Home

Champion™ pET Gateway® Expression Kits with Lumio™ Technology

1. The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Life Technologies Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Life Technologies Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use s
2. Allows recombinational cloning of the gene of interest from an entry clone Chloramphenicol resistance gene Allows counterselection of the plasmid ccdB gene Allows negative selection of the plasmid T7 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from bacteriophage T7 which allows efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pBR322 origin of replication ori Allows replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the lacUV5 promoter in the host chromosome to repress transcription of T7 RNA polymerase 29 Map and Features of pET161 DEST Map of pET161 The figure below shows the elements of pET161 DEST 7480 bp The complete DEST sequence of the vector is available for downloading from our Web site www invitrogen com or by contacting Technical Support page 34 DA ATG om ccdB attR2 Lumio tag 6xHis TZ term Comments for pET161 DEST 7480 nucleotides T7 promoter priming site bases 21 40 lac operator lacO bases 40 64 Ribosome binding site
3. If you wish to analyze total cell lysates transfer 15 ul of each sample from Step 1 to a fresh tube Proceed to Adding Lumio Detection Reagents next page If you wish to prepare lysate fractions to analyze soluble and insoluble protein proceed to Step 3 Centrifuge samples at maximum speed in a microcentrifuge for 5 minute at 4 C to pellet insoluble proteins Transfer supernatant to a fresh tube and store on ice Wash pellets once with Lysis Buffer to remove any residual soluble proteins Resuspend the pellets in 50 ul of 8 M urea Transfer 15 ul of each supernatant and pellet sample to a fresh tube Proceed to Adding Lumio Detection Reagents next page continued on next page Using the Lumio Green Detection Kit continued Adding Lumio At this point you should have 15 ul lysate samples for each time point Follow Detection the protocol below to prepare these samples for electrophoresis using the Reagents Lumio Detection Reagents 1 To each 15 pl lysate sample add 5 ul of 4X Lumio Gel Sample Buffer 2 Thaw the Lumio Green Detection Reagent and mix well by pipetting up and down Add 0 2 ul of the Lumio Green Detection Reagent to each sample using a 2 ul pipettor P2 pipettor Return the Lumio Green Detection Reagent to 20 C immediately after use Alternative If you do not have a 2ul pipettor make a fresh 1 5 dilution of the Lumio Green Detection Reagent using 1X Lumio Gel Sample Buffer Add
4. RBS bases 94 101 Initiation ATG bases 109 111 attR1 site bases 154 278 Chloramphenicol resistance gene bases 387 1046 ccdB gene bases 1388 1693 attR2 site bases 1734 1858 Lumio tag bases 1887 1904 Polyhistidine 6xHis region bases 1920 1937 T7 transcription termination region bases 1952 2080 T7 reverse priming site bases 1991 2010 bla promoter bases 2381 2479 Ampicillin bla resistance gene bases 2480 3340 pBR322 origin bases 3485 4158 ROP ORF c bases 4529 4720 lacl ORF c bases 6032 7123 c complementary strand continued on next page 30 Map and Features of pET161 DEST continued Features of pET161 DEST pET161 DEST 7480 bp contains the following elements All features have been functionally tested Feature Benefit 17 promoter Allows high level IPTG inducible expression of your recombinant protein in E coli strains expressing the T7 RNA polymerase T7 Promoter priming site Allows sequencing of the insert lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the ATG initiation codon for efficient translation of PCR product attR1 and attR2 sites Allows recombinational cloning of the gene of interest from an entry clone Chloramphenicol resistance gene Allows counterselection of the plasmid ccdB gene Allows nega
5. and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Lopez P J Marchand I Joyce S A and Dreyfus M 1999 The C terminal Half of RNase E Which Organizes the Escherichia coli Degradosome Participates in mRNA Degradation but not rRNA Processing in vivo Mol Microbiol 33 188 199 Rosenberg A H Lade B N Chui D S Lin S W Dunn J J and Studier F W 1987 Vectors for Selective Expression of Cloned DNAs by T7 RNA Polymerase Gene 56 125 135 Studier F W and Moffatt B A 1986 Use of Bacteriophage T7 RNA Polymerase to Direct Selective High Level Expression of Cloned Genes J Mol Biol 189 113 130 Studier F W Rosenberg A H Dunn J J and Dubendorff J W 1990 Use of T7 RNA Polymerase to Direct Expression of Cloned Genes Meth Enzymol 185 60 89 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 41 Notes invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
6. 11791 020 to catalyze the LR recombination reaction The LR Clonase II enzyme mix combines the proprietary enzyme formulation and 5X LR Clonase Reaction Buffer previously supplied as separate components in LR Clonase enzyme mix into an optimized single tube format for easier set up of the LR recombination reaction Use the protocol provided on page 13 to perform the LR recombination reaction using LR Clonase II enzyme mix Note You may perform the LR recombination reaction using LR Clonase enzyme mix if desired To use LR Clonase enzyme mix follow the protocol provided with the product Do not use the protocol for LR Clonase II enzyme mix provided in this manual as reaction conditions differ continued on next page Creating an Expression Clone continued Recombination The recombination region of the expression clone resulting from pET160 DEST x Region for pET160 DEST 61 118 166 214 1894 1954 entry clone is shown below Features of the Recombination Region e Shaded regions correspond to DNA sequences transferred from the entry clone into pET160 DEST by recombination Non shaded regions are derived from the pET160 DEST vector e Bases 203 and 1865 of the pET160 DEST vector sequence are marked lac operator T7 promoter priming site AGATCTCGAT CCCGCGAAAT TAATACGACT CACTATAGGG GAATTGTGAG CGGATAACAA RBS mm TTCCCCTCTA GAAATAATTT TGTTTAACTT TAAGAAGGAG ATATACAT ATG CAT CAT TAC GTA GTA Met Hi
7. 4X at 20 C and minimize exposure to air Use the buffer immediately upon removal from 20 C and return the buffer to 20 C immediately after use TM The Lumio In Gel Detection Enhancer is a proprietary solution and is designed to reduce the non specific binding of Lumio Green Detection Reagent with endogenous proteins The BenchMark Fluorescent Protein Standard is supplied with the Champion pET Expression System with Lumio Technology to allow easy and direct visualization of molecular weight ranges of your Lumio fusion protein on a SDS PAGE gel The standard consists of 7 distinct protein bands in the range of 11 155 kDa and is supplied in a ready to use format For detailed information TM and specifications refer to the BenchMark Fluorescent Protein Standard manual To facilitate separation and visualization of your recombinant fusion protein by polyacrylamide gel electrophoresis a wide range of pre cast NuPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen For more information about pre cast gels available from Invitrogen visit to our Web site www invitrogen com or contact Technical Support see page 34 continued on next page 19 Using the Lumio Green Detection Kit continued S MENO O 0U E NOU Materials Needed Preparing Lysate Samples 20 TM For optimal results with the Lumio Green Detect
8. DE3 pLysE CE6 BL21 SI Competent Cells and any derivatives that are made of them You may refuse this sub license by returning this product unused in which case Life Technologies accept return of the product with a full refund By keeping or using this product you agree to be bound by the terms of this license continued on next page 37 Purchaser Notification continued Limited Use Label License No 50 rne131 Cells 38 Life Technologies Corporation Life Technologies has an exclusive license to sell the rne131 genotype to scientists for research or commercial evaluation purposes only under the terms described below Use of the rne131 genotype by commercial entities for Commercial Purposes as defined below beyond evaluation requires the user to obtain a commercial license as detailed below Before using the BL21 Star strain please read the following license agreement If you do not agree to be bound by its terms contact Life Technologies within 10 days for authorization to return the unused BL21 Star product and to receive a full credit The rne131 genotype is covered by one or more French patents or patent applications and corresponding foreign patents or patent applications owned by CNRS Information about commercial licences may be obtained from Centre National de la Recherche Scientifique CNRS 3 rue Michel Ange 75794 PARIS Cedex 16 France REF L00084 Contact Dale Roche fist fr Life Technologies grants yo
