Expresso Solubility and Expression Screening System
Contents
1. Reagent Positive Negative Transformation Control Control Control pSol Vector 12 5ng uL 2 uL 2uL n a GH1 Control Insert 1 ul n a n a pUC19 provided with cells n a n a 1 ul 3 4 Expected Results e Cloning Reactions step 3 2 and the optional Positive Control reactions typically yield gt 50 colonies per 100 uL plated e Negative Control vector only reactions typically yield 10 colonies per 100 uL plated e Transformation Control should yield gt 1 x 10 colonies per ug plasmid 3 5 Increasing Number of Recombinants Certain genes can prove difficult to clone due to a large size toxic gene products secondary structures extremely biased base composition or other unknown reasons If necessary the entire 1 mL transformation culture from step 3 2 can be pelleted in a microcentrifuge 10 000 rpm 30 seconds resuspended in 100 uL of recovery media and plated See Appendix E Cloning Troubleshooting Guide for additional troubleshooting information MA158 Rev B Expresso Solubility and Expression Screening System 4 Colony PCR Screening for Recombinants Colonies are selected at random and screened for inserts by colony PCR using the pRham Forward and pETite Reverse primers which are included with the kit Colony PCR may also be performed using screening primers that are specific to the gene of interest e g pRham Forward and the gene specific reverse primer from step 1 1 The instruction2. MA158 Rev B 27 Expresso Solubility and Expression Screening System Appendix G Characteristics of Fusion Tags in the pSol Vector Suite 4 Fusion Tag AA Length kDa p Description Reference number 1 6xHis AFV 113 13 5 5 0 hypothetical protein from 12 Acidianus filamentous virus 1 2 6xHis SlyD 210 22 7 5 2 FKBP type peptidyl prolyl 13 cis trans isomerase 3 6xHis Tsf 297 32 2 5 7 E coli elongation factor 14 4 6xHis SUMO 115 13 3 5 2 Small Ubiquitin like 15 Modifier 5 6xHis Bla 381 41 3 4 4 Beta lactamase 16 6 6xHis MBP 382 42 1 5 5 Maltose Binding Protein 17 7 6xHis GST 233 27 4 6 6 Glutathione S transferase 18 8 6xHis Control 14 1 8 7 0 Affinity tag n a Molecular weights listed are all based on tag composition Some tags e g SUMO and Bla frequently display anomalous migrations on SDS PAGE MA158 Rev B 28 Expresso Solubility and Expression Screening System Notice of Limited Label License Copyright Patents Warranties Disclaimers and Trademarks Lucigen s products are sold for research use only and are not to be used in humans or for medical diagnostics Lucigen s liability with respect to any Expresso product is limited to the replacement of the product No other warranties of any kind expressed or implied including without limitation any implied fitness for any particular use are provided by Lucigen Lucigen is not liable for any direct indir
3. Appendix F Expression Purification Troubleshooting Guide Problem Probable Cause Solution Low recovery of recombinant protein Recombinant protein not overexpressed Check lysate by SDS PAGE and or western blot to confirm overexpression of recombinant protein The Expresso Solubility and Expression Screening System includes E cloni 10G Chemically Competent Cells for both cloning and protein expression If desired the confirmed pSol construct may be transferred to various other cell strains for expression of the target protein His tag not present Recombinant proteins may be cleaved by endogenous proteases during expression or lysate preparation Use protease inhibitors to prevent cleavage SelecTEV protease is resistant to most protease inhibitors including cOmplete protease inhibitor cocktail Roche Check lysate and column flow through by SDS PAGE and western blot to confirm 6xHis tag is attached to the overexpressed protein of the expected molecular weight Recombinant protein expressed in inclusion bodies Lyse induced bacteria directly in an SDS PAGE loading buffer and check for expression by SDS PAGE and or western blot Compare these results to SDS PAGE and or western blot assays of cleared lysate During induction incubate culture at a lower temperature e g 20 C to 30 C to obtain more soluble recombinant protein Test induction with lower concentrations of rhamnose
4. date of shipment Please avoid using reagents after one year from date of receipt Product Designations The Expresso Solubility and Expression Screening System contains the pre processed Expresso pSol Vector suite E cloni 10G Chemically Competent Cells for cloning and protein expression a cloning control insert PCR primers for clone verification recovery medium for transformation and solutions of L Rhamnose and D Glucose for small scale induction of protein expression The kit can also be purchased with SelecTEV Protease for fusion protein cleavage and or Accura High Fidelity Polymerase to amplify your gene of interest The system catalog numbers are listed below Expresso Solubility and Expression Screening System Product Description Catalog number Part Number s Expresso Solubility and Expression Screening 24 reactions 49060 1 A943302 1 System A96352 2 Expresso Solubility and Expression Screening 24 reactions 49062 1 A943302 1 System SelecTEV Protease A96352 2 A933167 1 Expresso Solubility and Expression Screening 24 reactions 49064 1 A943302 1 System Accura High Fidelity Polymerase A96352 2 A932528 0 Expresso Solubility and Expression Screening 24 reactions 49066 1 A943302 1 System SelecTEV Protease and Accura A96352 2 High Fidelity Polymerase A933167 1 A932528 0 Components amp Storage Conditions The Expresso Solubility and Expression Screening System may consist of up to four separate packa
5. 10 uL 15 D glucose Inoculate the medium with an uninduced E cloni 10G culture containing a verified pSol construct Shake at 220 250 rpm at 372C for 4 16 hours 7 Evaluation of Target Protein Expression and Solubility 7 1 Harvest normalized amounts of the induced cultures Note The volumes listed below are convenient for those with access to a sonicator equipped with a microtip It may be necessary to adjust culture and fraction volumes when using other equipment e Collect a 100 uL aliquot of each induced culture and mix with 900 ul of LB Miller media e Measure the ODeoo of the diluted samples MA158 Rev B e Expresso Solubility and Expression Screening System Based on the corrected cell density calculate the volume of 10 ODgoo unit equivalents 1 ODgoo equivalent 1 mL of culture at ODgos 1 Example If the ODgoo of the diluted culture 0 45 Then the corrected cell density 4 5 ODgos units And 10 ODs units 2 22 ml 10 ODgoo equivalents 4 5 ODeoo ml 2 22 ml Harvest 10 ODgoo units of each induced culture by centrifugation e g 12 000 x g for 1 minute e Resuspend the cell pellets in 1 mL lysis buffer e g 50 mM NaH PO 300 mM NaCl pH 8 0 The sample will conatin 10 ODgoo equivalents per mL e Proceed with lysis immediately or freeze samples 7 2 Lyse Cells by Sonication 7 3 Note Other physical lysis methods may be used Sonication is recommended because it is amenabl
