Home

The BLOCK-iT - Thermo Fisher Scientific

1. Permits high copy replication and maintenance in E coli 50 Map and Features of pLP VSVG pLP VSVG Map The figure below shows the features of the pLP VSVG vector The sequence of pLP VSVG is available at www invitrogen com or by contacting Technical Support see page 55 Comments for pLP VSVG 51 5821 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 VSV G glycoprotein VSV G bases 1346 2881 Human B globin polyadenylation signal bases 3004 3769 pUC origin bases 3927 4600 C Ampicillin bla resistance gene bases 4745 5605 C bla promoter bases 5606 5704 C C complementary strand Continued on next page Map and Features of pLP VSVG Features of pLP VSVG pLP VSVG 5 821 bp contains the following elements All features have been functionally tested Feature Benefit Human CMV promoter Permits high level expression of the VSV G gene in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the VSV G gene in mammalian cells VSV G glycoprotein VSV G Encodes the envelope G glycoprotein from Vesicular Stomatitis Virus to allow production of a pseudotyped retrovirus with a broad host range Burns et al 1993 Emi et al 1991 Yee et al 1994 Human f globin polyadenylation signal Allows efficient transcription termination an
2. Before selecting for stably transduced cells first determine the minimum concentration of Blasticidin required to kill your untransduced mammalian cell line i e perform a kill curve experiment For guidelines to perform a kill curve experiment see page 27 If you titered your lentiviral construct in the same mammalian cell line that you are using to generate a stable cell line then you may use the same concentration of Blasticidin for selection that you used for titering To obtain optimal expression of your shRNA of interest and therefore the highest degree of target gene knockdown you will need to transduce the lentiviral construct into your mammalian cell line of choice using a suitable MOI MOI is defined as the number of virus particles per cell and generally correlates with the number of integration events and as a result expression Typically shRNA expression levels increase as the MOI increases Continued on next page Transduction and Analysis Continued Determining the Optimal MOI Note Positive Control Important Concentrating Virus A number of factors can influence the optimal MOI including the nature of your mammalian cell line e 2 non dividing vs dividing cell type see Note below its transduction efficiency and the nature of your target gene of interest If you are transducing your lentiviral construct into the mammalian cell line of choice for the first time we recommend using a range
3. Ampicillin bla resistance gene Allows selection of the plasmid in E coli 48 Map and Features of pLP2 pLP2 Map 49 The figure below shows the features of the pLP2 vector The sequence of pLP2 is available at www invitrogen com or by contacting Technical Support see page 55 Comments for pLP2 4180 nucleotides RSV enhancer promoter bases 1 271 TATA box bases 200 207 Transcription initiation site base 229 RSV UTR bases 230 271 HIV 1 Rev ORF bases 391 741 HIV 1 LTR polyadenylation signal bases 850 971 bla promoter bases 1916 2014 Ampicillin b a resistance gene bases 2015 2875 pUC origin bases 3020 3693 Continued on next page Map and Features of pLP2 Continued Features of pLP2 4 180 bp contains the following elements All features have been pLP2 functionally tested Feature Benefit RSV enhancer promoter Permits high level expression of the rev gene Gorman et al 1982 HIV 1 Rev ORF Encodes the Rev protein that interacts with the RRE on pLP1 and on the pLenti6 BLOCK iT DEST expression vector to induce Gag and Pol expression which promotes the nuclear export of the unspliced viral RNA for packaging into viral particles HIV 1 LTR polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA Ampicillin bla resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori
4. Continued on next page System Summary Continued The BLOCK iT RNAi Technology The ViraPower Lentiviral Technology The Gateway Technology A variety of BLOCK iT RNAi products are available to facilitate RNAi analysis in mammalian and invertebrate systems The BLOCK iT U6 RNAi Entry Vector Kit supplied with the BLOCK iT Lentiviral RNAi Expression System uses a vector based approach to allow efficient generation of U6 RNAi cassettes for expression of shRNA molecules in mammalian cells Other BLOCK iT RNAi products are available to facilitate production and delivery of synthetic Stealth RNAi short interfering RNA siRNA diced siRNA d siRNA or double stranded RNA dsRNA for RNAi analysis in mammalian TM cells or invertebrate organisms For more information about any of the BLOCK iT RNAi products see the RNAi Central application portal at www invitrogen com rnai or contact Technical Support see page 55 The ViraPower Lentiviral Technology facilitates highly efficient in vitro or in vivo delivery of a target gene or RNA to dividing and non dividing mammalian cells using a replication incompetent lentivirus Based on the lentikat system developed by Cell Genesys Dull et al 1998 the ViraPower Lentiviral Technology possesses features which enhance its biosafety while allowing high level expression in a wider range of cell types than traditional retroviral systems The key components of the ViraPower
5. Introduction Important Using pENTR U6 13 To express your shRNA of interest from pLenti6 BLOCK iT DEST first generate an entry clone in the pENTR U6 vector using the BLOCK iT U6 RNAi Entry Vector Kit General guidelines are provided below Note that you must use the pENTR U6 entry vector to generate entry clones containing your shRNA sequence Although a large selection of Gateway entry vectors exists to facilitate generation of entry clones only the pENTR U6 entry vector contains the elements required to facilitate proper expression of shRNA molecules in mammalian cells These elements include e The human U6 promoter an RNA Polymerase III dependent promoter that facilitates high level constitutive expression of the shRNA of interest in mammalian cells Kunkel et al 1986 Kunkel amp Pederson 1988 e A Polymerase III Pol III terminator for efficient transcription termination of the shRNA molecule The BLOCK iT U6 RNAi Entry Vector Kit is supplied with the BLOCK iT Lentiviral RNAi Expression System but is also available separately see page 54 for ordering information TM To generate an entry clone in pENTR U6 you will e Design and synthesize two complementary oligonucleotides encoding your shRNA target sequence according to specified guidelines e Anneal the oligonucleotides to create a double stranded oligonucleotide TM e Clone the double stranded oligonucleotide into pENTR U
6. Add 250 uL of pre warmed S O C Medium to each vial Cap the vial s tightly and shake horizontally at 37 C for 1 hour at 225 rpm ina shaking incubator Spread 25 100 uL of the transformation mix on a pre warmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies For the pUC19 control dilute the transformation mix 1 10 into LB Medium e g add 100 uL of the transformation mix to 900 uL of LB Medium and plate 25 100 uL Store the remaining transformation mix at 4 C Plate out additional cells the next day if desired Continued on next page 18 Transforming One Shot StbI3 Competent E coli Continued Expected Results Confirming the Expression Clone Sequencing Maintaining the Expression Clone 19 When using One Shot Stbl3 Chemically Competent cells for transformation the LR recombination reaction should result in greater than 5 000 colonies if the entire LR reaction is transformed and plated The ccdB gene mutates at a very low frequency resulting in a very low number of false positives True expression clones will be chloramphenicol sensitive and ampicillin and Blasticidin resistant Transformants containing a plasmid with a mutated ccdB gene will be chloramphenicol ampicillin and Blasticidin resistant To check your putative expression clone test for growth on LB plates containing 30 ug mL c
7. II Enzyme Mix Box 2 Store Box 2 at 20 C for up to 6 months For long term storage store at 80 C Reagent Composition Amount Gateway LR Clonase II Proprietary 40 pL Enzyme Mix Proteinase K Solution 2 pg mL in 40 uL 10 mM Tris HCI pH 7 5 20 mM CaCl 50 glycerol pENTR gus Positive Control 50 ng L in TE buffer pH 8 0 150 pL Note The pENTR gus control included with the Gateway LR Clonase II Enzyme Mix may be used as a positive control for the LR recombination reaction only see page 17 Do not use the resulting expression clone to produce lentivirus for expression purposes as the pLenti6 BLOCK T DEST vector does not contain a eukaryotic promoter and the gus gene will not be expressed in mammalian cells The following reagents are included with the One Shot Stbl3 Chemically Competent E coli kit Box 3 Transformation efficiency is 2 1 x 10 cfu ug plasmid DNA Store Box 3 at 80 C Amount 50 uL Composition 10 pg pL in 5 mM Tris HCl 0 5 mM EDTA pH 8 2 Tryptone 0 5 Yeast Extract 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose Stbl3 Cells Reagent pUC19 Control DNA S O C Medium 6mL 21x 50 pL F mcrB mrr hsdS20 rs ms recA13 supE44 ara 14 galK2 lacY1 proA2 rpsL20 Str xyl 5 X leu mtl 1 Continued on next page Kit Contents and Storage Continued ViraPower Bsd Lentiviral Support Kit Contents
8. 1999 e RNAi pathway and expression of shRNA in mammalian cells see Brummelkamp et al 2002 McManus and Sharp 2002 Paddison et al 2002 Paul et al 2002 Sui et al 2002 and Yu et al 2002 For more information about any of the BLOCK iT RNAi products and other reference materials relating to RNAi refer to the RNAi Central application portal at www invitrogen com rnai The BLOCK iT Lentiviral RNAi Expression System Components of the System The BLOCK iT Lentiviral RNAi Expression System facilitates highly efficient in vitro or in vivo delivery of an shRNA of interest to dividing and non dividing mammalian cells using a replication incompetent lentivirus and includes the following major components e The BLOCK iT U6 RNAi Entry Vector Kit containing the pENTR U6 vector for production of an entry clone that contains elements required for expression of a double stranded oligonucleotide encoding an shRNA of interest in mammalian cells The entry vector containing this U6 RNAi cassette i e human U6 promoter double stranded oligonucleotide Polymerase III terminator may be transfected into mammalian cells for transient RNAi analysis or used to transfer the U6 RNAi cassette into the pLenti6 BLOCK iT DEST expression plasmid see below using Gateway Technology For more information about the U6 RNAi cassette see page 9 For detailed information about the pENTR U6 vector and instructions to generate an
9. Competent E coli supplied with the kit for transformation Stbl3 E coli are recommended for cloning unstable DNA including lentiviral DNA containing direct repeats and generally do not give rise to unwanted recombinants 37 Continued on next page Troubleshooting Continued LR Reaction and Transformation Continued Problem Reason Solution Few or no colonies obtained from the transformation control Competent cells stored e Store the One Shot Stbl3 Chemically incorrectly Competent E coli at 80 C e Thaw a vial of One Shot cells on ice immediately before use After addition of DNA After adding DNA mix competent cells competent cells mixed by gently Do not mix by pipetting up and pipetting up and down down Generating the Lentiviral Stock The table below lists some potential problems and possible solutions that may help you troubleshoot your co transfection and titering experiments Problem Reason Solution Low viral titer Low transfection efficiency Used poor quality expression construct plasmid DNA i e DNA from a mini prep Unhealthy 293FT cells cells exhibit low viability Cells transfected in media containing antibiotics i e Geneticin Plasmid DNA transfection reagent ratio incorrect 293FT cells plated too sparsely e Do not use plasmid DNA from a mini prep for transfection Use the PureLink HiPure Plasmid DNA Purific
10. Lentiviral Expression System include e ApLenti based expression vector e g pLenti BLOCK iT DEST for cloning a DNA sequence of interest This vector contains elements required to allow packaging of the expression construct into virions and an antibiotic resistance marker to allow selection of stably transduced cell lines For more information see page 6 e The ViraPower Packaging Mix an optimized mixture of the three packaging plasmids required for production of the lentivirus e An optimized 293FT producer cell line to facilitate optimal production of virus For more information about the biosafety features of the System see page 10 Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move a DNA sequence of interest into multiple vector systems To express an shRNA of interest in mammalian cells using the BLOCK iT Lentiviral RNAi Expression System and Gateway Technology simply 1 Clone a double stranded oligonucleotide encoding an shRNA of interest into the pENTR U6 entry vector to create an entry clone Transfect this entry clone directly into mammalian cells for initial screening if desired 2 Generate an expression clone by performing an LR recombination reaction between the pENTR U6 entry clone and the pLenti6 BLOCK iT DEST vector 3 Use your expression clone
11. Troubleshooting Continued Transduction and RNAi Analysis The table below lists some potential problems and possible solutions that may help you troubleshoot your transduction and knockdown experiment Problem Reason Solution Low levels of gene knockdown observed Low transduction efficiency e Polybrene not included during transduction e Non dividing cell type used e Transduce the lentiviral construct into cells in the presence of Polybrene e Transduce your lentiviral construct into cells using a higher MOI MOI too low Transduce your lentiviral construct into cells using a higher MOI Cells harvested and assayed too soon after transduction Do not harvest cells until at least 48 72 hours after transduction to allow expressed shRNA to accumulate in transduced cells If low levels of knockdown are observed at 48 hours culture cells for a longer period of time before assaying for gene knockdown or place cells under Blasticidin selection Note Placing cells under Blasticidin selection can improve gene knockdown results by killing untransduced cells Target gene is important for cell viability Make sure that your target gene is not essential for cell viability or growth Viral stocks not titered Titer the lentiviral stock using the procedure on page 29 before use Viral stock stored incorrectly e Aliquot and store stocks at 80 C e Do not freeze thaw more than
12. Centre Oxford Science Park Oxford OX4 4GA UK enquiries oxfordbiomedica co uk or BioMedica Inc 11622 EI Camino Real 100 San Diego CA 92130 2049 USA LentiVector is a registered US and European Community trade mark of Oxford BioMedica plc Continued on next page 58 Purchaser Notification Continued Limited Use Label License No 358 Research Use Only 59 The purchase of this product conveys to the purchaser the limited non transferable right to use the purchased amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial services of any kind including without limitation reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrog
13. RNAi analysis Guidelines are provided below Reminder Remember that your lentiviral construct contains a deletion in the 3 LTR that leads to self inactivation of the lentivirus after transduction into mammalian cells Once integrated into the genome the lentivirus can no longer produce packageable virus A number of factors can influence the degree to which expression of your gene of interest is reduced i e gene knockdown in an RNAi experiment including e Transduction efficiency e MOI used to transduce cells e Transcription rate of the target gene of interest e Stability of the target protein e Growth characteristics of your mammalian cell line e Activity of your shRNA in transient transfections Take these factors into account when designing your transduction and RNAi experiments After transducing your lentiviral construct into the mammalian cell line of your choice you may assay for target gene knockdown in the following ways e Poola heterogeneous population of cells and test for gene knockdown directly after transduction i e transient RNAi analysis Note that you must wait for a minimum of 48 72 hours after transduction before harvesting your cells to allow expressed shRNA molecules to accumulate in transduced cells e Select for stably transduced cells using Blasticidin This requires a minimum of 10 12 days after transduction but allows generation of clonal cell lines that stably express the shRNA of interest
14. The following reagents are included with the ViraPower Bsd Lentiviral Support Kit Boxes 4 and 5 Store the ViraPower Packaging Mix and Blasticidin at 20 C Store Lipofectamine 2000 Reagent at 4 C Important Do not freeze Lipofectamine 2000 Reagent Reagent Composition Amount ViraPower Packaging Mix Contains a mixture of the pLP1 pLP2 and pLP VSVG 195 ug plasmids 1 ug uL in TE pH 8 0 Lipofectamine 2000 Proprietary 0 75 mL Blasticidin Powder 50 mg 293FT Cell Line BLOCK iT U6 RNAi Entry Vector Kit TE buffer pH 8 0 10 mM Tris HCl 1 mM EDTA pH 8 0 P P The BLOCK iT Lentiviral RNAi Expression System includes the 293FT Cell Line Box 5 for producing lentiviral stocks The 293FT Cell Line is supplied as one vial containing 3 x 10 frozen cells in 1 mL of Freezing Medium Upon receipt store in liquid nitrogen For instructions to thaw culture and maintain the 293FT Cell Line see the 293FT Cell Line manual The BLOCK iT Lentiviral RNAi Expression System includes the BLOCK iT U6 RNAi Entry Vector Kit to facilitate production of a Gateway entry construct containing a U6 RNAi cassette for expression of your short hairpin RNA shRNA of interest The BLOCK iT U6 RNAi Entry Vector Kit contains e U6 RNAi Entry Vector Reagents Box 6 e OneShot TOP10 Chemically Competent E coli Box 7 Refer to the BLOCK iT U6 RNAi Entry Vector Kit manual for a detailed description o
15. and Hannon G J 2000 An RNA Directed Nuclease Mediates Genetic Interference in Caenorhabditis elegans Nature 404 293 296 Hannon G J 2002 RNA Interference Nature 418 244 251 Harborth J Elbashir S M Bechert K Tuschl T and Weber K 2001 Identification of Essential Genes in Cultured Mammalian Cells Using Small Interfering RNAs J Cell Science 114 4557 4565 Hutvagner G McLachlan J Pasquinelli A E Balint E Tuschl T and Zamore P D 2001 A Cellular Function for the RNA Interference Enzyme Dicer in the Maturation of the let 7 Small Temporal RNA Science 293 811 813 Izumi M Miyazawa H Kamakura T Yamaguchi I Endo T and Hanaoka F 1991 Blasticidin S Resistance Gene bsr A Novel Selectable Marker for Mammalian Cells Exp Cell Res 197 229 233 Jones A L Thomas C L and Maule A J 1998 De novo Methylation and Co Suppression Induced by a Cytoplasmically Replicating Plant RNA Virus EMBO J 17 6385 6393 Kertbundit S Greve H d Deboeck F Montagu M V and Hernalsteens J P 1991 In vivo Random b glucuronidase Gene Fusions in Arabidopsis thaliana Proc Natl Acad Sci USA 88 5212 5216 Ketting R F Fischer S E Bernstein E Sijen T Hannon G J and Plasterk R H 2001 Dicer Functions in RNA Interference and in Synthesis of 5mall RNA Involved in Developmental Timing in C elegans Genes Dev 15 2654 2659 Kimura M Takatsuki A and Yamaguch
16. generally alleviated after transduction when the media is replaced with fresh complete media It is possible to concentrate VSV G pseudotyped lentiviruses using a variety of methods without significantly affecting their transducibility If the titer of your lentiviral stock is relatively low less than 5 x 10 TU mL and your experiment requires that you use a large volume of viral supernatant e g a relatively high MOI you may wish to concentrate your virus before proceeding to transduction For details and guidelines to concentrate your virus refer to published reference sources Yee 1999 Continued on next page 32 Transduction and Analysis Continued Materials Needed e Your titered lentiviral stock store at 80 C until use Mammalian cell line of choice Complete culture medium for your cell line 6 mg mL Polybrene if desired Appropriately sized tissue culture plates for your application TM Components supplied with the BLOCK iT Lentiviral RNAi Expression System 10 mg mL Blasticidin stock used if selecting for stably transduced cells Transduction Follow the procedure below to transduce the mammalian cell line of choice with Procedure your lentiviral construct 1 Plate cells in complete media as appropriate for your application When determining the density at which to plate cells remember to take into account the length of time cells will be cultured prior to performing RNAi analysis e g 48
17. hours vs 120 hours On the day of transduction Day 1 thaw your lentiviral stock and dilute if necessary the appropriate amount of virus at a suitable MOI into fresh complete medium Keep the total volume of medium containing virus as low as possible to maximize transduction efficiency DO NOT vortex Remove the culture medium from the cells Mix the medium containing virus gently by pipetting and add to the cells Add Polybrene if desired to a final concentration of 6 ug mL Swirl the plate gently to mix Incubate at 37 C overnight Note If you are transducing cells with undiluted viral stock and are concerned about possible toxicity or growth effects caused by overnight incubation it is possible to incubate cells for as little as 6 hours prior to changing medium The following day Day 2 remove the medium containing virus and replace with fresh complete culture medium The following day Day 3 perform one of the following e Harvest the cells and assay for inhibition of your target gene if you are performing transient expression experiments If you wish to assay the cells at a later time you may continue to culture the cells or replate them into larger sized tissue culture formats as necessary e Remove the medium and replace with fresh complete medium containing the appropriate amount of Blasticidin to select for stably transduced cells Proceed to Step 7 Replace medium with fresh medium containing Blasticidin ev
18. of pLenti6 BLOCK iT DEST Map of The map below shows the elements of pLenti BLOCK T DEST DNA from the entry pLenti6 BLOCK clone replaces the region between bases 1 875 and 4 111 The sequence for iT DEST pLenti6 BLOCK iT DEST is available at www invitrogen com or by contacting Technical Support see page 55 attR1 ccdB Cm attR2 pLenti6 BLOCK iT DEST Comments for pLenti6 BLOCK iT DEST 8676 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 attR1 site bases 1868 1992 ccdB gene bases 2421 2726 C Chloramphenicol resistance gene Cm bases 3068 3727 C attR2 site bases 4008 4132 SV40 early promoter and origin bases 4281 4590 EM7 promoter bases 4645 4711 Blasticidin resistance gene bases 4712 5110 AU3 3 LTR bases 5196 5430 AUS bases 5196 5249 3 LTR bases 5250 5430 SV40 polyadenylation signal bases 5502 5636 bla promoter bases 6492 6590 Ampicillin b a resistance gene bases 6591 7451 pUC origin bases 7596 8269 C complementary strand Continued on next page 44 Map and Features of pLenti6 BLOCK iT DEST continued Features of the The pLenti6 BLOCK iT DEST 8 676 bp vector contains the following elements Vector All featur
19. to this product for purposes other than research contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 email outlicensing invitrogen com This product is the subject of one or more of U S Patent Numbers 5 910 438 6 180 407 and 7 176 029 and corresponding foreign patents and is sold under license from the Universit Libre de Bruxelles for research purposes only ccdB selection technology is described in Bernard et al Positive Selection Vectors Using the F Plasmid ccdB Killer Gene Gene 148 1994 71 74 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity For licensing information for use in other than research please contact Out Licensing Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail TM The Lentiviral Technology based upon the lentikat system is licensed from Cell Genesys Inc under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 and 6 218 187 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for non human r
20. with the BLOCK iT Dicer RNAi Kits to produce diced siRNA d siRNA using the Dicer Enzyme Ordering information for these products is provided below For more information go to www invitrogen com or call Technical Support see page 55 Product Amount Cat no BLOCK iT RNAi TOPO Transcription Kit 10 reactions K3500 01 BLOCK iT Dicer RNAi Transfection Kit 150 transfections K3600 01 BLOCK iT Complete Dicer RNAi Kit 150 transfections K3650 01 54 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail
21. 02 Paul et al 2002 Sui et al 2002 Yu et al 2002 Continued on next page Using shRNA for RNAi Analysis Continued Structural Features of shRNA Hallmarks of RNA Polymerase IIl Based Expression Using a Vector Based System to Express shRNA Exogenous short hairpin RNA can be transcribed by RNA Polymerase III Paule amp White 2000 and generally contain the following structural features e A short nucleotide sequence ranging from 19 29 nucleotides derived from the target gene followed by e A short spacer of 4 15 nucleotides i e loop and e A 19 29 nucleotide sequence that is the reverse complement of the initial target sequence The resulting RNA molecule forms an intramolecular stem loop structure that is then processed into an siRNA duplex by the Dicer enzyme RNA Polymerase III transcribes a limited number of genes including 5S rRNA tRNA 7SL RNA U6 snRNA and a number of other small stable RNAs that are involved in RNA processing Paule amp White 2000 Some of the hallmarks of RNA Polymerase III based transcription are that e Transcription initiates and terminates at fairly precise points e There is little addition of unwanted 5 and 3 sequences to the RNA molecule For more information about RNA Polymerase III transcription refer to published reviews or reference sources Paule amp White 2000 White 1998 A limitation of siRNA diced siRNA or synthetic siRNA for RNAi ana
22. 3 times e Ifstored for longer than 6 months re titer stock before use shRNA with weak activity chosen Select a different target region If possible screen shRNA first by transient transfection of the pENTR U6 construct to verify its activity then perform LR recombination with the pLenti6 BLOCK iT DEST vector and proceed to generate lentivirus Note Generally transient transfection greatly overexpresses shRNA so moderately active pENTR U6 entry clones may be less active when expressed from a lentiviral construct Continued on next page 40 Troubleshooting Continued Transduction and RNAi Analysis Continued Problem Reason Solution No gene knockdown shRNA with no activity chosen Select a different target region If possible observed screen shRNA first by transient transfection of the pENTR U6 construct to verify its activity then perform LR recombination with the pLenti6 BLOCK iT DEST vector and proceed to generate lentivirus Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not freeze thaw more than 3 times MOI too low Transduce your lentiviral construct into cells using a higher MOI Cytotoxic effects Target gene is essential for cell Make sure that your target gene is not observed after viability essential for cell viability or growth transduction Large volume of viral supernatant used for transduction e Remove the spent media con
23. 355 5661 gag coding sequence bases 1355 2857 gag pol frameshift base 2650 pol coding sequence bases 2650 5661 HIV 1 Rev response element RRE bases 5686 5919 Human f globin polyadenylation signal bases 6072 6837 pUC origin bases 6995 7668 C Ampicillin b a resistance gene bases 7813 8673 C bla promoter bases 8674 8772 C C complementary strand Continued on next page Map and Features of pLP1 Continued Features of pLP1 functionally tested pLP1 8 889 bp contains the following elements All features have been Feature Benefit Human cytomegalovirus CMV promoter Permits high level expression of the HIV 1 gag and pol genes in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Human f globin intron Enhances expression of the gag and pol genes in mammalian cells HIV 1 gag coding sequence Encodes the viral core proteins required for forming the structure of the lentivirus Luciw 1996 HIV 1 pol coding sequence Encodes the viral replication enzymes required for replication and integration of the lentivirus Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent expression of the gag and pol genes Human f globin polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli
24. 520 Takeuchi S Hirayama K Ueda K Sakai H and Yonehara H 1958 Blasticidin S A New Antibiotic The Journal of Antibiotics Series A 11 1 5 van der Krol A R Mur L A Beld M Mol J N and Stuitje A R 1990 Flavonoid Genes in Petunia Addition of a Limited Number of Gene Copies May Lead to a Suppression of Gene Expression Plant Cell 2 291 299 Voinnet O Pinto Y M and Baulcombe D C 1999 Suppression of Gene Silencing A General Strategy Used by Diverse DNA and RNA Viruses of Plants Proc Natl Acad Sci USA 96 14147 14152 White R J 1998 RNA Polymerase III Transcription Springer Verlag New York NY Yamaguchi H Yamamoto C and Tanaka N 1965 Inhibition of Protein Synthesis by Blasticidin S I Studies with Cell free Systems from Bacterial and Mammalian Cells J Biochem Tokyo 57 667 677 Yee J K Miyanohara A LaPorte P Bouic K Burns J C and Friedmann T 1994 A General Method for the Generation of High Titer Pantropic Retroviral Vectors Highly Efficient Infection of Primary Hepatocytes Proc Natl Acad Sci USA 91 9564 9568 Yee J K 1999 in The Development of Human Gene Therapy Friedmann T ed pp 21 45 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Yee J K Moores J C Jolly D J Wolff J A Respess J G and Friedmann T 1987 Gene Expression from Transcriptionally Disabled Retroviral Vectors Proc Natl Acad Sci USA 84 5197
25. 5201 Yu J Y DeRuiter S L and Turner D L 2002 RNA Interference by Expression of Short interfering RNAs and Hairpin RNAs in Mammalian Cells Proc Natl Acad Sci USA 99 6047 6052 Yu S F Ruden T v Kantoff P W Garber C Seiberg M Ruther U Anderson W F Wagner E F and Gilboa E 1986 Self Inactivating Retroviral Vectors Designed for Transfer of Whole Genes into Mammalian Cells Proc Natl Acad Sci USA 83 3194 3198 Zamore P D 2001 RNA Interference Listening to the Sound of Silence Nat Struct Biol 8 746 750 Zufferey R Dull T Mandel R J Bukovsky A Quiroz D Naldini L and Trono D 1998 Self inactivating Lentivirus Vector for Safe and Efficient in vivo Gene Delivery J Virol 72 9873 9880 2010 Life Technologies Corporation All rights reserved The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 64 invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
26. 6 Transduction and Analysisecsison m aeee ee a E ER entente aeae eR ee e EA tenete nennen 31 Examples of Expected Results ccccccccscseeseseesesssnsnesessseseeeecesesesesesesesesnansnesesescecececesesenesesesesnaanenesescseeeeceeenenenes 35 Troubleshooting s ocn rei reete e ea ned e pre OO ERN nter ee dr dd 37 ADPONGIX e iana 42 Recipes esea e aoa a nonien btt nonien gau tn audi gtbatat Hr hse dtes Re P 42 Blasticidin i eite tite i a ete ehe sie Dt pei d tem to tee eai e de det HE Reden 43 Map and Features of pLenti6 BEOCKAT DEST 5etetteporredoi teneret bees fid ie diabidie tutores inca dire pud 44 Map of pLenti6 GW U6bAamin PNA oua doute itt NND on e MU UE RU cuf ru amen mene 46 Map and Features of pLDPT si tian emite 47 Map and Feat res of pLP2 esee eere dirti feet d tete etd e ree ie te nig eee se ra re Pe tae et 49 Map and EFeaturesof pDP VSWQ s sarete ette dee n tee egi edere er e OR d 51 Map ot pEbN LB esa beau tr dep M d rapto a el t eee finta nd belua ORE T 53 Additional Products 25 255 aobmtnanelub veu nuege abitanti etienne 54 Technical Support nomeu eei get ete UR optet ite o Bee e i tete p ede 55 Purchaser NotfiCatiotr aieo eee a bre eiie nhe tiere biete oett Fase irren ve eese cR 56 Gateway Clone Distribution Policy eec eve ot pte tat tte m toI edades e UU een deo Mese t MU cnt 60 References cese eiie thu eben eedem eerie et tere fans 61 iii Kit Contents and Storag
