Turbo Dicer siRNA Generation Kit
Contents
1. 2 2 1 3 Optional Once hydrated these columns can be stored in the refrigerator up to 3 days 2 2 1 4 Spin the column at 750 x g for 4 min to remove excess interstitial fluid keeping track of the orientation of the column in the rotor by marking the column 2 2 1 5 Discard the wash tube and immediately apply the sample 20 100 ul DIRECTLY TO THE CENTER OF THE GEL BED at the top of the column without disturbing the gel surface or contacting the sides of the column with the pipette tip or reaction mixture 2 2 1 6 Place the column in the sample collection tube and place in the rotor maintaining the same orientation as in Step 2 2 1 4 2 2 1 7 Spin the column in the tube at 750 x g for 3 min Your sample will be in the collection tube 2 2 2 Use RNA Purification Column 2 to remove the undigested dsRNA 2 2 2 1 Insert the sample reservoir into one of the vials provided 14 858 457 1919 or 888 428 0558 US Toll Free 2 2 2 2 Add 10 ul of nuclease free water into the sample reservoir without touching the membrane with the pipette tip Seal the attached cap 2 2 2 3 Place the assembly in a microcentrifuge and counterbalance with a similar device Spin at 500 x g for 2 minutes Empty any nuclease free water in the collection tube 2 2 2 4 Add the samples from step 2 2 1 7 into the sample reservoir without touching the membrane with the pipette tip Seal with the attached cap 2 2 2 5 Place assembly in a microcentrifuge and co2. 5X BSA 1 tube 50 ul Nuclease free Water 1 tube 1 ml TurboScript T7 T7 Enzyme Mix 1 tube 10 ul T7 Reaction Buffer 1 tube 10 ul NTP Mix 1 tube 40 ul DNase I 1 tube 5 ul 2X Gel Loading Buffer 1 tube 175 wl Nuclease free Water 1 tube 1 ml LiCl Precipitation Solution 1 tube 175 wl GFP Control Plasmid 1 tube 10 ul of gWiz GFP 1 ug ul 5 Control Primer 1 tube 10 ul 1 ug ul 3 Control Primer 1 tube 10 ul 1 ug ul GeneSilencer siRNA GeneSilencer siRNA Transfection 1 tube 180 pl Transfection Reagent Kit Reagent 50 Transfections siRNA Diluent 1 bottle 1 5 ml RNA Purification Column 1 RNA Purification Column 1 5 columns Hydration Buffer 4 ml RNA Purification Column 2 5 columns Shipping and Storage The Turbo Dicer siRNA Generation Kit is shipped frozen For maximum stability and long term use immediately store Recombinant Turbo Dicer Enzyme Kit and TurboScript T7 Transcription Kit at 20 C upon receipt Store the GeneSilencer siRNA Transfection Kit at 4 C and store RNA Purification Columns 1 and 2 at room temperature All components are stable for six months when stored properly Genlantis 858 457 1919 or 888 428 0558 US Toll Free VKMO060711 Accessory Products Product Name Cat No Quantity Recombinant Human Turbo D
3. Figure 2 With abundant supply of dsRNA templates and subsequent efficient dsRNA cleavage you are sure to have sufficient siRNAs in every single species to achieve gene silencing Fig 2 Efficient Digestion of Double stranded RNA with Recombinant Human Turbo Dicer Enzyme 700 bp dsRNA 22bpsiRNA Lane Sample 1 100 bp marker 23 700 bp dsRNA lug undigested 3 700 bp dsRNA lug digested 15 hours with 1 unit of Dicer Enzyme 4 700 bp dsRNA lug digested 2 hours with 1 unit of Turbo Dicer Enz me Advantages of Turbo Dicer siRNA Generation Kit Compared to conventional siRNA construction methods such as chemical synthesis and hairpin siRNA expression vectors the Turbo Dicer siRNA Generation Kit offers the following advantages No guesswork A mixture of siRNAs has a better chance of success than a single siRNA design Cost effective No wasted time and money due to failed siRNA designs Fast and effective effective digestion of dsRNA in two hours High efficiency More regions of the genes can be screened for silencing Ideal for use with GeneSilencer siRNA Transfection Reagent VKM060711 Genlantis 8 858 457 1919 or 888 428 0558 US Toll Free METHODS AND PROCEDURES 1 Generating Double Stranded RNA dsRNA Template IMPORTANT NOTE 1 1 Preparation of Template DNA for Transcription 1 1 1 Determining a target region The region selected for gene silencing does not really seem to m
4. are greatly reduced if the 1 or 2 G residues are changed 1 1 3 1 Design gene specific PCR primers by using the diagram below We recommend using 20 bases that are specific to your gene in each primer 1 5 primer 5 GCG TAATACGACTCACTATAGGGAGA NNNNNNNNNN 3 leader T7 promoter sequence Target DNA 20 bases 1 3 primer 5 GCG TAATACGACTCACTATAGGGAGA NNNNNNNNNN 3 leader T7 promoter sequence Target DNA 20 bases VKM060711 Genlantis 9 858 457 1919 or 888 428 0558 US Toll Free 1 5 GCG TAATACGACTCACTATAGGGAGA Target DNA 3 T7 promoter 1 3 Target DNA AGAGGGATATCACTCAGCATAAT GCG 5 T7 promoter 15 1 5 GCGTAATACGACTCACTATAGGGAGA Target DNA TCTCCCTATAGTGAGTCGTATTACGC 3 3 CGCATTATGCTGAGTGATATCCCTCT Target DNA AGAGGGATATCACTCAGCATAATGCG 5 In vitro transcription Sense dsRNA Anti sense 1 1 3 2 PCR protocol We recommend that you use the PCR Control Plasmid which contains a 700 bp GFP gene as positive control template Prepare a 100 ul reaction mix as follows 10 ul 10 x PCR buffer 1 ul 10 mM each dNTP 1 ul DNA template 50 ng 1 ul 5 primer 1 ug l 1 ul 3 primer 1 ug l x pl DNA polymerase Amount varies depending on the supplier 86 x ul ddH O PCR program 94 C for 3 minutes 94 C for 30 seconds 58 C for 30 seconds 35 cycles 68 C for 1 minute Ikb _ 68 C for 5 minutes 4 C storage VKM060711 Ge