6. 6xHis tagged proteins Cleavage of Fusion Tag with SelecTEV Protease e Incubate the reaction at 30 C for at least 1 hour Incubation at lower temperatures can be performed but reaction time will need to be increased e 9Cleavage of Fusion Tag with SelecTEV Protease Removal of SelecTEV Protease and Solubility Tag e Bind the SelecTEV Protease digest reaction to an IMAC resin e Collect the Flow Through containing the untagged protein of interest e The Histidine tagged SelecTEV Protease and Histidine tagged pSol partner will bind to such resins e 10 Removing SelecTEV Protease after Cleavage MA158 Rev B Expresso Solubility and Expression Screening System System Details The Expresso Solubility and Expression Screening System uses Expressioneering Technology for rapid cloning and expression of solubility tagged fusion proteins in E coli Expressioneering is an in vivo recombinational cloning strategy whereby PCR products can be cloned instantly with no enzymatic treatment Figure 1 The target gene is PCR amplified mixed with the pSol vector s and transformed directly into chemically competent cells Recombination within the host cells seamlessly joins the insert to the vector Though several solubility tags are available from a variety of vendors choosing the best tag for a given target protein can only be determined empirically An important feature of this system is the standar
7. Sov rede ete 9 Protein PHUATCOLOM iie i FUN USA ARG A aR aE aa 9 Sele TEV IIR 10 uci 11 L Preparation of Insert DNA iiie te te in AAAA 11 2 Enzyme free Cloning with the pSol Vectors esee enne ener enhn nenne 13 3 Heat Shock Transformation of E cloni amp 10G Chemically Competent Cells 13 4 Colony PCR Screening for Recombinants sesinin 15 J DNA Purification and Sequencing erener TA 16 6 INnduCtION Of Protein EXprFeSSlOYL icis decet mua eg Ar PARTE ENNEN EENE ANEO 16 7 Evaluation of Target Protein Expression and Solubility eene 17 6 Affinity Purification of 6xHis tagged proteins eese eene nnne nnne 19 9 Cleavage of Fusion Tag with SelecTEV Protease eese 19 10 Removing SelecTEV Protease after Cleavage esses eese teen enne nennen 19 11 Selec TEV Cleavage During Dialysis esee esent nennen nennen enne eterne 20 Control r 21 y nn 21 Appendix A Media Recipes eerie eese eerte eren seen eene tns etate tas etas etate tse ta setas etse tese ts etse to sets etse ese tes senses 23 Appendix B Internal sequencing Primers 4 eerie eee eese eese ee etes etse ts essetis etse tasses stans tasses stes tosstnsts 23 A
8. from rhaPgap This regulatory cascade makes transcription from rhaPgap responsive to variable concentrations of rhamnose allowing tunable control of the target gene expression 3 For proteins that are potentially toxic to the host cells or that are difficult to express in soluble form this tuning capability enables adjustment of expression levels for optimal yield of soluble protein Transcription from the rhaPgap promoter is also subject to catabolite repression In the presence of glucose transcription from rhaPgap remains inactive even when rhamnose is available This repression allows the use of autoinduction procedures for protein expression in which cells are inoculated directly into medium containing rhamnose and a small amount of glucose 4 5 While glucose is present the cells grow without expression from the rhaPgap promoter Expression of the protein of interest occurs only late in the culture when the glucose is exhausted MA158 Rev B Expresso Solubility and Expression Screening System The pSol Vector Suite The pSol Vector Suite is based on Lucigen s patented pSMART vectors which feature transcriptional terminators to prevent unwanted transcription into or out of the cloned sequence The small size of the pSol Vector backbone facilitates cloning of large inserts and performing DNA manipulations such as site directed mutagenesis The pSol Vectors are supplied pre linearized for instant directional insertion of target
9. the protein fusion that produces the greatest proportion of protein in the soluble fraction for scale up and affinity purification 18 MA158 Rev B Expresso Solubility and Expression Screening System 8 10 Affinity Purification of 6xHis tagged proteins The fusion proteins expressed using pSol vectors contain an N terminal 6xHis tag Therefore the fusion protein containing the solubility tag and the protein of interest can be purified using an IMAC resin Many protocols are available for purification of 6xHis tagged proteins under native or denaturing conditions For best results follow the procedures recommended by the manufacturer of the IMAC resin Due to variations in target protein physical properties you may need to empirically determine the amount of resin needed for purification of your fusion protein Cleavage of Fusion Tag with SelecTEV Protease A TEV recognition site is located between the fusion tag and the protein of interest SelecTEV Protease recognizes the seven amino acid sequence Glu Asn Leu Tyr Phe GlIn Gly and cleaves between Gln and Gly with high specificity 9 11 Cleavage by the SelecTEV Protease is optimal in SelecTEV Buffer at 30 C but SelecTEV Protease is active between 4 30 C and pH 6 0 8 5 Optimization of the cleavage conditions may be necessary depending on the protein of interest An example of a SelecTEV Protease cleavage protocol is shown below e Set up the SelecTEV Se
10. Ne Lucigen Simplifying Genomics Expresso Solubility and Expression Screening System Note Two different storage temperatures required Vectors Protease Polymerase Competent Cells IMPORTANT IMPORTANT 20 C Storage Required 80 C Storage Required Immediately Upon Receipt Immediately Upon Receipt FOR RESEARCH USE ONLY NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St Middleton WI 53562 USA Toll Free 888 575 9695 608 831 9011 FAX 608 831 9012 lucigen lucigen com www lucigen com MA158 Rev B Expresso Solubility and Expression Screening System Table of Contents TECHNICAL SUPP OM RR 3 Product ITSCACU COL RR 3 5 Special Materials and Equipment Needed 1 eee ee eee esee esee eee ee stent east en stans tanen stas tasses stas tuas 5 nnn 6 System Details em T 7 TED SOL Vector ullesic esteso obe eaedem en tanec 8 E cloni 10G Chemically Competent Cells eese eese eene netten ANORA 8 Cloning E OY E E A E aa is E A ea aaa a atte a ene 9 pSoL His CofitrolVectOE s RR an ie Waa ins WAL ana RAN RI RAT na ea a ens ea eae 9 GET Gv EDIT ER 9 Colony SCLECNING PM 9 Protein EXPTOSSION sisson se rotto p th ase naa reeds ate ne cada ayn bowie eked
11. Reaction Buffer 10X 600 uL F882521 1 Betaine 5M 1 0 mL F881901 1 Package 4 E cloni 10G Chemically Competent Cells Store at 80 C Component 24 Reaction Kit Part E cloni 10G Chemically Competent Cells 24 X 40 uL F96419 Transformation Control pUC19 DNA 10 pg uL 20 uL F92078 1 Recovery Medium Store at 20 C or 80 C 2X12 mL F98226 1 Competent cells will thaw if stored at 20 C and should be discarded MA158 Rev B Expresso Solubility and Expression Screening System Introduction The Expresso Solubility Screening System enables rapid cloning and expression of a protein of interest fused to a diverse panel of powerful and cleavable fusion tags This system includes one unique and six literature validated fusion tags engineered into a suite of cloning ready pSol vectors for rapid evaluation Expressioneering technology allows a single PCR amplicon to be cloned directly into all of the pSol expression vectors without restriction enzymes ligase or DNA purification Each vector contains the rhaPgap promoter for stable cloning and strong tunable expression within a single host strain The vectors also encode a 6xHis tag on the N terminus of each fusion tag to facilitate affinity column purification The fusion tags can be easily cleaved from the protein of interest using the TEV Protease cleavage site located between the N terminal fusion tag and the protein of interest The Express
12. binant plasmids are constructed in the E cloni 10G host strain and expressed in the same host After clones have been verified by colony PCR individual colonies are grown in liquid culture and protein expression is induced by addition of rhamnose Expression of Sol tagged fusion proteins is evaluated by SDS PAGE analysis Protein Purification Materials for protein purification are not provided with the Expresso Solubility and Expression Screening System However 6xHis tagged proteins produced with this system may be purified by Immobilized Metal Affinity Chromatography IMAC Various IMAC reagents are available from a number of vendors Follow the resin manufacturer s guidelines for purification MA158 Rev B Expresso Solubility and Expression Screening System SelecTEV Protease The Expresso Solubility and Expression Screening System may be purchased with SelecTEV Protease See Product Designations on pg 3 for ordering information SelecTEV Protease is an enhanced form of Tobacco Etch Virus TEV protease that is highly site specific more active and more stable than native TEV protease SelecTEV Protease recognizes the seven amino acid sequence Glu Asn Leu Tyr Phe Gln Gly and cleaves between Gln and Gly with high specificity The protease can be used to cleave the N His Sol tag from the protein of interest SelecTEV Protease has an amino terminal 6xHis tag Following cleavage of a target protein the protease can be removed f
13. dized design of the pSol vectors which allows a single PCR product to be cloned and tested in all 8 vectors in parallel for selection of the best tag for a given target protein Expressioneering Technology Enzyme free directional PCR cloning in seconds ur 4 Target Gene C a E Your PCR Product with Expresso Expresso i Complementary Ends Vector Cells Transform Figure 1 Expressioneering Technology A PCR product that contains short homology to the ends of the pSol Expresso vectors is mixed with any of the pre processed vectors and transformed directly into the chemically competent cells provided Expression of the fusion protein in the pSol vectors is under control of the rhaPgap promoter which is inducible by L rhamnose This promoter is recognized by the E coli RNA polymerase therefore a single host strain can be used for both clone construction and protein expression This single host strategy allows a much more streamlined workflow than systems requiring separate hosts for cloning and expression The rhaPgap promoter is tightly controlled for protein expression In the absence of rhamnose the transcriptional activity of rhaPgap is very low allowing stable clone construction even for potentially toxic gene products 1 Transcription is positively controlled by two activators RhaR and RhaS which bind rhamnose 2 RhaR activates its own transcription as well as that of RhaS which in turn activates transcription
14. e e Gel purification of the PCR product prior to Expresso cloning e Dpnltreatment of the PCR product prior to Expresso cloning For best results purify PCR product following Dpnl treatment e Linearization of template by restriction digest Purify linear template prior to amplification by PCR Enzyme free Cloning with the pSol Vectors Following PCR product verification by agarose gel electrophoresis the PCR product 1 3 uL or 25 100 ng is mixed with 25 ng of pSol Vector and transformed directly into competent E cloni 10G cells To ensure optimal cloning results we strongly recommend the use of Lucigen s E cloni 10G Chemically Competent Cells which are included with the kit Proceed to Step 3 to perform the transformation Heat Shock Transformation of E cloni 10G Chemically Competent Cells E cloni 10G Chemically Competent Cells are provided in 40 uL aliquots sufficient for a single transformation Transformation is performed by incubation on ice followed by heat shock at 42 C Note For maximal transformation efficiency the heat shock is performed in 15 mL disposable polypropylene culture tubes 17 x 100 mm The use of other types of tubes may dramatically reduce the transformation efficiency 3 1 Preparation for Transformation e Bring the Recovery Medium to room temperature e Pre chill a 15 mL disposable polypropylene culture tube 17 x 100 mm on ice for each transformation e Thaw the E cloni 10G cells comple
15. e to small sample size Use of detergent containing lysis buffers is not recommended Lyse cells thoroughly by sonication on ice Refer to the sonicator manual for recommended settings Do not allow heat to build up and avoid frothing Transfer 400 ul of the lysate to a fresh tube and store on ice This fraction will be used to assess the Total amount of protein in the cell lysate Transfer a second 400 ul aliquot of lysate to a fresh tube and centrifuge at 15 000 x g for 15 minutes at 4 C Transfer the supernatant to a fresh tube and store on ice This fraction will be used to assess the Soluble protein in the cell lysate Add 400 ul of 2x SDS Sample Buffer to the Pellet This fraction will be used to assess the Insoluble protein in the cell lysate Care should be taken to fully resuspend this pellet SDS PAGE Analysis Dilute the Total Soluble and Insoluble fractions 1 1 with 2x SDS Sample Buffer Heat gel samples to 95 C for 5 minutes Load 0 05 ODgo units each of the Total Soluble and Insoluble fractions into the wells of a SDS PAGE gel Note The use of 4 20 polyacrylamide gels fitted with 15 well combs facilitates the workflow Pre poured gels of this type are available from several vendors Lucigen recommends loading 0 05 OD units e g 10 uL of each sample diluted 1 1 with 2x SDS Sample Buffer per lane of a 15 well polyacrylamide gel Include standards to estimate molecular weight of the recombinant protein Choose