27. 6 using an optimized 5 minute ligation procedure e Transform competent E coli and select for entry clones For detailed instructions and guidelines to generate your entry clone refer to the BLOCK iT U6 RNAi Entry Vector Kit manual This manual is supplied with BLOCK iT Lentiviral RNAi Expression System but is also available at www invitrogen com or by calling Technical Support see page 55 Creating Expression Clones Introduction Experimental Outline Important Propagating the Destination Vectors After you have generated an entry clone you are ready to perform the LR recombination reaction using your pENTR U6 entry construct and the pLenti6 BLOCK iT DEST vector to generate an expression clone To ensure that you obtain the best possible results we recommend that you read this section and the sections entitled Performing the LR Recombination Reaction pages 16 17 and Transforming One Shot Stb13 Competent E coli pages 18 19 before beginning To generate an expression clone you will TM 1 Perform an LR recombination reaction using the attL containing pENTR U6 entry clone and the attR containing pLenti BLOCK iT DEST vector Note Both the entry clone and the destination vector should be supercoiled see Important Note below Transform the reaction mixture into a suitable E coli host see page 18 Select for expression clones see the next page for a diagram of the recombination
28. 93FT cells differs from the traditional Lipofectamine 2000 transfection procedure in that you will e First prepare DNA Lipofectamine 2000 complexes and add them to plates containing growth media then e Add the 293FT cells to the media containing DNA Lipofectamine 2000 complexes and allow the cells to attach and transfect overnight see next page Using this procedure we consistently obtain lentiviral stocks with titers that are 3 to 4 fold higher than lentiviral stocks generated using the traditional Lipofectamine 2000 transfection procedure i e plating cells first followed by transfection with DNA Lipofectamine 2000 complexes You may use the traditional Lipofectamine 2000 transfection procedure if desired but keep in mind that the viral titer obtained may be lower see Alternative Transfection Procedure page 25 Continued on next page Producing Lentivirus in 293FT Cells Continued Transfection Procedure Follow the procedure below to cotransfect 293FT cells Include a negative control no DNA no Lipofectamine 2000 in your experiment to help evaluate results You will need 6 x 10 293FT cells for each sample 1 For each transfection sample prepare DNA Lipofectamine 2000 complexes as follows TM a Ina sterile 5 mL tube dilute 9 ug of the ViraPower Packaging Mix and 3 ug of pLenti BLOCK iT DEST expression plasmid DNA 12 yg total in 1 5 mL of Opti MEM I Medium without serum Mix gentl
29. CTA ACCCTCTCCT CGGTCTCGAT 15 Performing the LR Recombination Reaction Introduction Recommended E coliHost Note Important Gateway LR Clonase II Enzyme Mix Follow the guidelines and instructions in this section to perform the LR recombination reaction using the pPENTR U6 entry clone and the pLenti6 BLOCK iT DEST vector We recommend including a negative control no Gateway LR Clonase II in your experiment to help evaluate results For optimal results use Stbl3 E coli for transformation as this strain is particularly well suited for use in cloning unstable DNA such as lentiviral DNA which contains direct repeats One Shot Stb13 Chemically Competent E coli are included in the kit for transformation For instructions see Transforming One Shot Stb13 Competent E coli page 18 Note that transformants containing unwanted recombinants see Note below are not obtained when Stbl3 E coli are used for transformation You may transform the LR recombination reaction into other recA endA E coli strains including TOP10 and DH5a if desired Note however that these strains are not as well suited for cloning unstable DNA and may give rise to a low percentage lt 5 of transformants containing unwanted recombinants i e plasmids where recombination has occurred between the 5 and 3 LTRs when selected on plates containing only ampicillin These events occur less frequently when select
30. Invitrogen by technologies BLOCK iT Lentiviral RNAi Expression System A Gateway adapted lentiviral destination vector for high level expression of short hairpin RNA shRNA in dividing and non dividing mammalian cells Cat nos K4943 00 and K4944 00 Rev date 15 September 2010 Manual part no 25 0677 MANDO000401 ii Contents Kit Contents and Storage nee tese eae etes efe nee nd SEER kie se tee feti t De pe esee el RE Aneis Eae Renit iv Introduction PR 1 System 5 trifmaty s eere catre teen n Pe HERI e pe PI P P BR n o dett FREU ERE CEPI ERROR 1 The BLOCKAT Lentiviral RNAi Expression System eere eese ttes i erue spiel etie oe o crees gs 4 Using shRNA for RINAT Analysis etie etie tee eet rici petite feeit asini dede 7 Biosafety Features of the System esiis ea REEERE RE AE tenete tenete tenete nennen tenete tenente 10 Experimental Outline eite et ee eret hated dee a et rede e UR 12 Mel OUS coii uiseiiieo ccs ced cca cedo eee eia i ace EHI nad ena RUE NTMSE RE 13 Generating an Entry Clorie s nnam ERREUR DUERME RI AE R E EU reati uates 13 Creating Expression CIONES aene n a ea e e eE E E AE a E R E eA A 14 Performing the LR Recombination Reaction sse tenente 16 Transforming One Shot Stbl3 Competent E COE iet pen oe ebrei detiene nube Quae ede 18 Producing Lentivirus in 293FT Cells sse 20 Aitering Your Lentiviral Stock eatis Ai dai idee heme dede debt eiii ers 2
31. Rous Sarcoma Virus RSV enhancer promoter for Tat independent production of viral mRNA in the producer cell line Dull et al 1998 Modified HIV 1 5 and 3 Long Terminal Repeats LTR for viral packaging and reverse transcription of the viral mRNA Dull et al 1998 Luciw 1996 Note The U3 region of the 3 LTR is deleted U3 and facilitates self inactivation of the 5 LTR after transduction to enhance the biosafety of the vector Dull et al 1998 HIV 1 psi Y packaging sequence for viral packaging Luciw 1996 HIV Rev response element RRE for Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 Two recombination sites attR1 and attR2 for recombinational cloning of the U6 RNAi cassette from the pENTR U6 entry clone using Gateway Technology Chloramphenicol resistance gene Cm located between the two attR sites for counterselection The ccdB gene located between the attR sites for negative selection Blasticidin resistance gene Izumi et al 1991 Kimura et al 1994 Takeuchi et al 1958 Yamaguchi et al 1965 for selection in E coli and mammalian cells Ampicillin resistance gene for selection in E coli pUC origin for high copy replication of the plasmid in E coli Note that the pLenti6 BLOCK iT DEST vector does not contain a eukaryotic Important promoter The promoter used to control expression of the shRNA of interest is contained within the U6 RNAi cassette tha
32. Vector Kit manual Note The BLOCK iT Lentiviral RNAi Gateway Vector Kit includes Box 1 and Box 3 only Box Component Shipping Storage 1 pLenti6 BLOCK iT DEST Gateway Room temperature 20 C Vector Kit Gateway LR Clonase II Enzyme Mix Dry ice 209C One Shot Stb13 Chemically Dry ice 80 C Competent E coli 4 5 ViraPower Bsd Lentiviral Support Kit ViraPower Packaging ViraPower Packaging Mix Mix and Lipofectamine and Blasticidin 20 C 2000 Blue ice Lipofectamine 2000 4 C Blasticidin Room do not freeze temperature 6 293FT Cell Line Dry ice Liquid nitrogen 7 8 BLOCK iT U6 RNAi Entry Vector Kit Dry ice U6 RNAi Entry Vector Reagents 20 C One Shot TOP10 Chemically Competent E coli 80 C pLenti6 BLOCK The following vectors are included with the pLenti6 BLOCK iT DEST Gateway iT DEST Vector Vector Kit Box 1 Store the vectors at 20 C Kit Vector Composition Amount pLenti6 BLOCK iT DEST 40 uL of vector at 150 ng pL in 10 mM Tris HCl 6ug 1 mM EDTA pH 8 0 pLenti GW U6 lamin Control 20 uL of vector at 500 ng pL in 10 mM Tris HCl 10 ug Plasmid 1 mM EDTA pH 8 0 Continued on next page Kit Contents and Storage Continued Gateway LR Clonase II Enzyme Mix One Shot StbI3 Chemically Competent E coli Genotype of StbI3 Cells vi The following reagents are included with the Gateway LR Clonase
33. W U6 lamin The sequence of the vector is available at www invitrogen com or by calling Technical Support see page 55 attB1 Pug laminshRNA Pol IIl term attB2 pLenti6 GW U6 lamin 5 splice donor base 520 HIV 1 psi y packaging signal bases 521 565 HIV 1 Rev response element RRE bases 1075 1308 3 splice acceptor base 1656 3 splice acceptor base 1684 attB1 site bases 1891 1915 U6 promoter bases 1952 2215 Lamin A C shRNA bases 2216 2258 Pol Ill terminator bases 2259 2264 attB2 site bases 2269 2293 C SV40 early promoter and origin bases 2442 2751 EM7 promoter bases 2806 2872 Blasticidin resistance gene bases 2873 3271 AU3 3 LTR bases 3357 3591 AU3 bases 3357 3410 3 LTR bases 3411 3591 SV40 polyadenylation signal bases 3663 3797 bla promoter bases 4653 4751 Ampicillin bla resistance gene bases 4752 5612 pUC origin bases 5757 6430 46 Map and Features of pLP1 pLP1 Map 47 The figure below shows the features of the pLP1 vector Note that the gag and pol genes are initially expressed as a gag pol fusion protein which is self cleaved by the viral protease into individual Gag and Pol polyproteins The sequence of pLP1 is available at www invitrogen com or by contacting Technical Support see page 55 Comments for pLP1 8889 nucleotides CMV promoter bases 1 747 TATA box bases 648 651 Human f globin intron bases 880 1320 HIV 1 gag pol sequences bases 1
34. Yee 1999 Viral supernatant frozen and thawed multiple times Do not freeze thaw viral supernatant more than 3 times Poor choice of titering cell line Use HT1080 cells or another adherent cell line with the characteristics discussed on page 26 Target gene is essential for cell viability Make sure that your target gene is not essential for cell viability or growth by performing a transient transfection with the entry construct containing the shRNA of interest Polybrene not included during titering procedure Transduce the lentiviral construct into cells in the presence of Polybrene No colonies obtained Too much Blasticidin used for upon titering selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve experiment Use the minimum Blasticidin concentration required to kill your untransduced cell line Viral stocks stored incorrectly Aliquot and store stocks at 80 C Do not freeze thaw more than 3 times Polybrene not included during transduction Transduce the lentiviral construct into cells in the presence of Polybrene Titer indeterminable Too little Blasticidin used for cells confluent selection Increase amount of Blasticidin used for selection Viral supernatant not diluted sufficiently Titer lentivirus using a wider range of 10 fold serial dilutions e 10 to 10 39 Continued on next page
35. a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 19 Gateway Cloning Products This product and its use is the subject of one or more issued and or pending U S and foreign patent applications owned by Life Technologies Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchas
36. action not treated with proteinase K Treat reaction with proteinase K before transformation Didn t use the suggested amount of Gateway LR Clonase II enzyme mix or Gateway LR Clonase II enzyme mix was inactive e Make sure to store the Gateway LR Clonase II enzyme mix at 20 C or 80 C e Donot thaw the Gateway LR Clonase II enzyme mix more than 10 times e Use the recommended amount of Gateway LR Clonase II enzyme mix see page 17 e Test another aliquot of the Gateway LR Clonase II enzyme mix Not enough LR reaction transformed Transform 2 3 uL of the LR reaction into One Shot Stb13 Chemically Competent E coli Not enough transformation mixture plated Increase the amount of E coli plated Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the transformation mixture for 1 hour at 37 C with shaking before plating Too much entry clone DNA used in the LR reaction Use 50 150 ng of the entry clone in the LR reaction Different sized colonies i e large and small appear when using TOP10 E coli for transformation Some transformants contain plasmids in which unwanted recombination has occurred between 5 and 3 LTRs e Select for transformants on LB plates containing both 100 pg mL ampicillin and 50 pg mL Blasticidin e Use the One Shot StbI3 Chemically
37. al 1994 AU3 HIV 1 truncated 3 LTR Allows viral packaging but self inactivates the 5 LTR for biosafety purposes Dull et al 1998 The element also contains a polyadenylation signal for transcription termination and polyadenylation of mRNA in transduced cells SV40 polyadenylation signal Allows transcription termination and polyadenylation of mRNA bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pUC origin Permits high copy replication and maintenance in E coli 45 Map of pLenti6 GW U6 lamin P Description Map of pLenti6 GW U6 lamin Comments for pLenti6 GW U6 lamin 6837 nucleotides RSV 5 LTR hybrid promoter bases 1 410 RSV promoter bases 1 229 HIV 1 5 LTR bases 230 410 pLenti6 GW U6 lamin is a 6 837 bp control vector expressing an shRNA targeting the Lamin A C gene A double stranded oligonucleotide encoding the lamin shRNA was cloned into the pENTR U6 vector using the reagents supplied in the BLOCK iT U6 RNAi Entry Vector Kit to generate an entry construct containing the U6 lamin RNAi cassette The U6 lamin RNAi cassette was transferred into the pLenti6 BLOCK iT DEST vector using the Gateway LR recombination reaction to generate the pLenti6 GW U6 lamin FN vector The map below shows the elements of pLenti6 G
38. and pLenti6 GW U6 luc Knockdown of lentiviral constructs described in Example 1 were used to transduce COS 7 Lamin A C in African Green monkey kidney cells plated in a 12 well plate at an MOI of 50 COS 7 Cells Cell lysates were prepared 48 hours after transduction and equivalent amounts of cell lysate were analyzed by Western blot using an Anti Lamin A C Antibody 1 1 000 dilution BD Biosciences Cat no 612162 and an Anti B Actin Antibody 1 5 000 dilution Abcam Cat no ab6276 Results e Only the lamin A C specific shRNA Lane 2 inhibits expression of the lamin A C gene while no lamin A C knockdown is observed with the luciferase shRNA Lane 3 e The lamin A C shRNA expressed from pLenti6 GW U6 lamin is active in anon human derived cell line i Lane 1 Untransduced Lamin A C cp Lane 2 Lenti6 GW U6 lamirP construct Lane 3 Lenti6 GW U6 luc construct ee Actin 36 Troubleshooting LR Reaction and Transformation The table below lists some potential problems and possible solutions that may help you troubleshoot the LR recombination and transformation procedures Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Incorrect antibiotic used to select for transformants Select for transformants on LB agar plates containing 100 pg mL ampicillin LR recombination re
