Manual - Gene Bridges
Contents
1. THE RECOMBINEERING COMPANY GENE BRIDGES I By Re ET Recombination 90 ee Ai o ile aaa Itt Mm a Ba N i u i wae tf l aa I i Br l a Version 2 9 May 2014 CONTENTS 1 BAG SUBEIORING FRU ss aac ae a T PENEPE 3 2 Exp rim ntal QUINE een ee 5 3 How Red ET Recombination works e lleeee eee ieeeeeene eese nennen nena nnn n anna nn nnn nana 7 4 Oligonucleotide Design for Red ET Recombination 1 ceeee ec creeeee en 9 5 Media for antibiotic selection een 10 6 Technical LOT OC ON een 11 6 1 Protocols for generating a linear vector by PCR r CtiOn ccccccccccseeccsnseccsnecessesessaescsaneses 11 6 2 Transformation with Red ET expression plasmid pReaET esses 12 6 3 Subcloning of a gene from a BAC by REOVET cccccccccccscssssesesecccsseeeseeeeecessessusaeeeecessesaaas 13 6 4 Verification of the obtained subclones cccsssecccccsneeeeccssaneeseeessaueeeeeessaueseeesssauanseessaaaenseess 15 6 5 Maps F igelere Utclqme T nee 16 6 6 Qecet ee M S 18 7 WOT SIO UNG ora cadets2. ps pRedET 9270 bp alpha recA repA pSC101 ori Figure 5 Map of the Red ET expression plasmid pRedET tc Transformation of E coli hosts with this plasmid is selected for by acquisition of tetracycline resistance at 30 C Expression of the Red ET Recombination proteins is induced by L arabinose activation of the BAD promoter at 37 C ampicillin resistance gene ColE1 origin pColE1 amp template 2786 bp ampicillin resistance gene ColE1 origin Tr PCR product of linear vector Figure 6 Map of the PCR template and PCR product of the control experiment The pink colored regions at both ends of the PCR product represent the introduced sequence which is homologous to the Hoxa11 gene homology arms 16 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 TOTS Tea TCCTGAGTAG GoTGGCGGGC TGACGGATGG AATATGTATC GAGAGAATGT GACAAATCCG AGGALGDUULU CC ITTTITGU CGCTCATGAG GIGITAILAC CCGGGAGCGG CCATAAACTG TTTCTACAAA ACALTRACCC CAGGAAGAAA ATTTGAACGT CCAGGCATCA CDICTITTGTT TGATAAATGC ACCGACAATA TGCGAAGCAA AATTAAGCAG TATTTTTCTA TTCAATAATA BOR GATATCGCTC CGGCCCGGAG AAGGCCATCC AATACATTCA TTGAAAAAGG AAGAGT GCA GAT AAC ATG GCL GIT AGA TTA AAC GAA ACA CAA CGC GAG di CGA TIT GCT AGC AGC GGG GAG GAA Salah ATG GLU ACG CAA TLG CGT COT AAT AMG TGC GAA GGT ACT CAA TAC TTA CTG GGG ATA TIG ITA GCC GGG ATC AGA AGT C
3. e Cool benchtop centrifuge to 2 C 1 Set up one or two microfuge tubes containing fresh 1 4 ml LB medium plus Cm 15ug ml and inoculate with 30 ul of fresh overnight culture 2 Culture for 2 3 h at 37 C shaking at 1 000 rpm 3 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled 2 C microfuge benchtop centrifuge Discard the supernatant by quickly tipping out the supernatant twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tube on ice 4 Take the Red ET Recombination protein expression plasmid pRedET tube 1 Add 1 yl to your cell pellet Mix briefly Keep the tube on ice Transfer the cell suspension from the tube to the chilled electroporation cuvette Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 5 Electroporate at 1350 V 10uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using a 1 mm electroporation cuvette Other devices can be used but 1350 V and a 5 ms pulse are recommended 6 Resuspend the electroporated cells in 1 ml LB medium without antibiotics and return them to the microfuge tube 7 Incubate at 30 C for 70 min shaking at 1 000 rpm The Red ET expression pl
4. 6 1 Protocols for generating a linear vector by PCR reaction Oligonucleotide design Please follow the advice in Oligonucleotide Design page 8 for Red ET Recombination See the detailed sequence information of template in section 6 5 i Choose 50 nucleotides at the 3 end of your gene which you want to subclone Order an oligonucleotide with these 50 nucleotides at the 5 end At the 3 end of this sequence include the PCR primer sequence for amplification of the ColE1 amp template given in italics below Forward oligonucleotide 5 N so GCTCTCCTGAGTAGGACAAATCO 3 ii Choose 50 nucleotides at the 5 end of your gene which you want to subclone and transfer them into the reverse complement orientation Order an oligonucleotide with this sequence at the 5 end At the 3 end of this sequence include the PCR primer sequence for the ColE1 amp template given in italics below Reverse oligonucleotide 9 N so TCACAGCTTGTCTGTAAGCGGATG 3 If desired include restriction sites or other short sequences in the ordered oligo s between the 5 homology regions and the 3 PCR primer sequences PCR The oligonucleotides are suspended in dH2O at a final concentration of 25 pmol ul We present one standard PCR protocol however any standard PCR protocol should yleld satisfactory results PCR reaction in 50 ul 38 5 ul dH2O 5 0 ul 10 x PCR reaction buffer 2 0 ul 5 mM dNTP 1 0 ul upper oligonucleotide 1 0 ul lower olig
5. 9 May 2014 3 How Red ET Recombination works In Red ET Recombination also referred to as mediated recombination target DNA molecules are precisely altered by homologous recombination in E coli which express the phage derived protein pairs either RecE RecT from the Rac prophage or Reda Red from X phage These protein pairs are functionally and operationally equivalent RecE and Reda are 5 3 exonucleases and RecI and Red are DNA annealing proteins A functional interaction between RecE and RecT or between Reda and Red is also required in order to catalyze the homologous recombination reaction Recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Figure 2 The recombination is further assisted by A encoded Gam protein which inhibits the RecBCD exonuclease activity of E coli Double stranded break 3 5 2 RecE B3 or Reda exonuclease 5 3 3 OOOOO s Single strand or RedB binding proteins 5 3 3 Joint molecule formation DNA replication Figure 2 Mechanism of Red ET Recombination Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 7 Double stranded break repair DSBR is initiated by the recombinase protein pairs HecE RecT or Reda RedBp First Reda or RecE digests one strand of the DNA from the DSB leaving the other strand as a 3 ended single stranded DNA overhang Then Red or RecT binds and
