Errata--GenoMax 3 - Thermo Fisher Scientific
Contents
1. the Camera dialog box 8 Select the desired Range Selection or All and Clipboard as the Copy To location 9 Open Microsoft Word or Excel and paste the data from the Clipboard 10 Print and or save the data from Word Excel Page 245 Replace the note on page 245 with the following Note If database objects are renamed or modified AFTER you have copied them to the Clipboard when you paste the object s the changes subsequent to copying are not reflected Remember that the data for the Clipboard is collected when you copy it not when you paste it Page 253 Add the following bullet to the list of field types o List of URLs list of web addresses Page 274 In the Similarity Between Ambiguous Nucleotides section the Average Minimum and Maximum similarity percentages for R A and R T are incorrectly stated in Table 19 3 The table should read as follows Similarity N N N R N A R W R A R T Maximum 100 100 100 100 100 Average 25 25 25 25 50 0 Minimum 0 0 0 0 0 Page 275 Add the following text to the Restriction Map Setup section at the bottom of the page After clicking the Add button to quickly move to the vicinity of the enzyme of interest in the Choose Database Enzymes dialog box enzyme list highlight the first enzyme name on the list and using the keyboard type the first letter or first few letters quickly of the name of the enzyme of interest The enzyme list scrolls to the2. Errata Vector NTI Suite 7 0 Including Xpression NTI User s Manual Updated April 19 2002 Vector NTI Page 152 153 The NCBI gateway page used for the Vector NTI Tools gt Compare Against gt GenBank via BLAST on NCBI Server tool has changed Replace the text on page 152 starting with Figure 14 2 and ending with the first paragraph on page 153 with the following information pertinent to the new gateway page 4 NCBI Blast Microsoft Internet Explorer Of x File Edit View Favorites Tools Help Ea E gt O h m 3 na 3 es Forward Stop Refresh A a Favorites History Mail Size Print EE CATEMPStmp 0 htm z Go Links ral NCBI nucleotide nucleotide BLAST Nucleotide Protein Translations Retrieve results for an RIDI ttetcatgtttgacagettatcatcgataagctttaatgeggtagtttatcacagttaaa tLtigctaacgcagtcaggcaccgtgtatgaaatctaacaatgegetcatcgtcatectegy Search Jcaccgtcaccetggatgctgtaggeataggettggttatgecggtactgeegggectctt gegggatategtccattccgacagcatcgecagtcactatggegtgetgetagegcetata tgegttgatgcaatttctatgegcaccegttcteggagcactytecgacegetttgaccg y Set subsequence From To Choose database nr z xo CD CD ED Fig 14 2 BLAST Search page in the WWW browser This page is Vector NTI s gateway to the NCBI BLAST Search server it contains options that can be used to change various BLAST search parameters The sequence of pBR322 is already entered in the Search field In the Choose database section select the nr
3. ble Tools Window Help Se lt 9 ent Unde NEZA 2 ws et ae Ag pagne 2 BF Sole a7 EEEO peek Gant Heda iT 6j 4 a TC TG 5 ActivePe y Cut ow Ely BRIS 2 B 7 up dA 7 Copy Le 5 Biel ES E Paste Sequence at 2801 bp Cti a Same Tn Delete pBR322 Properties a aa masi New gt 2 A Open from Clipboard aso a c Cope Tos pBR322 cimmi Hide Biter 4361bp LIRR Select Branch OCA SelectAll Cirle Set Selection Chie x Pg Set Caret Position 5 Aval 1426 d Eind Sequence 2788 ee wh eo xj gt Camera 2 CTTATCCGG TAACTATCGT CTTGAGTCCA ACCCGGTAAG ACACA Display Setup GARATAGGCC ATTGATAGCA GAACTCAGGT TGGGCCATTC TGTC GGCGGTGCT ACAGAGTTCT TGAAGTGGTG GCCTAACTAC GGC ICCGCCACGA TGTCTCAAGA ACTTCACCAC CGGATTGATG CCG Options DOAI TARACCCAOT TACOTTOCOR MARACROTRO CTACOTOTEO NTCOCCCANA CRRRCCACCE ar Z 2801 bp alz Fig 14 4a Transferring the result of the query back to Vector NTI In the Open Import from Clipboard dialog box that opens select GenBank file from the list of file types and press the Open button Open Import from Clipboard 21x EMBL file Bac GenBank file FASTA file SWISS PROT file GenPept file Protein FASTA file REBASE file PROSITE file Nucleotide Sequence file A Amino Acid Sequence file A YNTI DNA RNA archive xl 003333333303 Fig 14 4b Selecting the file type for the transferred query Vector NTI opens your molecule in a new Molecule Viewing windo
4. database Scroll to the bottom of the page If your email address appears in the Send results by e mail text box delete it Press the BLAST button Note At this step your WWW browser may display a dialog box or start a program to establish an Internet connection If this happens enter the required parameters and continue Once an Internet connection with the NCBI server has been established you should see the NCBI formatting BLAST page To proceed press the Format button on that page The response time for the BLAST results varies depending on the server load If the server is busy wait several minutes and resubmit the query Page 153 154 The tool used in step 3 of the tutorial no longer exists in Vector NTI Replace step 3 beginning at the bottom of page 153 and continuing on to page 154 with the following information for using the replacement tool 3 Display the Result of the Query in a Molecule Display Window To transfer the result of the query back to Vector NTI highlight the GenBank text starting at the word LOCUS and ending with the at the end of the sequence Select Edit gt Copy from the drop down menu or its analog in your browser to copy the selected text to the Clipboard Switch back to the Vector NTI workspace and choose Edit gt Open from Clipboard from the VNTI drop down menu Fig 14 4a Vector NTI pBR322 Of x Molecule View Analyze Gel List Align Assem
