5 ml aliquots each containing 50 mg of fecal materials in 1 5 ml microfuge tubes as described below 1 Vortex the stool specimen in the stool collection tube vigorously at top speed to fully homogenize the specimen MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 6 2 Load 100 ug of sand is Sigma 274739 white 50 70 mesh into 1 5 ml microfuge tubes The sand required for bacterial cell lysis and DNA RNA extraction It is convenient to use th
17. or RNAtyping the fecal specimens need to Lane 2 6 No DNA RNA control be stored at 20 C to 70 C or preserved in Lane 3 7 PCR amplification Lane 4 8 Minus RT control AquasStool solution Lane 5 9 RT PCR amplification ka bp 2000 fF 1500 No DNA RNA No DNA RNA 500 400 300 200 100 MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 11 DNA RNA Extraction from RNAlater Preserved Fecal Specimen RNAlater Ambion is a widely used preservative for stabilizing biospecimens prior to their DNA and RNA extraction AquaStool may be used to extract DNA and RNA from RNAlater preserved fecal specimens similar to standard AquaStool protocols except two important steps First prior to extraction RNAlater should be removed from the specimen as completely as possible Secondly DNA and RNA in the cleared lysate should be precipitated with 0 7 volume instead of the standard 1 volume of isopropanol These steps will prevent the highly concentrated salts in RNAlater from interfering DNA and RNA precipitation in isopropanol solution However you should note that this protocol is not Suitable if your targets are cell free DNA fragments or viruses in the feces as they will be discarded with RNAlater 1 Centrifuge RNAlater preserved specimen at 14 000 x g for 5 min to pellet the fecal materials 2 Aspirate to remove RNAlat
18. t and then vortex at top speed to fully disperse the pellet Incubate on ice for 10 min to release the RNA Centrifuge at 14000 x g or 5 min to pellet the insoluble Transfer the RNA supernatant to a new 1 5 ml microfuge tube the RNA solution may appear light yellowish but it no longer contains RT PCR inhibitors The concentration of the RNA DNA solution may be estimated by diluting 2 ul of the sample with 98 ul of TE buffer pH 8 for OD2g69 and OD2g9 reading and then calculating the concentration using the formula of RNA DNA concentration ng ul 50 dilution factor x 45 ng ul x OD260 The expected RNA DNA concentration should be around 450 ng ul and the total RNA DNA yield from 0 5 ml of AquaStool preserved stool specimen 50 mg of feces should be about 150 200 ug of which about 1 2 1 3 is RNA Store the RNA solution at 20 C or 70 C PCR and RT PCR Amplification The most common application of fecal DNA and RNA is to determine if specific DNA or RNA sequences exist in the fecal specimen by PCR genotyping or RT PCR RNAtyping for the diagnosis of cancers bacterial viral fugal and parasitic infections identification of transgenic animals analysis of human and animal intestinal microbiome and survey of wildlife animals However most fecal DNA and RNA extraction methods are unreliable and often have a PCR failure rate ranging from 20 100 due to their poor and inefficient DNA RNA protection extraction and PCR inhibitor r
19. umen and blood circulation It can be an unmatched and excellent barometer of our health and diseases in particular gastrointestinal cancers infections inflammations and microbiome However stool is one of the most difficult and challenging biospecimens to obtain high quality DNA and RNA from for molecular analysis due to its content of large amount of digestive enzymes that destroy the DNA and RNA prior to and during extraction and numerous DNA and RNA contaminants that interfere with subsequent molecular analysis AquaStool technology will facilitate the growth of stool based sciences and accelerate the drive toward personalized medicine Multifunctionalities AquaStool combines the functions of biospecimen stabilization preservation DNA RNA extraction and PCR inhibitor removal in a single solution It streamlines biospecimen preservation DNA RNA extraction and molecular analysis It makes fecal DNA RNA extraction simple fast economic and convenient MoBiTec GmbH Germany m Phone 49 551 70722 0m Fax 49 551 70722 22 m E Mail info mobitec com m www mobitec com MoBiTec GmbH 2010 Page 4 Extract both Fecal DNA and RNA Aquastool extracts both fecal DNA and RNA from the same fecal specimen enabling noninvasive genotyping and RNAtyping for the identification of transgenic animals monitoring wildlife animals diagnosis of gastrointestinal disorders and the study of RNA expression and its relationship to genetic variation

AquaStool

Contents

Download Pdf Manuals

Related Search

Related Contents