6. artificial chromosomes by ET recombination Nucleic Acids Res 27 1555 1557 1999 Muyrers J P P Zhang Y Buchholz F Stewart A F RecE RecT and Reda RedB initiate double stranded break repair by specifically interacting with their respective partners Genes Dev 14 1971 1982 2000 Muyrers J P P Zhang Y Benes V Testa G Ansorge W Stewart A F Point mutation of bacterial artificial chromosomes by ET recombination EMBO Reports 1 239 243 2000 Muyrers J P P Zhang Y Stewart A F ET cloning Think recombination first Genetic Engineering Principles and Methods Ed J K Setlow 22 77 98 Kluwer Academic Plenum Publishers NY 2000 Muyrers J P P Zhang Y and Stewart A F Recombinogenic engineering new options for cloning and manipulating DNA Trends in Bioch Sci 26 325 31 2001 Narayanan K Williamson R Zhang Y Stewart A F loannou P A Efficient and precise engineering of a 200 kb beta globin human bacterial artificial chromosome in E coli DH10B using an inducible homologous recombination system Gene Ther 6 442 447 1999 Schleif R S DNA Looping Annu Rev Biochem 61 199 223 1992 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 e Testa G Zhang Y Vintersten K Benes V Pijnappel P Chambers l Smith A J H Smith A G and Stewart A F Engineering of mouse genome with bacterial artificial chromosomes to create multipurpose alleles Nature Biotechnol
7. back into the microfuge tube Incubate the cultures at 37 C with shaking for 70 minutes Recombination will now occur 8 Streak the cultures with a loop 100 ul is sufficient if necessary plate all onto LB agar plates containing ampicillin 100 ug ml The plates should not contain Tc otherwise the Red ET Recombination protein expression plasmid pRedET will either persist or the cells will die Incubate the plates at 37 C overnight The Red ET recombination protein expression plasmid pRedET will disappear at 37 C You should obtain 2100 colonies and the ratio of induced uninduced bacterial colonies should exceed 10 1 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 6 4 Verification of the obtained subclones Colonies should be picked and cultured in 1 ml of LB medium with Amp overnight to verify the successful recombination event Plasmid DNA should be prepared and analyzed by restriction digest For the control experiment the restriction pattern of pSub Hoxa11 after Bg digest is shown below 7759bp 3485bp 1959bp 1836bp 1730bp 692bp 422bp s also figure 8 M Subclones kb y 3 SM A 1 l1 11 u 4U 2 0 1 6 159 Figure 4 Restriction analysis of pSub Hoxa11 subclones after Bgll digest M 1 kb ladder from Gibco Lanes 7 to 15 different subclones containing the 15kb Hoxa1 1 gene Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 15 6 5 Maps and Sequences
8. cell and during one hour there is approximately 1 doubling step meaning any daughter cell will still have on average 2 3 copies left and wil also go on expressing the recombination proteins The plasmid is actually lost after electroporation and recombination when cells are incubated at 37 C overnight 4 Prepare the cells for electroporation Centrifuge for 30 sec at 11 000 rpm in a cooled 2 C microfuge benchtop centrifuge Discard the supernatant by quickly tipping it out twice and place the pellet on ice Resuspend the pellet with 1 ml chilled ddH2O pipetting up and down three times to mix the suspension Repeat the centrifugation and resuspend the cells again Centrifuge and tip out the supernatant once more 20 to 30 ul will be left in the tube with the pellet Resuspend cells and keep the tubes on ice 5 Add 1 2 ul 100 200 ng of your prepared linear vector PCR product to the pellet to each of the two microfuge tubes induced and uninduced and pipette the mixture into the chilled electroporation cuvettes In parallel pipette 1 ul from tube 3 into each of the two tubes of the control 6 Electroporate at 1350 V 10 uF 600 Ohms This setting applies to an Eppendorf Electroporator 2510 using an electroporation cuvette with a slit of 1mm Other devices can be used but 1350 V and a 5 ms pulse are recommended 7 Add 1 ml LB medium without antibiotics to the cuvette Mix the cells carefully by pipetting up and down and pipette
9. coats the single strand The protein nucleic acid filament aligns with homologous DNA Once aligned the 3 end becomes a primer for DNA replication The A recombination genes can be expressed from a plasmid Figure 5 and are therefore transferable to any E coli strain pRedET Figure 5 carries the X phage red ypa operon expressed under the control of the arabinose inducible pBAD promoter Guzman et al 1995 and confers Tetracycline resistance tc The pBAD promoter is both positively and negatively regulated by the product of the araC gene Schleif 1992 AraC is a transcriptional regulator that forms a complex with L arabinose Arabinose binds to AraC and allows transcription to begin In the presence of glucose or the absence of arabinose transcription is blocked by the AraC dimer The plasmid carries the reda p y genes of the A phage together with the recA gene in a polycistronic operon under the control of an inducible promoter The recombination window is therefore limited by the transient expression of Red proteins Thus the risk of unwanted intramolecular rearrangement is minimized While constitutive expression of the redy gene has a toxic effect in recA cells like DH10B or HS996 under some conditions thus limiting the efficiency of recombination tightly regulated expression of the gene together with simultaneous expression of the red a and B genes allows efficient homologous recombination between linear DNA fragmen