5. areas in mammalian cells How Turbo Dicer siRNA Generation Kit Works The Turbo Dicer siRNA Generation Kit mimics the natural RNA interference process by using recombinant human Turbo Dicer enzyme to cleave in vitro transcribed dsRNA into a pool of 22 bp siRNAs Figure 1 Figure 1 How Turbo Dicer siRNA Generation Kit Works Turbo Dicer siRNA Construction Kit T7 promoter Sen se Mapa PETT AA eed ot Pu Target Sequence Illa Anti sense T7 promoter PCR T promoter Sgnse Target Sequence 17 promoter Art sense Transcribe with T7 RNA polymerase LAN ae Aneal and cleanup Sense RNA WPF RNA 2 hour digestion using recombinant Turbo Dicer enzyme and clean up VKM060711 Genlantis 7 858 457 1919 or 888 428 0558 US Toll Free The Turbo Dicer siRNA Generation Kit relies on two novel technologies for efficient siRNA production First the TurboScript T7 Transcription Kit utilizes a novel technology to allow rapid synthesis of 10 to 50 times the amount of RNA produced by conventional in vitro transcription reactions The secret behind high yield is that each DNA template is copied hundreds of times This ensures that you will have sufficient dsRNA after annealing the transcribed sense and antisense RNA strands The second key technology is an ultra active form of human recombinant Turbo Dicer enzyme that can cleave more than 95 of dsRNA template into 22 bp siRNAs within 2 hours under optimized reaction conditions
6. line development in Caenorhabditis elegans Science 293 2269 2271 Boutla A C Delidakis I Livadaras M Tsagris and M Tabler 2001 Short 5 phosphorylated double stranded RNAs induce RNA interference in Drosophila Curr Biol 11 1776 1780 Hammond S M E Bernstein D Beach and G J Hannon 2000 An RNA directed nuclease mediates post transcriptional gene silencing in Drosophila cells Nature 404 293 296 Ui Tei K S Zenno Y Miyata and K Saigo 2000 Sensitive assay of RNA interference in Drosophila and Chinese hamster cultured cells using firefly luciferase gene as target FEBS Lett 479 79 82 Elbashir S M J Harborth W Lendeckel A Yalcin K Weber and T Tuschl 2001 Duplexes of 21 nucleotide RNAs mediate RNA interference in cultured mammalian cells Nature 411 494 498 Elbashir SM Harborth J Weber K Tuschl T 2002 Analysis of gene function in somatic mammalian cells using small interfering RNAs Methods 26 2 199 213 For additional troubleshooting assistance please contact Genlantis Technical Support Dept at Telephone 858 457 1919 Fax 858 623 9494 OR 888 428 0558 US toll free E mail tech genlantis com Web http www genlantis com For a complete list of GTS international distributors visit our web site at http www genetherapysystems com VKM060711 Genlantis 21 858 457 1919 or 888 428 0558 US Toll Free
7. material that may be present around the rim of the tube 1 2 1 2 Assemble the transcription reaction at room temperature The following amounts are for a single 20 ul reaction Reactions may be scaled up or down if desired Add to 20 ul Nuclease free Water 8 ul NTP mix 2 ul T7 Reaction Buffer 1 pg PCR template DNA from step 1 1 4 8 2 ul T7 Enzyme Mix The spermidine in the T7 Reaction Buffer can co precipitate the template DNA if the reaction is assembled on ice Add the T7 Reaction Buffer after the water and the NTP Mix are already in the tube 1 2 2 Gently flick the tube or pipette the mixture up and down gently then microfuge the tube briefly so that the reaction mixture is at the bottom of the tube 1 2 3 Incubate at 37 C for 2 4 hours The first time a new template is transcribed the recommended incubation time is 2 4 hours To determine the optimum incubation time for maximum yield with a given template a time course experiment can be done To do this set up a TurboScript T7 Transcription reaction and remove aliquots of the reaction at various intervals for example after 1 hour 2 hours 4 hours 6 hours and overnight incubations VKM060711 Genlantis 11 858 457 1919 or 888 428 0558 US Toll Free NOTE NOTE IMPORTANT 1 2 4 Add 1 ul DNase I to each 20 ul T7 Reaction Mix well and incubate for 15 min at 37 C The DNase I treatment removes the template DNA 1 2 5 Check the dsRNA on a 1 agarose gel TA