39. ation MidiPrep Kit to prepare plasmid DNA e Use healthy 293FT cells under passage 20 do not overgrow TM e Donot add Geneticin to media during transfection as this reduces transfection efficiency and causes cell death Use a DNA in ng Lipofectamine 2000 in uL ratio ranging from 1 2 to 1 3 e Plate cells such that they are 90 95 confluent at the time of transfection OR use the recommended transfection protocol i e add cells to media containing DNA lipid complexes see page 24 Transfected cells not cultured in media containing sodium pyruvate One day after transfection remove media containing DNA lipid complexes and replace with complete media containing sodium pyruvate Sodium pyruvate provides an extra energy source for the cells Lipofectamine 2000 Reagent handled incorrectly e Store at 4 C Do not freeze e Mix gently by inversion before use Do not vortex Continued on next page 38 Troubleshooting Continued Generating the Lentiviral Stock Continued Problem Reason Solution Low viral titer Viral supernatant harvested too Viral supernatants can generally be collected Continued early 48 72 hours posttransfection If many cells are still attached to the plate and look healthy at this point wait an additional 24 hours before harvesting the viral supernatant Viral supernatant too dilute Concentrate virus using any method of choice
40. blished institutional guidelines Since safety requirements for use and handling of lentiviruses may vary at individual institutions consult the health and safety guidelines and or officers at your institution prior to use of the BLOCK iT Lentiviral RNAi Expression System Experimental Outline Flow Chart The diagram below describes the general steps required to express your shRNA of interest using the BLOCK iT Lentiviral RNAi Expression System atfR1 ccdB Cm attR2 pENTR UG Entry Construct X pLenti6 a BLOCK iT DEST 4 8676 bp Gateway LR Clonase II Enzyme Mix attB1 Pus shRNA of interest Pol Ill term attB2 1 Perform an LR recombination Expression Construct reaction between the pENTR U6 entry construct and pLenti6 BLOCK iT DEST to generate pLenti6 BLOCK iT the pLenti BLOCK iT expression construct ViraPower Packaging Mix 2 Cotransfect the 293FT producer Em cell line with your pLenti6 BLOCK iT expression construct and the optimized packaging mix 293FT Producer Cell Line 3 Harvest viral supernatant and determine the titer 4 Add the viral supernatant to your mammalian cell line of interest Select for stably transduced cells using blasticidin if desired Your Mammalian Cell Line of Interest 5 Assay for knockdown of the target gene Pus ShRNA of interest 12 Methods Generating an Entry Clone
41. change is normal and does not affect production of the lentivirus 6 Harvest virus containing supernatants 48 72 hours posttransfection by removing medium to a 15 mL sterile capped conical tube Note Minimal differences in viral yield are observed whether supernatants are collected 48 or 72 hours posttransfection Caution Remember that you are working with infectious virus at this stage Follow the recommended guidelines for working with BL 2 organisms see pages 11 and 28 for more information 7 Centrifuge at 3000 rpm for 5 minutes at 4 C to pellet cell debris Perform filtration step if desired see Note on the next page 8 Pipet viral supernatants into cryovials in 1 mL aliquots Store viral stocks at 80 C Proceed to Titering Your Lentiviral Stock page 26 Continued on next page 24 Producing Lentivirus in 293FT Cells Continued Alternative Transfection Procedure Note Long Term Storage Scaling Up Virus Production 25 An alternative transfection procedure is provided below to cotransfect 293FT cells Note that use of this procedure generally results in production of lentiviral stocks with a slightly lower titer that those produced when using the recommended Transfection Procedure previous page 1 The day before transfection plate 293FT cells in a 10 cm tissue culture plate such that they will be 90 95 confluent on the day of transfection i e 6 x 10 cells in 10 mL of growth medium containin
42. d polyadenylation of mRNA pUC origin of replication ori Permits high copy replication and maintenance in E coli Ampicillin bla resistance gene Allows selection of the plasmid in E coli 52 Map of pENTR gus Description Map of Control Vector Comments for pENTR gus 3841 nucleotides pENTR gus is a 3 841 bp entry clone containing the Arabidopsis thaliana gene for B glucuronidase gus Kertbundit et al 1991 The gus gene was amplified using PCR primers containing attB recombination sites The amplified PCR product was then used in a BP recombination reaction with pDONR201 to generate the entry clone For more information about the BP recombination reaction refer to the Gateway Technology with Clonase II manual which is available at www invitrogen com or by contacting Technical Support see page 55 TM The figure below summarizes the features of the pENTR gus vector The sequence for pENTR gus is available at www invitrogen com or by contacting Technical Support see page 55 attL1 bases 99 198 complementary strand gus gene bases 228 2039 attL2 bases 2041 2140 pUC origin bases 2200 2873 C Kanamycin resistance gene bases 2990 3805 C C complementary strand 53 Additional Products Accessory Products Many of the reagents supplied in the BLOCK iT Lentiviral RNAi Kits as well as other products suitable for use with the kits ar
43. d with 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids 176 penicillin streptomycin and 1 mM MEM Sodium Pyruvate Note MEM Sodium Pyruvate provides an extra energy source for the cells and is available separately see page 54 See note above for L glutamine concentration e Sterile 10 cm tissue culture plates one each for the lentiviral construct positive control and negative control e Sterile tissue culture supplies e 5and15 mL sterile capped conical tubes e Cryovials Continued on next page 20 Producing Lentivirus in 293FT Cells Continued Materials Supplied Components supplied with the kits with the Kits 293FT Cell Line s XN D 3 vA o PA E ViraPower Packaging Mix 21 e pLenti6 GW U6 lamin positive control vector Components supplied with the BLOCK iT Lentiviral RNAi Expression System only e ViraPower Packaging Mix e Lipofectamine 2000 transfection reagent store at 4 C and mix gently before use The human 293FT Cell Line is supplied with the BLOCK iT Lentiviral RNAi Expression System to facilitate optimal lentivirus production Naldini et al 1996 The 293FT Cell Line a derivative of the 293F Cell Line stably and constitutively expresses the SV40 large T antigen from pCMVSPORT6TAg neo and must be maintained in medium containing Geneticin For more information about PCMVSPORT6TAg neo and how to culture and maintain 293FT cells refer to
44. e Types of Kits This manual is supplied with the following products Product Cat no BLOCK iT Lentiviral RNAi Gateway Vector Kit K4943 00 BLOCK iT Lentiviral RNAi Expression System K4944 00 Intended Use For Research Use Only Not intended for any animal or human therapeutic or diagnostic use Kit Components The BLOCK iT Lentiviral RNAi Kits include the following components For a detailed description of the contents of each component see pages v vii For a detailed description of the contents of the BLOCK iT U6 RNAi Entry Vector Kit and how to use the reagents supplied see the BLOCK iT U6 RNAi Entry Vector Kit manual For detailed instructions to grow and maintain the 293FT Cell Line see the 293FT Cell Line manual Cat no Components K4943 00 K4944 00 pLenti BLOCK iT DEST Gateway Vector Kit Gateway LR Clonase II Enzyme Mix One Shot Stbl3 Chemically Competent E coli Z ViraPower Bsd Lentiviral Support Kit 293FT Cell Line Ar VS Re SS ON BLOCK iT U6 RNAi Entry Vector Kit Continued on next page Kit Contents and Storage Continued Shipping and The BLOCK iT Lentiviral RNAi Kits are shipped as described below Upon Storage receipt store each item as detailed below For more detailed information about the reagents supplied in the BLOCK iT U6 RNAi Entry Vector Kit refer to the BLOCK iT U6 RNAi Entry
45. e enzyme mix if desired To use Gateway LR Clonase enzyme mix follow the protocol provided with the product Do not use the protocol for Gateway LR Clonase II enzyme mix provided in this manual Continued on next page 16 Performing the LR Recombination Reaction Continued Positive Control The pENTR gus plasmid is included with the Gateway LR Clonase II enzyme mix for use as a positive control for the LR recombination reaction Use pENTR gus in your LR recombination reaction to verify the efficiency of the LR reaction However the resulting expression clone cannot be used as an expression control because neither the pLenti6 BLOCK iT DEST vector nor pENTR gus include a eukaryotic promoter to control expression of the gus gene in mammalian cells Materials Needed Purified plasmid DNA of your pENTR U6 entry clone 50 150 ng L in TE Buffer e TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA see page 54 e Sterile 0 5 mL microcentrifuge tubes Components supplied with the kits e plLenti6 BLOCK iT DEST vector 150 ng uL in TE Buffer pH 8 0 Components supplied with the BLOCK iT Lentiviral RNAi Expression System only e pENTR gus control e Gateway LR Clonase II enzyme mix store at 20 C until immediately before use e 2ug yL Proteinase K solution thaw and keep on ice until use Setting Up the LR Follow this procedure to perform the LR reaction between the pENTR U6 entry clone Recombina
46. e available separately Ordering information is provided below For more information go to www invitrogen com or contact Technical Support see page 55 Product Amount Cat no BLOCK iT U6 RNAi Entry Vector Kit 20 constructions K4945 00 Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 One Shot Stb13 Chemically Competent E coli 20 x 50 pL C7373 03 One Shot ccdB Survival 2 T1 Chemically Competent Cells 10 transformations A10460 ViraPower Bsd Lentiviral Support Kit 20 reactions K4970 00 ViraPower Lentiviral Packaging Mix 60 reactions K4975 00 Lipofectamine 2000 Reagent 0 75 mL 11668 027 15mL 11668 019 Opti MEM I Reduced Serum Medium 100 mL 31985 062 500 mL 31985 070 Blasticidin 50 mg R210 01 293FT Cell Line 3 x 10 cells R700 07 Phosphate Buffered Saline PBS pH 7 4 500 mL 10010 023 1L 10010 031 Ampicillin 200 mg 11593 027 TE pH 8 0 500 mL AM9849 PureLink HiPure Plasmid DNA Purification MidiPrep Kit 25 reactions K2100 04 Fetal Bovine Serum FBS Certified 500 mL 16000 044 MEM Sodium Pyruvate Solution 100X 100 mL 11360 070 BLOCK iT RNAi Accessory Products Other BLOCK iT RNAi products are available to facilitate RNAi analysis The BLOCK iT RNAi TOPO Transcription Kit allows generation of double stranded RNA dsRNA for use in invertebrate RNAi analysis The dsRNA may also be used as a substrate
47. e into a 21 23 nt siRNA duplex Example The figure below illustrates the structure of the shRNA generated from the pLenti6 GW U6 lamin construct The 19 bp lamin A C target sequence is indicated in bold The underlined bases are derived from the Pol III terminator C 5 GCUGGACUUCCAGAAGAACA G 37 UUGACCUGAAGGUCUUCUUGU A Note The length of the stem and loop may differ depending on how you design the oligo nucleotides encoding your target sequence For guidelines to design the oligonucleotides refer to the BLOCK iT U6 RNAi Entry Vector Kit manual Biosafety Features of the System Introduction Biosafety Features of the BLOCK iT Lentiviral RNAi Expression System The lentiviral and packaging vectors supplied in the BLOCK iT Lentiviral RNAi Expression System are third generation vectors based on lentiviral vectors developed by Dull et al 1998 This third generation lentiviral system includes a significant number of safety features designed to enhance its biosafety and to minimize its relation to the wild type human HIV 1 virus These safety features are discussed below TM The BLOCK iT Lentiviral RNAi Expression System includes the following key safety features TM e ThepLenti6 BLOCK iT DEST expression vector contains a deletion in the 3 LTR AU3 that does not affect generation of the viral genome in the producer cell line but results in self inactivation of the lentivirus after t
48. ection page 38 for more tips and guidelines to optimize the viral yield Continued on next page Titering Your Lentiviral Stock Continued Example of Expected Results In this experiment a pLenti6 lentiviral stock was generated using the protocol on page 24 HT1080 cells were transduced with 10 fold serial dilutions of the lentiviral supernatant 10 to 10 dilutions or untransduced mock following the protocol on page 29 Forty eight hours post transduction the cells were placed under Blasticidin selection 10 pg mL After 10 days of selection the cells were stained with crystal violet see plate below and colonies were counted 10 10 mock gt 10 8 10 104 In the plate above the colony counts were Mock no colonies 10 dilution confluent undeterminable 10 dilution confluent undeterminable 10 dilution confluent undeterminable 10 dilution 46 105 dilution 5 Thus the titer of this lentiviral stock is 4 8 x 10 TU mL i e average of 46 x 10 and 5 x 10 30 Transduction and Analysis Introduction Factors Affecting Gene Knockdown Levels Transient vs Stable Expression Determining Antibiotic Sensitivity for Your Cell Line Multiplicity of Infection MOI 31 Once you have generated a lentiviral stock with a suitable titer you are ready to transduce the lentiviral construct into your mammalian cell line to express the shRNA of interest and perform
49. ed from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights
50. ed to kill your untransduced mammalian cell line i e perform a kill curve experiment Typically concentrations ranging from 2 10 pg mL Blasticidin are sufficient to kill most untransduced mammalian cell lines Test a range of concentrations see protocol below to ensure that you determine the minimum concentration necessary for your cell line 1 Plate cells at approximately 25 confluence Prepare a set of 6 plates Allow cells to adhere overnight 2 The next day substitute culture medium with medium containing varying concentrations of Blasticidin e 2 0 2 4 6 8 10 ug mL Blasticidin 3 Replenish the selective media every 3 4 days and observe the percentage of surviving cells 4 Determine the appropriate concentration of Blasticidin that kills the cells within 10 14 days after addition of antibiotic Transduction of lentivirus into mammalian cells may be enhanced if cells are transduced in the presence of hexadimethrine bromide Polybrene For best results we recommend performing transduction in the presence of Polybrene Note however that some cells are sensitive to Polybrene e g primary neurons Before performing any transduction experiments you may want to test your cell line for sensitivity to Polybrene If your cells are sensitive to Polybrene e g exhibit toxicity or phenotypic changes do not add Polybrene during transduction In this case cells should still be successfully transduced Conti
51. en s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones fo
52. entry clone refer to the BLOCK iT U6 RNAi Entry Vector Kit manual e ThepLenti6 BLOCK iT DEST expression vector into which the U6 RNAi cassette will be cloned The vector also contains the elements required to allow packaging of the expression construct into virions e g 5 and 3 LTRs y packaging signal and a selectable marker to allow generation of stable cell lines For more information about the pLenti6 BLOCK iT DEST vector see page 6 and pages 44 45 TM e The ViraPower Packaging Mix that contains an optimized mixture of the three packaging plasmids pLP1 pLP2 and pLP VSVG These plasmids supply the helper functions as well as structural and replication proteins in trans required to produce the lentivirus For more information about the packaging plasmids see the Appendix pages 47 52 e An optimized 293FT producer cell line that stably expresses the SV40 large T antigen under the control of the human CMV promoter and facilitates optimal production of virus For more information about the 293FT Cell Line refer to the 293FT Cell Line manual You will co transfect the ViraPower Packaging Mix and the pLenti6 BLOCK iT DEST expression construct containing the U6 RNAi cassette into 293FT cells to produce a replication incompetent lentivirus which can then be transduced into a mammalian cell line of interest Once the lentivirus enters the target cell the viral RNA is reverse transcribed actively imported into the n