9. TOP10 cells zz 21 x 50 pl pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 0 5 mM 50 ul EDTA pH 8 The table below describes the items included in the BL21 Star DE3 One Shot Chemically Competent E coli kit Box 3 Transformation efficiency is 2 1x 10 cfu ug DNA Store Box 3 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 25mMKCI 10 mM MgCl 10 mM MgSO4 20 mM glucose BL21 Star DE3 21x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 0 5 mM 50 ul EDTA pH 8 continued on next page Kit Contents and Storage continued Genotype of TOP10 Genotype of BL21 Star DE3 Lumio Green Detection Kit and BenchMark Fluorescent Protein Standard Use this strain for propagation and general maintenance of your pET expression construct Genotype F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG Use this E coli strain for expression only Do not use these cells to propagate or maintain your construct Genotype F ompT hsdSs rgms gal dcm rne131 DE3 The DE3 designation means this strain contains the lambda DE3 lysogen which carries the gene for T7 RNA polymerase under the control of the lacUV5 promoter IPTG is required to induce expression of the T7 RNA polymerase The strain is an E coli B r strain
10. the bacteriophage T7 RNA polymerase to allow regulated expression of heterologous genes in E coli from the T7 promoter Rosenberg et al 1987 Studier and Moffatt 1986 Studier et al 1990 For more information TM about the Champion pET Expression System see page 3 continued on next page Overview continued Gateway Technology Lumio Technology The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your gene of interest into multiple vector systems To express your gene of interest in E coli using Gateway Technology simply 1 Clone your gene of interest into a Gateway entry vector to create an entry clone 2 Generate an expression clone by performing a LR recombination reaction between the entry clone and a Gateway destination vector e g pET160 DEST or pET161 DEST 3 Transform your expression clone into BL21 Star E coli and assay for expression For more information about the Gateway Technology refer to the Gateway Technology with Clonase II manual This manual is available for downloading from our Web site www invitrogen com or by contacting Technical Support Technical Support page 34 TM The Lumio System is based on the FIAsH Fluorescein Arsenical Hairpin technology which uses a biarsenical reagent to bind and detect
11. the pLysS plasmid to further reduce basal level expression of the gene of interest For more information see page 5 pET160 GW CAT or pET161 GW CAT is provided for use as a positive control for expression The control vectors allow expression of the chloramphenicol acetyltransferase CAT protein fused to either an N terminal or C terminal TM Lumio tag To propagate and maintain each plasmid 1 Resuspend the vector in 20 ul of sterile water to prepare a 5 ng ul stock solution 2 Use the stock solution to transform a recA end E coli strain like TOP10 DH5a TI or equivalent 3 Select transformants on LB plates containing 100 ug ml ampicillin Prepare a glycerol stock of a transformant containing plasmid for long term storage TM The basic steps needed to induce expression of your gene in BL21 Star DE3 E coli are outlined below 1 Isolate plasmid DNA using standard procedures and transform your construct and the positive control separately into BL21 Star DE3 One Shot cells 2 Grow the transformants and induce expression with IPTG over several hours Take several time points to determine the optimal time of expression 3 Optimize expression to maximize the yield of protein continued on next page Expressing Recombinant Proteins continued Plasmid Preparation Ampicillin Selection Using Carbenicillin Note Materials Needed You may prepare plasmid DNA using your method of ch
12. while handling or imaging the gel For optimal visualization of the fluorescent protein bands you will need one of the following e UV transilluminator 302 nm or 365 nm To photograph a gel on the UV transilluminator use a standard video camera CCD Charged Couple Device camera or a cooled CCD camera with ethidium bromide filter SYBR Green filter or band pass filter encompassing the emission maxima 535 nm of the stain Note If you are using 365 nm UV transilluminator you may have to expose the gel for a longer time as the sensitivity is lower than a 302 nm UV transilluminator e Laser based scanner with a laser line that falls within the excitation maxima of the stain 500 nm a 535 nm long pass filter or a band pass filter centered at the emission maxima of 535 nm The sensitivity of detection is higher with laser based scanners equipped with the appropriate filters than with UV transillumination Be sure to adjust the settings on the camera prior to turning on the UV light on the UV transilluminator The fluorescent dye of the Lumio Detection Reagent is sensitive to photobleaching Avoid exposing the gel to UV light for a long time 1 Place the gel on a UV transilluminator 302 nm equipped with a standard camera and make sure the ethidium bromide or SYBR Green filter is selected on the camera You may also use a laser based scanner with a laser line that falls within the appropriate excitation and emissi
13. 1 ul of this diluted Lumio Green Detection Reagent to each sample 3 Mix samples well by pipetting up and down and incubate samples at 70 C for 10 minutes 4 Allow samples to cool for 1 2 minutes and centrifuge briefly at high speed in a microcentrifuge 5 Thaw the Lumio In Gel Detection Enhancer and mix well by pipetting up and down Add 2 ul Lumio In Gel Detection Enhancer to each sample Return the Lumio In Gel Detection Enhance to 20 C immediately after use 6 Mix samples well by pipetting up and down and incubate samples at room temperature for 5 minutes 7 Load 5 20 ul of each sample on an appropriate gel and perform electrophoresis Proceed to Analyzing Lumio Fusion Proteins next page Note If you are using NuPAGE Novex Gels there is no need to add NuPAGE Antioxidant in the running buffer during electrophoresis 21 Analyzing Lumio Fusion Proteins Introduction Required Equipment to Visualize the Gel Visualizing and Imaging the Gel 22 Once you have performed electrophoresis you will visualize Lumio fusion proteins directly in the gel General guidelines are provided below For more TM detailed information refer to the Lumio Green Detection Kit manual After electrophoresis is complete we recommend removing the gel from the cassette The sensitivity of detection is much higher when the gel is imaged after removal from the cassette Avoid touching the gel with bare hands
14. 12 for the location of the primer binding sites Primer Sequence T7 Promoter Primer 5 TAATACGACTCACTATAGGG 3 T7 Reverse Primer 5 TAGTTATTGCTCAGCGGTGG 3 15 Expressing Recombinant Proteins Introduction BL21 Star Strains Positive Controls Basic Strategy 16 BL21 Star DE3 One Shot E coli Box 3 are supplied with each Champion pET Gateway Expression Kit with Lumio Technology for use as the host for expression You will need pure plasmid DNA of your expression clone to transform into BL21 Star DE3 for expression studies Since each recombinant protein has different characteristics that may affect optimal expression we recommend performing a time course of expression to determine the best conditions for expression of your protein The BL21 Star DE3 E coli strain is specifically designed for expression of genes regulated by the T7 promoter Each time you perform an expression experiment you will transform your plasmid into BL21 Star DE3 Use the TOP10 strain not the BL21 Star DE3 strain for propagation and maintenance of your plasmid Basal level expression of T7 polymerase particularly in BL21 Star DE3 cells may lead to plasmid instability if your gene of interest is toxic to E coli TM Note If you are expressing a highly toxic gene the BL21 Star DE3 pLysS strain is also available from Invitrogen for expression purposes The BL21 Star DE3 pLysS strain contains
15. 5 Store at 4 C Medium is stable for only 1 2 weeks continued on next page Recipes continued Lysis Buffer 50 mM potassium phosphate pH 7 8 400 mM NaCl 100 mM KCl 10 glycerol 0 5 Triton X 100 10 mM imidazole 1 Prepare 1 M stock solutions of KH PO and KoHPO 2 For 100 ml dissolve the following reagents in 90 ml of deionized water 2 3 g NaCl 0 75 g KCl 10 ml glycerol 0 5 ml Triton X 100 68 mg imidazole 3 Mix thoroughly and adjust pH to 7 8 with HCl Bring the volume to 100 ml Store at 4 C 27 Map and Features of pET160 DEST Map of pET160 The figure below shows the elements of pET160 DEST 7437 bp The complete DEST sequence of each vector is available for downloading from our Web site www invitrogen com or by contacting Technical Support page 34 Dran ac 6xHis Lumio tag TEV attR1 co ccdB attR2 T7 term Comments for pET160 DEST 7437 nucleotides T7 promoter priming site bases 21 40 lac operator lacO bases 40 64 Ribosome binding site RBS bases 94 101 Initiation ATG bases 109 111 Polyhistidine 6xHis region bases 112 129 Lumio tag bases 142 159 TEV recognition site bases 169 189 attR1 site bases 196 320 Chloramphenicol resistance gene bases 429 1088 ccaB gene bases 1409 1714 attR2 site bases 1755 1879 T7 transcription termination region bases 1905 2033 T7 reverse priming site bases 1944 1963 bla promoter bases 2338 2436 Ampicillin b
16. Champion pET Gateway Expression Kit with Lumio Technology for expression of T7 regulated genes This strain carries the DE3 bacteriophage lambda lysogen This 1DE3 lysogen contains a Jac construct consisting of the following elements e The lacI gene encoding the lac repressor e The T7 RNA polymerase gene under control of the lacLIV5 promoter e Asmall portion of the lacZ gene This ac construct is inserted into the int gene such that it inactivates the int gene Disruption of the int gene prevents excision of the phage i e lysis in the absence of helper phage The lac repressor encoded by lacI represses expression of T7 RNA polymerase Addition of the gratuitous inducer isopropyl B D thiogalactoside IPTG allows expression of T7 RNA polymerase from the lacUV5 promoter The BL21 Star DE3 strain also contains other features which facilitate high level expression of heterologous genes For more information see page 5 Studies have shown that there is always some basal expression of T7 RNA polymerase from the lacUV5 promoter in ADE3 lysogens even in the absence of inducer Studier and Moffatt 1986 In general this is not a problem but if the gene of interest is toxic to the E coli host basal expression of the gene of interest may lead to plasmid instability and or cell death To address this problem the pET160 DEST and pET161 DEST vectors have been designed to contain a T7lac promoter to drive expression of the gene of inte
17. E coli Strains BL21 Star Strains rne131 Mutation BL21 Star DE3 pLysS Strain Note The BL21 Star DE3 E coli strain is included in each Champion pET Gateway Expression Kit with Lumio Technology for use as a host for expression Other BL21 Star strains are also available from Invitrogen see below In addition to the ADE3 lysogen that allows high level expression of T7 regulated genes see page 3 the BL21 Star strains also contain the rne131 mutation This particular TM mutation further enhances the expression capabilities of BL21 Star The rne gene encodes the RNase E enzyme an essential 1061 amino acid E coli endonuclease which is involved in rRNA maturation and mRNA degradation as a component of a protein complex known as a degradosome Grunberg Manago 1999 Lopez et al 1999 Various studies have shown that the N terminal portion of RNase E approximately 584 amino acids is required for rRNA processing and cell growth while the C terminal portion of the enzyme approximately 477 amino acids is required for mRNA degradation Kido et al 1996 Lopez et al 1999 The rne131 mutation present in the BL21 Star strains encodes a truncated RNase E which lacks the C terminal 477 amino acids of the enzyme required for mRNA degradation Kido et al 1996 Lopez et al 1999 Thus mRNAs expressed in the RNase E defective BL21 Star strains exhibit increased stability when compared to other BL21 st
18. FOL TINS oi actes De bti rien beso Bd puede teer i cat Ra tn fepe decia Ded ette Beet 22 Purifying Recombinant Fusion Proteins sssssssseseeeeeeeeenerennenenennnrtrtrtr tenerte 25 Append aa aa oid nbi aa aa a aA a e f bete dete a ie SEE dE cer iaaa 26 Recipes aouto tee iei e eon ten oot peo eh etoile Nis heit intor epi ie onion end 26 Map and Features of pET160 DEST 5 seien eeedeetee tenente the detti ta totes to do ta tete tbe binden iota to totale 28 Map and Features of pET161 DEST nri iee aee ie ea iaeaea EA Tae tette nennen tenente tenete nennen 30 Map oFBETIGUGUWTQUAT aco hd I inier epe tua ed VA oer DIM R eE UR E e Rn ER ri Hund 32 Map of pBLIGIEQWU C EET uico teasers eM erben bekennen inb revenus bei M Eeo e RATEN UMOR etd pp Debo te rop DARE vente dessus db yb 33 Technical Support nettes pati ariel aan ties hla easier n E EAA titu 34 Purchaser Notification erc te Tenn nitro deren 35 Gateway Clone Distribution Policy aeneae letto pais ruis n i iive c a ird vteie ee 39 References ene decns ot aan sad Eas erede eee eei dus ett e E Ro etg 41 iii lv Kit Contents and Storage Types of Kits This manual is supplied with the following kits TM Kit with Lumio Technology Kit Quantity Catalog no Champion pET160 Gateway Expression 20 reactions 12583 035 Kit with Lumio Technology Champion pET161 Gateway Expression 20 reactions 12583 043 TM TM Shipping Storage The Cha
19. Invitrogen by technologies Champion pET Gateway Expression Kits with Lumio Technology For inducible expression and specific detection of Lumio fusion proteins in E coli Catalog nos 12583 035 and 12583 043 Rev Date 4 August 2010 Manual part no 25 0698 MAN0000429 ii Table of Contents Kit Gonterits and Storage oii eee rege pietre Sec dre te rte decretae edet reple peret en v Accessory A KOO KETC E APEE E E E E E viii D 1 uc SUN 1 I7 Regulated ExpressiOn i aet bee ade te ime aae tete i a dee ese asas eda eges 3 BL2 VStar Ecol SUrditiosomoboe uet rodeada tcu odes da a a aaia ia deans UTC 5 The Lumio Tecbnolob yeast Ae o ere aa LV eme has odora M Iu RA Saa oo iaoea a LR Medo deuda dr E REA 6 Working with Arsenic Compounds orea onih E a E tenente etre 7 Methods rm 8 Generating an Entry Clone pnia ass ea Eee ae E E E E aa ied ein us 8 Creating an Expression Clone esni rrei i Aa E REE A E EAE EE Ia EEan EEr EEEIEE R 10 Performing the LR Recombination Reaction sssssssssssseeeeeeererennenenenenntte net tenete 13 Transforming One Shor TOP10 Competent Cells cae s orn a rta ee eost onem m Fee ttai 14 Expressing Recombinant Proteins ccccccscsessssssssssesceceseesesesesesesnsnssesescscsescecseseseseseeceeesesenesesesesesceceeesenenenens 16 Using th Lumio Green Detection Kit iiie peregi inc eta dns sd Serb era endis Va qua do 19 Analyzing Lumio Fusion
20. New Biarsenical Ligands and Tetracysteine Motifs for Protein Labeling in Vitro and in Vivo Synthesis and Biological Applications J Am Chem Soc 124 6063 6076 Carrington J C and Dougherty W G 1988 A Viral Cleavage Site Cassette Identification of Amino Acid Sequences Required for Tobacco Etch Virus Polyprotein Processing Proc Natl Acad Sci USA 85 3391 3395 Deutscher M P 1990 Guide to Protein Purification In Methods in Enzymology Vol 182 J N Abelson and M I Simon eds Academic Press San Diego CA Dougherty W G Carrington J C Cary S M and Parks T D 1988 Biochemical and Mutational Analysis of a Plant Virus Polyprotein Cleavage Site EMBO J 7 1281 1287 Dubendorff J W and Studier F W 1991 Controlling Basal Expression in an Inducible 17 Expression System by Blocking the Target T7 Promoter with lac Repressor J Mol Biol 219 45 59 Griffin B A Adams S R and Tsien R Y 1998 Specific Covalent Labeling of Recombinant Protein Molecules Inside Live Cells Science 281 269 272 Grunberg Manago M 1999 Messenger RNA Stability and its Role in Control of Gene Expression in Bacteria and Phages Annu Rev Genet 33 193 227 Kido M Yamanaka K Mitani T Niki H Ogura T and Hiraga S 1996 RNase E Polypeptides Lacking a Carboxyl terminal Half Suppress a mukB mutation in Escherichia coli J Bacteriol 178 3917 3925 Landy A 1989 Dynamic Structural
21. agree to be bound by the provisions of this license agreement You may not distribute the BL21 Star strain to others even to those within your own institution You may only transfer modified altered or original material from the cell line to a third party following written notification of and written approval from Life Technologies so that the recipient can be licensed You may not assign sub license rent lease or otherwise transfer this license agreement or any of the rights or obligation there under except as expressly permitted by Life Technologies and CNRS This license agreement is effective until terminated You may terminate it at any time by destroying all BL21 Star products in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all BL21 Star strains in your control and so notify Life Technologies in writing TM continued on next page Purchaser Notification continued Limited Use Label License No 54 ULB ccdB Selection Technology Limited Use Label License No 167 Target Sequences for Synthetic Molecules This product is the subject of one or more of U S Patent Numbers 5 910 438 6 180 407 and 7 176 029 and corresponding foreign patents and is sold under license from the Universit Libre de Bruxelles for research purposes only ccdB selection technology is described
22. and does not contain the lon protease It also has a mutation in the outer membrane protease OmpT The lack of these two key proteases reduces degradation of heterologous proteins expressed in the strain The strain carries a mutated rne gene rne131 which encodes a truncated RNase E enzyme that lacks the ability to degrade mRNA resulting in an increase in mRNA stability see page 5 TM TM The Champion pET Gateway Expression Kits with Lumio Technology are supplied with the Lumio Green Detection Kit Box 4 and the BenchMark Fluorescent Protein Standard Box 5 Refer to their corresponding manuals for detailed information pertaining to each item and a description of the reagents provided vii Accessory Products Additional Products Purification of Recombinant Protein viii Many of the reagents supplied in the Champion pET Gateway Expression TM Kits with Lumio Technology and other reagents suitable for use with the kits are available separately from Invitrogen Ordering information for these reagents is provided below Item Quantity Catalog no Gateway LR Clonase II Enzyme Mix 20 reactions 11791 020 100 reactions 11791 100 One Shot TOP10 Chemically Competent 10 x50 ul C4040 10 E coli 20x 50 ul C4040 03 BL21 Star DE3 One Shot Chemically 20 x 50 ul C6010 03 Competent E coli BL21 Star DE3 pLysS One Shot 20 x 50 ul C6020 03 Chemically Competent E coli Lumio Green D
23. and pET160 DEST or pET161 DEST to generate your expression clone We recommend including the pENTR gus positive control supplied with the LR Clonase TM II enzyme mix in your experiments to help you evaluate your results You should have the following materials on hand before beginning Purified plasmid DNA of your entry clone 50 150 ng ul in TE pH 8 0 pET160 DEST or pET161 DEST vector 150 ng ul in TE pH 8 0 LR Clonase II enzyme mix Invitrogen Catalog no 11791 020 keep at 20 C until immediately before use pENTR gus positive control optional 50 ng ul in TE pH 8 0 supplied with the LR Clonase II enzyme mix TE Buffer pH 8 0 10 mM Tris HCI pH 8 0 1 mM EDTA 2 ug ul Proteinase K solution supplied with the LR Clonase II enzyme mix thaw and keep on ice until use Add the following components to 1 5 ml microcentrifuge tubes at room temperature and mix To include a negative control set up a second sample reaction and substitute TE Buffer for the LR Clonase II enzyme mix Step 4 Component Sample Positive Control Entry clone 50 150 ng reaction 1 7 ul Destination vector 150 ng tl 1 ul 1u pENTR gus 50 ng ul z 2 ul TE Buffer pH 8 0 to 8 pl 5 pl Remove the LR Clonase II enzyme mix from 20 C and thaw on ice 2 minutes Vortex the LR Clonase II enzyme mix briefly twice 2 seconds each time To each sample above add 2 ul of LR Clonase II enzyme mi
24. ctroporator with cuvettes optional e LB plates containing 100 ug ml ampicillin two for each transformation e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned in the correct orientation reducing the number of colonies to be analyzed You may sequence your construct to confirm the orientation and reading frame if desired see next page For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of S O C Medium from Box 2 to room temperature e Warm LB plates containing 100 pg ml ampicillin at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot TOP10 cells from Box 2 for each transformation continued on next page Transforming One Shot TOP10 Competent Cells continued One Shot TOP10 Chemical Transformation Protocol What You Should See Confirming the Expression Clone Sequencing 1 Add1uglofthe LR recombination reaction from Step 6 page 13 into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down 2 Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformati
25. d ATG initiation codon at least 24 additional amino acids will be present at the N terminus of your protein see diagram on page 12 Note If you wish to express the native N terminus without the additional amino acids include a stop codon and a second ribosome binding site upstream of the ATG initiation codon in your sequence of interest see below If you wish to Then your insert express your protein with a e should contain a stop codon at the 5 end native N terminus i e without to terminate the N terminal peptide the additional N terminal e should contain a second ribosome binding amino acids site 9 10 base pairs 5 of the ATG initiation codon of your protein include the C terminal e should not contain a stop codon at the Lumio and 6xHis tags 3 end TM e should be in frame with the Lumio tag after recombination see page 12 for a diagram not include the C terminal e should contain a stop codon at the 3 end Lumio and 6xHis tags Creating an Expression Clone Introduction Experimental Outline Resuspending the Vectors Propagating the Vectors LR Clonase II Enzyme Mix 10 After you have generated an entry clone you will perform the LR recombination reaction to transfer the gene of interest into pET160 DEST or pET161 DEST to create your expression clone To ensure that you obtain the best results we recommend that you read this section and the next sect
26. e increase in molecular weight from the particular N or C terminal fusion tag in each pET Gateway vector Note that the expected sizes take into account any additional amino acids between the gene of interest and the fusion peptide see page 11 or page 12 for a diagram Vector Fusion Expected Size Increase pET160 DEST N terminal 4 kDa pET161 DEST N terminal if using the vector 2 5 kDa encoded ATG initiation codon C terminal 4kDa You may detect your fusion protein by western blotting using antibodies available from Invitrogen if desired If you are using pET160 DEST detect expression of your N terminally tagged protein using the Anti HisG Antibody Catalog no R940 25 Anti HisG HRP Antibody Catalog no R941 25 or Anti HisG AP Antibody Catalog no R942 25 If you are using pET161 DEST detect expression of your C terminally tagged protein using the Anti His C term Antibody Catalog no R930 25 Anti His C term HRP Antibody Catalog no R931 25 or the Anti His C term AP Antibody Catalog no R932 25 continued on next page 23 Analyzing Lumio Fusion Proteins continued Assay for CAT If you use the pET160 GW CAT or pET161 GW CAT positive control vector you may assay for CAT protein using CAT Antiserum available from Invitrogen see page viii for ordering information Other commercial kits are available for assaying CAT expression The molecular weight of the CAT fusion protein is ap
27. echnologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy page 39 continued on next page Purchaser Notification continued Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer Limited Use Label License No 30 T7 Expression System This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany The composition and or use of this product may be claimed
28. email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com SDS Certificate of Analysis Limited Warranty 34 Safety Data Sheets SDSs are available on our website at www invitrogen com sds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform acco
29. en to facilitate generation of entry clones For more information refer to our Web site www invitrogen com or contact Technical Support page 34 Refer to the manual for the specific entry vector you are using for detailed instructions to construct an entry clone pET160 DEST allows expression of recombinant proteins with an N terminal peptide containing the 6xHis and Lumio tags The N terminal peptide also includes a TEV protease cleavage site to enable removal of the tag after protein purification using TEV protease If you wish to Then your insert include the 6xHis and e should not contain a ribosome binding site Lumio tags and ATG initiation codon e should be in frame with the N terminal 6xHis and Lumio tags after recombination see page 11 for a diagram express your protein witha e should contain a stop codon at the 5 end to native N terminus i e terminate the N terminal peptide without the N terminal e should contain a second ribosome binding peptide site 9 10 base pairs 5 of the ATG initiation codon of your protein continued on next page Generating an Entry Clone continued Points to Consider pET161 DEST allows expression of recombinant proteins with a C terminal for pET161 DEST peptide containing the Lumio and 6xHis tags and contains a ribosome binding site and ATG initiation codon If you express your protein using the vector encoded ribosome binding site an
30. er in ADE3 lysogens can result in an increase in basal expression of T7 RNA polymerase If you are expressing an extremely toxic gene the pET construct may be unstable in BL21 Star DE3 cells Adding 1 glucose to the bacterial culture medium may help to repress basal expression of 17 RNA polymerase and stabilize your pET construct You should have the following materials on hand before beginning e Your pET DEST expression clone gt 10 pg ml e pET160 GW CAT or pET161 GW CAT positive control plasmid optional e BL21 Star DE3 One Shot cells Box 3 supplied with the kit e SO B or LB containing the appropriate antibiotic for selection plus 1 glucose if desired e 37 C incubator shaking and nonshaking e 42 C water bath e 1M isopropyl B D thiogalactoside IPTG Invitrogen Catalog no 15529 019 e Liquid nitrogen continued on next page 17 Expressing Recombinant Proteins continued Transforming To transform your construct or the positive control into BL21 Star DE3 One BL21 Star DE3 Shot cells follow the instructions below You will need one vial of cells per One Shot Cells transformation Note You will not plate the transformation reaction but inoculate it into medium for growth and subsequent expression 1 Thaw on ice one vial of BL21 Star DE3 One Shot cells per transformation 2 Add 5 10 ng plasmid DNA in a 1 to 5 ul volume into each vial of BL21 Star DE3 One Shot cells and mix by stir
31. erminal Lumio fusion proteins e Detection compatible with downstream applications such as Coomassie staining silver staining fluorescent staining western blotting or mass spectrometry analysis For more information about the Lumio Technology and the Lumio Green TM Detection Kit refer to the Lumio Green Detection Kit manual The Lumio System consists of two major components e The tetracysteine Lumio tag Cys Cys Pro Gly Cys Cys When fused to a gene of interest the Lumio tag allows the expressed fusion protein from the pET Gateway vector construct to be specifically recognized by a biarsenical labeling reagent For more information on the tetracysteine motif see below e The biarsenical Lumio Green Detection Reagent which becomes fluorescent upon binding to recombinant proteins containing the Lumio tag The Lumio Green Reagent is supplied pre complexed to EDT 1 2 ethanedithiol which stabilizes and solubilizes the biarsenic reagent TM The Lumio Green Detection Reagent binds a tetracysteine motif consisting of Cys Cys Xaa Xaa Cys Cys where Cys equals cysteine and Xaa equals any amino acid other than cysteine This motif is rarely seen in naturally occurring proteins allowing specific fluorescence labeling and detection of recombinant proteins fused to the Lumio tag In the Lumio System the optimized Cys Cys Pro Gly Cys Cys tetracysteine motif is used as this motif has been shown to have a hi
32. etection Kit 100 reactions LC6090 BenchMark Fluorescent Protein Standard 250 pl LC5928 PureLink HQ Plasmid Purification Kit 100 reactions K2100 01 Ampicillin 200 mg 11593 019 Isopropylthio B galactoside IPTG 1g 15529 019 AcTEV Protease 1000 units 12575 015 CAT Antiserum 50 ul R902 25 If your gene of interest in is frame with a C terminal or N terminal peptide containing a polyhistidine 6xHis tag you may use Invitrogen s ProBond or Ni NTA Purification System to purify your recombinant fusion protein See the table below for ordering information 10 ml polypropylene columns Product Amount Catalog no ProBond Purification System 6 purifications K850 01 ProBond Nickel Chelating Resin 50 ml R801 01 150 ml R801 15 Ni NTA Purification System 6 purifications K950 01 Ni NTA Agarose 10 ml R901 01 25 ml R901 15 Purification Columns 50 R640 50 Overview Introduction Features of the pET160 and pET161 Gateway Destination Vectors The Champion pET Expression System Introduction TM TM The Champion pET Gateway Expression Kits with Lumio Technology contain Gateway adapted destination vectors that allow high level expression of recombinant proteins in E coli and are designed for use with the Lumio Technology Using the kit facilitates sensitive and specific in gel detection of Lumio fusion proteins in polyacrylamide gels without the need for staining or weste
33. gher affinity for and more rapid binding to biarsenic compounds as well as enhanced stability compared to other characterized motifs Adams et al 2002 Coomassie is a registered trademark of Imperial Chemical Industries PLC Working with Arsenic Compounds Introduction Dermal Toxicity Evaluation Accidental Spills and Accidental Contact Disposing of the Lumio Green Reagent TM The Lumio Green Detection Reagent supplied with the Lumio Green Detection Kit is a biarsenical compound and should be handled with care Information on handling and disposing the Lumio Green Detection Reagent is described below Exercise caution when handling the Lumio Green Reagent Wear protective clothing eyewear and gloves suitable for use with dimethyl sulfoxide e g nitrile gloves when handling the Lumio Green Detection Reagent Review the Material Safety Data Sheet MSDS before handling TM A dermal toxicity evaluation of the Lumio Green Detection Reagent was independently performed by MB Research Laboratories Spinnerstown PA USA by applying a full vial of material to the mouse skin In this study no adverse reaction or toxicity was noted Although arsenic compounds are toxic this product contains 0 276 of an organic arsenic compound that shows no toxicity ata maximum dose level likely to be handled The toxicology of this material however has not been fully investigated Handle according to your chem
34. ibed in Steps 4 and 5 Proceed to Using the Lumio Green Detection Kit next page 18 Using the Lumio Green Detection Kit Introduction Lumio Gel Sample Buffer Lumio In Gel Detection Enhancer BenchMark Fluorescent Protein Standard Polyacrylamide Gel Electrophoresis Once you have finished your pilot expression you are ready to analyze the samples using the Lumio Green Detection Kit To detect Lumio fusion proteins you will add the Lumio Green Detection Reagent Lumio Gel Sample Buffer and Lumio In Gel Detection Enhancer to your cell lysates prior to electrophoresis If you have used the Champion pET Expression System before note that the protocols for preparing sample lysates have been optimized for use with the Lumio Green Detection Kit Follow the guidelines and protocols provided in this section to prepare samples for in gel detection using the Lumio Green Detection Kit For more detailed information refer to the Lumio Green Detection Kit manual The Lumio Gel Sample Buffer 4X supplied with the kit is a proprietary sample buffer containing protein denaturing and reducing agents The buffer is specifically formulated to provide optimal results with the Lumio Green Detection Reagent Always use the Lumio Gel Sample Buffer 4X to prepare samples for electrophoresis To prevent oxidation of the reducing agent in the buffer store the Lumio Gel Sample Buffer
35. ical hygiene plan and avoid contact with this material TM Treat accidental spills of the Lumio Green Detection Reagent on surfaces with 10 bleach for 10 minutes and then carefully clean up Discard arsenic containing waste according to your institution s guidelines Treat accidental contact of the Lumio Green Detection Reagent with human skin by washing excess reagent with soap and water as soon as possible Consult a physician following contact with Lumio Green Reagent Do not treat arsenic skin exposure with EDT 1 2 ethanedithiol as this may promote uptake of the Lumio Green Reagent into the body All excess reagents that contain or have come in contact with arsenic compounds should be discarded according to your institution s guidelines and all applicable local state and federal requirements In general we recommend disposing of protein samples labeled with the Lumio Green Detection Reagent and polyacrylamide gels containing protein samples labeled with the Lumio Green Detection Reagent as hazardous waste For specific disposal requirements in your area consult your safety officer Methods Generating an Entry Clone Introduction Points to Consider for pET160 DEST To recombine your gene of interest into pET160 DEST or pET161 DEST you will need a Gateway entry clone containing the gene of interest Many entry vectors including pENTR D TOPO Catalog no K2400 20 are available from Invitrog
36. ication techniques may be utilized in conjunction with ProBond or Ni NTA to purify the fusion protein see Deutscher 1990 for more information 25 Recipes LB Luria Bertani Medium and Plates S O B Medium with Antibiotic 26 Appendix Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 2 Tryptone 0 5 Yeast Extract 0 05 NaCl 2 5 mM KCl 10 mM MgCl 1 Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water 2 Make a 250 mM KCI solution by dissolving 1 86 g of KCl in 100 ml of deionized water Add 10 ml of this stock KCI solution to the solution in Step 1 3 Adjust pH to 7 5 with 5 M NaOH and add deionized water to 1 liter Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCl You may also add antibiotic if needed
37. ied and carries the bacteriophage X DE3 lysogen containing the T7 RNA polymerase gene As a condition of sale use of this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of
38. in Bernard et al Positive Selection Vectors Using the F Plasmid ccdB Killer Gene Gene 148 1994 71 74 The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity For licensing information for use in other than research please contact Out Licensing Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail This product and or its use is the subject of one or more of U S Patent Nos 5 932 474 6 008 378 6 054 271 and 6 451 569 and foreign equivalents owned by and or licensed to Life Technologies Corporation 39 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 40 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing atfL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organiza
39. in U S Patent No 5 693 489 licensed to Life Technologies Corporation by Brookhaven Science Associates LLC The T7 expression system is based on technology developed at Brookhaven National Laboratory under contract with the U S Department of Energy and is the subject of patents and patent applications assigned to Brookhaven Science Associates LLC BSA By provisions of the Distribution License Agreement granted to Life Technologies covering said patents and patent applications Life Technologies grants you a non exclusive sub license under patents assigned to BSA for the use of this technology including the enclosed materials based upon the following conditions 1 these materials are to be used for non commercial research purposes only A separate license under patents owned by BSA is required for any commercial use including the use of these materials for research purposes or production purposes by any commercial entity Information about commercial license may be obtained from The Office of Technology Transfer Brookhaven National Laboratory Bldg 475D P O Box 5000 Upton New York 11973 5000 Phone 516 344 7134 2 No materials that contain the cloned copy of the T7 gene 1 the gene for T7 RNA polymerase may be distributed further to third parties outside of your laboratory unless the recipient receives a copy of this sub license and agrees to be bound by its terms This limitation applies to strains BL21 DE3 BL21 DE3 pLysS and BL21
40. ion Kit follow these guidelines TM Load at least 1 picomole of the Lumio fusion protein Use 5 ul of BenchMark Fluorescent Protein Standard on a mini gel as a molecular weight marker Always use the Lumio Gel Sample Buffer 4X to prepare samples for electrophoresis Wear protective clothing eyewear and gloves suitable for use with dimethyl TM sulfoxide e g nitrile gloves when handling the Lumio Green Reagent Use the Lumio Gel Sample Buffer 4X in a certified fume hood Visualize the gel immediately after electrophoresis to prevent diffusion of proteins as the proteins are not fixed in the gel during Lumio detection Avoid storing the protein sample in the Lumio Gel Sample Buffer or Lumio Green Detection Reagent You should have the following materials on hand before beginning Cell pellets from Pilot Expression page 18 Lysis Buffer see page 27 for recipe 8 M urea optional 4X Lumio Gel Sample Buffer supplied with the kit Lumio Green Detection Reagent supplied with the kit Lumio In Gel Detection Enhancer supplied with the kit Water bath set at 70 C Appropriate pre cast gels and running buffer Follow the protocol below to prepare cell lysates 1 Thaw the cell pellets from the pilot expression Steps 5 and 7 page 18 and resuspend each pellet in 50 ul of Lysis Buffer see page 27 for a recipe Note To facilitate lysis you may need to add lysozyme or sonicate the cells
41. ion entitled Performing the LR Recombination Reaction page 13 before beginning To generate an expression clone you will 1 Perform an LR recombination reaction using the attL containing entry clone and the attR containing pET160 DEST or pET161 DEST vector 2 Transform the reaction mixture into One Shot TOP10 Chemically Competent E coli supplied with the kit 3 Select for expression clones refer to pages 11 12 for diagrams of the recombination region of the resulting expression clones pET160 DEST and pET161 DEST are supplied as 6 ug of plasmid lyophilized in TE pH 8 0 To use simply resuspend the destination vector in 40 ul of sterile water to a final concentration of 150 ng ul If you wish to propagate and maintain pET160 DEST or pET161 DEST we recommend using One Shot ccdB Survival T1 Chemically Competent E coli Catalog no C7510 03 from Invitrogen for transformation The ccdB Survival T1 E coli strain is resistant to CcdB effects and can support the propagation of plasmids containing the ccdB gene To maintain the integrity of the vector select for transformants in media containing 50 100 ug ml ampicillin and 15 30 ug ml chloramphenicol Note Do not use general E coli cloning strains including TOP10 or DH5a for propagation and maintenance of pET160 DEST or pET161 DEST as these strains are sensitive to CcdB effects LR Clonase II enzyme mix is available separately from Invitrogen Catalog no
42. la resistance gene bases 2437 3297 pBR322 origin bases 3442 4115 ROP ORF c bases 4486 4677 lacl ORF c bases 5989 7080 c complementary strand continued on next page 28 Map and Features of pET160 DEST continued Features of pET160 DEST pET160 DEST 7437 bp contains the following elements All features have been functionally tested Feature Benefit 17 promoter Allows high level IPTG inducible expression of your recombinant protein in E coli strains expressing the T7 RNA polymerase T7 Promoter priming site Allows sequencing of the insert lac operator lacO Binding site for lac repressor that serves to reduce basal expression of your recombinant protein Ribosome binding site Optimally spaced from the ATG initiation codon for efficient translation of PCR product N terminal 6xHis tag Allows purification of recombinant fusion protein on metal chelating resin e g ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti HisG Antibodies TM Lumio tag Cys Cys Pro Gly Cys Cys TM Allows binding of the Lumio Green Detection Reagent to facilitate in gel detection of your recombinant fusion protein Adams et al 2002 TEV recognition site Allows removal of the N terminal tag from your recombinant protein using TEV protease Carrington and Dougherty 1988 Dougherty et al 1988 attR1 and att R2 sites
43. mpion pET Gateway Expression Kits with Lumio Technology are shipped on dry ice Each kit contains five boxes see below Upon receipt store the boxes as detailed below Box Item Storage 1 pET DEST Gateway Vector 20 C 2 One Shot TOP10 Chemically Competent E coli 80 C 3 BL21 Star DE3 One Shot Chemically Competent E 80 C coli 4 Lumio Green Detection Kit 20 C protected from light 5 BenchMark Fluorescent Protein Standard 20 C protected from light pET DEST The vectors provided with the Champion pET Gateway Expression Kits with Gateway Vector Lumio Technology Box 1 are listed below Store Box 1 at 20 C Item Concentration Amount Gateway Destination Vector lyophilized in TE 6 ug pET160 DEST or pET161 DEST Buffer pH 8 0 Control Plasmid lyophilized in TE 100 ng pET160 GW CAT or pET161 GW CAT Buffer pH 8 0 continued on next page Kit Contents and Storage continued One Shot TOP10 Reagents BL21 Star DE3 One Shot Reagents vi The table below lists the items included in the One Shot TOP10 Chemically Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu ug DNA Store Box 2 at 80 C Item Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO4 20 mM glucose
44. n an entry clone containing the CAT gene and pET160 DEST CAT is expressed as a fusion to the Lumio tag The molecular weight of the CAT fusion protein is approximately 32 kDa The complete sequence of pET160 GW CAT is available for downloading from Web site www invitrogen com or by contacting Technical Support page 34 DA ATG 6xHis Lumio tag TEV attB1 CAT att2 T7 term 4 gt eG S z 5 pET160 GW CAT 6498 bp Comments for pET160 GW CAT o 6498 nucleotides BRA T7 promoter priming site bases 21 40 lac operator lacO bases 40 64 Ribosome binding site RBS bases 91 101 Initiation ATG bases 109 111 Polyhistidine 6xHis region bases 112 129 Lumio tag bases 142 159 TEV recognition site bases 169 189 attB1 site bases 196 220 CAT gene bases 241 942 attB2 site bases 916 940 T7 transcription termination region bases 966 1094 T7 reverse priming site bases 1005 1024 bla promoter bases 1399 1497 Ampicillin b a resistance gene bases 1498 2358 pBR322 origin bases 2503 3176 ROP ORF c bases 3547 3738 lacl ORF c bases 5050 6141 c complementary strand Map of pET161 GW CAT Description Map pET161 GW CAT 6518 bp is a control vector containing the chloramphenicol acetyltransferase CAT gene and was constructed using the Gateway LR recombination reaction between an entry clone containing the CAT gene and pET161 DEST CAT is expressed as a fusion to the Lumio
45. oice We recommend using the PureLink HQ Mini Plasmid Purification Kit Catalog no K2100 01 for isolation of pure plasmid DNA Note that since you are purifying a low copy number plasmid you may need to increase the amount of bacterial culture that you use to prepare your plasmid construct Ampicillin generally works well for selection of transformants and expression experiments However if you find that your expression levels are low you may want to use carbenicillin instead see below The resistance gene for ampicillin encodes the B lactamase protein which is secreted into the medium where it hydrolyzes ampicillin inactivating the antibiotic Since B lactamase is catalytic ampicillin is rapidly removed from the medium resulting in non selective conditions If your plasmid is unstable this may result in the loss of plasmid and low expression levels Carbenicillin is generally more stable than ampicillin and studies have shown that using carbenicillin in place of ampicillin may help to increase expression levels by preventing loss of the pET160 DEST or pET161 DEST expression clone If you wish to use carbenicillin perform your transformation and expression experiments in LB containing 50 ug ml carbenicillin Note If your gene of interest is highly toxic increasing the concentration of carbenicillin used from 50 ug ml to 200 ug ml may help to increase expression levels Cyclic AMP mediated derepression of the JacUV5 promot
46. on efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Qyv Qn am so 7 Spread 100 200 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend plating two different volumes to ensure that at least one plate will have well spaced colonies If you use One Shot TOP10 Chemically Competent E coli supplied with the kit the LR reaction should give gt 5000 colonies if the entire LR reaction is transformed and plated The ccdB gene mutates at a very low frequency resulting in a very low number of false positives True expression clones will be ampicillin resistant and chloramphenicol sensitive Transformants containing a plasmid with a mutated ccdB gene will be both ampicillin and chloramphenicol resistant To check your putative expression clone test for growth on LB plates containing 30 ug ml chloramphenicol A true expression clone will not grow in the presence of chloramphenicol You may sequence your construct to confirm that your gene is in frame with the appropriate N terminal or C terminal fusion tag if desired We suggest using the 17 Promoter and 17 Reverse primer sequences see below Refer to the diagram on page 11 or page
47. on spectra see above 2 Image the gel with a suitable camera with the appropriate filters using a 4 10 second exposure You may need to adjust the brightness and contrast to reduce any faint non specific bands You should see fluorescent bands of Lumio fusion proteins and the gel should have minimal background The Lumio fusion protein bands appear white or black depending on the type of imaging system used For an example of expected results refer to the Lumio Green Detection Kit manual continued on next page Analyzing Lumio Fusion Proteins continued Note Important Note Detecting the 6xHis Tag e The fluorescent signal is stable for 10 15 minutes if the gel is not exposed to UV light e The fluoresence emission of the Lumio Green Detection Reagent is in the green light region If you have a suitable imaging system with a colored camera and appropriate filters you may visualize and image the emitted green fluorescence e Longer exposure times may produce a fluorescent dye front TM Detection with the Lumio Green Detection Kit is not permanent and is lost by subsequent staining of the gel with other protein stains It is extremely important to record a permanent image of the gel prior to staining the gel with protein stains and gel drying Expression of your protein with the N and or C terminal tags will increase the size of your recombinant protein The table below lists the expected siz
48. perator T7 promoter priming site AGATCTCGAT CCCGCGAAAT TAATACGACT CACTATAGGG GAATTGTGAG CGGATAACAA RBS een TTCCCCTCTA GAAATAATTT TGTTTAACTT TAAGAAGGAG ATATACAT ATG GCT AGC TAC CGA TCG Met Ala Ser 161 ATG ACT GGT GGA CAG CAA ATG GGT ATT ATG ATT ATC ACA AGT TTG TAC TAC TGA CCA CCT GTC GTT TAC CCA TAA TAC TAA TAG TGT TCA AAC ATG Met Thr Gly Gly Gln Gln Met Gly Ile Met Ile Ile Thr Ser Leu Tyr attB1 site cd attB2 site AAA AAA GCA GGC TNN ___ NAC CCA GCT TTC TTG TAC AAA GTG GTG TTT PPT CGT CCG ANN GENE NTG GGT CGA AAG AAC ATG TTT CAC CAC Lys Lys Ala Gly Pro Ala Phe Leu Tyr Lys Val Val Lumio tag ATC AAT TCG AAG CTT GAA GCT GGT GGC TGT TGT CCT GGC TGT TGC GGT TAG TTA AGC TTC GAA CTT CGA CCA CCG ACA ACA GGA CCG ACA ACG CCA Tle Asn Ser Lys Leu Glu Ala Gly Gly Cys Cys Pro Gly Cys Cys Gly 6xHis tag I GGC GGC ACC GGT CAT CAT CAC CAT CAC CAT TGA GTTTGATCCG GCTGCTAACA CCG CCG TGG CCA GTA GTA GTG GTA GTG GTA ACT Gly Gly Thr Gly His His His His His His nod m T7 reverse priming site T7 transcription termination region AAGCCCGAAA GGAAGCTGAG TTGGCTGCTG CCACCGCTGA GCAATAACTA GCATAACCCC Performing the LR Recombination Reaction Introduction Materials Needed Setting Up the LR Recombination Reaction Once you have an entry clone containing your gene of interest you may perform an LR recombination reaction between the entry clone
49. proteins containing a tetracysteine motif i e Lumio tag Griffin et al 1998 The biarsenical reagent becomes strongly fluorescent only upon binding to the tetracysteine motif allowing specific detection of Lumio fusion proteins directly in gels For more TM information about the Lumio Technology see page 6 T7 Regulated Expression The Basis of T7 Regulated Expression Regulating Expression of T7 RNA Polymerase T7lac Promoter The Champion pET Expression System uses elements from bacteriophage T7 to control expression of heterologous genes in EF coli In pET160 DEST and pET161 DEST expression of the gene of interest is controlled by a strong bacteriophage 17 promoter that has been modified to contain a Jac operator sequence see below In bacteriophage 17 the T7 promoter drives expression of gene 10 10 T7 RNA polymerase specifically recognizes this promoter To express the gene of interest it is necessary to deliver T7 RNA polymerase to the cells by inducing expression of the polymerase or infecting the cell with phage expressing the polymerase In the Champion pET Gateway Expression Kits with Lumio Technology T7 RNA polymerase is supplied by the BL21 Star DE3 host E coli strain in a regulated manner see below When sufficient T7 RNA polymerase is produced it binds to the 17 promoter and transcribes the gene of interest The BL21 Star DE3 E coli strain is specifically included in each
50. proximately 32 kDa Removal of the If you are expressing your recombinant fusion protein from pET160 DEST you N terminal Fusion may use recombinant TEV protease available from Invitrogen see page viii for Tag Using TEV ordering information to remove the N terminal fusion tag Instructions for Protease digestion are included with the product For more information contact Technical Support page 34 Note After digestion with TEV protease twelve vector encoded amino acids will remain at the N terminus of your protein 24 Purifying Recombinant Fusion Proteins Introduction ProBond and Ni NTA Scaling up Expression for Purification Additional Purification Steps The presence of the polyhistidine 6xHis tag in pET160 DEST and pET161 DEST allows purification of your recombinant fusion protein with a metal chelating resin such as ProBond or Ni NTA ProBond and Ni NTA are nickel charged agarose resins that can be used for affinity purification of fusion proteins containing the 6xHis tag Proteins bound to the resin may be eluted with either low pH buffer or competition with imidazole or histidine e To scale up your pilot expression for purification see below TM e To purify your fusion protein using ProBond or Ni NTA refer to the manual included with each product You may download the manuals from our Web site www invitrogen com e To purify your fusion protein using another metal chelating resin refe
51. r to the manufacturer s instructions We generally scale up expression to a 50 ml bacterial culture for purification using a 2 ml ProBond or Ni NTA column Depending on the expression level of your recombinant fusion protein you may need to adjust the culture volume to bind the maximum amount of recombinant fusion protein to your column To grow and induce a 50 ml bacterial culture 1 Inoculate 10 ml of S O B or LB containing the appropriate antibiotic with a BL21 Star DE3 transformation reaction see page 25 Grow overnight at 37 C with shaking 225 250 rpm to ODeoo 1 2 The next day inoculate 50 ml of S O B or LB containing the appropriate antibiotic with 1 ml of the overnight culture Note You can scale up further and inoculate all of the 10 ml overnight culture into 500 ml of medium but you will need to adjust the bed volume of your ProBond or Ni NTA column accordingly 4 Grow the culture at 37 C with shaking 225 250 rpm to an OD6o 0 5 2 3 hours The cells should be in mid log phase Add 0 5 1 mM IPTG to induce expression Grow at 37 C with shaking until the optimal time point determined by the pilot expression is reached Harvest the cells by centrifugation 3000 x g for 10 minutes at 4 C 7 Proceed to purification or store the cells at 80 C for future use There may be cases when your specific fusion protein may not be completely purified by metal affinity chromatography Other protein purif
52. rains When heterologous genes are expressed in the BL21 Star strains from T7 based expression vectors the yields of recombinant proteins generally increase If you discover that your gene is toxic to BL21 Star DE3 cells you may want to perform your expression experiments in the BL21 Star DE3 pLyssS strain see page viii for ordering information The BL21 Star DE3 pLysS strain contains the pLysS plasmid which produces T7 lysozyme 17 lysozyme binds to T7 RNA polymerase and inhibits transcription This activity results in reduced basal levels of T7 RNA polymerase leading to reduced basal expression of T7 driven heterologous genes For more information about BL21 Star DE3 pLyssS refer to our Web site www invitrogen com or contact Technical Support page 34 Note that while BL21 Star DE3 pLysS reduces basal expression from the gene of interest when compared to BL21 Star DES it also generally reduces the overall induced level of expression of recombinant protein The Lumio Technology Advantages of the Lumio Technology Components of the Lumio System Tetracysteine Motif TM Using the Champion pET Expression Kits with Lumio the following advantages Technology provides e Lumio fusion protein sensitivity at nanogram levels e Rapid detection of Lumio fusion proteins directly in the gel without the need for staining or western blotting TM e Capable of detecting N terminal and C t
53. rding to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Information for European Customers Limited Use Label License No 5 Invitrogen Technology The BL21 Star DE3 strain is genetically modif
54. rest The T7lac promoter consists of a lac operator sequence placed downstream of the T7 promoter The ac operator serves as a binding site for the lac repressor encoded by the lacI gene and functions to further repress T7 RNA polymerase TM induced basal transcription of the gene of interest in BL21 Star DE3 cells continued on next page T7 Regulated Expression continued Expressing Toxic Genes Using TOP10 Cells TM In some cases the gene of interest is so toxic to BL21 Star DE3 cells that other E coli host strains may be required for expression For a discussion of other alternative strains that may be used see page 5 One Shot TOP10 competent E coli which do not contain T7 RNA polymerase TM TM are included in each Champion pET Gateway Expression Kits with Lumio Technology to provide a host for stable propagation and maintenance of recombinant plasmids As mentioned on the previous page the presence of T7 RNA polymerase even at basal levels can lead to expression of the desired gene even in the absence of inducer If the gene of interest is toxic to the E coli host plasmid instability and or cell death may result We recommend that you transform your Gateway LR recombination reaction into TOP10 cells for characterization of the construct propagation and maintenance When you are ready to perform an expression experiment transform your construct into BL21 Star DE3 E coli BL21 Star
55. ring gently with the pipette tip Do not mix by pipetting up and down Incubate on ice for 30 minutes Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly tape the tube on its side for better aeration and incubate at 37 C for 30 minutes with shaking 200 rpm Soy UE eS 8 Add the entire transformation reaction to 10 ml of LB containing the appropriate antibiotic and 1 glucose if desired 9 Grow overnight at 37 C with shaking Proceed to Pilot Expression below Pilot Expression 1 Inoculate 10 ml of LB containing the appropriate antibiotic and 1 glucose if desired with 500 ul of the overnight culture from Step 9 above 2 Grow two hours at 37 C with shaking ODs should be about 0 5 0 8 mid log 3 Split the culture into two 5 ml cultures Add IPTG to a final concentration of 0 5 1 mM to one of the cultures You will now have two cultures one induced one uninduced 4 Remove a 500 pl aliquot from each culture centrifuge at maximum speed in a microcentrifuge for 30 seconds and aspirate the supernatant Freeze the cell pellets at 20 C These are the zero time point samples Continue to incubate the cultures at 37 C with shaking Take time points for each culture every hour for 4 to 6 hours 7 For each time point remove 500 pl from the induced and uninduced cultures and process as descr
56. rn blotting In addition the BenchMark Fluorescent Protein Standard consists of molecular weight range proteins conjugated to a fluorescent dye to allow you to easily determine the molecular weight of your Lumio fusion protein The pET Gateway destination vectors contain the following elements e T7lac promoter for high level IPTG inducible expression of the gene of interest in E coli Dubendorff and Studier 1991 Studier et al 1990 e N terminal or C terminal Lumio tag for specific detection of recombinant proteins using the Lumio Green Detection Kit e Two recombination sites att R1 and attR2 downstream of the T7lac promoter for recombinational cloning of the gene of interest from an entry clone e N terminal or C terminal 6xHis tag for purification of recombinant fusion proteins e TEV protease recognition site for cleavage of the fusion tag from the recombinant protein of interest pET160 DEST only e lacl gene encoding the lac repressor to reduce basal transcription from the T7lac promoter in the pET Gateway vector and from the lacLIV5 promoter in the E coli host chromosome see page 3 for more information e Ampicillin resistance marker for selection in E coli e pBR322origin for low copy replication and maintenance in E coli TM The Champion pET Expression System is based on expression vectors originally developed by Studier and colleagues and takes advantage of the high activity and specificity of
57. s His 6xHis tag Lumio tag CAC CAT CAC CAT GGT GCT GGT GGC TGT TGT CCT GGC TGT TGC GGT GGC GTG GTA GTG GTA CCA CGA CCA CCG ACA ACA GGA CCG ACA ACG CCA CCG His His His His Gly Ala Gly Gly Cys Cys Pro Gly Cys Cys Gly Gly attB1 site TEV recognition site 203 I I GGC GAA AAC CTG TAT TTT CAG GGA ATT ATC ACA AGT TIG TAC AAA AAA CCG CTT TTG GAC ATA AAA GTC CCT TAA TAG TGT TCA AAC ATG TTT TIT Gly Glu Asn Leu Tyr Phe Gln Sty Ile Ile Thr Ser Leu Tyr Lys Lys TEV cleavage site Tues attB2 site l GC GGG NUN S NACCCAGCTT TCTTGTACAA AGTGGTGATA ATTAATTAAG CGT coc ANN _GENE_ NTGGGTCGAA AGAACATGTT TCACCACTAT TAATTAATTC Ala GLY duse Sek ser T7 transcription termination region TZ reverse priming site ATCAGATCCG GCTGCTAACA AAGCCCGAAA GGAAGCTGAG TTGGCTGCTG CCACCGCTGA GCAATAACTA GCATAACCCC TTGGGGCCTC TAAACGGGTC TTGAGGGGTT TTTTGCTGAA continued on next page 11 Creating an Expression Clone continued Recombination The recombination region of the expression clone resulting from pET161 DEST x Region for pET161 DEST 61 118 166 1860 1908 1961 12 entry clone is shown below Features of the Recombination Region e Shaded regions correspond to DNA sequences transferred from the entry clone into pET161 DEST by recombination Non shaded regions are derived from the pET161 DEST vector e Bases 161 and 1844 of the pET161 DEST vector sequence are marked lac o
58. tag The molecular weight of the CAT fusion protein is approximately 32 kDa The complete sequence of this vector is available for downloading from Web site www invitrogen com or by contacting Technical Support page 34 i a ATG Eley e Vl attB2 Cumio tag 6xHis M7 term 4 yo E pET161 GW CAT 6518 bp A Comments for pET161 GW CAT o 6518 nucleotides pBR3 T7 promoter priming site bases 21 40 lac operator lacO bases 40 64 Ribosome binding site RBS bases 94 101 Initiation ATG bases 109 111 attB1 site bases 154 178 CAT gene bases 199 855 attB2 site bases 872 896 Lumio tag bases 925 942 Polyhistidine 6xHis region bases 958 975 T7 transcription termination region bases 990 1118 T7 reverse priming site bases 1029 1048 bla promoter bases 1419 1517 Ampicillin bla resistance gene bases 1518 2378 pBR322 origin bases 2523 3196 ROP ORF c bases 3567 3758 lacl ORF c bases 5070 6161 c complementary strand 33 Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or
59. the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicensing lifetech com continued on next page 35 Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy 36
60. tions and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Adams S R Campbell R E Gross L A Martin B R Walkup G K Yao Y Llopis J and Tsien R Y 2002
61. tive selection of the plasmid TM Lumio tag Cys Cys Pro Gly Cys Cys TM Allows binding of the Lumio Green Detection Reagent to facilitate in gel detection of your recombinant fusion protein Adams et al 2002 C terminal 6xHis tag Allows purification of recombinant fusion protein on metal chelating resin e g ProBond or Ni NTA In addition allows detection of recombinant protein with the Anti His C term Antibodies 17 Reverse priming site Allows sequencing of the insert T7 transcription termination region Sequence from bacteriophage T7 which allows efficient transcription termination bla promoter Allows expression of the ampicillin resistance gene Ampicillin resistance gene B lactamase Allows selection of the plasmid in E coli pBR322 origin of replication ori Allows replication and maintenance in E coli ROP ORF Interacts with the pBR322 origin to facilitate low copy replication in E coli lacI ORF Encodes lac repressor which binds to the T7lac promoter to block basal transcription of the gene of interest and to the JacUV5 promoter in the host chromosome to repress transcription of T7 RNA polymerase 3l Map of pET160 GW CAT Description Map 32 pET160 GW CAT 6498 bp is a control vector containing the chloramphenicol acetyltransferase CAT gene and was constructed using the Gateway LR recombination reaction betwee
62. u a non exclusive license to use the enclosed BL21 Star strain for research or for commercial evaluation purposes only The strain is being transferred to you in furtherance of and reliance on such license You may not use the strain or the materials contained therein for any Commercial Purpose as defined below beyond a one year evaluation without a license for such purpose from CNRS If you are a commercial entity each of your laboratories is allowed a one year evaluation not free use period after which time this right automatically terminates To use any portion of BL21 Star strain for a Commercial Purpose as defined below commercial entities must obtain a commercial license from CNRS for each of their laboratories Contact information for commercial entities purchasing a BL21 Star strain will be provided to CNRS who may contact them during the evaluation period regarding their desire for a commercial license Commercial Purposes include Any use of rrie131 in a Commercial Product Any use of rne131 in the manufacture of a Commercial Product Any sale of rne131 or products having used in a commercial process the rne131 genotype Access to the BL21 Star strain must be limited solely to those officers employees and students of your institution who need access to perform the above described research or evaluation You must inform each such officer employee and student of the provisions of this license agreement and require them to
63. uch transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Life Technologies under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Life Technologies Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Life T
64. x Mix well by pipetting up and down Reminder Return LR Clonase II enzyme mix to 20 C immediately after use Incubate reactions at 25 C for 1 hour Note Extending the incubation time to 18 hours typically yields more colonies Add 1 ul of Proteinase K to each reaction Incubate for 10 minutes at 37 C Proceed to Transforming One Shot TOP10 Competent Cells next page Note You may store the LR reaction at 20 C for up to 1 week before transformation 13 Transforming One Shot TOP10 Competent Cells Introduction m XN D 4 Y Nee o i Materials Needed Note Preparing for Transformation 14 Once you have performed the LR recombination reaction you will transform your pET expression clone into competent E coli One Shot TOP10 Chemically Competent E coli Box 2 are supplied with the kit to facilitate transformation To maintain the stability of your construct we recommend that you transform your LR recombination reaction into TOP10 cells and characterize transformants in TOP10 before proceeding to expression studies using BL21 Star DE3 Expression of T7 RNA polymerase in BL21 Star DE3 may be leaky and may lead to rearrangement or loss of your plasmid You should have the following materials on hand before beginning e LRrecombination reaction from Performing the LR Recombination Reaction Step 6 previous page e S OC Medium supplied with the kit e 42 C water bath or ele

Champion™ pET Gateway® Expression Kits with Lumio™ Technology

Contents

Download Pdf Manuals

Related Search

Related Contents

Champion&trade; pET Gateway&reg; Expression Kits with Lumio&trade; Technology

Contents

Download Pdf Manuals

Related Search

Related Contents

Champion™ pET Gateway® Expression Kits with Lumio™ Technology