10. 19 8 Hnelerences and Palenls nein naea aa aa aR 22 8 1 PICTOL ENC CS RTT TT ET 22 8 2 auci P O OO 23 9 Purchaser Notification Warranty eeclesie eee eeee eese aiana ainiai aaka 24 10 Other products available from Gene Bridges eeeeeeceeeeeeeeeere e 25 11 DNA Engineering Services Available from Gene Bridges 30 Please read The products listed in this manual are for research purposes only They are not designed for diagnostic or therapeutic use in humans animals or plants Success depends on following the protocols exactly as they are described Do read the trouble shooting guide before beginning your experiments Red ET Recombination is the intellectual property of Gene Bridges GmbH Safety Some chemical reagents used with this system are dangerous if handled carelessly Take care when using chemical reagents such as isopropanol and ethidium bromide and electrical apparatus high voltage power supplies gel electrophoresis and electroporation apparatus Follow the manufacturers safety recommendations 2 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 1 BAC Subcloning Kit Introduction The completion of large DNA sequencing projects including the Human Genome Project has generated an extraordinary amount of primary sequence data The next major challen
11. ET SCTCGTGCTA AAGTTTACTC GCGGGTGTGG CCITITUCSGOIT DZATICGOUGOGL CITGATTTGG ITGACGITGG AACCCTATCT TTAAAAAATG ACAATTTAAA ACGTGAGTTT AGATCCTITT DGTGOGTTTGT CAGAGCGCAG GAACTCTGTA CAGTGGCGAT GCAGCEG ICG CAV CGAAL UG AAAGGCGGAC TCCAGGGGGA GOGILIATITI GGLLTTTTTIA ATCOOLCIGALT CAGCCGAACG GTATTTTCTC CoACAL CCGG TACAGACAAG CGTGGACA ATATATACTT TGGTTACGCG TOTTCCCTTCO TCCCTTTAGG GTGATGGTTC AGTCCACGTT CGGGCTATTC AGCTGATTTA AGGATCTAGG TCGTTCCACT TTTCTGCGCG TTGCCGGATC ATACCAAATA GCACCGCCTA AAGTCGTGTC GGCTGAACGG AGATACCTAC AGGTATCCGG AACGCCTGGT TTGTGATGCT CGGTTCCTGG TCTGTGGATA ACCGAGCGCA CTTACGCATC CAACACCCGC CTGTGATATC ECORV TAGATTGATT CAGCETGACC CIT TCLS GITCCGALDTT ACGTAGTOGGG CTTTAATAGT TTTTGATTTA ACAAAAATTT TOAAGAICGCI GAGCGTCAGA TARTCTGOUI G AAGAGCTACC CIGICCITLI CATACCTCGC TTACCGGGTT cGocGGTTUGTG AGCGOTGAGLTI TAAGCGGCAG ATCTTTATAG CoGlCAGEGGG CLITIITGCTSE ACLOCTATTAC GCGAGTCAGT TGTGCGGTAT TGACGCGCCE GCGGCGGAGG TACGUGCCCT GCTACACTIG ACGIICGCCG AGTGCILTAC CCATCGCCCT GGACTCTTGT TAAGGGATTT AACGCGAATT TTTTGATAAT CCCCGTAGAA CTTGCAAACA AACTCTTTTT AGTGTAGCCG ICTGCTAATC GGACTCAAGA O BLADULC ATGAGAAAGC GGTCGGAACA ICUTGIV GGG GCGGAGCCTA GUOLTITITOCLT CGUCTTTGAG GAGCGAGGAA IICACACUGU TGACGGGCTT TG GCTGAISAT GIAGEGGEGE CCAGCGCCCT GCITICOCCO GGCACCTCGA GATAGACGGT TCCAAACTTG DOCCGAITTC TTAACAAAAT CICATGAULA AAGATCAAAG AAAAAACCAC CCGAAGGTAA IAGITAGGUC CTGTTACCAG CGATAGT
12. IT GAT AAG RI GAG TCA TOC ACH GAT CCA CGC ATA LIT ICT GTA CAG RIT VOL CAG ATC AAA CAA CCA AGT ACG CAT AAC AAA GAC CCG CGU GIT ATC var CRT GIT TIT TTG GGT CIT GAG GIT CIG LIU GGT GTC ACA GLT GCC ATL GGA GTA ACT GAC GAG CTA TTA TOG ATG GCT GGC GGT AIC 212 TAL GCT GAG TI GCI GCA AGT CTA CGC GAA ATA GGA CGC GaL AGL GAG TGG ATT ACG ATA on lone CGA ITT TGT CGC AAG ACC LOG CTTI GAC GGC GCG TTT GCA ACG GGT GIC a GIG COC GGC ATA CAT ATG AAG GAT ACC GAA GAT ATT GCA GGG GL GCC GAA GGT Cela GCG CAL Oa alk AGL GAG T ACG OIA AAA GET sale AGT TCA Call ACG TAC GAA GTA TAL ACG GAT GLA TGG ATG LIT GIT GAT GGG CAG Cl ATI CTG ATC GAA TIA Tol GAT BAL ACE GAA I ACT GCA AAA GGA GCA ATT UCC GTG GAA Col IC CAG GGG ACT GCI Bee GTA GIA GGA IGI GAT ACT AAG CT AAA CIG AIT CGT AAL ATG GCG ITI GAG GCA GCT Mer GGA GGT ATG CAT TIT GTA GAT on GTT GAC ACA GCC ET Sue ATG TCC LIT GGL AAG GAT es Cee AAA Lu ATG GAC TTG GTA AAG AL AAT a CGG Sule GGT oc GAA TAA ClGTCAUACC ATTAAGCGCG AGCGULUCCGCT TCAAGCTCTA CCCCAAAAAA IITTOGCUC TL AACAACACTC GGCCTATTGG AITAACGITT AAATCCCTTA GATLTTCTTI CGLTALUCAGC ULGGCTICAG ACCACTTCAA ToC TIGGTGC COGATAAGGC GAACGACCTA CCGAAGGGAG CGAGGGAGCT ICTGACTTGA CCAGCAACGC ITICUITGOGIT CUGCTCGCCUO GCCTGATGCG GGCTGCOUCL CELATSSS
13. Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid FRT or loxP flanked kanamycin neomycin resistance template FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP to be used for your own experiments Expression plasmid for FLPe or Cre site specific recombinase in E coli cells Positive controls to introduce a single FRT site into a 15 kb high copy plasmid Detailed protocols descriptions of plasmids maps and sequences Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 27 K006 Quick and Easy E coli Gene Deletion Kit Description Contents 28 This kit is designed to knock out or alter genes on the E coli chromosome in less than one week Red ET recombination allows the exchange of genetic information in a base pair precise specific and faithful manner An FRT flanked kanamycin resistance marker cassette is supplied with the kit which can be used to replace a gene on the E coli chromosome Red ET recombination can replace fragments as large as 30kb from the chromosome The use of a FRI flanked resistance cassette for the replacement of the targeted gene allows the subsequent removal of the selection marker by a FLP recombinase step if required FLP expression plasmids can be purchased from Gene Bridges Multiple knock outs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combi
14. TAC AGGI TOGAGL GCLCACOCTIL GGAGAGCGCA ITTUCGCCALL TGGAAAAACG LALATGTTCT TGAGCTGATA GCGGAAGAGC ATAGGGTCAT GICTOCTLCC GTGATCAGCA Figure 7 Sequence of the PCR product used in the control experiment The red colored regions at both ends are the introduced homology arms which are homologous to the Hoxali gene The sequence between the EcoRV sites GATATO reflects the minimal vector Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 17 Bgll 17685 EcoRV 16766 EcoRV 1524 Bgll 15955 De Bgll 2 ori amp ___ Bgl 2752 Boll 13996 pSub Hoxa11 17883 bp N al 6237 Hoxall gene Figure 8 Map of the subclone pSub Hoxai1 obtained in the control reaction A 15 kb fragment containing the mouse Hoxa11 gene of the original BAC is subcloned into a minimal vector Bgll restriction sites which are used to check the successful recombination are indicated s also fig 4 6 6 Oligonucleotides The oligonucleotides used to subclone a 15kb fragment from the control BAC are given below The homology arms are indicated in italics the introduced EcoRV restriction sites are indicated in bold and the sequence which primes the linear vector PCR template is underlined Upper 5 TGTCCACGTAGCACGAGCTGCTGATCACATCTCAGCGACCTCCGCCGCGATAT CACAGCTTGTCTGTAAGCGGATG 3 Lower 5 TCTCTCGGTGGAGAGAATGTGTGTTATCACCAGGAAGAAAACCGACAATAGATA TCGCICICCIGAGTAGGACAAATO 3 18 Gene Bridges BAC Subclon