53. ered Rev dependent by virtue of the HIV 1 RRE in the gag pol mRNA transcript Addition of the RRE prevents gag and pol expression in the absence of Rev Dull et al 1998 e A constitutive promoter RSV promoter has been placed upstream of the 5 LTR in the pLenti6 BLOCK iT DEST expression vector to offset the requirement for Tat in the efficient production of viral RNA Dull et al 1998 Continued on next page 10 Biosafety Features of the System Continued Biosafety Level 2 Important 11 Despite the inclusion of the safety features discussed on the previous page the lentivirus produced with this system can still pose some biohazardous risk since it can transduce primary human cells For this reason we highly recommend that you treat lentiviral stocks generated using this System as Biosafety Level 2 BL 2 organisms and strictly follow all published BL 2 guidelines with proper waste decontamination Furthermore exercise extra caution when creating lentivirus carrying potential harmful or toxic genes e g activated oncogenes For more information about the BL 2 guidelines and lentivirus handling refer to the document Biosafety in Microbiological and Biomedical Laboratories 5 Edition published by the Centers for Disease Control CDC This document may be downloaded at the following address http www cdc gov od ohs biosfty bmbl5 bmbl5toc htm Handle all lentiviruses in compliance with esta
54. ery 3 4 days until Blasticidin resistant colonies can be identified generally 10 12 days after selection Pick at least 5 Blasticidin resistant colonies see Note on the next page and expand each clone to assay for knockdown of the target gene 33 Continued on next page Transduction and Analysis Continued Note Performing RNAi Analysis Expected Results Assaying for Lamin A C Expression Integration of the lentivirus into the genome is random The influence of the surrounding genomic sequences at the integration site may affect target gene knockdown from different Blasticidin resistant clones Test at least 5 Blasticidin resistant clones and select the clone that provides the optimal degree of gene knockdown for further studies You may use any method as appropriate to assay for knockdown of your target gene including functional analysis immunofluorescence western blot qRT PCR with the appropriate LUX primers or real time qRT PCR using TaqMan products For more information about LUX primers or TaqMan products see www invitrogen com TM When performing RNAi studies using pLenti6 BLOCK iT lentiviral constructs we generally observe inhibition of gene expression within 48 to 120 hours after transduction The degree of gene knockdown depends on the time of assay stability of the protein of interest and on the other factors listed on page 31 Note that 100 gene knockdown is generally not obser
55. es have been functionally tested Feature Benefit Rous Sarcoma Virus RSV Allows Tat independent production of viral mRNA Dull et al enhancer promoter 1998 HIV 1 truncated 5 LTR Permits viral packaging and reverse transcription of the viral mRNA Luciw 1996 5 splice donor and 3 acceptors Enhances the biosafety of the vector by facilitating removal of the packaging sequence and RRE such that expression of the gene of interest in the transduced host cell is no longer Rev dependent Dull et al 1998 HIV 1 psi y packaging signal Allows viral packaging Luciw 1996 HIV 1 Rev response element RRE Permits Rev dependent nuclear export of unspliced viral mRNA Kjems et al 1991 Malim et al 1989 attR1 and attR2 sites Bacteriophage A derived DNA recombination sequences that permit recombinational cloning of the gene of interest from a Gateway entry clone Landy 1989 ccdB gene Permits negative selection of the plasmid Chloramphenicol resistance gene Cm Allows counterselection of the plasmid SV40 early promoter and origin Allows high level expression of the selection marker and episomal replication in cells expressing the SV40 large T antigen EM7 promoter Synthetic prokaryotic promoter for expression of the selection marker in E coli Blasticidin bsd resistance gene Permits selection of stably transduced mammalian cell lines Kimura et
56. esearch use requires a license from Cell Genesys Cell Genesys Inc 342 Lakeside Drive Foster City California 94404 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity including non gene therapy research and target validation applications in laboratory animals Continued on next page Purchaser Notification Continued Limited Use Label License No 109 Retroviral Helper Lines Limited Use Label License No 173 Inhibition of gene expression by double stranded RNA Limited Use Label License No 177 In vivo oligonucleotide generator Limited Use Label License No 317 LentiVector Technology Retroviral helper cell lines are licensed from Wisconsin Alumni Research Foundation under U S Patents and corresponding patents and applications in other countries for internal research purposes only Use of these cell lines for Commercial Purposes requires a license from Life Technologies This product and or its use may be covered by one or more of U S Patent No 6 506 559 and or foreign equivalents and is sold under license to Invitrogen Corporation by the Carnegie Institution of Washington 1530 P Street N W Washington DC 20005 A separate license from the Carnegie Institution of Washington may be required to use this product T
57. f the reagents provided with the kit and instructions to produce the Gateway entry construct vii Introduction System Summary Description of the System Advantages of the BLOCK iT Lentiviral RNAi Expression System The BLOCK iT Lentiviral RNAi Expression System combines BLOCK iT RNAi and ViraPower Lentiviral technologies to facilitate creation of a replication incompetent lentivirus that delivers a short hairpin RNA shRNA of interest to dividing or non dividing mammalian cells for RNA interference RNAi analysis The System includes e The BLOCK iT U6 RNAi Entry Vector Kit for production of an entry clone that contains elements required to express a double stranded oligonucleotide ds oligo encoding an shRNA of interest in mammalian cells i e human U6 promoter and RNA Polymerase III Pol III terminator The entry vector containing this U6 RNAi cassette U6 promoter ds oligo Pol III terminator is used to transfer the U6 RNAi cassette into the lentiviral expression plasmid see below using Gateway Technology e A promoterless pLenti6 BLOCK iT DEST destination vector into which the U6 RNAi cassette of interest is transferred This expression plasmid contains elements that allow packaging of the construct into virions and the Blasticidin resistance marker for selection of stably transduced cell lines e Components of the ViraPower Lentiviral System for production of a replication incompetent le
58. g serum 2 On the day of transfection remove the culture medium from the 293FT cells and replace with 5 mL of growth medium containing serum or Opti MEM I Medium containing serum Do not include antibiotics in the medium 3 Prepare DNA Lipofectamine 2000 complexes as instructed in the recommended Transfection Procedure Step 1 previous page 4 Add the DNA Lipofectamine 2000 complexes dropwise to each plate of cells Mix gently by rocking the plate back and forth Incubate the cells overnight at 37 C in a CO incubator Follow Steps 5 8 as instructed in the recommended Transfection Procedure previous page If you plan to use your lentiviral construct for in vivo applications filter your viral supernatant through a sterile 0 45 um low protein binding filter after the low speed centrifugation step see Step 7 previous page to remove any remaining cellular debris We recommend using Millex HV 0 45 um PVDF filters Millipore Cat no SLHV033RB for filtration If you wish to concentrate your viral stock to obtain a higher titer perform the filtration step first before concentrating your viral stock Place lentiviral stocks at 80 C for long term storage Repeated freezing and thawing is not recommended as it may result in loss of viral titer When stored properly viral stocks of an appropriate titer should be suitable for use for up to one year After long term storage re titer your viral stocks before transduci
59. his product is for non clinical research use only It is not to be used for commercial purposes Use of this product to produce products for sale or for diagnostic therapeutic or high throughput drug discovery purposes the screening of more than 10 000 compounds per day is prohibited In order to obtain a license to use this product for these commercial purposes contact The Regents of the University of California This product or the use of this product is covered by U S Patent No 5 624 803 owned by The Regents of the University of California This product is licensed under U S Pat Nos 5 817 491 5 591 624 5 716 832 6 312 682 6 669 936 6 235 522 6 924 123 and foreign equivalents from Oxford BioMedica UK Ltd Oxford UK and is provided for use in academic and commercial in vitro and in vivo research for elucidating gene function and for validating potential gene products and pathways for drug discovery and development but excludes any use of LentiVector technology for creating transgenic birds for the purpose of producing useful or valuable proteins in the eggs of such transgenic birds the delivery of gene therapies and for commercial production of therapeutic diagnostic or other commercial products not intended for research use where such products do not consist of or incorporate a lentiviral vector Information about licenses for commercial uses excluded under this license is available from Oxford BioMedica UK Ltd Medawar
60. hloramphenicol A true expression clone should not grow in the presence of chloramphenicol Sequencing the expression construct is not required as transfer of the U6 RNAi cassette from pENTR U6 into the pLenti6 BLOCK iT DEST vector preserves the orientation of the cassette However if you wish to sequence your pLenti6 BLOCK iT DEST expression construct we recommend using the following primers Refer to the diagram on page 15 for the location of the primer binding sites in the expression vector Primer Sequence U6 Forward 5 GGACTATCATATGCTTACCG 3 V5 C term Reverse 5 ACCGAGGAGAGGGTTAGGGAT 3 Note For information about a convenient custom primer synthesis service go to www invitrogen com or call Technical Support see page 55 Once you have generated your expression clone maintain and propagate the expression clone in LB medium containing 100 pg mL ampicillin Addition of Blasticidin is not required Producing Lentivirus in 293FT Cells Introduction Plasmid Preparation Materials Needed Before creating a stably transduced cell line expressing your shRNA of interest first produce a lentiviral stock containing the packaged pLenti6 BLOCK iT DEST expression construct by co transfecting the optimized ViraPower Packaging Mix and your pLenti6 BLOCK iT DEST expression construct into the 293FT Producer Cell Line After generating your expression clone you must isolate
61. hown to be non essential in development Harborth et al 2001 Use of the pLenti6 GW U6 lamin lentiviral construct for RNAi analysis is limited by the following factors e Not all mammalian cell lines express the lamin A C gene and the control lentiviral construct may only be used to block lamin A C expression in cell lines that express the lamin A C gene Cell lines that are known to express Lamin A C and that have been used successfully in knockdown experiments using the control lentiviral construct include HeLa HEK 293 A549 HT1080 and COS 7 Note Cell lines that are known to express Lamin A C but that have not been tested for lamin A C knockdown using the control lentiviral construct include CHO S K562 and MDCK e The shRNA produced from the control lentiviral construct targets the human lamin A C gene Although this particular target sequence is active in facilitating knockdown of the human lamin A C gene Elbashir et al 2001 Harborth et al 2001 it is not known how effective this particular shRNA is for facilitating knockdown of the lamin A C gene across species A non human derived cell line that has been used successfully in a knockdown experiment using the control lentiviral construct is COS 7 Continued on next page The BLOCK iT Lentiviral RNAi Expression System Continued Features of the The pLenti6 BLOCK iT DEST vector contains the following elements pLenti6 BLOCK iT DEST Vector
62. i I 1994 Blasticidin 5 Deaminase Gene from Aspergillus terreus BSD A New Drug Resistance Gene for Transfection of Mammalian Cells Biochim Biophys ACTA 1219 653 659 Kjems J Brown M Chang D D and Sharp P A 1991 Structural Analysis of the Interaction Between the Human Immunodeficiency Virus Rev Protein and the Rev Response Element Proc Natl Acad Sci USA 88 683 687 Kunkel G R Maser R L Calvet J P and Pederson T 1986 U6 Small Nuclear RNA is Transcribed by RNA Polymerase III Proc Natl Acad Sci USA 83 8575 8579 Kunkel G R and Pederson T 1988 Upstream Elements Required for Efficient Transcription of a Human U6 RNA Gene Resemble Those of U1 and U2 Genes Even Though a Different Polymerase is Used Genes Dev 2 196 204 Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Continued on next page 62 References Continued Lee R C Feinbaum R L and Ambros V 1993 The C elegans Heterochronic Gene lin 4 Encodes Small RNAs with Antisense Complementarity to lin 14 Cell 75 843 854 Lewis P F and Emerman M 1994 Passage Through Mitosis is Required for Oncoretroviruses but not for the Human Immunodeficiency Virus J Virol 68 510 516 Li W X and Ding S W 2001 Viral Suppressors of RNA Silencing Curr Opin Biotechnol 12 150 154 Lin F and Worman H J 1993 Structural Organizat
63. i e 2 days after transduction The transduced cells in the second set of wells were replated into a 6 well plate then cultured for an additional 72 hours Cell lysates were prepared 120 hours i e 5 days after transduction Equivalent amounts of cell lysate were analyzed by Western blot using an Anti Lamin A C Antibody 1 1 000 dilution BD Biosciences Cat no 612162 and an Anti B Actin Antibody 1 5 000 dilution Abcam Cat no ab6276 Results e Only the lamin A C specific shRNA Lanes 3 and 4 inhibits expression of the lamin A C gene while no lamin A C knockdown is observed with the luciferase shRNA Lanes 5 and 6 e A greater degree of lamin A C knockdown is observed 5 days after transduction gt 80 when compared to 2 days e The degree of lamin A C gene blocking achieved using the lamin shRNA is similar to that achieved with the well characterized chemically synthesized siRNA Elbashir et al 2001 Harborth et al 2001 1 3 4 5 6 Lane 1 Untransduced Day 2 Lane 2 Untransduced Day 5 4 Lamin A C Lane 3 Lenti6 GW U6 lamin 5N a lt construct Day 2 Lane 4 Lenti6 GW U6 lamin 4 construct Day 5 a c Actin Lane 5 Lenti6 GW U6 luc FNA construct Day 2 Lane 6 Lenti6 GW U6 luc 5N 35 construct Day 5 Continued on next page Examples of Expected Results Continued Example 2 In this experiment the pLenti6 GW U6 lamin
64. iate Early Gene Molec Cell Biol 7 4125 4129 Nykanen A Haley B and Zamore P D 2001 ATP Requirements and Small Interfering RNA Structure in the RNA Interference Pathway Cell 107 309 321 Paddison P J Caudy A A Bernstein E Hannon G J and Conklin D S 2002 Short Hairpin RNAs shRNAs Induce Sequence Specific Silencing in Mammalian Cells Genes Dev 16 948 958 Paul C P Good P D Winer I and Engelke D R 2002 Effective Expression of Small Interfering RNA in Human Cells Nat Biotechnol 20 505 508 Paule M R and White R J 2000 Transcription by RNA Polymerases I and III Nuc Acids Res 28 1283 1298 Plasterk R H A and Ketting R F 2000 The Silence of the Genes Curr Opin Genet Dev 10 562 567 Romano N and Macino G 1992 Quelling Transient Inactivation of Gene Expression in Neurospora crassa by Transformation with Homologous Sequences Mol Microbiol 6 3343 3353 Smith C J Watson C F Bird C R Ray J Schuch W and Grierson D 1990 Expression of a Truncated Tomato Polygalacturonase Gene Inhibits Expression of the Endogenous Gene in Transgenic Plants Mol Gen Genet 224 477 481 Continued on next page 63 References Continued Sui G Soohoo C Affar E B Gay F Shi Y Forrester W C and Shi Y 2002 A DNA Vector Based RNAi Technology to Suppress Gene Expression in Mammalian Cells Proc Natl Acad Sci USA 99 5515 5