16. ect incidental or consequential damages arising out of or in connection with the use or inability to use any of its Expresso products Limited Label License This product is the subject of U S Patent 46 709 861 and additional patent applications owned by Lucigen Corporation are pending The consideration paid for this product grants a Limited License to use the product pursuant to the terms set forth in this Limited Label License Academic Not for Profit and For Profit institutions acquire certain limited nontransferable rights with the purchase of this product see below The purchase price of this product includes limited nontransferable rights to use only the purchased amount of the product This limited license specifically excludes manufacture of the pSol vectors or derivatives thereof Lucigen Corporation reserves all other rights in particular the purchaser of this product may not transfer or otherwise sell this product or its components or derivatives to a third party and no rights are conveyed to the purchaser to use the product or its components or derivatives for commercial purposes Commercial purposes includes any activity for which a party receives consideration and may include but is not limited to 1 use of the product or its components or derivatives in manufacturing 2 use of the product or its components or derivatives for diagnostic purposes 3 transfer or sale of vectors made with the product or components or derivat
17. genes using Expressioneering Technology Figures 1 3 The vectors contain all signals for expression which include the rhaPgap promoter an efficient ribosome binding site from the T7 gene 10 leader and translational start and stop codons Each vector is designed for expression of the target protein as a fusion with an amino terminal 6xHis Sol tag In addition all of the tags in the kit are positioned for precise removal by TEV protease to produce target protein of nearly native sequence The single PCR product produced is suitable for cloning into all 8 of the pSol Vectors Figure 2 The pSol vectors do not contain the acZ alpha gene fragment so they do not enable blue white colony screening However the background of empty vector is typically 596 so minimal colony screening is necessary pSOL Expression Vectors TARGET GENE firey L d RBS ATG GIGS arme e gt RBS ATG Gro Ro m a o RBS Ribosome Binding Site 9 e o e ATG Translation Start Site gt RBS ATG GEESE nme HIS 6xHis Ta RBS ATG story T I wee e GY Fusion Tags PENNE n SelecTEV Protease eo m Kan Kanamycin Resistance Gene Expresso ROP Repressor of Priming Vector for low copy number o Ori Origin of Replication Terminator Figure 2 pSol Expression Vectors E cloni 10G Chemically Competent Cells E cloni 10G Chemically Competent Cells are an E coli strain optimized for high efficiency transformat
18. ges depending on catalog number ordered MA158 Rev B Expresso Solubility and Expression Screening System Package 1 2 and 3 Must be stored at 20 C Package 4 containing Competent Cells Must be stored at 80 C 15 C max 25 C min 80 C min 70 C max Package 1 Expresso Solubility and Expression Screening Suite Store at 20 C Component Concentration Volume Part Expresso pSol Vectors 3 reactions each 12 5 ng uL 6 uL 1 pSol AFV F843211 1 2 pSol SIyD F843212 1 3 pSol Tsf F843213 1 4 pSol SUMO F843214 1 5 pSol Bla F843215 1 6 pSol MBP F843216 1 7 pSol GST F843217 1 8 pSol His Control F843218 1 GH1 Control Insert Positive Control 50 ng uL 10 uL F823219 1 Primers for PCR screening and sequencing pRham Forward Primer 50 pmol uL 100 uL F81887 1 pETite Reverse Primer 50 pmol uL 100 uL F91710 1 Rhamnose Solution 2096 w v 1 25 mL F88889 1 Glucose Solution 1596 w v 1 25 mL F88890 1 Package 2 SelecTEV Protease Store at 20 C Component Concentration Amount Part SelecTEV Protease 1000 Units 10 U uL 100 uL F833167 SelecTEV 20X Buffer 20X 1 0 mL F883093 1 DTT 100 mM 500 uL F853091 1 Package 3 Accura High Fidelity Polymerase Store at 20 C Component Concentration Amount Part Accura High Fidelity Polymerase 2 U uL 25U F832528 0 Accura 2XHF Reaction Buffer 2X 1 25 mL F882522 1 Accura 10X GC
19. he insert with the vector as well as the predicted coding sequence pRham Forward and pETite Reverse primers provided with the kit may be used for sequencing See Appendix D Vector Map and Sequencing Primers for the sequence and orientation of these primers Depending on the size of the fusion tag sequencing primers specific to each fusion tag will be required in order to obtain sequencing data for the junction between the fusion tag and protein of interest See Appendix B for information on tag specific primers 5 4 Preparation of Glycerol Stocks optional If archiving clones for future use mix an aliquot of the overnight culture leftover from step 5 1 with an equal volume of sterile 50 glycerol in a cryovial Mix well and store at 70 6 Induction of Protein Expression 6 1 Induction of Protein Expression Induction may be performed using a standard induction protocol step 6 1 1 or an autoinduction protocol step 6 1 2 Regardless of the method of induction Lucigen recommends performing small scale expression trials 2 to 50 mL to evaluate expression and solubility of the target protein before scaling up for purification Small scale studies are also recommended when optimizing expression conditions e g growth temperature duration of induction titration of Rhamnose concentration etc MA158 Rev B Expresso Solubility and Expression Screening System 6 1 1 Standard Induction Protocol Use 30 ul of culture leftover fr
20. in studies of the Escherichia coli phosphate regulon J Bacteriol 180 1277 Egan S M and Schleif R F 1993 A regulatory cascade in the induction of rhaBAD J Mol Biol 234 87 Giacalone M J Gentile A M Lovitt B T Berkley N L Gunderson C W and Surber M W 2006 Toxic Protein Expression in Escherichia coli using a rhamnose based tightly regulated and tunable promoter system Biotechniques 40 355 Wegerer A Sun T and Altenbuchner J 2008 Optimization of an E coli L rhamnose inducible expression vector test of various genetic module combinations BMC Biotechnol 8 2 Grossman T H Kawasaki E S Punreddy S R and Osburne M S 1998 Spontaneous cAMP dependent deprepression of gene expression in stationary phase plays a role in recombinant expression instability Gene 209 95 Bubeck P Winkler M and Bautsch W 1993 Rapid cloning by homologous recombination in vivo Nuc Acids Res 21 3601 Klock H E Koesema E J Knuth M W and Lesley S A 2008 Combining the polymerase incomplete primer extension method for cloning and mutagenesis with microscreening to accelerate structural genomics efforts Proteins 71 982 21 MA158 Rev B Expresso Solubility and Expression Screening System 10 11 12 13 14 15 16 17 18 Sambrook J and Russell D W 2001 Molecular Cloning A Laboratory Manual Third Edition Cold Spring Harbor Laboratory Press Cold S
21. ion The E cloni 10G cells are ideal for cloning and propagation of plasmid clones and give high yield and high quality plasmid DNA due to the endA1 and recA1 mutations The 10G cell strain is also well suited for protein expression with pSol expression plasmids This system eliminates the need to shuttle vectors into a separate strain for protein expression If desired confirmed pSol constructs may be transferred to other strains for protein expression MA158 Rev B Expresso Solubility and Expression Screening System E cloni 10G Genotype F mcrA A mrr hsdRMS mcrBC endA1 recA1 80dlacZAM15 AlacX74 araD139 A ara leu 7697galU galK rpsL nupG A tonA StrR E cloni 10G Chemically Competent Cells produce 2 1 x 10 cfu ug supercoiled pUC19 DNA As a control for transformation E cloni 10G Competent Cells are provided with supercoiled pUC19 DNA at a concentration of 10 pg uL Use 1 uL 10 pg for transformation Select pUC19 transformants on plates containing Ampicillin or Carbenicillin 100 ug mL Cloning Strategy The pSol vectors are provided in a linearized form ready for co transformation with a PCR product containing the gene of interest The coding sequence is amplified with user supplied primers that include 18 nucleotides of overlap with the ends of the vector The forward primer contains sequence corresponding to the TEV cleavage recognition site and the reverse primer includes stop codons and vector sequence Recombination bet
22. ives of the product 4 use of this product or materials made therefrom to provide a service information or data e g DNA sequence to a third party in return for a fee or other consideration or 5 resale of the product or its components or derivatives whether or not such product or its components or derivatives are resold for use in research Academic Not for Profit and For Profit institutions must obtain a separate license from Lucigen Corporation to use this product for any purpose other than those permitted above It is the sole responsibility of the buyer to ensure that use of the product does not infringe that patent rights of third parties The 6xHis tag is licensed from Hoffmann La Roche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for the use in research Information about licenses for commercial use is available from QIAGEN GmbH QIAGEN Strasse 1 D 40724 Hilden Germany Purification of 6xHis tagged proteins with Ni NTA manufactured by QIAGEN is highly recommended for best performances and to avoid poor purification results If the purchaser is not willing to accept these use limitations Lucigen Corporation is willing to accept return of the product for a full refund For information on obtaining a license contact Lucigen Corporation 2905 Parmenter St Middleton WI 53562 Email Lucigen lucigen com Phone 608 831 9011 Fax 608 831 9012 29 MA158 Rev B
23. o Solubility and Expression Screening System may be purchased with SelecTEV Protease a highly site specific and very active variant of native TEV protease SelecTEV protease and the fusion tags contain N terminal His tags and can be removed from TEV digestion reactions by IMAC a Important Note The Expresso Solubility and Expression Screening System is intended to improve the chance of obtaining soluble and functional protein for research purposes However there will be proteins whose expression and or solubility will not improve upon using this kit For example Lucigen does NOT recommend using this system for GPCRs ion channels and other proteins that are either membrane integrated or associated Special Materials and Equipment Needed The Expresso Solubility and Expression Screening System supplies many of the items needed to efficiently generate and express recombinant clones Less common items that must be supplied by the user include e Custom Primers for target gene amplification e Sterile polypropylene 17 x 100 mm culture tubes e Sonicator equipped with a microtip e Resin and columns for immobilized metal affinity chromatography e SDS PAGE equipment MA158 Rev B Expresso Solubility and Expression Screening System Process Workflow An example of an Expresso Solubility and Expression Screening System workflow is provided below Workflow Step Workflow Details Reference in Detailed Protocol Preparation of e Amplify
24. ocol using Accura High Fidelity Polymerase For a 50 uL reaction assemble the following on ice Volume Component Final concentration or pL Quantity 25 2X HF Reaction Buffer 1X dNTPs 2 5 mM each 200 uM X Forward Primer 1 uM X Reverse Primer 1 uM X Template DNA 100 pg 30 ng plasmid 0 5 Accura High Fidelity Polymerase 2 U uL 1U X Nuclease free HO 50 Total volume Cycle the PCR reaction according to the table below Step Temperature Time 1 Initial Denaturation 94 C 30 seconds 2 Denaturation 94 C 15 seconds 3 Annealing 60 C 15 seconds 4 Extension 72 C 60 sec kb 5 Repeat steps 2 4 20 30 total cycles 6 Final extension 72 C 10 minutes 7 Hold 4 C eo Refer to the Accura High Fidelity Polymerase user manual MA151 for additional PCR guidance http lucigen com docs manuals MA151 Accura High Fidelity Polymerase pdf MA158 Rev B Expresso Solubility and Expression Screening System 2 1 2 2 Analysis of Amplified DNA Confirm the size and quality of the amplified DNA by agarose gel electrophoresis If the reaction yields a single product at a concentration of 10 ng uL or higher you can proceed directly to Step 2 Expresso Cloning using pSol Vectors Note If the amplification template is an intact circular plasmid encoding kanamycin resistance high background is likely Methods to avoid this background includ
25. om Step 5 to inoculate 3 ml LB Miller medium containing 30 ug mL kanamycin without glucose When cultures reach an optical density of 0 5 at 600 nm OD o9 induce expression by adding 30 ul of 20 L Rhamnose to the culture Continue shaking at 37 C for 4 hours Notes For maximal induction Lucigen recommends a final concentration of 0 2 L Rhamnose Lower amounts in the range of 0 001 to 0 1 can be used for lower levels of expression which may improve the solubility of some proteins Induction for up to 8 hours may be required for maximal expression of some target proteins Induction for up to 24 hours or more may be required for cultures grown at 20 C to 30 C 6 1 2 Autoinduction Autoinduction uses glucose to repress the rhaPgap promoter Cells will preferentially metabolize glucose during the early stages of growth and the rhaPgap promoter will become active only when glucose is depleted The timing of induction by rhamnose can be controlled by varying the concentration of glucose between 0 0596 and 0 1596 Later onset of induction may be beneficial if the expressed protein is unstable insoluble or toxic to the host cells Prepare LB Miller medium containing 30 ug mL kanamycin L Rhamnose 0 2 w v and D glucose 0 05 to 0 1596 w v 4 see table below Autoinduction Method Add per mL of culture Early autoinduction 10 uL 20 L rhamnose 3 3 uL 15 D glucose Late autoinduction 10 uL 20 L rhamnose
26. ough a reduced amount of vector sequence before reaching the cloning junction Vector Forward Primers 5 gt 3 pSol AFV ACG AGT ATT CTT ACG ATG CGT CCG AG pSol Bla CTG CCG GGT AAG CAC ACC pSol GST ATG TGC CTG GAT GCG TTC CC pSol MBP ACG TAT TGC CGC CAC CAT G pSol SlyD GTG CTC ACG ACC ACC ATC ACG pSol SUMO GGT GTC CGA TGG ATC TTC AGA G pSol Tsf GAG CAC AAT GCG GAA GTG ACC 23 MA158 Rev B Expresso Solubility and Expression Screening System Appendix C Colony PCR Screening The Expresso Solubility and Expression Screening System includes pRham Forward and pETite Reverse primers which can be used for colony PCR with your gene of interest GOI To enhance the specificity of the screen the GOI Reverse primer designed in section 1 1 may be used in place of the pETite Reverse primer Refer to the chart below to determine the expected PCR product sizes when using pRham Forward with pETite Reverse or pRham Forward with GOI Reverse All sizes are listed in base pairs Weer pRham Forward amp pETite Reverse pRham Forward amp GOI Reverse Vector GOI PCR Fragment Vector GOI PCR Fragment pSol AFV 490 439 pSol SlyD 781 730 pSol Tsf 1042 991 pSol SUMO 496 445 pSol Bla 1294 1243 pSol MBP 1297 1246 pSol GST 850 799 pSol His Control 193 142 24 MA158 Rev B Expresso Solubility and Exp
27. ove the DTT used in the TEV cleavage reaction 11 SelecTEV Cleavage During Dialysis The cleavage reaction can be performed during buffer exchange by dialysis Conditions may be adjusted from those recommended above In general use 1 uL SelecTEV 10 U for every 10 ug of fusion substrate If dialysis is carried out at 4 C an overnight 2 16 hours reaction time is recommended 20 MA158 Rev B Expresso Solubility and Expression Screening System Control Information The Expresso Solubility and Expression Screening System includes a GH1 positive control insert that can be cloned into any of the pSol vectors To generate a soluble control fusion protein clone the control insert into either pSol Bla pSol SIyD pSol Tsf or pSol MBP vector These clones can be used to express and purify soluble fusion proteins that can be expressed purified and cleaved with SelecTEV protease as specified in step 10 The following table summarizes the expected protein sizes before and after TEV protease cleavage SelecTEV is approximately 27 kDa and may be visible when performing SDS PAGE on the cleavage reaction Construct Full Length Expected Size Expected Cleavage Products Bla GH1 64 kDa hus a SlyD GH1 45 kDa ies ie Tsf GH1 54 kDa be i MBP GH1 64 kDa ie is References 1 Haldimann A Daniels L and Wanner B 1998 Use of new methods for construction of tightly regulated arabinose and rhamnose promoter fusions
28. phoresis Determine concentration of insert and add the correct amount Use the supplied control insert to test the system Incorrect primer sequences Be sure the 5 ends of the primer sequences match the pSol vector ends Wrong antibiotic used Add the correct amount of kanamycin to molten agar at 55 C before pouring plates Incorrect amounts of antibiotic in agar plates DO NOT spread antibiotic onto the surface of agar plates Incorrect tubes used for heat shock Use 15 mL disposable polypropylene culture tubes 17 x 100 mm The use of other types of tubes may dramatically reduce the transformation efficiency Difficult to clone PCR insert Pellet the entire 1 mL transformation culture from step 3 2 resuspended in 100 LL of recovery media and plate High background of transformants that do not contain inserts Transformants are due to intact kanamycin resistant plasmid template DNA Linearize plasmid DNA used as a template prior to PCR or gel isolate PCR fragment or treat PCR reaction with Dpnl Inserts are too small to detect Analyze colonies by sequencing to confirm the presence of inserts Incorrect amount of antibiotic in agar plates Add the correct amount of kanamycin to molten agar at 55 C before pouring plates DO NOT spread antibiotic onto the surface of agar plates 26 MA158 Rev B Expresso Solubility and Expression Screening System
29. ppendix C Colony PCR Screening 4 eere e eret eee ee eese eee ee etes tn sensns etas tas tn sense tas ta senses sens ta sensns etas tne 24 Appendix D Vector Map and Sequencing Primers 4 eee eee eee eese e esee en etes ten etse tns etse ts stas toss toas 25 Appendix E Cloning Troubleshooting Guide 4 eere eee eere eee ee ette etes e tenetis etes ts stats etos sinas 26 Appendix F Expression Purification Troubleshooting Guide ceres ee eere e eee eene tentent 27 Appendix G Characteristics of Fusion Tags in the pSol Vector Suite ccscscscssscsscssscscsescsesceesceencees 28 2 MA158 Rev B Expresso Solubility and Expression Screening System Technical Support Lucigen is dedicated to the success and satisfaction of our customers Our products are tested to assure they perform as specified when used according to our recommendations It is imperative that the reagents supplied by the user are of the highest quality Please follow the instructions carefully and contact our technical service representatives if additional information is necessary We encourage you to contact us with your comments regarding the performance of our products in your applications Thank you Lucigen Technical Support Email techserv lucigen com Phone 888 575 9695 Product Guarantee Lucigen guarantees that this product will perform as specified for one year from the
30. pring Harbor New York Parks T D Leuther K K Howard E D Johnston S A Dougherty W G 1994 Release of proteins and peptides from fusion proteins using a recombinant plant virus proteinase Anal Biochem 216 413 Phan J Zdanov A Evdokimov A G Tropea J E Peters H P K Kapust R B Li M Wlodawer A and Waugh D S 2002 Structural basis for the substrate specificity of tobacco etch virus protease J Biol Chem 27 50564 Tozser J Tropea J E Cherry S Bagossi P Copeland T D Wlodawer A and Waugh D S 2005 Comparison of the substrate specificity of two potyvirus proteases FEBS J 272 514 Goulet A Spinelli S Blangy S van Tilbeurgh H Leulliot N Basta T Prangishvili D Cambillau C Campanacci V 2009 The thermo and acido stable ORF 99 from the archaeal virus AFV1 Protein Sci 6 1316 Han KY1 Song JA Ahn KY Park JS Seo HS Lee J 2007 Solubilization of aggregation prone heterologous proteins by covalent fusion of stress responsive Escherichia coli protein SlyD Protein Eng Des Sel 20 543 Han KY1 Song JA Ahn KY Park JS Seo HS Lee J 2007 Enhanced solubility of heterologous proteins by fusion expression using stress induced Escherichia coli protein Tsf FEMS Microbiol Lett 274 132 Marblestone J G Edavettal S C Lim Y Lim P Zuo X and Butt T R 2006 Comparison of SUMO fusion technology with traditional gene fusion system
31. region The length of complementarity to the target gene will depend on the sequence Because the pSol vectors include in frame stop codons it is not necessary to include the stop codon of the target gene Factors affecting the length of the target specific portion of the primers include GC content Tm and potential for formation of hairpins or primer dimers We recommend that target specific portion of each primer be designed with a Tm of 60 C The annealing temperature used in amplification may be adjusted to accommodate primers with higher or lower Tm Forward Primer 5 AAT CTG TAC TTC CAG GGT TAA TAG AGC GGC CGC CAC TTA GAC ATG AAG GTC CCA TARGET GENE ATT ATC TCG CCG GCG GTG 5 Reverse Primer Figure 3 Primers for cloning into the Expresso pSol Vectors MA158 Rev B Expresso Solubility and Expression Screening System 1 2 Amplification of the target gene Amplify the desired coding sequence by PCR using primers designed as described in section 1 1 and a proofreading PCR polymerase Notes e The performance of the Expresso Solubility and Expression Screening System has been verified with PCR products from various proofreading polymerases including Accura High Fidelity Polymerase e If not using Accura High Fidelity Polymerase follow the manufacturer s recommendations during amplification of the target gene e The use of non proofreading polymerases e g Taq is strongly discouraged 1 2 1 Amplification prot
32. ression Screening System Appendix D Vector Map and Sequencing Primers The sequences of the pRham Forward and pETite Reverse primers are Rham Forward 5 GcTTTTTAGACTGGTCGTAGGGAG 3 p ETite Reverse 5 CCTCAAGACCCGTTTAGAGGC 3 p Shown below are the regions surrounding the cloning sites in the pSol vectors thaPgap Promoter CACCACAATTCAGCAAATTGTGAACATCATCACGTTCATCTTTCCCTGGTTGCCAATGGCCCATTTTCCTGTCAGTAACGAGAAGGTCGC GTGGTGTTAAGTCGTTTAACACTTGTAGTAGTGCAAGTAGAAAGGGACCAACGGTTACCGGGTAAAAGGACAGTCATTGCTCTTCCAGCG pRham Forward GAATTCAGGCGCTTTTTAGACTGGTCGTAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTATAAGAAGGAGATATACAT CTTAAGTCCGCGAAAAATCTGACCAGCATCCCTCTGGTGTTGCCAAAGGGAGATCTTTATTAAAACAAATTGATATTCTTCCTCTATATGTA Start 6xHis tag TEV Cleavage Site M H H H H H H E N L Y F Q G ATG CAT CAT CAC CAC CAT CAC Fusion Tag GAG AAT CTG TAC TTC CAG GGT TAC GTA GTA GTG GTG GTA GTG CTC TTA GAC ATG AAG GTC CCA Stop TAA TAGAGCGGCCGCCACCGCTGAG TARGET GENE TTA ATCTCGCCGGCGGTGGCGACTC CAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGGT GTTATTGATCGTATTGGGGAACCCCGGAGATTTGCCCAGAACTCCCCAAAAAACGACTTTCCTCCTTGATATAGGCCCA pETite Reverse MA158 Rev B 25 Expresso Solubility and Expression Screening System Appendix E Cloning Troubleshooting Guide Problem Probable Cause Solution Very few or no transformants No DNA degraded DNA or insufficient amount of DNA Check insert DNA by gel electro
33. rom the cleavage reaction by IMAC MA158 Rev B Expresso Solubility and Expression Screening System Detailed Protocol 1 Preparation of Insert DNA 1 1 Primer Design To clone with Expressioneering Technology the target DNA must first be amplified with primers that add flanking sequence identical to those found at the ends of linear pSol vectors Figure 3 Forward Primer Features The forward primer should be of the general structure AAT CTG TAC TTC CAG GGT XXX XXX XXX XXX XXX XXX 3 The required sequence at the 5 end of the forward primer includes 6 of the TEV recognition site codons This sequence is also found at one end of all of the pSol vectors The 3 end of the forward primer anneals to the bottom strand of the target gene usually beginning with the second codon The length of complementarity to the target gene will depend on the sequence Because each Expresso pSol vector contains an ATG initiation codon immediately preceding the 6xHis codons the ATG initiation codon from the target gene is not needed Reverse Primer Features The reverse primer should be of the general structure 5 GTG GCG GCC GCT CTA TTA XXX XXX XXX XXX XXX XXX 3 The required sequence at the 5 end of the reverse primer matches 18 bases of the downstream end of the pSol vectors The 3 end of the reverse primer anneals to the top strand of the target gene usually including the last codons prior to the stop codon of the coding
34. s Enhanced expression and solubility with SUMO Protein Sci 15 182 Tokunaga H1 Arakawa T Tokunaga M 2010 Novel soluble expression technologies derived from unique properties of halophilic proteins App Microbiol Biotechnol 88 1223 Kapust R B and Waugh D S 1999 Escherichia coli maltose binding protein is uncommonly effective at promoting the solubility of polypeptides to which it is fused Protein Sci 8 1668 Smith D B and Johnson K S 1998 Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S transferase Gene 67 31 22 MA158 Rev B Expresso Solubility and Expression Screening System Appendix A Media Recipes LB Miller Culture Medium Per liter 10 g Bacto tryptone 5 g yeast extract 10 g NaCl Mix components and autoclave LB Lennox kan30 Agar Medium for Plating of Transformants Per liter 10 g Bacto tryptone 5 g yeast extract 5 g NaCl 15 g agar Mix components autoclave and cool to 55 C To select for pSol transformants add kanamycin to a final concentration of 30 ug mL Pour into petri plates 2X SDS Gel Sample Buffer 62 5 mM Tris HCl pH 6 8 2 SDS 5 B mercaptoethanol or 0 1 M DTT 25 glycerol 0 01 Bromophenol Blue Appendix B Internal sequencing Primers The table below provides primer sequences that can be used to sequence from within the fusion tag toward the fusion junction Compared to the pRham Forward primer these primers read thr
35. s below provide details on performing colony PCR using Lucigen s ClonelD 1X Colony PCR Master Mix catalog 30059 Additional information on ClonelD Colony PCR can be found in the User s Manual http lucigen com docs manuals MA140 ClonelD pdf If not using Lucigen s ClonelD Colony PCR to perform screening follow the manufacturer s instructions Due to the high efficiency of Expresso Cloning System nearly all of colonies on the transformation plates will contain the desired recombinant plasmids Nonetheless Lucigen recommends screening at least 2 colonies from each plate 4 1 Colony PCR Screening e Obtain ClonelD 1X Colony PCR e Fora25yLreaction assemble the following on ice Volume pL Component 25 ClonelD 1X Colony PCR Mix 0 25 pRham Forward primer 50 uM Blue cap 0 25 pETite Reverse primer 50 uM Brown cap 25 5 Total volume e Using a pipet tip transfer well isolated colonies to the PCR reaction mix e Disperse the cells by pipetting up and down several times e Use the same tip to inoculate 3 mL of LB Miller medium containing 30 ug mL kanamycin and 0 596 glucose The glucose in these cultures represses undesired expression of the target protein during this initial growth reducing the risk of slow growth and plasmid instability particularly if the target protein is toxic to the host strain Note To expedite the workflow one portion of each culture can be used for plasmid minipreps s
36. t up the SelecTEV Protease reaction by adding the following reagents to a 1 5 mL tube Final Concentration Volume uL Component UE X Fusion Protein 30 ug 5 SelecTEV 20X Buffer 1X 1 DTT 100mM 1mM 1 SelecTEV Protease 10 U uL 10U Y Water N A 100 Total e Incubate the reaction at 30 C for at least 1 hour e Refer to the manual for SelecTEV Protease http lucigen com docs manuals MA157 SelecTEV Protease pdf for further guidance Removing SelecTEV Protease after Cleavage SelecTEV Protease contains a histidine 6xHis tag at its N terminus After cleavage of the fusion protein you may remove SelecTEV Protease from the cleavage reaction by IMAC Perform the binding and elution as described in the resin manufacturer s protocol The cleaved native protein will be in the flow through fractions as long as the cleaved protein does not contain a histidine tag The histidine tagged fusion partner and the SelecTEV Protease will remain bound to the resin MA158 Rev B Expresso Solubility and Expression Screening System Notes e Imidazole remaining in the sample from the initial purification will prevent the histidine tag on SelecTEV from binding to the IMAC resin Remove the imidazole by dialysis or with a desalting column prior to performing the post TEV IMAC purification e Some IMAC resins do not tolerate 1 mM DTT Methods employed to remove imidazole will simultaneously rem
37. tely on ice 5 10 minutes 3 2 Transformation Protocol e Add vector and insert DNAs to the tubes containing the E cloni 10G Chemically Competent Cells on ice as indicated below Rxn Rxn Rxn Rxn Rxn Rxn Rxn Rxn Reagent MA158 Rev B Expresso Solubility and Expression Screening System 12 5 ng uL pSol AFV Vector 2 uL 12 5 ng uL pSol SlyD Vector 2 uL 12 5 ng uL pSol Tsf Vector 2 uL 12 5 ng uL pSol SUMO Vector 2 uL 12 5 ng uL pSol Bla Vector 2 uL 12 5 ng uL pSol MBP Vector 2 uL 12 5 ng uL pSol GST Vector 2 uL 12 5 ng uL pSol Control Vector 2 uL Amplified Target Fragment lt 3 uL lt 3 uL lt 3 uL lt 3 uL lt 3uL lt 3 uL lt 3 uL lt 3 uL e Transfer the entire mixture of cells and DNA to a pre chilled 15 mL polypropylene culture tube s 17 x 100 mm e Incubate culture tubes containing cells and DNA on ice for 30 minutes e Heat shock cells by placing the tubes in a 42 C water bath for 45 seconds e Return the tubes of cells to ice for 2 minutes e Add 960 uL of room temperature Recovery Medium to the cells in the culture tubes e Place the culture tubes in a shaking incubator at 250 rpm for 1 hour at 37 C e Plate 100 uL of transformed cells on LB Lennox agar plates containing 30 ug mL kanamycin e Incubate the plates overnight at 37 C 3 3 Optional Controls
38. tep 5 and another portion can be used to inoculate cultures for induction of protein expression However only colony PCR verified cultures should be used for subsequent DNA purification and analysis e Cycle the PCR reaction according to the table below Step Temperature Time 1 Initial Denaturation 98 C 2 minutes 2 Denaturation 94 C 15 seconds 3 Annealing 55 C 15 seconds 4 Extension 72 C 1 minute kb 5 Repeat steps 2 4 25 total cycles 6 Final extension 72 C 10 minutes 7 Hold 4 C eo MA158 Rev B Expresso Solubility and Expression Screening System Load 5 uL of the ClonelD 1X Colony PCR Mix reaction s onto an agarose gel for analysis 0 7 2 agarose gel Compare PCR product result s to expected band sizes The expected bands size is determined by the fusion tag and the size of the gene of interest See Appendix C Colony PCR Screening for information on the size of the fusion tags 5 DNA Purification and Sequencing 5 1 Colony Growth Transfer cultures containing PCR verified pSol plasmids to a 37 C incubator and shake overnight at 220 250 rpm 5 2 DNA Purification Use standard methods 8 to isolate plasmid DNA from 1 5 ml aliquots of the overnight cultures The pSol plasmids contain the low copy ColE1 origin of replication and produce DNA yields of 150 ng per mL of culture 5 3 Sequencing Lucigen strongly recommends sequence confirmation of the junctions of t
39. the desired coding sequence by e 1 1 Primer Design Insert DNA PCR e 1 2 Amplification of the e If the PCR yields a single robust product proceed directly to step 2 Enzyme free Cloning with the pSol Vectors target gene Expresso Cloning using pSol Vector s e Add PCR product and pSol vector s to Chemically Competent E cloni 10G Cells e Perform transformation e Incubate the transformation plates overnight at 37 C e 3 2 Transformation Protocol Colony PCR Screening for Recombinants e Perform colony PCR screen e Analyze PCR products by agarose gel electrophoresis e Start overnight cultures of PCR positive e 4 1 Colony PCR Screening e 5 1 Colony Growth colonies Grow overnight e 1 Isolate plasmid DNA from 1 5 mL of e 5 2 DNA Purification cultures and split culture e 6Induction of Protein into three aliquots e 2 Inoculate cultures for protein Expression expression e 3 Prepare glycerol stocks optional Evaluate Target Protein Expression and Solubility e Harvest induced cultures e Lyse cells by sonication e Fractionate lysates by centrifugation e Analyze total soluble and insoluble protein fractions by SDS PAGE e 7 Evaluate Target Protein Expression and Solubility Affinity Purification of 6xHis tagged proteins e Bind cleared lysate to IMAC resin e Wash column and elute fusion proteins e Dialyze overnight to remove imidazole e 8 Affinity Purification of
40. ween the vector and insert occurs within the host strain seamlessly fusing the gene of interest to the vector The method is similar to cloning by homologous recombination 6 It does not require single stranded ends on the vector or the insert as in PIPE cloning 7 pSol His Control Vector The pSol His Control Vector included with the kit is intended to enable determination of baseline expression and solubility levels that may be achieved with the vector host system in the absence of a solubility enhancing tag GH1 Control Insert The GH1 Control Insert included with the kit is a 0 6 kb PCR fragment that encodes human Growth Hormone 1 GH1 It is flanked by sequences for Expresso cloning directly into the pSol Vectors It serves as a positive control for monitoring cloning efficiency expression solubility and TEV protease cleavage Colony Screening Empty vector background with the pSol Vectors is typically very low 596 so minimal screening is necessary Colony PCR may be used to verify the presence of inserts Primers included with the kit are suitable for screening by colony PCR and for sequencing of plasmid DNA Lucigen recommends sequence analysis to confirm the junctions of the insert with the vector as well as the predicted coding sequence See Appendix B Appendix B Internal sequencing Primers for primer sequences that can be used to sequence from within the fusion tag toward the fusion junction Protein Expression Recom
Download Pdf Manuals
Related Search