8. plate type Serum Free Medium ul per well 96 wells 1 0 25 48 wells 1 75 25 24 wells 3 5 25 3 2 3 Prepare the d siRNA solution by first mixing the siRNA Diluent and serum free medium SFM according to Table 4 below Use the Diluent SFM mix to dilute the recommended amount of d siRNA in Table 4 Mix well by pipetting up and down several times Incubate at room temperature for 5 minutes IMPORTANT Avoid vortexing the siRNA Diluent mix Table 4 siRNA Dilutions For Suspension Cells Tissue Culture Recommended Amount siRNA Diluent ul plate or dish type of d siRNA to use ng serum free medium ul per well per well 96 wells 125 2 5 15 48 wells 250 5 0 15 24 wells 500 10 0 15 3 2 4 Add the d siRNA solution from Step 3 2 3 to the diluted GeneSilencer solution from Step 3 2 2 Incubate at room temperature for 5 minutes to allow the siRNA lipid complexes to form IMPORTANT You can incubate the siRNA GeneSilencer mix for longer than 5 minutes but make sure not to exceed 30 minutes in order to maintain maximum siRNA transfection efficiency VKM060711 Genlantis 17 858 457 1919 or 888 428 0558 US Toll Free VKM060711 Genlantis 3 2 5 While the siRNA GeneSilencer mix is incubating spin down the cells from Step 3 2 1 remove the growth medium and re suspend the cells in the appropriate growth medium serum free or serum containing to achieve a final cell density listed in Table 5 3 2 6 Transfer resuspended cells to
9. 100 48 wells 250 5 0 15 200 24 wells 500 10 0 15 500 3 1 4 Add the RNA solution from Step 3 1 3 to the diluted GeneSilencer solution from Step 3 1 2 Incubate at room temperature for 5 minutes to allow the siRNA lipid complexes to form IMPORTANT You can incubate the siRNA GeneSilencer mix for longer than 5 minutes but make sure not to exceed 30 minutes in order to maintain maximum siRNA transfection efficiency 3 1 5 Add the siRNA GeneSilencer mix to cells growing in serum containing medium Incubate at 37 C for 24 hours See Table 2 for final transfection volume TIPS For some cell lines like HeLa MDCK and CHO K1 transfection efficiencies may be higher if serum is omitted from the medium during the first 4 hours of transfection After this step add one volume of medium containing 20 serum then proceed to step 3 1 6 VKM060711 Genlantis 16 858 457 1919 or 888 428 0558 US Toll Free 3 1 6 Add fresh tissue culture medium to growing cells as needed Most RNA interference can be detected within 48 hours post transfection 3 2 Transfection of Suspension Cells 3 2 1 The day before transfection split the cells as necessary to optimize their health and achieve log growth by transfection time 3 2 2 Prepare the GeneSilencer Reagent by diluting in serum free medium according to the recommended amount in Table 3 below Table 3 GeneSilencer Dilutions For Suspension Cells Tissue Culture GeneSilencer Reagent ul
10. 888 428 0558 US Toll Free IMPORTANT IMPORTANT VKM060711 Genlantis 1 Avoid using excess recombinant Turbo Dicer enzyme as it may decrease the amount of diced siRNA d siRNA that can be generated from the digestion reaction 2 1 ug of dsRNA control template will yield about 0 5 ug of d siRNA which is sufficient for one or two transfections in 24 well plates using the GeneSilencer siRNA Transfection Reagent Adjust the reaction volume accordingly if you need more d siRNAs 2 1 2 Incubate for two hours at 37 C avoid overdigesting dsRNA for longer than 2 hours 2 1 3 Stop the reaction by adding 2 ul Turbo Dicer Stop Solution 2 1 4 Check d siRNA 22 base pairs by using one of the following methods a 3 agarose Gel TAE b 15 native polyacrylamide gel 29 1 cast in 1X and electrophoresed in 0 5X TBE Run at 10 Watts and 4 C Visualize RNA by staining with ethidium bromide 2 2 Purification of siRNAs 2 2 1 Use RNA Purification Column 1 to remove salts and unincorporated nucleotides A fixed angle rotor microcentrifuge is required in this step On a variable speed microcentrifuge DO NOT use the pulse button which overrides the speed setting and takes the rotor to maximum g force 2 2 1 1 Tap the RNA Purification Column to settle the dry gel in the bottom of the spin column 2 2 1 2 Hydrate the column with 650 ul of Hydration Buffer Cap vortex tap out air bubbles and hydrate at room temperature 5 15 min
11. E by using the 2X Gel Loading Buffer dsRNA will migrate like DNA i e a 500 bp dsRNA will migrate at the same rate as a 500 bp band in a DNA ladder ssRNA will migrate much faster than a dsDNA of the equivalent size You may see faint slower migrating bands above the full length transcript on non denaturing gels These may be the result of secondary structures within the transcript and should be ignored 1 3 Recovery of dsRNA dsRNA can be directly use for the Recombinant Turbo Dicer Enzyme Kit without purification However dsRNA purified using the following procedure can give slightly better result 1 3 1 Precipitate the RNA by adding 30 ul Nuclease free Water and 30 ul LiCl Precipitation Solution to the mixture from Step 1 2 4 1 3 2 Mix thoroughly Chill for gt 30 min at 20 C 1 3 3 Centrifuge at 4 C for 15 minutes at maximum speed to pellet the RNA 1 3 4 Carefully remove the supernatant Wash the pellet once with 1 ml 70 ethanol and centrifuge again to maximize removal of unincorporated nucleotides 1 3 5 Carefully remove the 70 ethanol and resuspend the RNA in Nuclease free Water or TE Buffer Determine the RNA concentration and store at 20 C or 70 C Lithium chloride precipitation may not efficiently precipitate RNAs smaller than 300 nucleotides Also the concentration of RNA should be at least 0 1 ug ul to assure efficient precipitation To precipitate from TurboScript reactions that are thought to have very low