65. ion is performed using both ampicillin 100 pg mL and Blasticidin 50 pg mL Note also that transformed E coli grow more slowly in LB media containing ampicillin and Blasticidin and may require slightly longer incubation times to obtain visible colonies For more information about Blasticidin see the Appendix page 43 Tip When using TOP10 E coli for transformation we have observed that transformants containing a plasmid that has recombined between the 5 and 3 LTRs i e unwanted recombinants generally give rise to larger colonies than those containing an intact plasmid Select small colonies for analysis Do not transform the LR recombination reaction into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene TM Gateway LR Clonase II enzyme mix is supplied with the BLOCK iT Lentiviral RNAi Expression System and is also available separately see page 54 The Gateway LR Clonase II enzyme mix combines the proprietary enzyme formulation and 5X LR Clonase Reaction Buffer previously supplied as separate components in LR Clonase enzyme mix into an optimized single tube format for easier set up of the LR recombination reaction Use the protocol provided on page 17 to perform the LR recombination reaction using Gateway LR Clonase II enzyme mix Note You may perform the LR recombination reaction using Gateway LR Clonas
66. ion of the Human Gene Encoding Nuclear Lamin A and Nuclear Lamin C J Biol Chem 268 16321 16326 Luciw P A 1996 in Fields Virology Fields B N Knipe D M Howley P M Chanock R M Melnick J L Monath T P Roizman B and Straus S E eds 3rd Ed pp 1881 1975 Lippincott Raven Publishers Philadelphia PA Malim M H Hauber J Le S Y Maizel J V and Cullen B R 1989 The HIV 1 Rev Trans activator Acts Through a Structured Target Sequence to Activate Nuclear Export of Unspliced Viral mRNA Nature 338 254 257 Naldini L 1998 Lentiviruses as Gene Transfer Agents for Delivery to Non dividing Cells Curr Opin Biotechnol 9 457 463 Naldini L 1999 in The Development of Human Gene Therapy Friedmann T ed pp 47 60 Cold Spring Harbor Laboratory Press Cold Spring Harbor NY Naldini L Blomer U Gage F H Trono D and Verma I M 1996 Efficient Transfer Integration and Sustained Long Term Expression of the Transgene in Adult Rat Brains Injected with a Lentiviral Vector Proc Natl Acad Sci USA 93 11382 11388 Napoli C Lemieux C and Jorgensen R 1990 Introduction of a Chalcone Synthase Gene into Petunia Results in Reversible Co Suppression of Homologous Genes in trans Plant Cell 2 279 289 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immed
67. ls Resistance is conferred by expression of either one of two Blasticidin S deaminase genes BSD from Aspergillus terreus Kimura et al 1994 or bsr from Bacillus cereus Izumi et al 1991 These deaminases convert Blasticidin S to a non toxic deaminohydroxy derivative Izumi et al 1991 The formula for Blasticidin S is Ci7HzsNsOs HCL and the molecular weight is 458 9 The diagram below shows the structure of Blasticidin NH2 Sn A HOOC o CH3 HCI Y p NH 0 NH2 Always wear gloves mask goggles and a laboratory coat when handling Blasticidin Weigh out Blasticidin and prepare solutions in a hood Blasticidin may be obtained in 50 mg aliquots see page 54 for ordering information e Blasticidin is soluble in water and acetic acid e Prepare a stock solution of 5 to 10 mg mL Blasticidin in sterile water and filter sterilize the solution e Aliquot in small volumes suitable for one time use and freeze at 20 C for long term storage or store at 4 C for short term storage e Aqueous stock solutions are stable for 1 week at 4 C and 6 8 weeks at 20 C e pH ofthe aqueous solution should not exceed 7 0 to prevent inactivation of Blasticidin e Do not subject stock solutions to freeze thaw cycles do not store in a frost free freezer e Upon thawing use what you need and discard the unused portion e Medium containing Blasticidin may be stored at 4 C for up to 2 weeks Map and Features
68. lysis in mammalian cells is the transient nature of siRNA The Gateway adapted pENTR U6 vector supplied in the BLOCK iT U6 RNAi Entry Vector Kit addresses this limitation by facilitating generation of an entry clone containing a ds oligo encoding an shRNA of interest within the context of an RNA Polymerase III driven expression cassette i e U6 RNAi cassette see next page The resulting pENTR U6 entry construct may be introduced into dividing mammalian cells for transient expression of the shRNA of interest and initial RNAi screening if desired Once initial screening is complete the U6 RNAi cassette may then be easily and efficiently transferred into the pLenti BLOCK iT DEST vector or other suitable destination vector by LR recombination For more information about the BLOCK iT U6 RNAi Entry Vector Kit its components and how to generate the pENTR U6 construct refer to the BLOCK iT U6 RNAi Entry Vector Kit manual Continued on next page Using shRNA for RNAi Analysis Continued Features of the U6 RNAi Cassette Human U6 Promoter Structure of the shRNA The U6 RNAi cassette contains all of the elements required to facilitate RNA Polymerase III controlled expression of your shRNA of interest from pLenti6 BLOCK iT DEST or pENTR U6 including a e Human U6 promoter see below for more information e Double stranded oligo encoding an shRNA to your target gene of interest e Polymerase III Pol III te
69. mond et al 2000 Nykanen et al 2001 In addition to dsRNA other endogenous RNA molecules including short temporal RNA stRNA see below and micro RNA miRNA Ambros 2001 Carrington amp Ambros 2003 have been identified and shown to be capable of triggering gene silencing For more information about the RNAi pathway and the mechanism of gene silencing refer to these reviews Bosher amp Labouesse 2000 Dykxhoorn et al 2003 Hannon 2002 Plasterk amp Ketting 2000 Zamore 2001 Small temporal RNA stRNA a subclass of micro RNA miRNA were originally identified and shown to be endogenous triggers of gene silencing in C elegans Grishok et al 2001 Lee et al 1993 Short temporal RNA including let 7 Grishok et al 2001 and lin 4 Lee et al 1993 encode hairpin precursors that are processed by the Dicer enzyme into 21 23 nucleotide siRNA duplexes Hutvagner et al 2001 Ketting et al 2001 that then enter the RNAi pathway and result in gene silencing by blocking translation Short hairpin RNA shRNA are an artificially designed class of RNA molecules that can trigger gene silencing through interaction with cellular components common to the RNAi and miRNA pathways Although shRNA are a structurally simplified form of miRNA these RNA molecules behave similarly to siRNA in that they trigger the RNAi response by inducing cleavage and degradation of target transcripts Brummelkamp et al 2002 Paddison et al 20
70. mpicillin and Blasticidin Appendix 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 Liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 mL deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 Liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if desired 4 Store at 4 C Follow the instructions below to prepare LB agar plates containing ampicillin and Blasticidin Important Note The stability of Blasticidin may be affected by high temperature therefore we do not recommend adding Blasticidin to warm LB agar Let LB agar cool to room temperature before adding Blasticidin 1 2 3 Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add ampicillin to a final concentration of 100 pg mL and pour into 10 cm plates Let harden then spread 50 pg mL Blasticidin on each plate Invert and store at 4 C in the dark Plates containing Blasticidin may be stored at 4 C for up to 2 weeks 42 Blasticidin Description Molecular Weight Formula and Structure Handling Blasticidin Preparing and Storing Stock Solutions 43 Blasticidin S HCl is a nucleoside antibiotic isolated from Streptomyces griseo chromogenes which inhibits protein synthesis in both prokaryotic and eukaryotic cel
71. nce lentiviral titers including e The characteristics of the cell line used for titering see below e The age of your lentiviral stock Viral titers may decrease with long term storage at 80 C If your lentiviral stock has been stored for longer than 6 months titer or re titer your lentiviral stock prior to use in an RNAi experiment e Number of freeze thaw cycles Viral titers can decrease as much as 10 with each freeze thaw cycle e Improper storage of your lentiviral stock Lentiviral stocks should be aliquotted and stored at 80 C see page 25 for recommended storage conditions You may titer your lentiviral stock using any mammalian cell line of choice Generally we recommend using the same mammalian cell line to titer your lentiviral stock as you will use to perform your expression studies However in some instances you may wish to use a different cell line to titer your lentivirus e g if you are performing RNAi studies in a non dividing cell line or a primary cell line In these cases we recommend that you choose a cell line with the following characteristics to titer your lentivirus e Grows as an adherent cell line e Easy to handle e Exhibits a doubling time in the range of 18 25 hours e Non migratory We generally use the HT1080 human fibrosarcoma cell line ATCC Cat no CCL 121 for titering purposes Important You may use other cell lines including HeLa and NIH 3T3 to titer your lentivirus Howeve
72. nd other tissue culture supplies with bleach and dispose of as biohazardous waste Wear gloves a laboratory coat and safety glasses or goggles when handling viral stocks and media containing virus Continued on next page 28 Titering Your Lentiviral Stock Continued Transduction and Titering Procedure Expected Results 29 Follow the procedure below to determine the titer of your lentiviral stock using the mammalian cell line of your choice You will use at least one 6 well plate for every lentiviral stock to be titered one mock well plus five dilutions Note If you have generated a lentiviral stock of the pLenti6 GW U6 lamin FN control construct we recommend titering this stock as well 1 10 11 The day before transduction Day 1 trypsinize and count the cells plating them in a 6 well plate such that they will be 30 50 confluent at the time of transduction Incubate cells at 37 C overnight Example When using HT1080 cells we usually plate 2 x 10 cells per well in a 6 well plate On the day of transduction Day 2 thaw your lentiviral stock and prepare 10 fold serial dilutions ranging from 10 to 10 For each dilution dilute the lentiviral construct into complete culture medium to a final volume of 1 mL DO NOT vortex Note You may prepare a wider range of serial dilutions 10 to 10 if desired Remove the culture medium from the cells Mix each dilution gently by inversion and add to
73. ne into the pLenti6 BLOCK IT DEST vector by recombination Non shaded regions are derived from the pLenti6 BLOCK iT DEST vector Note The DNA sequences transferred from the pENTR U6 entry clone consist of a U6 RNAi cassette containing the human U6 promoter your ds oligo encoding the shRNA of interest Pol III terminator e The transcriptional start site is indicated Note that transcription starts at the first nucleotide following the end of the human U6 promoter sequence Bases 1 875 and 4 111 of the pLenti6 BLOCK iT DEST sequence are marked 1875 1821 AAGTTGACTA GTATCGATGC GTTAACGTTC GAATTCTGCA GATATCAACA AGTTTGTACA AAAAAGCAGG CTTTAAAGGA CTATAGTTGT TCAAACATGT TTTTTCGTCC GAAATTTCCT L attB1 r ACCAATTCAG TCGACTGGAT CCGGTACCAA GGTCGGGCAG GAAGAGGGCCO TATTICCCAT GATTOCTTCA TATTTGCATA U6 promoter TACGATACAA GGCTGTTAGA GAGATAATTA GAATTAATTT GACTGTAAAC ACAAAGATAT TAGTACAAAA TACGTGACGT U6 forward priming site AGAALAGT AAT AATTTCTTGG GTAGTTTGGA GITTTAASAT TATGTTTTAA AAT CCACTAT CATATGCITA CCGTAACTIG Transcriptional start Pol Ill terminator l mMm AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAAA AOO oligo TTTTTTCTAG ACCCAGCTTT TTTCATAAAG CTAAAGAACC GAAATATATA GAACACCTTT CCTGCTTTGTGG awa AAGATC TGGGTCGAAA E 4111 attB2 CTTGTACAAA GTG GTTGATATCC AGCACAGTGG CGGCCGCTCG AGTCTAGAGG GCCCGCGGTT CGAAGGTAAG GAACATGTTT CAC CAACTATAGG J V5 C term reverse priming site r 1 4191 CCTATCC
74. ng your mammalian cell line of interest It is possible to scale up the cotransfection experiment to produce a larger volume of lentivirus if desired For example we have scaled up the cotransfection experiment from a 10 cm plate to a T 175 cm flask and harvested up to 30 mL of viral supernatant If you wish to scale up your cotransfection remember that you will need to increase the number of cells plated and the amounts of DNA Lipofectamine 2000 and medium used in proportion to the difference in surface area of the culture vessel Titering Your Lentiviral Stock Introduction Experimental Outline Factors Affecting Viral Titer Selecting a Cell Line Before transducing your mammalian cell line and expressing your shRNA for RNAi analysis we recommend determining the titer of your lentiviral stock While this procedure is not required for some applications it is necessary if e You wish to control the number of integrated copies of the lentivirus e You wish to generate reproducible gene knockdown results To determine the titer of a lentiviral stock you will 1 Prepare 10 fold serial dilutions of your lentiviral stock 2 Transduce the different dilutions of lentivirus into the mammalian cell line of your choice in the presence of Polybrene 3 Select for stably transduced cells using Blasticidin 4 Stain and count the number of Blasticidin resistant colonies in each dilution A number of factors can influe
75. nterfering RNAs in Mammalian Cells Science 296 550 553 Buchschacher G L Jr and Wong Staal F 2000 Development of Lentiviral Vectors for Gene Therapy for Human Diseases Blood 95 2499 2504 Burns J C Friedmann T Driever W Burrascano M and Yee J K 1993 Vesicular Stomatitis Virus G Glycoprotein Pseudotyped Retroviral Vectors Concentration to a Very High Titer and Efficient Gene Transfer into Mammalian and Nonmammalian Cells Proc Natl Acad Sci USA 90 8033 8037 Carrington J C and Ambros V 2003 Role of MicroRNAs in Plant and Animal Development Science 301 336 338 Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Cogoni C and Macino G 1997 Isolation of Quelling Defective qde Mutants Impaired in Posttranscriptional Transgene Induced Gene Silencing in Neurospora crassa Proc Natl Acad Sci USA 94 10233 10238 Cogoni C and Macino G 1999 Gene Silencing in Neurospora crassa Requires a Protein Homologous to RNA Dependent RNA Polymerase Nature 399 166 169 Cogoni C Romano N and Macino G 1994 Suppression of Gene Expression by Homologous Transgenes Antonie Van Leeuwenhoek 65 205 209 Dull T Zufferey R Kelly M Mandel R J Nguyen M Trono D and Naldini L 1998 A Third Generation Lentivirus Vector wi
76. ntivirus that stably expresses the shRNA of interest from the U6 RNAi cassette in both dividing and non dividing mammalian cells For more information about the BLOCK iT RNAi Technology ViraPower Lentiviral Technology and Gateway Technology see page 2 TM Use of the BLOCK iT Lentiviral RNAi Expression System to facilitate lentiviral based delivery of shRNA to mammalian cells provides the following advantages TM e The pENTR U6 entry vector provides a rapid and efficient way to clone ds oligo duplexes encoding a desired shRNA target sequence into a vector containing an RNA Pol III dependent expression cassette i e U6 RNAi cassette for use in RNAi analysis e The vectors in the System are Gateway adapted for easy recombination of the U6 RNAi cassette from the pENTR U6 vector into the pLenti6 BLOCK iT DEST vector e Generates a replication incompetent lentivirus that effectively transduces both dividing and non dividing mammalian cells thus broadening the potential RNAi applications beyond those of other traditional retroviral systems Naldini 1998 e Efficiently delivers the shRNA of interest to mammalian cells in culture or in vivo e Provides stable long term expression of the shRNA of interest beyond that offered by traditional adenoviral based systems e Produces a pseudotyped virus with a broadened host range Yee 1999 e Includes multiple features designed to enhance the biosafety of the system