5. ections performance during search results downloading can vary In the case of an unstable and or slow network connection large downloads may be aborted before completion To avoid this problem if you are downloading multiple molecules it is recommended that you download in several small batches instead of one large batch BLAST Viewer Online Help The help topic for the BLAST Results Viewer Analysis Pane describes the Hit Distribution Graph incorrectly The correct description for the Hit Distribution Graph is found on page 530 of the Vector NTI Suite Version 7 Including Xpression NTI User s Manual and is as follows Hit Distribution Graph upper pane Each residue in the query sequence is traced to all hit elements in which it is included and 100 percent identical The number of hit elements per residue are tallied Summed up and plotted across the molecule Xpression NTI Page 594 Ratio section second paragraph Delete Fold Change for Affymetrix data Xpression NTI currently does not support the Fold Change ratio type Page 602 The XNTI database management operation choices have changed for XNTI version 1 1 The database management choices for XNTI v 1 1 are as follows e Select Database opens an Xpression NTI database other than the default This allows you to have several different databases to work with and to alternately view those databases e Purge Database removes all objects from all tables in the Xpr
6. ession NTI database This operation can be used on a fresh installation of XNTI if you wish to delete the sample data before adding your own data for example e Database Compact removes from the data files and database table any unnecessary data that may accumulate from extensive creation and deletion of database objects Although these data do not affect functionality they can affect performance It is it suggested that you perform Database Compact once a week Page 614 Add the following topic after the Editing User Fields in Individual Objects topic Annotations and User Fields Currently User defined fields for Genes are updated independently of Gene annotations Therefore if you update the Gene annotations you will have to subsequently update the User defined fields accordingly Page 617 Under the Normalize by Equalizing the Distribution bullet first sub bullet Set Average to 1 change the word median to mean Page 646 The keyboard shortcuts cited at the top of the page work only for the keypad buttons usually on the right side of the keyboard they do not work for the regular keys on the keyboard The Shift and Shift keypad shortcuts are disabled for the Birds Eye Navigation Map in the Genes Pane Page 695 Add the following note to the bottom of the page Note The scale for Scatter Plot analysis is log10 Page 707 Replace the first paragraph on this page with the following You can import other Expression data
7. file formats using an import scheme To begin this process perform the following steps e Choose Tools gt Import Expression from the menu in the Expression Database Explorer window The Select Module dialog box opens e Inthe Select Module dialog box choose Import via Scheme and press the OK button The Expression Import dialog box opens Fig 38 74 Page 707 Add the following note to the last bullet on this page Note The Generic Tab delimited scheme available on the Import Scheme drop down box list is used for importing InforMax internal format file types For demonstration purposes an InforMax internal format file called Generic txt is provided for you in the Demo Projects folder in the Vector NTI 7 installation on your hard drive Page 707 708 Order of data processing during Expression Data import During data import when the Expression Import Scheme is read the definitions on the Position tab of the Tag dialog box are read sequentially one group at a time Definitions inside of each group are read simultaneously Group order is as follows Group Text Fields e Start at line with text e Include lines with text e Include columns with text e Stop at column without text e Stop at line with text Doesn t apply to the first row which will be included independently of this definition because commonly the first row represents column headers Group II Rows and columns enumeration e Rows e Columns G
8. from Vector NTI ona Macintosh and vice versa If you want to move the VNTI Database from PC to Macintosh or vice versa you must do so using VNTI Archive files For more information on importing and exporting VNTI Database objects as Archives see pages 236 and 238 respectively Page 238 Add the following topic to the Operations on Subbases section on page 238 see also Page 215 correction above Copy and Save or Print a List of the Objects in a Subbase You can copy and save print a list of the objects in a subbase including the object names and other desired column information by performing the following steps 1 Open the Exploring Local Vector NTI Database window 2 Navigate to the database table of interest by selecting it from the Database Table drop down box 3 Right click on the column headings in the Database lt Object gt Pane right hand pane and choose Columns to launch the Columns dialog box 4 Add or remove columns to customize the information showing in the Database lt Object gt Pane according to what you want to print save Close the Columns dialog box Create a subbase and add to it the objects you want to print save or navigate to the desired preexisting subbase Alternately you can highlight the particular objects of interest instead of creating a subbase 7 With the Database lt Object gt Pane activated press the Camera button on the toolbar or choose Edit gt Camera from the menu to launch
9. roup Ill Transpose When building the scheme if definitions in Group I are already defined they are reflected in the Scope Pane In this case column and row numbers are taken from the Scope pane instead of the Source File s pane Tags are processed in the following order 1 Experiment features Name Type Chip Tissue 2 Expression Runs tag Name Target 3 Genes tag 4 Data E Values tag 5 Additional matrices in the order they were added Page 709 There is currently only one way to change the Expression Experiment name during import In the final Expression Import window before pressing the Finish button highlight the Experiment name and press F2 Index Page 748 Under the listing Multiple Alignment it says See Alignment Multiple This should be changed to See Alignment initiating multiple Page 750 Under the listing Profile Alignment it says See Alignment Profile This should be changed to See Alignment initiating profile
10. vicinity of that enzyme Note For this technique to work the enzyme list must be sorted alphabetically by enzyme name To sort the list alphabetically by enzyme name click on the Name column header in the Choose Database Enzymes dialog box Page 305 Add the following instructions for making the reverse complement of a DNA RNA molecule Making the Reverse Complement of a DNA Molecule To make the reverse complement of a DNA RNA molecule open the molecule in a Molecule Viewing window in Vector NTI With any pane activated choose Molecule gt Operations gt Advanced DNA RNA gt Make Reverse Copy from the drop down menu The Choose New DNA RNA Molecule Name dialog box appears allowing you to save the reverse complement Important Remember to RENAME the molecule before saving it or the reverse complement is saved over the existing molecule in the database and the existing molecule is lost Page 305 Add the following note after the instructions for saving and loading PCR settings Important If you have made changes to the settings in a PCR Primers dialog box and want to save the settings to a file before running the analysis you must first press the Apply button to register the changes before saving to a file If the new settings are not applied the preexisting settings are saved BLAST Search Page 526 Add the following note to the BLAST Search Results topic Note Depending on the stability and speed of your network conn
11. w automatically generating the restriction map and graphics representation of the molecule Page 164 In the second paragraph of step 5 the default matrix is cited incorrectly The default matrix for AlignX is blosum62mt2 Page 215 Add the following Exploring Database window operation to the bulleted list at the end of the page see also Page 238 topic below e Copy and save or print a list of the objects in a subbase Page 229 Add the following procedure description to the Database Search section Searching By Object Name in the Vector NTI Database Although currently the Database Search function does not allow you to search according to object name you can do a name search by performing the following steps 1 Open the Exploring Local Vector NTI Database window 2 Navigate to the database table of interest by choosing it from the Database Table drop down list 3 Sort the objects alphabetically according to name if not already sorted by name by clicking on the Name column heading 4 Highlight the first name on the list 5 Using the keyboard type the first letter or first few letters quickly of the desired object name The list scrolls to the area of the typed letter s Page 231 Add the following note to the Backup Restore and Cleanup section Important Vector NTI Database Backups are NOT cross platform compatible i e the Vector NTI Database on a PC cannot be restored using a VNTI Database Backup made
Download Pdf Manuals
Related Search