12. Mt PEPPE REE TET ETE TAE E E E 6 Introduction to RNA Interference eee ecceeesceeececeeseesecesecseeseeeaecaeeeeesecaaeseeeeeeseceaeeaeeereaeeas 7 How Turbo Dicer siRNA Generation Kit Works 0 ccccceecceseesseesceseeseeeeeeseceeeeeeseceaeeaeeeeeaeeas 7 Advantages of Turbo Dicer siRNA Generation Klt ooonoonccinconococonnconnconnconnnnnnonanonnn non nono ncco nono 8 METHODS AND PROCEDURES Generating Double Stranded RNA dsRNA Template oooonoconocnconnninnconnconccon nono noconoconocnnonnnos 9 Generating siRNAs Using Recombinant Turbo Dicer Enzyme cecceceeseeseeeececeeneeeeeeseeaeees 13 Transfect d siRNA with the GeneSilencer siRNA Transfection Reagent cece 15 APPENDIX Quality Control cc 1 scene s 19 Troubleshooting Guides ciennduiindi an tinn da ahah tended iaa 19 References seansu OT 21 VKM060711 Genlantis 858 457 1919 or 888 428 0558 US Toll Free OVERVIEW Kit Contents The Turbo Dicer siRNA Generation Kit contains sufficient reagents for generating small interfering RNAs siRNAs from up to 5 different genes and for 50 transfections in 24 well plates Contents Quantity Recombinant Turbo Dicer Recombinant Turbo Dicer Enzyme 1 tube Transcription Kit 5 Reactions Enzyme Kit 50 Units 100 ul 0 5 unit ul Turbo Dicer Reaction Buffer 1 tube 50 ul 50 mM MgCl Solution 1 tube 100 ul 10 mM ATP 1 tube 50 ul Turbo Dicer Stop Solution 1 tube 100 ul
13. Turbo Dicer siRNA Generation Kit Instruction Manual Catalog Number T520001 8 Genlantis Genlantis A Division of Gene Therapy Systems Inc 10190 Telesis Court San Diego CA 92121 Phone 888 428 0558 US Toll Free e 858 457 1919 Fax 858 623 9494 e 858 558 3617 E mail orders genlantis com Web Site http www genlantis com PAGE INTENTIONALLY LEFT BLANK VKM060711 Genlantis 858 457 1919 or 888 428 0558 US Toll Free Purchaser Notification Limited License The purchase price paid for the Turbo Dicer siRNA Generation Kit by end users grants them a non transferable non exclusive license to use the kit and or its separate and included components as listed in the Kit Contents section This kit is intended for internal research only by the purchaser Such use is limited to protocols described in the product manual Furthermore research only use means that this kit and all of its contents are excluded without limitation from resale repackaging or use for the making or selling of any commercial product or service without the written approval of Genlantis a division of Gene Therapy Systems Inc GTS Purchasers may terminate this License at any time by returning all Turbo Dicer siRNA Generation Kit material and documentation to GTS or by destroying all Turbo Dicer siRNA Generation Kit components Purchasers are advised to contact GTS with the notification that a Turbo Dicer siRNA Generation Kit is being r
14. actions from the RNA Purification Columns are used and or purify dsRNA before Turbo Dicer reaction Too much Recombinant Turbo Dicer Enzyme was added Use 1 unit of the enzyme for every microgram of dsRNA 10 mM ATP is old Use fresh ATP solution VKMO060711 Genlantis 858 457 1919 or 888 428 0558 US Toll Free 19 Troubleshooting Guide Continued Problem Possible Causes Recommended Solutions Low Transfection Sub optimal GeneSilencer Optimize the GeneSilencer siRNA ratio by Efficiency siRNA ratio or Suboptimal using 0 5 7 ul of GeneSilencer for each 100 siRNA concentration ng of siRNA Use a low siRNA quantity to optimize this parameter After establishing the optimal GeneSilencer siRNA ratio vary the siRNA quantity over the ranges suggested in the Methods and Procedures section Over digestion of dsRNA Make sure you digest the dsRNA with Turbo Dicer for no longer than 2 hours as recommended Denatured siRNA Use recommended buffer 100 mM NaCl 50 mM Tris pH 7 5 in RNase free water to dilute siRNA Do not use water as it can denature the siRNA Cells have been in Thaw out a fresh aliquot of cells and passage continuous passage for gt 2 once or more before transfecting Avoid months using cells that have been in culture or have been passaged for excessive periods of time Sub optimal cell density Use cells that are 50 70
15. ants insects and nematodes and cultured mammalian cell lines RNAi is characterized by targeted mRNA degradation after introduction of sequence specific double stranded RNAs dsRNAs into cells 1 2 3 Several studies indicate that RNAi is an evolutionarily conserved defense mechanism directed against invading viral genomes or aberrant transcription products 4 5 Jn vitro studies using Drosophila lysates revealed that 21 25 nucleotide small interfering RNA duplexes siRNAs are the mediators of gene silencing These siRNAs are derived from processing of the dsRNA by an RNase I like enzyme 6 7 8 The mechanism involves the recruitment of siRNAs into a multi protein complex known as RNA Induced Silencing Complex RISC which interacts with the target RNA to mediate cleavage in a catalytic fashion 6 9 10 Although cellular uptake of long trigger dsRNAs by organisms such as C elegans and Drosophila has proven to be an effective method to induce RNAi long dsRNAs tend to result in non specific gene suppression in vertebrate cells due in part to Type I interferon response 11 Subsequent studies using synthetic siRNAs less than 30 nucleotides demonstrated that siRNAs can bypass the mammalian interferon response and cause effective gene specific silencing in mammalian cells 1 12 In addition the gene silencing effect caused by siRNA can be detected even after many cell divisions These properties make siRNA a useful tool for a broad range of research
16. as for adherent cells except that the GeneSilencer siRNA ratio is higher VKMO060711 Genlantis 15 858 457 1919 or 888 428 0558 US Toll Free NOTE Gene suppression was observed with GFP d siRNA generated from the GFP Control Plasmid Co transfection of 1 ug of GFP Control Plasmid and 500 ng of d siRNA resulted in 60 suppression of GFP expression in transiently transfected NIH 3T3 cells 3 1 Transfection of Adherent Cells 3 1 1 The day before transfection plate cells so that they will be 50 70 confluent on the day of transfection 3 1 2 Prepare the GeneSilencer Reagent by diluting in serum free medium according to the recommended amount in Table 1 below Table 1 GeneSilencer Dilutions For Adherent Cells Tissue Culture GeneSilencer Reagent ul Plate or Dish Type Serum Free Medium ul per well 96 wells 1 0 25 48 wells 1 75 25 24 wells 3 5 25 3 1 3 Prepare the siRNA solution by first mixing the siRNA Diluent and serum free medium SFM according to Table 2 below Use the Diluent SFM mix to dilute the recommended amount of d siRNA in Table 2 Mix well by pipetting up and down several times Incubate at room temperature for 5 minutes IMPORTANT Avoid vortexing the siRNA Diluent mix Table 2 siRNA Dilutions For Adherent Cells Tissue Culture Recommended Amount siRNA Diluent ul Final transfection volume plate type of d siRNA to use ng Serum Free Medium ul ul per well per well 96 wells 125 2 5 15
17. atter You may follow a method suggested by Tuschl et al 13 and pick a region of about 100 150 nucleotides downstream from the start codon which would prevent the diced siRNAs d siRNAs from potentially competing with proteins involved in translation initiation 1 1 2 The size of the target template The Recombinant Turbo Dicer Enzyme performs best with double stranded RNA dsRNA between 500 1000 bp in length Turbo Dicer also works with longer dsRNAs even full length cDNAs However for silencing a single gene using a 500 bp dsRNA is sufficient We recommend that you use templates that are 500 1000 bp in length 1 The yield of dsRNA might be low if the DNA template is smaller than 300 bp or the gene is GC rich and longer than 2 kb 2 The Turbo Dicer enzyme might not digest well if the dsRNA is smaller than 300 bp 1 1 3 Adding T7 Promoters to the DNA template using PCR The DNA template must contain the T7 RNA polymerase promoter site at both ends so that it can be used as a template for in vitro transcription with the TurboScript T7 Transcription Kit T7 promoter sequence 1 TAATACGACTCACTATAGGGAGA The underlined sequence shown above is the minimum promoter sequence needed for efficient transcription The 1 base in bold is the first base incorporated into RNA during transcription The 20 base T7 promoter region includes 2 bases which will form the first 2 bases of the transcribed RNA Yields of transcription product
18. confluent on the day of transfection Optimal cell density may vary depending on cell type Improper storage GeneSilencer reagent is very stable but long exposure to elevated temperatures and or excessive freeze thaw cycles may cause degradation of the reagent Store GeneSilencer Reagent at 4 C Wrong medium Be sure to use serum free medium when forming the GeneSilencer siRNA complex Cell line is difficult to Optimize GeneSilencer siRNA ratio and transfect siRNA amount as indicated on page 15 GeneSilencer siRNA GeneSilencer siRNA complexes should be complexes not freshly freshly prepared If complexes have been prepared prepared and stored for longer than 45 minutes aggregation may occur Sub optimal GeneSilencer Too much GeneSilencer or too much siRNA siRNA ratio used could cause aggregation Adjust the ratio as outlined above Aggregation Excess GeneSilencer used Decrease the amount of GeneSilencer reagent Cytotoxicity Unhealthy cells Check cells for contamination Thaw a new batch of cells Cells too confluent or cell density too low Check culture medium pH kind used last time changed Check materials used for proper function culture plates incubators etc GeneSilencer concentration Reduce GeneSilencer concentration in 20 too high 30 increments VKM06071 1 Genlantis 858 457 1919 or 888 428 0558 US Toll Free 20 References 12 13 Caplen N J S Parrish F Imani A Fir
19. culture plates according to Table 5 below Table 5 Volume and Number of Cells to Transfer Into Culture Dishes Tissue Culture Volume of resuspended cells to Number of cells transferred to each plate or dish type transfer to each well ml well approximate 96 wells 0 1 Lx 10 48 wells 0 2 2x 10 24 wells 0 5 5x 10 3 2 7 Add the siRNA GeneSilencer mix to resuspended cells in Table 5 above Gently mix the cells by pipetting up and down several times to avoid cell clumping Incubate at 37 C for 24 hours 3 2 8 Add fresh tissue culture medium to growing cells as needed Most RNA interference can be detected within 48 hours post transfection 18 858 457 1919 or 888 428 0558 US Toll Free APPENDIX Quality Control All components in the TurboScript T7 Transcription Kit are functionally tested by using PCR product amplified from the GFP Control Plasmid Each 20 ul reaction yields at least 50 80 ug of dsRNA after a 4 hour incubation All components in the Recombinant Turbo Dicer Enzyme Kit are tested using a 10ul reaction containing ug of dsRNA generated from the GFP Control Plasmid At least 0 5 ug of d siRNA must be produced after 2 hours of incubation The GeneSilencer siRNA Transfection Kit is functionally qualified by transfecting fluorescent labeled siRNA in cultured cells Troubleshooting Guide products for the full length gene of interest Problem Possible Causes Recommended Solutions I have difficu
20. e and R A Morgan 2001 Specific inhibition of gene expression by small double stranded RNAs in invertebrate and vertebrate systems Proc Natl Acad Sci U S A 98 9742 9747 Grishok A A E Pasquinelli D Conte N Li S Parrish I Ha D L Baillie A Fire G Ruvkun and C C Mello 2001 Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C elegans developmental timing Cell 106 23 34 Parrish S J Fleenor S Xu C Mello and A Fire 2000 Functional anatomy of a dsRNA trigger differential requirement for the two trigger strands in RNA interference Mol Cell 6 1077 1087 Hamilton A J and D C Baulcombe 1999 A species of small antisense RNA in posttranscriptional gene silencing in plants Science 286 950 952 Sijen T J Fleenor F Simmer K L Thijssen S Parrish L Timmons R H Plasterk and A Fire 2001 On the role of RNA amplification in dsRNA triggered gene silencing Cell 107 465 476 Bernstein E A A Caudy S M Hammond and G J Hannon 2001 Role for a bidentate ribonuclease in the initiation step of RNA interference Nature 409 363 366 Hutvagner G J McLachlan A E Pasquinelli E Balint T Tuschl and P D Zamore 2001 A cellular function for the RNA interference enzyme Turbo Dicer in the maturation of the let 7 small temporal RNA Science 293 834 838 Knight S W and B L Bass 2001 A role for the RNase III enzyme DCR 1 in RNA interference and germ
21. eturned in order to obtain a refund and or to expressly terminate a research only license granted through the purchase of the kit This document covers in full the terms of the Turbo Dicer siRNA Generation Kit research only license and does not grant any other express or implied license The laws of the State of California shall govern the interpretation and enforcement of the terms of this License Product Use Limitations The Turbo Dicer siRNA Generation Kit and all of its components are developed designed intended and sold for research use only They are not to be used for human diagnostic or included used in any drug intended for human use All care and attention should be exercised in the handling of the kit components by following appropriate research lab practices For more information or for any comments on the terms and conditions of this License please contact Director of Licensing Genlantis a division of Gene Therapy Systems Inc 10190 Telesis Court San Diego CA 92121 Telephone 858 457 1919 Fax 858 623 9494 Email licensing genlantis com Limited Label License for the Recombinant Turbo Dicer Enzyme This product is covered by several patent applications owned by the Stanford University The purchase of this product conveys to the buyer the limited non exclusive non transferable right without the right to resell repackage or further sublicense under these patent rights to perform the siRNA production methods cla
22. icer Enzyme Kit T520002 50 Units TurboScript T7 Transcription Kit T510003 20 Reactions RNA Purification Column 1 T510004 20 Columns RNA Purification Column 2 T510005 20 Columns For efficient and functional siRNA transfection Product Name Cat No Quantity GeneSilencer siRNA Transfection Reagent 0 75 ml T500750 200 reactions GeneSilencer siRNA Transfection Reagent 5 x 0 75 ml T505750 5 x 200 reactions For efficient transfection of DNA into diverse cell lines Product Name Cat No Quantity GenePORTER 2 Transfection Reagent T202007 75 reactions 0 75 ml GenePORTER 2 Transfection Reagent 1202015 150 reactions 1 5 ml GenePORTER 2 Transfection Reagent 1202075 750 reactions 5 x 1 5 ml For 3 minute transformation into E coli Product Name Cat No Quantity TurboCells Chemically Competent E coli C300020 20 x 50 ul TurboCells F Chemically Competent E coli C301020 20 x 50 ul Product Support Telephone 858 457 1919 OR 888 428 0558 US toll free Fax 858 623 9494 E mail tech genlantis com Web http www genlantis com For a complete list of international distributors visit our web site at www genlantis com VKM060711 Genlantis 858 457 1919 or 888 428 0558 US Toll Free Introduction to RNA Interference RNA interference RNAi has become an important tool for studying gene functions because it allows sequence specific gene suppression in a variety of organisms e g pl
23. imed in those patent applications for research purposes solely in conjunction with this product No other license is granted to the buyer whether expressly by implication by estoppel or otherwise In particular the purchase of this product does not include nor carry any right or license to use develop or otherwise exploit this product commercially and no rights are conveyed to the buyer to use the product or components of the product for any other purposes including without limitation provision of services to a third party generation of commercial databases or clinical diagnostics or therapeutics In addition any user that purchases more than 5 000 in any calendar quarter may be outside the above research license and will contact Stanford University for a license This product is sold pursuant to a license from Stanford University and Stanford University reserves all other rights under these patent rights For information on a license to the patent rights for uses other than in conjunction with this product or to use this product for purposes other than research please contact Stanford University at 650 723 0651 This is Stanford University reference S02 028 VKM060711 Genlantis 3 858 457 1919 or 888 428 0558 US Toll Free TABLE OF CONTENTS Page OVERVIEW Purchaser Notifica iii AA eles A ese te ains 3 KIECOMEN SA A A east Mol tet ie bsvcast hase td 5 Shipping and SOTA AS 5 Accessory Products AAA sudo AAA AA AAA E 6 PrOdUCE SUPPO
24. ld dilutions of an RNA solution of known concentration Start at about 80 ng ul and go down to about 1 25 ng ul Make a few dilutions of the unknown RNA and add ethidium bromide to 1 ng ul to each dilution of both RNAs Spot 2 ul of the control RNA samples and the unknown RNA dilutions onto plastic wrap placed on a UV transilluminator Compare the fluorescence of the RNAs to estimate the concentration of the sample RNA Make sure that the sample dilutions are in the linear range of ethidium bromide fluorescence This assay will detect as little as 5 ng of RNA with an error of about 2 fold 1 4 3 2 Denaturing gel electrophoresis If unincorporated nucleotides have not been removed from the reaction an aliquot of the TurboScript reaction should be run on a denaturing agarose or acrylamide gel alongside an aliquot of RNA of known concentration Stain the samples with ethidium bromide and simply compare the intensity of the unknown sample to that of the known RNA sample to estimate its concentration 2 Generating siRNAs Using Recombinant Turbo Dicer Enzyme 2 1 Turbo Dicer Reaction 2 1 1 Keep the Turbo Dicer Reaction Buffer at room temperature while assembling the reaction The following amounts are for a single 10 pl reaction 3 wl x Nuclease free water xul dsRNA 1 pg lul 10mM ATP lul SXBSA 2ul 50mM MgCl 1 ul 10X Dicer Reaction Buffer 2 ul Recombinant Turbo Dicer Enzyme 0 5 unit ul VKM060711 Genlantis 13 858 457 1919 or
25. lty Sub optimal primer design Re design primers by changing the gene obtaining PCR specific portions of the primers and optimize the PCR conditions The gene is too long Amplify portions of the gene in 500 to 700 bp fragments and proceed to transcribe dsRNAs from these fragments Neither my template nor the control reaction works in generating dsRNA Expired or defective kit component Double check that you have followed the procedure accurately and consider trying the control reaction a second time If the kit control still doesn t work it is an indication that something else may be wrong with the kit Call GTS Technical Support for further troubleshooting The control reaction works with the TurboScript T7 Transcription Kit but my template gives low dsRNA yield Wrong amount of DNA template or poor DNA quality Check the amount and quality of template Also check an aliquot of the template DNA on an agarose gel to make sure it is intact and that it is the expected size PCR products were of poor quality Use a different DNA polymerase if possible and or extend reaction time DNA template has high G C content Optimize transcription reaction condition by doubling the amount of GTP and CTP performing the reaction at 15 C and adding 0 5 1 DMSO d siRNA yield is low No dsRNA or poor dsRNA quality Check the amount of dsRNA added Make sure that the correct fr
26. nlantis 10 858 457 1919 or 888 428 0558 US Toll Free IMPORTANT IMPORTANT IMPORTANT TIP 1 1 4 Purification of PCR Product It is important to proceed with a clean PCR product to ensure high yield of ds RNA PCR products can be purified the following method 1 1 4 1 Add 1 10 volume of 3 M sodium acetate pH 5 3 1 1 4 2 Add 2 volumes of ethanol 1 1 4 3 Mix well and chill at 20 C for 30 min 1 1 4 4 Pellet the DNA for 15 30 min in a microcentrifuge at top speed 1 1 4 5 Remove the supernatant carefully Resuspend the DNA pellet with 100 ul cold 70 ethanol 1 1 4 6 Spin at top speed for 15 min 1 1 4 7 Remove the supernatant carefully and air dry the DNA pellet 1 1 4 8 Resuspend the DNA in 20 pl of Nuclease free Water and quantitate by spectro photometery Store at 20 C until later use If you use other commercially available kits to purify PCR products please make sure that agarose is removed completely before proceeding to the next step 1 2 Generation of dsRNA 1 2 1 Transcription Reaction Assembly 1 2 1 1 Thaw the frozen reagents Place the T7 Enzyme Mix on ice it is formulated in glycerol and does not freeze at 20 C Vortex the T7 Reaction Buffer and the NTP Mix until they are completely in solution Once thawed store the NTP Mix on ice Keep T7 Reaction Buffer at room temperature while assembling the reaction All reagents should be microfuged briefly before opening to prevent loss and contamination of
27. unterbalance with a similar device Spin at 500 x g for 15 minutes IMPORTANT Do not centrifuge more than 15 minutes 2 2 2 6 Remove assembly from centrifuge Separate collection vial from sample reservoir Purified d siRNA is in the collection vial undigested large dsRNAs remain in the sample reservoir 2 2 2 7 Store the d siRNA at 20 C 2 2 3 Qualification of Purification Products For RNA molecules 1 A260 unit corresponds to 40 ug ml so the siRNA yield can be calculated as follows A260 X dilution factor X 40 pg ml RNA NOTE Typically each microgram of dsRNA will yield about 0 5 ug of d siRNA 3 Transfect d siRNA with the GeneSilencer siRNA Transfection Reagent IMPORTANT Transfection Optimization Guidelines a Adherent Cells Although GeneSilencer consistently delivers high transfection efficiencies in a wide range of cell types to obtain maximum efficiency in particular cell lines some optimization may be needed The two critical variables are the GeneSilencer siRNA ratio and the siRNA quantity To optimize these two variables al Determine the best GeneSilencer siRNA ratio by using 0 5 7 ul of reagent for each 100 ng of siRNA Use a low siRNA quantity to optimize this parameter a2 Once the optimal ratio has been established vary the siRNA quantity over the suggested range At this point cell number can also be optimized b Suspension Cells For suspension cells the optimization procedure is the same
28. yields of RNA do not dilute the transcription reaction with water prior to adding the LiCl Precipitation Solution 1 4 Quantitation of dsRNAs 1 4 1 Quantitation by UV light absorbance Reading the Axo of a diluted aliquot of the reaction is clearly the simplest way to determine yield but any unincorporated nucleotides and or template DNA in the mixture will contribute to the reading Typically a 1 500 dilution of an aliquot of a TurboScript reaction will give an absorbance reading in the linear range of a spectrophotometer For RNA molecules 1 A260 unit corresponds to 40 ug ml so the RNA yield can be calculated as follows A260 X dilution factor X 40 pg ml RNA VKM060711 Genlantis 12 858 457 1919 or 888 428 0558 US Toll Free 1 4 2 Assessing dsRNA yield with RiboGreen 1 4 3 If you have a fluorometer or a fluorescence microplate reader Molecular Probes RiboGreen fluorescence based assay for RNA quantitation is a convenient and sensitive way to measure RNA concentration Follow the manufacturer s instructions for using RiboGreen Quantitation by ethidium bromide fluorescence The intensity of ethidium bromide staining of dsRNA in an agarose gel can be used to get a rough estimation of the RNA yield 1 4 3 1 Ethidium bromide spot assay If unincorporated nucleotides have been removed an ethidium bromide spot assay can be used to quantitate RNA concentration Make a standard curve with several 2 fo
Download Pdf Manuals
Related Search