77. nued on next page Titering Your Lentiviral Stock Continued Preparing and Follow the instructions below to prepare Polybrene Sigma Aldrich Storing Cat no H9268 Polybrene 1 Prepare a 6 mg mL stock solution in deionized sterile water 2 Filter sterilize and dispense 1 mL aliquots into sterile microcentrifuge tubes 3 Store at 20 C for long term storage Stock solutions may be stored at 20 C for up to 1 year Do not freeze thaw the stock solution more than 3 times as this may result in loss of activity Note The working stock may be stored at 4 C for up to 2 weeks Materials Needed Your pLenti6 BLOCK iT lentiviral stocks store at 80 C until use Adherent mammalian cell line HT1080 human fibrosarcoma or other Complete culture medium for your cell line 6 mg mL Polybrene if desired 6 well tissue culture plates Crystal violet Sigma Aldrich Cat no C3886 prepare a 1 crystal violet solution in 10 ethanol Phosphate Buffered Saline PBS page 54 TM Components supplied with the BLOCK iT Lentiviral RNAi Expression System Blasticidin 10 mg mL stock for selection Follow the recommended Federal and institutional guidelines for working with ai Remember that you will be working with media containing infectious virus BL 2 organisms Perform all manipulations within a certified biosafety cabinet Treat media containing virus with bleach Treat used pipets pipette tips a
78. o One Shot Stbl3 Chemically Competent E coli Box 3 included with the kit The transformation efficiency of One Shot Stbl3 TM Chemically Competent E coli is 1 x 10 cfu ug plasmid DNA LR recombination reaction from Step 7 previous page LB Medium if performing the pUC19 control transformation 42 C water bath LB plates containing 100 pg mL ampicillin two for each transformation warm at 37 C for 30 minutes before use 37 C shaking and non shaking incubator Components supplied with the kits One Shot Stb13 Chemically Competent E coli Box 3 one vial per transformation thaw on ice immediately before use S O C Medium Box 3 warm to room temperature pUC19 positive control if desired to verify the transformation efficiency Box 3 Use this procedure to transform the LR recombination reaction into One Shot Stbl3 Chemically Competent E coli 1 TM Thaw on ice one vial of One Shot Stbl3 chemically competent cells for each transformation Add 2 to 3 uL of the LR recombination reaction from Step 7 page 17 into a vial of One Shot StbI3 cells and mix gently Do not mix by pipetting up and down For the pUC19 control add 10 pg 1 uL of DNA into a separate vial of One Shot cells and mix gently Incubate the vial s on ice for 30 minutes Heat shock the cells for 45 seconds at 42 C without shaking Remove the vial s from the 42 C water bath and place them on ice for 2 minutes
79. of MOIs e g 0 1 5 10 50 to determine the MOI required to obtain the optimal degree of target gene knockdown In general non dividing cell types transduce lentiviral constructs less efficiently than actively dividing cell lines If you are transducing your lentiviral construct into a non dividing cell type you may need to increase the MOI to achieve an optimal degree of target gene knockdown If you have generated the control pLenti6 GW U6 lamin lentiviral construct you may use this lentiviral stock as a negative control for the RNAi response in any mammalian cell line In addition you may use this lentiviral construct as a positive control to help you determine the optimal MOI and verify the RNAi response in some cell lines To use the construct as a positive control remember that you must use a cell line that expresses the lamin A C gene see Note page 5 Note If your cell line expresses lamin A C you may detect the protein using Western blot analysis see page 34 Remember that viral supernatants are generated by harvesting spent media containing virus from the 293FT producer cells Spent media lacks nutrients and may contain some toxic waste products If you are using a large volume of viral supernatant to transduce your mammalian cell line e g 1 mL of viral supernatant per well in a 6 well plate note that growth characteristics or morphology of the cells may be affected during transduction These effects are
80. one well of cells total volume 1 mL Add Polybrene if desired to each well to a final concentration of 6 pg mL Swirl the plate gently to mix Incubate at 37 C overnight The following day Day 3 remove the media containing virus and replace with 2 mL of complete culture medium The following day Day 4 remove the medium and replace with complete culture medium containing the appropriate amount of Blasticidin to select for stably transduced cells Replace medium with fresh medium containing Blasticidin every 3 4 days After 10 12 days of selection day 14 16 you should see no live cells in the mock well and discrete Blasticidin resistant colonies in one or more of the dilution wells Remove the medium and wash the cells twice with PBS Add crystal violet solution 1 mL for 6 well dish 5 mL for 10 cm plate and incubate for 10 minutes at room temperature Remove the crystal violet stain and wash the cells with PBS Repeat wash Count the blue stained colonies and determine the titer of your lentiviral stock When titering pLenti6 BLOCK iT lentiviral stocks using HT1080 cells we generally obtain titers ranging from 5 x 10 to 2 x 10 transducing units TU mL For an example of expected results obtained from a typical titering experiment see the next page Note If the titer of your lentiviral stock is less than 1 x 10 TU mL we recommend producing a new lentiviral stock See page 26 and the Troubleshooting s
81. part of the ViraPower Bsd Lentiviral Support Kit see page 54 Continued on next page Producing Lentivirus in 293FT Cells Continued Lipofectamine 2000 Opti MEM Positive Control The Lipofectamine 2000 reagent supplied with the BLOCK iT Lentiviral RNAi Expression System Ciccarone ef al 1999 is a proprietary cationic lipid based formulation suitable for the transfection of nucleic acids into eukaryotic cells Using Lipofectamine 2000 to transfect 293FT cells offers the following advantages e Provides the highest transfection efficiency in 293FT cells e DNA Lipofectamine 2000 complexes can be added directly to cells in culture medium in the presence of serum e Removal of complexes or medium change or addition following transfection is not required although complexes can be removed after 4 6 hours without loss of activity Note Lipofectamine 2000 is available separately or as part of the ViraPower Bsd Lentiviral Support Kit see page 54 for ordering information To facilitate optimal formation of DNA Lipofectamine 2000 complexes we recommend using Opti MEM I Reduced Serum Medium see page 54 for ordering information For more information about Opti MEM I go to www invitrogen com or call Technical Support see page 55 The pLenti6 GW U6 lamin plasmid is included with the BLOCK iT Lentiviral RNAi Kits as a control for lentivirus production We recommend including the positi
82. plasmid DNA for transfection Plasmid DNA for transfection into eukaryotic cells must be very clean and free from contamination with phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating lentiviral plasmid DNA using the PureLink HiPure Plasmid DNA Purification MidiPrep Kit see page 54 Resuspend the purified pLenti BLOCK iT DEST expression plasmid in sterile water or TE Buffer pH 8 0 to a final concentration ranging from 0 1 3 0 ug pL You will need 3 ug of the expression plasmid for each transfection Important Do not use mini prep plasmid DNA for transfection e pLenti BLOCK T DEST expression construct 0 1 3 0 ug pL in sterile water or TE Buffer pH 8 0 e 293FT cells cultured in the appropriate medium i e D MEM supplemented with 10 FBS 2 mM L glutamine 0 1 mM MEM Non Essential Amino Acids and 1 penicillin streptomycin Note D MEM already contains 4 mM L glutamine which is enough to support cell growth of the 293FT Cell Line However since L glutamine slowly decays over time supplement the medium with 2 mM L glutamine 293FT cells grow well in 6 mM L glutamine but higher concentrations of L glutamine may reduce growth e Opti MEM I Reduced Serum Medium pre warmed see page 54 e Fetal bovine serum FBS see page 54 e Complete growth medium containing sodium pyruvate i e DD MEM supplemente
83. r note that the titer obtained when using HeLa cells or NIH 3T3 cells is approximately 10 fold lower than the titer obtained when using HT1080 cells Continued on next page Polybrene is a registered trademark of Abbott Laboratories 26 Titering Your Lentiviral Stock Continued Note Antibiotic Selection Preparing Blasticidin Determining Antibiotic Sensitivity Using Polybrene During Transduction 27 The titer of a lentiviral construct may vary depending on which cell line is chosen see Factors Affecting Viral Titer previous page If you have more than one lentiviral construct we recommend that you titer all of the lentiviral constructs using the same mammalian cell line The pLenti6 BLOCK iT DEST expression construct contains the Blasticidin resistance gene bsd Kimura et al 1994 to allow for Blasticidin selection Takeuchi et al 1958 Yamaguchi et al 1965 of mammalian cells that have stably transduced the lentiviral construct TM If you are using the BLOCK iT Lentiviral RNAi Expression System Blasticidin is supplied with the kit Blasticidin is also available separately or as part of the ViraPower Bsd Lentiviral Support Kit see page 54 for ordering information For more information about how to prepare and handle Blasticidin refer to the Appendix page 43 To select for stably transduced cells using Blasticidin first determine the minimum concentration of Blasticidin requir
84. r purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 60 References Ambros V 2001 MicroRNAs Tiny Regulators with Great Potential Cell 107 823 826 Anandalakshmi R Pruss G J Ge X Marathe R Mallory A C Smith T H and Vance V B 1998 A Viral Suppressor of Gene Silencing in Plants Proc Natl Acad Sci USA 95 13079 13084 Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Bernstein E Caudy A A Hammond S M and Hannon G J 2001 Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference Nature 409 363 366 Bogenhagen D F and Brown D D 1981 Nucleotide Sequences in Xenopus 55 DNA Required for Transcription Termination Cell 24 261 270 Boshart M Weber F Jahn G Dorsch Hasler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Bosher J M and Labouesse M 2000 RNA Interference Genetic Wand and Genetic Watchdog Nature Cell Biol 2 E31 E36 Brummelkamp T R Bernards R and Agami R 2002 A System for Stable Expression of Short I
85. ransduction of the target cell Yee et al 1987 Yu et al 1986 Zufferey et al 1998 Once integrated into the transduced target cell the lentiviral genome is no longer capable of producing packageable viral genome e The number of genes from HIV 1 that are used in the system has been reduced to three i e gag pol and rev e The VSV G gene from Vesicular Stomatitis Virus is used in place of the HIV 1 envelope Burns et al 1993 Emi et al 1991 Yee et al 1994 e Genes encoding the structural and viral genome packaging components are separated onto four plasmids All four plasmids have been engineered not to contain any regions of homology with each other to prevent undesirable recombination events that could lead to the generation of a replication competent virus Dull et al 1998 e Although the three packaging plasmids allow expression in trans of proteins required to produce viral progeny e g gal pol rev env in the 293FT producer cell line none of them contain LTRs or the Y packaging sequence This means that none of the HIV 1 structural genes are actually present in the packaged viral genome and thus are never expressed in the transduced target cell No new replication competent virus can be produced e The lentiviral particles produced in this system are replication incompetent and only carry the gene of interest No other viral species are produced e Expression of the gag and pol genes from pLP1 has been rend
86. region of expression clones in pLenti6 BLOCK iT DEST The pLenti6 BLOCK iT DEST vector is supplied as a supercoiled plasmid Although the Gateway Technology manual has previously recommended using a linearized destination vector for more efficient LR recombination further testing has found that linearization of pLenti6 BLOCK iT DEST is not required to obtain optimal results for any downstream application TM To propagate and maintain the pLenti6 BLOCK iT DEST vector use 10 ng of the vector to transform One Shot ccdB Survival 2 T1 Chemically Competent Cells see page 54 The One Shot ccdB Survival 2 T1 Chemically Competent E coli strain is resistant to CcdB effects and can support the propagation of plasmids containing the ccdB gene To maintain integrity of the vector select for transformants in media containing 50 to 100 pg mL ampicillin and 15 to 30 ug mL chloramphenicol Note Do not use general E coli cloning strains including StbI3 TOP10 or DH5a for propagation and maintenance as these strains are sensitive to CcdB effects Continued on next page 14 Creating Expression Clones Continued Recombination The recombination region of the expression clone resulting from Region of pLenti6 BLOCK iT DEST x pENTR U6 entry clone is shown below pLenti6 B LOCK Features of the Recombination Region iT DEST e Shaded regions correspond to those DNA sequences transferred from the pENTR U6 entry clo
87. rminator consisting of a cluster of six thymidine T residues Bogenhagen amp Brown 1981 See the diagram below for an illustration of the U6 RNAi cassette U6 promoter Pol IlI term Expression of the shRNA of interest from pLenti6 BLOCK iT DEST or pENTR U6 is controlled by the human U6 promoter The endogenous U6 promoter normally controls expression of the U6 RNA a small nuclear RNA snRNA involved in splicing and has been well characterized Kunkel et al 1986 Kunkel amp Pederson 1988 Paule amp White 2000 We and other groups have chosen this particular promoter to control vector based expression of shRNA molecules in mammalian cells Paddison et al 2002 Paul et al 2002 for the following reasons e The promoter is recognized by RNA Polymerase III and controls high level constitutive expression of shRNA e The promoter is active in most mammalian cell types e The promoter is a type III Pol III promoter all elements required to control expression of the shRNA are located upstream of the transcription start site Paule amp White 2000 TM Once you have used the BLOCK iT Lentiviral RNAi Expression System to generate a lentiviral construct containing the U6 RNAi cassette you will transduce the lentivirus into mammalian cells to express the shRNA of interest The shRNA forms an intramolecular stem loop structure similar to the structure of miRNA that is then processed by the endogenous Dicer enzym
88. se manuals are supplied with the BLOCK iT Lentiviral RNAi Expression System but are also available at www invitrogen com or by contacting Technical Support see page 55 The One Shot Stb13 Chemically Competent E coli Gateway LR Clonase II Enzyme Mix and Lipofectamine 2000 Reagent included in the BLOCK iT Lentiviral RNAi Expression System are available separately and are supplied with individual documentation detailing general use of the product For instructions to use these products specifically with the BLOCK iT Lentiviral RNAi Kits follow the recommended protocols in this manual TM The BLOCK iT Lentiviral RNAi Expression System is designed to help you create a lentivirus to deliver and express an shRNA of interest in mammalian cells for RNAi analysis Although the system has been designed to help you express your shRNA of interest in the simplest most direct fashion use of the system is geared toward those users who are familiar with the principles of retrovirus biology and gene silencing We highly recommend that users possess a working knowledge of viral and tissue culture techniques lipid mediated transfection and the RNAi pathway For more information about the following topics refer to these published references e Retrovirus biology and the retroviral replication cycle see Buchschacher and Wong Staal 2000 and Luciw 1996 e Retroviral and lentiviral vectors see Naldini 1999 Naldini 1998 and Yee