15. asmid pRedET will be lost at 37 C 8 Using a small loop plate 100 ul cells on LB agar plates containing Tc 3 ug ml plus Cm 15 ug ml for the BAC Incubate the plates at 30 C overnight or for at least 15 h Protect the plates from light by wrapping them up because Tc is sensitive to light Make sure the cells stay at 30 C otherwise the Red ET plasmid will be lost 9 At the same time use a loop to streak the control culture which already contains both a BAC and pRedET tube 4 on a Cm Tc 15 ug ml 3 ug ml plate and incubate at 30 C overnight Protect the plate from light by wrapping it up 6 3 Subcloning of a gene from a BAC by Red ET In the next step the fragment which is to be subcloned will recombine into the linear vector leading to a circular molecule which contains the ampH selection marker and a ColE1 origin of replication minimal high copy vector Prepare electro competent cells from the BAC hosts that contain the pRed ET expression plasmid shortly after inducing the expression of the recombination proteins In advance prepare the linear vector DNA fragment with homology arms matching the fragment you would like to subclone from your BAC Use tube 3 minimal vector PCR product and tube 4 E coli cells control BAC pRedET tc to perform a control experiment in parallel Day 39 1 To start overnight cultures pick one colony from the plate you obtained in 6 2 step 8 and inoculate one microfuge tube co
16. d to Gene Bridges Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 23 9 Purchaser Notification Warranty This product is the subject of European Patent No 1034260 issued on 12 3 2003 or PCT EP98 07945 and United States Patent No 6 355 412 issued on 12 of March 2002 The purchase of this product conveys to the purchaser the non transferable right to use this product for research purposes only The purchaser can not sell or otherwise transfer this product or its components to a third party No rights are conveyed to the purchaser to use this product or its components for a commercial purpose Commercial purposes shall include any activity for which a party receives consideration of any kind These may include but are not limited to use of the product or its components in manufacturing to provide a service information or data use of the product for diagnostic purposes or re sale of the product or its components for any purpose commercial or otherwise The use of homologous recombination for commercial purposes may infringe the intellectual property covered by the EP 419 621 patent family Products containing the araB promoter are sold under patent license for research purposes only and are non transferable Inquiries for any commercial use including production of material to be sold commercially or used in production or in product development efforts which includes efforts toward regulatory approval should be made direct
17. es BAC Subcloning Kit Version 2 9 May 2014 You cannot separate the recombined plasmid from the non recombined one after recombination even after re transformation high copy plasmid In very rare cases we have observed that after recombination it is difficult to separate the original plasmid from the recombined one If you cannot separate them by dilution of the plasmid and re transformation you can choose a single cutting restriction enzyme and digest the plasmid for a few minutes After re ligation and re transformation the two plasmids should be separated even when they were tangled intertwined before Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 21 8 References and Patents 8 1 References 22 Angrand P O Daigle N van der Hoeven F Scholer H R Stewart A F Simplified generation of targeting constructs using ET recombination Nucleic Acids Res 27 e16 1999 Guzman L M Belin D Carson M J Beckwith J Tight regulation modulation and high level expression by vectors containing the arabinose pBAD promoter J Bacteriol 177 4121 4130 1995 Hill F Benes V Thomasova D Stewart A F Kafatos F C Ansorge W BAC trimming minimizing clone overlaps Genomics 64 111 113 2000 Miller C A Ingmer H and Cohen SN Boundaries of the pSC101 Minimal Replicon are Conditional J Bacteriol 177 4865 4871 1995 Muyrers J P P Zhang Y Testa G Stewart A F Rapid modification of bacterial
18. ge is to investigate the components that make up a genome and is often called functional genomics Escherichia coli vectors that can contain large inserts such as bacterial artificial chromosomes BACs P1 vectors and P1 artificial chromosomes PACs offer several advantages for functional genomics They can carry sufficient DNA to encompass most eukaryotic genes including all cis acting regulatory elements as well as many eukaryotic gene clusters prokaryotic regulons and many complete viral genomes in a single molecule However conventional cloning methods rely on the use of restriction enzymes and in vitro purification steps which preclude engineering of large molecules Consequently the usefulness of such molecules has been limited until recently Red ET Recombination is the method that permits precise engineering of DNA molecules of any size including very large ones such as BACs or the E coli chromosome It relies on homologous recombination in vivo in E coli and allows a wide range of modifications with DNA molecules at any chosen position Homologous recombination is the exchange of genetic information between two DNA molecules in a precise and specific manner These qualities are optimal for engineering a DNA molecule regardless of its size Homologous recombination occurs through homology regions which are stretches of DNA shared by the two molecules that recombine Because the sequences of the homology regions can be chosen f
19. ing Kit Version 2 9 May 2014 7 Troubleshooting Problems with the recombination reaction can be caused by a number of different factors Please review the information below to troubleshoot your experiments We highly recommend performing a positive control experiment using the components provided in the kit For homologous recombination the two DNA molecules must share two regions of perfect sequence identity Several wrong nucleotides in the homology region can completely abolish recombination Since oligonucleotides are used to add the homology regions they have to be synthesized properly and be of excellent quality Take into account that long oligonucleotides especially if they are longer than 80 bp require additional purification steps such as HPLC Also note that the electronic sequences provided for BACs may not be 100 correct Observation No colonies on your plate after Red ET Recombination lf you do not obtain any colonies after recombination the following parameters should be checked 1 The PCR product could be wrong check it by restriction digest or sequencing could be degraded check an aliquot on an agarose gel could have incorrect homology arms Please double check the oligonucleotides used to generate the homology arms for quality and correctness If necessary verify the sequence by sequencing of the PCR product may not be enough increase the amount of PCR product from approximately 200 ng up
20. ions should be stored at 20 C For selective LB medium the antibiotic is dissolved in LB medium to the indicated working concentration 1 Chloramphenicol Cm stock solution c 30 mg ml dissolved in ethanol Working concentration 15 ug ml for BACs and 50 ug ml for high copy plasmids Ampicillin Amp stock solution c 100 mg ml dissolved in 50 ethanol Working concentration 50 ug ml for BACs and 100ug ml for high copy plasmids Tetracycline Tc stock solution c 10 mg ml dissolved in 75 ethanol Working concentration for p5C101 BAD gbaA 3 ug ml for high copy plasmids 10 ug ml Tetracycline is light sensitive Kanamycin Km stock solution c 30 mg ml dissolved in ddH gt 0 Working concentration 15 ug ml for BACs and 50 ug ml for high copy plasmids streptomycin Str stock solution c 50 mg ml dissolved in ddH20 Working concentration 50 ug ml Selective LB plates are made by adding 15 g agar to 1 L LB medium After boiling cool to approx 50 C add the required antibiotics to yield the appropriate working concentrations and pour into petri dishes L arabinose stock solution Use 1096 L arabinose Sigma A 3256 in ddH2O fresh or frozen in small aliquots at 20 C Use 50 ul stock solution per 1 4 ml LB for induction of recombination protein expression from pRedET Frozen aliquots should not undergo more than three freeze thaw cycles Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 6 Technical protocol
21. ls maps and sequences 4 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 2 Experimental Outline Step 1 homology region on ET minimal vector M homology region OH OH L Arabinose O 30 gt 37 HO OH Step 3 A Geneof interest I j Hh Subclone Figure 1 Flowchart of the experimental outline for subcloning a gene or part of a gene from a BAC into a plasmid Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 5 In the first step oligonucleotides are designed containing stretches homologous hm to the fragment of the BAC which is to be subcloned At their 3 ends these oligonucleotides also contain primer sequences for amplification of the vector Using these oligonucleotides a linear minimal vector with flanking homology arms is constructed in a PCR reaction In the second step the E coli strain carrying the BAC which is to be modified is transformed with the expression plasmid pRedET The expression of genes mediating Red ET is induced by the addition of L arabinose In the third step the linear vector PCR product with the added homology arms is electroporated into the cells Recombination will take place and the clones carrying the subcloned fragment are identified by selection for ampicillin resistance Only colonies with a circularized recombines vector will Survive ampicillin selection on the agar plates 6 Gene Bridges BAC Subcloning Kit Version 2
22. ly to Xoma Corporation Berkeley California Xoma Corporation 2910 Seventh Street Berkeley CA 94710 Limited Warranty Gene Bridges is committed to providing customers with high quality goods and services Gene Bridges assumes no responsibility or liability for any special indirect incidental or consequential loss or damage whatsoever This warranty limits Gene Bridges GmbH s liability only to the cost of the product 24 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 10 Other products available from Gene Bridges General information e Kits are available for non commercial research organizations Commercial companies or for profit organizations require a sub license to use Red ET Recombination The complete product list as well as the all information how to order the kits in your country is given on our website www genebridges com K001 Quick and Easy BAC Modification Kit Description Contents This kit is designed to modify any type of bacterial artificial chromosomes BACs within 1 2 weeks by using a kanamycin neomycin cassette This kit is optimized for basic modifications such as insertions or deletions of fragments in any type of bacterial artificial chromosomes BACs leaving a selectable marker gene This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET af
23. n Cassette FRT cm FRT e A007 loxP flanked Chloramphenicol Selection Cassette loxP cm loxP e A008 FRT flanked Ampicillin Selection Cassette FRT amp FRT e A009 loxP flanked Ampicillin Selection Cassette loxP amp loxP e A010 FRI flanked Pro and Eukaryotic Hygromycin Selection Cassette FRT PGK gb2 hygro FRT e A011 loxP flanked Pro and Eukaryotic Hygromycin Selection Cassette loxP PGK gb2 hygro loxP Additional strains and plasmids e A104 Enhanced FLP Expression Plasmid 707 FLPe with tetracycline resistance marker for use in E coli only e A105 Enhanced FLP Expression Plasmid 708 FLPe with chloramphenicol resistance marker for use in E coli only e A112 Cre Expression Plasmid 705 Cre cm resistance marker e A113 Cre Expression Plasmid 706 Cre tet resistance marker e A201 Enhanced Eukaryotic FLP Expression Plasmid pCAGGS FLPe Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 29 11 DNA Engineering Services Available from Gene Bridges Instead of performing your own DNA manipulations let the Gene Bridges DNA Engineering Service do the work for you We work for many commercial and research organisations across the world to provide DNA modifications in low or high copy plasmids cosmids BACs and the E coli chromosome The available DNA modifications are Insertion of a selectable or non selectable marker cassette Deletion of sequences of any size ranging from 1 bp up to more than 100 kb with
24. n be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid oRpsL neomycin template to be used for your own experiments Positive controls to introduce a point mutation in a 150 kb BAC Detailed protocols descriptions of plasmids maps and sequences Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 K004 Quick and Easy Conditional Knockout Kit FRT FLPe and K005 Quick and Easy Conditional Knockout Kit loxP Cre Description Contents This kit is designed to integrate FRT or loxP sites into large vectors at any position within 2 weeks Single FRT or loxP sites are inserted by Red ET recombination of FRT or loxP flanked functional cassettes into any designated locus with subsequent removal of the selection marker by FLPe or Cre recombinases Conditional targeting constructs can be generated either by a repetitive insertion of the functional cassette supplied with the kit or by combination with other functional cassettes offered by Gene Bridges The functional cassette supplied with the kit FRT PGK gb2 neo FRT or loxP PGK gb2 neo loxP combines a prokaryotic promoter go2 for expression of kanamycin resistance in E coli with an eukaryotic promoter PGK for expression of neomycin resistance in mammalian cells High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET
25. nation with other functional cassettes offered by Gene Bridges Strictly controlled recombination process due to an optimized design of the pRedEI expression plasmid The genes for the Recombination proteins are under the control of an inducible promoter and the plasmid carries a temperature sensitive origin of replication for a convenient removal of the plasmid after recombination Two Red ET Recombination protein expression plasmids pRedET tc and pRedET amp Any E coli strain can be made Red ET proficient by transformation with these plasmids FRT flanked kanamycin resistance template FRT PGK gb2 neo FRT to be used for your own experiments Positive controls to replace the gene for mannose transporter manxX on the E coli chromosome Detailed protocols descriptions of plasmids maps and sequences Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 Additional functional cassettes e A001 Pro and Eukaryotic Neomycin Selection Cassette PGK gb2 neo e A002 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette FRT PGK gb2 neo FRT e A003 loxP flanked Pro and Eukaryotic Neomycin Selection Cassette loxP PGK gb2 neo loxP e A004 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site FRT PGK gb2 neo FRT loxP e A005 FRT flanked Pro and Eukaryotic Neomycin Selection Cassette plus loxP site 2 version loxP FRT PGK gb2 neo FRT e A006 FRT flanked Chloramphenicol Selectio
26. ntaining 1 0 ml LB medium plus Tc 3 ug ml and Cm 15 ug ml for the BAC Also pick one colony from the control plate Puncture a hole in the lid of the tubes for air Incubate the cultures while shaking at 30 C overnight Day 4 Before starting e Chill ddH2O or 1096 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap e Cool benchtop centrifuge to 2 C Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 13 2 The next day set up 4 lid punctured microfuge tubes 2 for your own experiment and 2 for control experiment containing 1 4 ml fresh LB medium conditioned with the same antibiotics as in step 1 Inoculate two of them with 30 ul fresh overnight culture for your experiment the other two with 30 ul of the overnight culture from the control Incubate the tubes at 30 C for approximately 2 h shaking at 1 100 rpm until ODeoo 0 3 3 Add 50 ul 10 L arabinose to one of the tubes for your own experiment and to one of the control tubes giving a final concentration of 0 396 0 496 This will induce the expression of the Red ET Recombination proteins Do not use D arabinose Leave the other tubes without induction as negative controls Incubate all at 37 C shaking for 45 min to 1 h Note It is important that cells are incubated at 37 C the temperature at which all proteins necessary for the subsequent recombination are expressed There are about 5 copies of this temperature sensitive plasmid per
27. ogy 21 443 7 2003 e Zhang Y Buchholz F Muyrers J P P and Stewart A F A new logic for DNA engineering using recombination in Escherichia coli Nature Genetics 20 123 128 1998 e Zhang Y Muyrers J P P Testa G and Stewart A F DNA cloning by homologous recombination in Escherichia coli Nature Biotech 18 1314 1317 2000 e Zhang Y Muyrers P P J Rientjes J and Stewart A F Phage annealing proteins promote oligonucleotide directed mutagenesis in Escherichia coli and mouse ES cells BMC Molecular Biology 4 1 14 2003 8 2 Patents Red ET recombination is covered by one or several of the following patents and patent applications e Stewart A F Zhang Y and Buchholz F 1998 Novel DNA cloning method European Patent No 1034260 issued on 12 of March 2003 United States Patent No 6 509 156 e Stewart A F Zhang Y and Muyrers J P P 1999 Methods and compositions for directed cloning and subcloning using homologous recombination United States Patent No 6 355 412 issued on 12 of March 2002 e Youming Zhang A Francis Stewart and Joep P P Muijrers 2001 Improved RecT or RecET cloning and subcloning method European Patent Application No 01 117 529 6 e Stewart A F Zhang Y and Muyrers J P P 2001 Recombination method European Patent Application No 0103276 2 These patents and patent applications are owned by Gene Bridges or owned by the EMBL and exclusively license
28. onucleotide 2 0 ul Minimal vector PCR template tube 2 0 5 ul Taq polymerase 5 U ul e An annealing temperature of 57 62 C is optimal e Thirty cycles 1 95 1 57 62 C 2 5 72 C Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 11 1 Check 3 ul of PCR products on a gel to ensure the PCR was successful The size of the PCR product is around 2 7kb s page 17 2 Precipitate using 5 ul 3 M NaAc pH 7 0 and 150 ul 100 ethanol Mix well and precipitate for 5 min at 80 C or 30 min at 20 C Spin down the DNA at maximal speed for 5 min 3 Carefully wash the pellet once with 500ul 70 ethanol Be sure not to wash it away You should see an obvious pellet at the bottom or along the walls of your tube 4 Dry the pellet at 37 C using a heating block for 5 10 min or vacuum dry for 2 min Resuspend in 5 ul 10mM Tris HCl pH 8 0 0 2 0 5 ug ul 6 2 Transformation with Red ET expression plasmid pRedET Before starting with the experiment please streak out the glycerol stock of the BAC clone you obtained from the stock center on LB plates conditioned with Cm Day 1 1 Set up an overnight culture Pick one or two colonies and inoculate them in microfuge tubes containing 1 0 ml LB medium plus Cm 15ug ml Puncture a hole in the lid for air Incubate at 37 C overnight with shaking Day 2 Before starting e Chill ddH2O or 1096 glycerol on ice for at least 2 h e Chill electroporation cuvettes 1 mm gap
29. or without leaving a selectable marker Replacement of genes on the E coli chromosome Point mutations Fusions Introduction of site specific targeting sites loxP FRT etc Insertion of restriction enzyme recognition sites Subcloning of DNA pieces up to 60 kb Transferring DNA fragments into multiple destination vectors BAC and cosmid stitching Substitutions Contact our DNA Engineering Service by email to contact genebridges com or go to www genebridges com for details and prices 30 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 This page intentionally left blank Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 31 Gene Bridges GmbH Commercial Centre Im Neuenheimer Feld 584 69120 Heidelberg Tel 49 0 6221 13 70 811 Fax 49 0 6221 13 70 829 contact genebridges com www genebridges com
30. r respectively 10 glycerol is sufficiently cold Linear DNA has been shown to be about 10 fold less active than DNA transformed in circular form Eppendorf Operation Manual Electroporator 2510 version 1 0 Make sure that the time constant is around 5 ms please make sure that there is no arching during the electroporation process please make sure that after electroporation the cells are plated on the appropriate concentration of antibiotics depending on the copy number of the plasmid or BAC see page 10 oimilar number of colonies on both plates the induced and the uninduced one If you obtain a high number of colonies on both plates it indicates that there are still traces of the circular or supercoiled plasmid used to prepare the linear fragment left in the sample Since the transformation efficiency of linear fragments is 10 fold less than of circular DNA molecules you may obtain a background even if no traces were visible on an agarose gel If the linear DNA fragment was obtained by restriction digestion use less DNA and gel purify the fragment If the linear cassette was obtained by PCR set up a Dpnl digest for your PCR product and gel purify it at the end If you obtain a very low number of colonies on both plates it indicates that the overall efficiency of Red ET Recombination is very low In this case please check all parameters mentioned in the section entitled no colonies after Red ET Hecombination 20 Gene Bridg
31. reely any position on a target molecule can be specifically altered Red ET Recombination utilizes homologous recombination and represents a revolutionary DNA engineering platform that addresses the limitations found in conventional methods BAC Subcloning kit The BAC subcloning kit is designed to subclone DNA fragments of any size including very large fragments gt 20 kb from any type of bacterial artificial chromosomes BACs P1s PACs into a plasmid vector Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 3 Contents of the kit 1 pRedET ic Red ET expression plasmid 20 ng ul 20 ul 2 minimal vector PCR template for generating a linear vector carrying a ColE1 origin plus ampicillin resistant amp gene 50ng ul 20 ul 3 minimal vector PCR product A ColE1 origin plus ampicillin resistant gene amp already flanked by homology arms to be used in the control reaction for subcloning the mouse Hoxa11 gene 15kb from a mouse BAC 100 ng ul 10 ul 4 E coli cells control BAC pRedET tc Glycerol stock of E coli strain DH10B harboring the expression plasmid pRedET ic as well as a pBeloBAC11 derivate for the control experiment 500 ul 25 glycerol 5 pSub Hoxal11 Glycerol stock of E coli strain DH10B harboring the plasmid which contains the mouse Hoxal1 gene 15kb as positive control 500 ul 25 glycerol Please store tubes 1 3 at 20 C and tubes 4 and 5 at 80 C Kit manual with protoco
32. ter recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain can be made Red ET proficient by transformation with this plasmid BAC host E coli strain HS996 already carrying the Red ET plasmid Tn5 neomycin resistance template to be used for your own experiments Positive controls to introduce a Tn5 neo cassette in a 150 kb BAC Detailed protocols descriptions of plasmids maps and sequences Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 25 K002 Counter Selection BAC Modification Kit Description Contents 26 This kit is designed to modify any type of bacterial artificial chromosomes BACs within 2 3 weeks by using a counter selection cassette The kit is designed for advanced BAC modification such as introducing short sequences e g point mutations loxP sites restriction sites etc insertion or deletion of non selectable marker genes fragment exchange without leaving a selection marker or any unwanted sequences The included counter selection cassette pRpsL neo is based on streptomycin selection which shows a much higher efficiency than pSacB neo or comparable systems This kit can also be used to work on bacterial chromosomes and common ColE1 origin plasmids High Red ET efficiency plus convenient removal of the Red ET Recombination protein expression plasmid pRedET after recombination Red ET Recombination protein expression plasmid pRedET Any E coli strain ca
33. the other oligonucleotide is the homology region shared by the target molecule and the linear molecule For the homology regions choose the last 50bp at either end of the part you want to subclone from the BAC 2 Optional Part B BU for the other oligonucleotide This part of the oligonucleotide allows useful sequences such restriction sites multiple cloning sites etc to be incorporated into the recombinant product B and or B By design these will be incorporated into the recombinant product exactly where desired If the introduction of such operational sequences is not needed this piece can simply be omitted from the oligonucleotide design 3 Required Part C C for the other oligonucleotide This sequence usually 18 to 24 nucleotides long primes the PCR amplification of the minimal vector from the provided template sequences are given on page 10 PCR template with annealed oligos PCR product amp BAC Targeting construct N B C oni 3 A A ORI Amp ORI Ampf ORI Amp C B Ns A A BAC Figure 3 Practical steps involved in Subcloning by Red ET recombination Fig 3 illustrates the principle for designing oligonucleotides to generate a linear vector with homology arms See text above for further details Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 9 5 Media for antibiotic selection All antibiotics are available from Sigma Stock solut
34. to 500 ng Please take into consideration that you may also increase non specific background 2 The BAC may be instable and may have rearranged Digest the BAC and run on a gel preferably PFGE to confirm the approximate size may contain some repeats in the region you are targeting Re check sequence could be wrong make sure that you have the right BAC by isolating DNA and checking the region of the homology arms by PCR If necessary sequence the PCR product to verify the region of homology Some BACs are wrongly annotated inherently instable or a mixture of more than one BAC Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 19 3 The Red ET reaction did not take place because there was no expression plasmid present in the cells e g the cells were grown at 37 C instead of 30 C check for tc no or the wrong type of arabinose was used for induction please make sure you use L arabinose some strains e g JM109 DHbalpha are less efficient in Red ET Recombination than others DH10B HS996 GeneHogs or TOP10 are our preferred strains in very rare cases an elongation of the reaction time for the recombination from 70 min incubation of electroporation to up to four hours is necessary for successful recombination 4 Problems with and after the electroporation cells are not competent enough to take up the linear DNA fragment Please make sure that the cells were kept on ice and that the wate
35. ts and plasmids resident in cells such as DH10B pRedET is a derivative of a thermo sensitive pSC101 replicon which is a low copy number plasmid dependent on oriR101 The RepA protein encoded by plasmid pSC101 is required for plasmid DNA replication and the partitioning of plasmids to daughter cells at division Miller Ingmer and Cohen 1995 Because the RepA protein is temperature sensitive T cells have to be cultured at 30 C to maintain the plasmid pSC101 derivatives are easily curable at 37 C to 43 C Experiments have shown that the copy number of the plasmid decreases by about 8096 during four generations of bacterial cell growth at 42 C After return of the cultures to 30 C approximately the same number of generations of bacterial cell growth is required for the copy number of the plasmid to return to the level observed before Miller Ingmer and Cohen 1995 oince the plasmid is based on oriR101 it can be propagated in E coli together with most ColE1 derived plasmids 8 Gene Bridges BAC Subcloning Kit Version 2 9 May 2014 4 Oligonucleotide Design for Red ET Recombination To target your BAC at the site s you choose you will need to attach short homology regions to a minimal vector containing a selectable marker This is most conveniently done by ordering two oligonucleotides for use in PCR amplification see Figure 3 Each oligonucleotide consists of two or if desired three parts 1 Required Part A A for
Download Pdf Manuals
Related Search