89. t is transferred from the pENTR U6 entry clone into pLentio BLOCK T DEST after LR recombination For more information about the features of the U6 RNAi cassette see page 9 Using shRNA for RNAi Analysis The RNAi Pathway RNAi describes the phenomenon by which dsRNA induces potent and specific stRNA and shRNA inhibition of eukaryotic gene expression via the degradation of complementary messenger RNA mRNA and is functionally similar to the processes of post transcriptional gene silencing PTGS or cosuppression in plants Cogoni et al 1994 Napoli et al 1990 Smith et al 1990 van der Krol et al 1990 and quelling in fungi Cogoni amp Macino 1997 Cogoni amp Macino 1999 Romano amp Macino 1992 In plants the PTGS response is thought to occur as a natural defense against viral infection or transposon insertion Anandalakshmi et al 1998 Jones et al 1998 Li amp Ding 2001 Voinnet et al 1999 In eukaryotic organisms dsRNA produced in vivo or introduced by pathogens is processed into 21 23 nucleotide double stranded short interfering RNA duplexes siRNA by an enzyme called Dicer a member of the RNase III family of double stranded RNA specific endonucleases Bernstein et al 2001 Ketting et al 2001 Each siRNA then incorporates into an RNA induced silencing complex RISC an enzyme complex that serves to target cellular transcripts complementary to the siRNA for specific cleavage and degradation Ham
90. taining virus and replace with fresh complete media e Concentrate the virus Yee 1999 Polybrene used during transduction Verify the sensitivity of your cells to Polybrene If cells are sensitive omit the Polybrene during transduction Too much Blasticidin used for selection Determine the Blasticidin sensitivity of your cell line by performing a kill curve Use the minimum Blasticidin concentration required to kill your untransduced cell line Non specific off target gene knockdown observed Target sequence contains strong homology to other genes Select a different target region No gene knockdown observed when cells are transduced with the pLenti6 GW U6 lamin control lentivirus Used a cell line that does not express the lamin A C gene Use a cell line that expresses the lamin A C gene e g A549 HeLa HEK 293 HT1080 COS 7 Used a cell line that expresses the lamin A C gene but does not share 100 homology with the shRNA sequence Use a human cell line that expresses the lamin A C gene e g A549 HeLa HEK 293 HT1080 or use COS 7 cells Note The pLenti6 GW U6 lamin 4 control expresses an shRNA targeted to the human lamin A C gene If you are using a non human cell line the lamin A C gene may contain a polymorphism in the target region that renders the shRNA inactive 41 Recipes LB Luria Bertani Medium LB Plates Containing A
91. tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS Certificate of Analysis Limited Warranty 55 Safety Data Sheets SDSs are available on our website at www invitrogen com sds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to
92. th a Conditional Packaging System J Virol 72 8463 8471 Dykxhoorn D M Novina C D and Sharp P A 2003 Killing the Messenger Short RNAs that Silence Gene Expression Nat Rev Mol Cell Biol 4 457 467 Elbashir S M Harborth J Lendeckel W Yalcin A Weber K and Tuschl T 2001 Duplexes of 21 Nucleotide RNAs Mediate RNA Interference in Cultured Mammalian Cells Nature 411 494 498 Continued on next page 61 References Continued Emi N Friedmann T and Yee J K 1991 Pseudotype Formation of Murine Leukemia Virus with the G Protein of Vesicular Stomatitis Virus J Virol 65 1202 1207 Fisher D Z Chaudhary N and Blobel G 1986 cDNA Sequencing of Nuclear Lamins A and C Reveals Primary and Secondary Structural Homology to Intermediate Filament Proteins Proc Natl Acad Sci USA 83 6450 6454 Gorman C M Merlino G T Willingham M C Pastan I and Howard B H 1982 The Rous Sarcoma Virus Long Terminal Repeat is a Strong Promoter When Introduced into a Variety of Eukaryotic Cells by DNA mediated Transfection Proc Natl Acad Sci USA 79 6777 6781 Grishok A Pasquinelli A E Conte D Li N Parrish S Ha I Baillie D L Fire A Ruvkun G and Mello C C 2001 Genes and Mechanisms Related to RNA Interference Regulate Expression of the Small Temporal RNAs That Control C elegans Developmental Timing Cell 106 23 34 Hammond S M Bernstein E Beach D
93. the 293FT Cell Line manual This manual is supplied with the BLOCK iT Lentiviral RNAi Expression System but is also available at www invitrogen com or by calling Technical Support see page 55 Note The 293FT Cell Line is also available separately see page 54 The health of your 293FT cells at the time of transfection has a critical effect on the success of lentivirus production Use of unhealthy cells can negatively affect the transfection efficiency resulting in production of a low titer lentiviral stock For optimal lentivirus production i e producing lentiviral stocks with the expected titers follow the guidelines below to culture 293FT cells before use in transfection e Make sure that cells are greater than 90 viable e Subculture and maintain cells as recommended in the 293FT Cell Line manual Do not allow cells to overgrow before passaging e Use cells that have been subcultured for less than 20 passages The pLP1 pLP2 pLP VSVG plasmids are provided in an optimized mixture to facilitate viral packaging of your pLenti6 BLOCK iT DEST expression vector following cotransfection into 293FT producer cells The amount of the packaging mix 195 ug and Lipofectamine 2000 Reagent 0 75 mL supplied in the BLOCK iT Lentiviral RNAi Expression System is sufficient to perform 20 cotransfections in 10 cm plates using the recommended protocol on page 24 Note ViraPower Packaging Mix is available separately or as
94. tion and the pLenti6 BLOCK iT DEST vector If you want to include a negative control set Reaction up a separate reaction but omit the Gateway LR Clonase II enzyme mix 1 Add the following components to 0 5 mL microcentrifuge tubes at room temperature and mix Component Sample Positive Control Entry clone 50 150 ng reaction 1 7 uL pENTR gus 50 ng uL 2 pL pLenti6 BLOCK iT DEST vector 150 ng L 1 pL 1 pL TE Buffer pH 8 0 to 8 uL 5 uL 2 Remove the Gateway LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes 3 Vortex the Gateway LR Clonase II enzyme mix briefly twice 2 seconds each time 4 To the sample above add 2 uL of Gateway LR Clonase II enzyme mix Mix well by pipetting up and down Reminder Return Gateway LR Clonase II enzyme mix to 20 C immediately after use 5 Incubate the reaction at 25 C for 1 hour Note Extending the incubation time to 18 hours typically yields more colonies 6 Add 1 pL Proteinase K 2 ug nuL to each reaction Incubate for 10 minutes at 37 C 7 Proceed to Transforming One Shot Stb13 Competent E coli next page Note You may store the LR reaction at 20 C for up to 1 week before transformation 17 Transforming One Shot StbI3 Competent E coli Introduction Materials Needed One Shot StbI3 Transformation Procedure Follow the instructions in this section to transform the LR recombination reaction int
95. to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product
96. to produce a lentiviral construct 4 Transduce the lentiviral construct into mammalian cells to express the shRNA of interest Select for stably transduced cells if desired For detailed information about the Gateway Technology refer to the Gateway Technology with Clonase II manual which is available at www invitrogen com or by contacting Technical Support see page 55 Continued on next page System Summary Continued Purpose of this Manual Note Important Where to Go For More Information TM This manual provides an overview of the BLOCK iT Lentiviral RNAi Expression System and provides instructions and guidelines to 1 Use the pLenti6 BLOCK iT DEST vector and a pENTR U6 entry clone in an LR recombination reaction to generate an expression clone containing the U6 RNAi cassette of interest 2 Co transfect the pLenti6 BLOCK iT DEST expression construct and the ViraPower Packaging Mix into the 293FT Cell Line to produce a lentiviral stock 3 Titer the lentiviral stock 4 Transduce the lentiviral construct into mammalian cells and perform transient RNAi analysis or 5 Generate a stably transduced cell line if desired For details and instructions to generate a pPENTR U6 entry clone containing the U6 RNAi cassette refer to the BLOCK iT U6 RNAi Entry Vector Kit manual For instructions to culture and maintain the 293FT producer cell line refer to the 293FT Cell Line manual Both of the
97. ucleus Lewis amp Emerman 1994 Naldini 1999 and stably integrated into the host genome Buchschacher amp Wong Staal 2000 Luciw 1996 Following integration into the genome the shRNA of interest is constitutively expressed allowing you to perform transient RNAi analysis or use Blasticidin selection to generate a stable cell line for long term knockdown studies Continued on next page The BLOCK iT Lentiviral RNAi Expression System Continued VSV Envelope Glycoprotein pLenti6 GW U6 lamin P Control Note Most retroviral vectors are limited in their usefulness as delivery vehicles by their restricted tropism and generally low titers In the BLOCK iT Lentiviral RNAi Expression System this limitation has been overcome by use of the G glycoprotein gene from Vesicular Stomatitis Virus VSV G as a pseudotyping envelope thus allowing production of a high titer lentivirus with a significantly broadened host cell range Burns et al 1993 Emi et al 1991 Yee et al 1994 The BLOCK iT Lentiviral RNAi Kits also include the pLenti6 GW U6 lamin FN plasmid for use as a positive control for lentivirus production Once generated the control lentiviral construct may be transduced into certain mammalian cell lines see Note below where it expresses an shRNA targeted to the human lamin A C gene Fisher et al 1986 Lin amp Worman 1993 Lamin A C isa structural component of the nuclear envelope and has been s
98. ve control vector in your cotransfection experiment to generate a control lentiviral stock Once generated the control lentivirus may be transduced into certain mammalian cell lines see Note on page 5 to express an shRNA targeted to the human lamin A C gene and may be used as a control for the RNAi response in these cell lines Continued on next page 22 Producing Lentivirus in 293FT Cells Continued Recommended Transfection Conditions S MENO O O E 23 Nous We produce lentiviral stocks in 293FT cells using the optimized transfection conditions shown below The amount of lentivirus produced using these recommended conditions at a titer of 1 x 10 to 1x 10 transducing units TU mL is generally sufficient to transduce 1x 10 to 1x 10 cells at a multiplicity of infection MOD 1 Condition Amount Tissue culture plate size 10 cm one per lentiviral construct Number of 293FT cells to transfect 6 x 10 cells see Recommendation on page 21 to prepare cells for transfection Amount of ViraPower Packaging Mix 9 pg 9 uL of 1 ug pL stock Amount of pLenti6 BLOCK iT DEST 3 pg expression plasmid Amount of Lipofectamine 2000 Reagent 36 uL to use Note You may produce lentiviral stocks using other tissue culture formats but keep in mind that optimization will be necessary to obtain the expected titers The recommended procedure to co transfect 2
99. ved but gt 80 is possible with optimized conditions For an example of results obtained from RNAi experiments using the pLenti6 GW U6 lamin lentiviral construct see the next page If you perform RNAi analysis using the pLenti GW U6 lamin control lentiviral stock you may assay for lamin A C expression and knockdown using Western blot We use an Anti Lamin A C Antibody BD Biosciences Cat no 612162 to detect lamin A C expression 34 Examples of Expected Results Introduction Example 1 Knockdown of Lamin A C in HeLa Cells This section provides examples of results obtained from two RNAi experiments performed using the pLenti6 GW U6 lamin control lentiviral construct In this experiment double stranded oligonucleotides targeting the endogenous lamin A C gene and the luciferase reporter gene were generated and cloned into pENTR U6 using the BLOCK iT U6 RNAi Entry Vector Kit The U6 lamin and U6 luciferase U6 luc RNAi cassettes were transferred into the pLenti6 BLOCK iT DEST vector using the LR recombination reaction to generate the pLenti6 GW U6 lamin and pLenti6 GW U6 luc expression constructs Lentiviral stocks were generated and titered in HT1080 cells following the protocols in this manual see pages 20 29 HeLa cells plated in a 12 well plate were transduced with each lentiviral construct at an MOI of 100 Cell lysates were prepared from one set of wells 48 hours
100. with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 email outlicensing invitrogen com Continued on next page 56 Purchaser Notification Continued Limited Use Label License No 23 GUS control vector Limited Use Label License No 27 RNA Transfection Limited Use Label License No 51 Blasticidin and the Blasticidin Selection Marker Limited Use Label License No 54 ULB ccdB Selection Technology Limited Use Label License No 108 Lentiviral Technology 57 The GUS positive control vector in these products is claimed in patents and patent applications See U S Patent No 5 599 670 and Great Britain Patent No 2 197 653 licensed to Invitrogen by Cambia Biosystems L L C CBL Use of the GUS gene is restricted to use as a positive control Any other use may require a license from CBL Use of this product in conjunction with methods for the introduction of RNA molecules into cells may require licenses to one or more patents or patent applications Users of these products should determine if any licenses are required Blasticidin and the blasticidin resistance gene bsd are the subject of U S Patent No 5 527 701 sold under patent license for research purposes only For information on purchasing a license
101. y b Inaseparate sterile 5 mL tube mix Lipofectamine 2000 gently before use then dilute 36 uL in 1 5 mL of Opti MEM I Medium without serum Mix gently and incubate for 5 minutes at room temperature c After the 5 minute incubation combine the diluted DNA with the diluted Lipofectamine 2000 Mix gently d Incubate for 20 minutes at room temperature to allow the DNA Lipofectamine 2000 complexes to form The solution may appear cloudy but this will not impede the transfection 2 While DNA lipid complexes are forming trypsinize and count the 293FT cells Resuspend the cells at a density of 1 2 x 106 cells mL in growth medium containing serum or Opti MEM I Medium containing serum 3 Add the DNA Lipofectamine 2000 complexes to a 10 cm tissue culture plate containing 5 mL of growth medium containing serum or Opti MEM I Medium containing serum Do not add antibiotics to the medium 4 Add5mL of the 293FT cell suspension 6 x 106 total cells to the plate containing media and DNA Lipofectamine 2000 complexes and mix gently by rocking the plate back and forth Incubate the cells overnight at 37 C in a CO incubator 5 The next day remove the media containing the DNA Lipofectamine 2000 complexes and replace with complete culture medium containing sodium pyruvate see page 20 Note Expression of the VSV G glycoprotein causes 293FT cells to fuse resulting in the appearance of multinucleated syncitia This morphological

The BLOCK-iT - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents