User Manual PrecisionX Cas9 SmartNuclease™ RNA System
Contents
1. Clustered Regularly Interspaced Short Palindromic Repeats system originally discovered in the bacterium Streptococcus pyogenes as a mechanism to defend against viruses and foreign DNA has provided yet another tool for targeted genome engineering this time taking advantage of a system that uses small RNAs as guides to cleave DNA in a sequence specific manner With its ease in designing guide sequences to target specific sequences unlike ZFNs and TALENs where construct assembly can be laborious and time consuming as well as its targeting efficiency this system has the potential to be a disruptive technology in the field of genome engineering The CRISPR CRISPR associated Cas system involves 1 retention of foreign genetic material called spacers in clustered arrays in the host genome 2 expression of short guiding RNAs crRNAs from the spacers 3 binding of the crRNAs to specific portions of the foreign DNA called protospacers and 4 Page 2 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 degradation of protospacers by CRISPR associated nucleases Cas A well characterized Type Il CRISPR system has been previously described in the bacterium Streptococcus pyogenes where four genes Cas9 Cas1 Cas2 Csn1 and two non coding small RNAs pre crRNA and tracrRNA act in concert to target and degrade foreign DNA in a sequence specific manner Jinek et al 2012 The specificity of bind2. Polymerase Mix 2ul Total reaction volume 20 ul Use 0 3 0 5 ug PCR product template or 1 yg linearized plasmid template 3 Pipette the mixture up and down gently and then microfuge tube briefly to collect the reaction mixture at the bottom of the tube 4 Incubate at 37 C 4 6 hrs 5 Add 1 wl DNase mix well and incubate 10 min at 37 C Inactivate Dnase at 75 C for 10 min or perform Dnase inactivation during purification step C Purification of guide RNA transcripts Synthesized RNA can be purified by using a spin column based method or phenol chloroform extraction followed by ethanol precipitation Lithium Chloride LiCl precipitation is a convenient and effective way to remove unincorporated nucleotides and most proteins However this method may not efficiently precipitate RNAs smaller than 300 nucleotides Therefore we do not recommend using LiCl for gRNA transcript precipitation 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual 1 Spin Column Purification Spin column based purification will remove proteins unincorporated nucleotides and salts from RNA a Adjust the volume of the reaction mixture to 100 ul by adding nuclease free water and mix well b Purify the RNA by following the spin column manufacturer s instructions 2 Phenol chloroform Extraction and Ethanol Precipitation For removal of proteins and most of the free nucleotides p
3. construct for in vitro FAASCPNON sisiane iaa ele eee aE eiaa 19 B in vitro transcription of gRNA construct s es 22 C Purification of guide RNA transcripts eeseeeeeeseeeeeeeeeee 23 D Analysis of guide RNA transcripts cceecceeeeeeseeeeeeees 24 IV Protocol for Transfection of Cas9 MRNA and guide RNA 25 A Overview of Transfection Conditions ccccccceeeeeneees 25 V Frequently Asked Questions 0 c ccceeeeeeeeeeeeeteeeeteeeeeeeeees 26 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Vi Reference S i csas cst eccendl ce a aaa ae aa aaa ai eana ETE iaaii 28 VII Technical Support ssssssseossnsssnessnessnessnesenesssssrnseressrssseese 30 VII Licensing and Warranty information eseeeeeeeeeeeee eneee 31 I Introduction A Overview of CRISPR system In the past decade a great deal of progress has been made in the field of targeted genome engineering Technologies such as designer zinc finger nucleases ZFNs transcriptional activator like effector nucleases TALENs and homing meganucleases have made site specific genome modifications a reality in many different model organisms ranging from zebrafish to mammalian cells Based on the results to date however genome editing tools that are efficient flexible and cost effective have remained elusive to the general research community The recent discovery of the type Il prokaryotic CRISPR
4. in parallel 5 If assaying for HDR of donor vector select cells with targeted insertion of donor vector using FACS based sorting of fluorescent marker or antibiotic selection e g Puro Neo using a suitable concentration of antibiotics for the targeted cell line V Frequently Asked Questions Q We prepared oligos according to the protocol ligated the oligos to the vector and transformed into competent cells Very few colonies showed up in the plate What is the reason for this 1 Please use very high efficiency competent cells for the reaction e g cells with efficiencies of gt 1 x 10 9 CFUs ug of pUC18 plasmid 2 Please make sure to not freeze thaw stock plasmid as damage to the plasmid may result Either store the plasmid at 4C for short term use 1 2 weeks or aliquot each reaction into separate tubes for storage at 20C Page 26 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Q How many guide RNA constructs do you have to design to target a DNA sequence of interest Due to the unpredictable efficacy of a particular guide RNA construct for optimal results we suggest designing multiple 2 or more constructs targeting a particular DNA sequence of interest By designing several constructs following the simple design rules outlined in Section Il B and C one has increased chances of finding a construct s to cleave target DNA with the highest efficiency Q We designed
5. reagents may end up at the top of tubes we recommend a brief spin to bring all the reagents down to the bottom of tubes before opening the tubes 3 a Set up the ligation reaction as follows Materials Amounts Linearized vector 1 ul Annealed oligo mix 3 ul 5x ligation buffer 1 ul Fast ligase 0 25 ul Total volume 5 25 ul Mix reaction well and incubate for 5 7 minutes at room temperature If you are making several constructs at the same time we strongly recommend adding ligase and buffer separately and individually to the linearized vector i e do not make and aliquot a pre mixture of ligase and buffer to the linearized vector Transformation Reaction Add a vial of competent cells to the ligation mix Place cells on ice for 15 minutes Heatshock cells at 42 C for 50 seconds then immediately transfer cells to ice for 2 minutes Add 250 ul SOC medium and incubate at 37 C for 1 hour with shaking Spread 100 ul of cultured cells on a pre warmed LB plate containing 50 ug ml Kanamycin and incubate overnight at 37 C Page 18 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 4 Confirmation of Positive Clones a Pick 1 to 2 colonies grow in LB Kanamycin medium overnight at 37 C with shaking b Next day miniprep plasmid DNAs and send for sequencing using the provided sequencing primer Note Primer provided is ready to use concentrated at 5 uM simply use 1 ul per reac
6. robustness of the Cas9 mMRNA gRNA system is illustrated by the fact that HDR events can be detected in as little as 18hrs post transfection whereas the Cas9 all in one plasmid system takes 24 48 hours before positive signals can be seen data not shown The combination of Cas9 mRNA and guide RNA presents a robust alternative to plasmid based Cas9 systems for efficient targeting and cleavage of DNA sequences especially suitable for in vivo applications 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Cas9 gRNA Production Vector Cas9 synthetic mRNA kb M_Cas9 mRNA 9 T7 Promoter AAVST QRNA 6 T7 gRNA Cloning RNA Scaffold and Production Vector es cat CAS510A 1 Seeman 3 3 Pend 2 5 Fee j AAVS1 gRNA T7 cat CAS520A 1 1s Cas9 mRNA cat CASSOOA 1 5i 3 1 Siwan 3 s os Sve 3 SVs 3 0 5 Fig 3 Ready to transfect Cas9 mRNA and guide RNAs targeting human AAVS7 prepared using the SmartNuclease T7 gRNA Synthesis Kit Hatgaag fantictteaaptecgccaty Haagactacutecage f Atai nea ga Hoanne r TG TOCECTCCAC COCACAG TOG GOCCACTAGODATCAGGATT OG IGALCAGAAAAL i i pi ETLE TTT TEETE thirty i dy kia ie Target gt m Region X X EGFP HR Donor Fragment 4 Homologous Recombination eS Fig 4 EGIP cell line targeted by Cas9 mRNA and guide RNAs for monitoring HDR efficiency of donor vector bearing EGFP fragment Page 10 ver 3 140402 www sys
7. 0bp The PCR product can be spin column purified using commercial kit s from QIAGEN or other vendors 2 Linearization Page 20 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Plasmid DNA can be linearized with EcoRI downstream of the custom gRNA to be transcribed Circular plasmid templates will generate extremely long heterogeneous RNA transcripts because RNA polymerases are very processive It is highly recommended to examine the linearized template DNA on a gel to confirm that cleavage is complete Since initiation of transcription is one of the limiting steps of in vitro transcription reactions even a small amount of circular plasmid in template prep will generate a large proportion of transcript If linearizing the template we suggest using an EcoRI restriction enzyme with no star activity such as EcoRI HF New England Biolabs for optimal results a After linearization of the template terminate the restriction digest by adding the following in order e 1 20th of initial reaction volume 50 ul of 0 5M EDTA e 1 10th of initial reaction volume 50 ul of 3M NaOAc or 5M NH40Ac e 2 volumes of ice cold 100 ethanol 100 ul b Mix well and chill at 80 C for at least 30 min c Pellet the DNA for 15 min in a microcentrifuge at 13 000rpm d Remove the supernatant re spin the tube for a few seconds and remove the residual fluid with a very fine tipped pipet e Resuspend in
8. 7 gRNA Vector Catalog CAS510A 1 Page 6 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Table 1 List of available Cas9 ready to transfect MRNA and in vitro synthesis reagents for guide RNA production Cat CAS500A 1 Description Transfection ready hspCas9 SmartNuclease mRNA Eukaryotic Version Size 20 ug CAS502A 1 Transfection ready hspCas9 SmartNuclease mRNA Prokaryotic Version 20 ug CAS504A 1 Transfection ready hspCas9 D10A SmartNickase mRNA Eukaryotic Nickase 20 ug CAS510A 1 SmartNuclease Linearized T7 QRNA vector 10 rxn CAS510A KIT SmartNuclease T7 gRNA Synthesis kit includes CAS510A 1 and T7 IVT synthesis reagents 1 kit CAS520A 1 Transfection ready Cas9 SmartNuclease AAVS1 gRNA 10 pg CAS520A 1 Transfection ready Cas9 SmartNuclease AAVS1 gRNA 10 pg CAS530G 1 Transfection ready hspCas9 T2A GFP SmartNuclease mRNA wildtype Cas9 w GFP marker 10 pg CAS531R 1 Transfection ready hspCas9 T2A RFP SmartNuclease mRNA wildtype Cas9 w RFP marker 10 pg CAS534G 1 Transfection ready Cas9 Nickase T2A GFP SmartNickase mRNA Cas9 Nickase w GFP marker 10 pg CAS534R 1 Transfection ready Cas9 Nickase T2A RFP SmartNickase mRNA Cas9 Nickase w RFP marker 10 pg 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Bios
9. Highly Efficient Targeted Mutagenesis of Drosophila with the CRISPR Cas9 System Cell Rep 2013 Jul 11 4 1 220 8 Wang H et al One step generation of mice carrying mutations in multiple genes by CRISPR Cas mediated genome engineering Cell 2013 May 9 153 4 910 8 Ran FA et al Double Nicking by RNA Guided CRISPR Cas9 for Enhanced Genome Editing Specificity Cell 2013 Sep 12 154 1 10 Vil Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site hitp www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 30 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Vill Licensing and Warranty information Limited Use License Use of the PrecisionX Cas9 SmartNuclease Expression System i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser
10. SSB ystem Biosciences PrecisionX Cas9 SmartNuclease RNA System Catalog s CAS5xxA 1 series User Manual Store at 20 C upon receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Contents L IMTODUCTIO Meien ia e avec eed enna 2 A Overview of CRISPR SYSt OM ccccceeteeeeeeeeeeeeeeeeeeeeeeeaes 2 B Product Information and Vector Maps cccccseeeeeseeeeeees 6 C Validation Data for the Cas9 RNA System s e 9 D Applications of the Cas9 SmartNuclease Expression SYSISIN EE EEE AEA a ieuu eevee CA E AE 13 E Additional Materials Required ccccccssceeeeeesseeeeeseeeenees 14 FiRelated Products oriee tire e knne EEEE E SEREEN 14 G Shipping and Storage Conditions for Kit eceeeeeenees 14 Il Protocol for guide RNA cloning into Linearized T7 gRNA VECON aeei a tists adler tial a E A tit aana AAEE eee 15 A Quick Overview of the Protocol ssesssssiseriesresrresrresnen 15 B Selection of Target DNA Sequence c cccccceseeeeereeeeees 15 C Design of Guide RNA Oligonucleotides ccceeeeeeeee 16 D Cloning into the T7 gRNA Vector sscceeeeeesseeeeeseeeeeeees 17 III Protocol for T7 based in vitro synthesis of guide RNA 19 A Preparation of custom gRNA
11. a guide RNA construct to transfect into target cells and there is no evidence of activity What are the possible reasons for this There are many possibilities of why a particular guide RNA does not show any measureable effects Some of the possibilities include the following 1 Poor transfection efficiency of target cells For certain cell types e g primary stem suspension cells passive transfection may not be very efficient In these cases active transfection systems e g NucleoFection may provide better results 2 Errors in guide RNA design The sequences of oligo duplexes targeting the DNA should be carefully checked to follow design rules 3 Mutation s in DNA sequence targeted In certain cases the DNA sequence targeted may contain mutations which affect recognition of the gRNA sequence leading to failure of cleavage It is difficult to know in advance but if it happens repeatedly it may be necessary to follow up with another gRNA sequence or perhaps sequence verifying the genomic target prior to design of gRNA constructs 888 266 5066 Toll Free 650 968 2200 outside US Page 27 System Biosciences SBI User Manual 4 Length of time before assaying We suggest a minimum of 48 hours post transfection to begin assaying for cleavage of a DNA target however in certain cases it may be useful to wait up to 1 week to observe the full effect of cleavage Q We want to perform HDR applications using the Cas9 SmartNu
12. ceipt if stored at 20 C All others CAS500A 1 502A 1 504A 1 520A 1 530G 1 531R 1 534G 1 and 534R 1 are pre synthesized mRNAs and will be shipped on dry ice Upon receiving store the components at 80 C Shelf life of the product is 1 year after receipt if stored in 80 C Page 14 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Protocol for guide RNA cloning into Linearized T7 gRNA Vector A Quick Overview of the Protocol The general workflow of cloning the custom guide RNA into the T7 guide RNA cloning vector Cat CAS510A 1 is summarized below Briefly here are the steps involved in the process 1 Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA which is 20bp upstream of the PAM 5 NGG 3 2 Anneal the two oligonucleotides to generate a duplex 3 Clone the duplex into the provided linearized T7 gRNA vector by ligation reaction 4 Transform into competent cells and grow in LB Kanamycin plate 50 ug ml 5 Confirm positive clones by direct sequencing 6 Linearize the positive construct with EcoRI or using PCR template for in vitro transcription IVT with SmartNuclease T7 gRNA Synthesis Kit Cat CAS510A KIT B Selection of Target DNA Sequence The selection of the target DNA sequence is not limited by any constraints with exception of a PAM sequence in the form of 5 NGG 3 where N any base
13. ciences SBI User Manual Table 2 List of components in Catalog CAS510A 1 SmartNuclease Linearized T7 gRNA vector Reagent Amount SmartNuclease Linearized T7 gRNA sau Vector H 5X Ligation Buffer 10 pl Fast Ligase 2 5 ul Sequencing Primer 5 uM 5 GCGGGCCTCTTCGCTATTAC 3 20m Table 3 List of components in Cat CAS510A KIT SmartNuclease T7 gRNA Synthesis Kit Reagent Amount SmartNuclease Linearized T7 gRNA i i Vector H 5X Ligation Buffer 10 pl Fast Ligase 2 5 pl Sequencing Primer 5 uM 5 GCGGGGCCTCTTCGCTATTAC 3 20 ul 2X NTP Buffer Mix 100 pl T7 RNA Polymerase Mix 20 ul T7 gRNA PCR primer mix 5 uM 50 ul DNase 2U pl 10 ul Page 8 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 C Validation Data for the Cas9 RNA System We have tested the expression and functionality of ready to transfect mRNA for Cas9 nuclease and guide RNAs Fig 3 for their ability to cleave target sequences to induce HDR directed repair in an engineered EGIP Enhanced GFP Inhibited Protein HEK2983T parental cell line Fig 4 This cell line contains a stop codon in the middle of the coding region of EGFP as well as a 53bp sequence from the human AAVS1 gene The results indicate that the mRNA and guide RNA combination is comparable to SBI s plasmid based all in one Cas9 system Fig 5 with respect to HDR efficiency The
14. clease system but we do not have the corresponding donor vectors What are our options in this case There are several options for performing HDR of a donor vector into cells that have been targeted with the Cas9 SmartNuclease system Option 1 Design an HDR donor vector containing the region of DNA to be inserted or corrected into target cells Typically this vector contains 5 and 3 arms homologous 800bp to the desired insert correction region and may contain selection or fluorescent markers for selection of cells after HDR In addition single stranded oligo donor vectors can be constructed with areas of small homology lt 50bp flanking the cutting site and containing an small oligonucleotide sequence in the middle These can be combined with Cas9 Nickase GFP or RFP expression vectors for FACS sorting to study those cells that have been successfully transfected Option 2 SBI provides a full suite of off the shelf HDR cloning vectors containing multiple MCS for cloning in of homology arms and insert sequences as well as selectable fluorescent and antibiotic selection markers Please inquire for availability of these vectors VI References Carr PA Church GM Genome engineering Nat Biotechnol 2009 Dec 27 12 1151 62 doi 10 1038 nbt 1590 Page 28 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Bhaya D et al CRISPR Cas systems in bacteria and archaea versatile sma
15. d guide RNA A Overview of Transfection Conditions 1 Plate 100 000 to 200 000 of target cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control 2 Next day or when cells are 50 60 confluent transfect target cells with the Cas9 mRNA and gRNA and appropriate donor vector if HDR is desired using a suitable transfection reagent following the manufacturer s recommended protocol for 12 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note We tested 8 1 16 1 32 1 and 64 1 ratio of Cas9 mRNA 800 ng to AAVS1 gRNA 100ng 50ng 25ng 12 5ng with 0 5 ug HR donor vector in EGIP 293T cells for HDR application All tested ratios achieved comparable HR efficiency in comparison to positive 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual control all in one plasmid system 0 5 wg EF1 hspCas9 H1 AAVS gRNA with 0 5 wg HR donor vector For other cell lines we suggest optimizing the amounts and ratios of Cas9 mRNA gRNA and donor vector for optimal results 3 Allow at least 12 hours before changing transfection media to complete growth media 4 48 72 hours after initial transfection assay for cleavage activity using Surveyor Nuclease PCR genotyping analysis or HDR activity if using donor vector
16. de RNA Oligonucleotides Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure shown below 5 AGGGNNNNNNNNNNNNNNNNNNNN 3 3 NNNNNNNNNNNNNNNNNNNNCAAA 8 Page 16 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 The top strand has an AGGG overhang at its 5 end followed by the selected target sequence The bottom strand has an AAAC overhang at its 5 end followed by a target sequence complementary to the top strand Example If your target sequence is AGCGAGGCTAGCGACAGCATAGG AGG PAM sequence then the oligo sequences would be Top strand oligo 5 AGGGAGCGAGGCTAGCGACAGCAT 3 Bottom strand oligo 5 AAACATGCTGTCGCTAGCCTCGCT 3 D Cloning into the T7 gRNA Vector 1 Anneal the two single strand DNA oligonucleotides Dilute you primer at the concentration of 10uM using dH2O and set up the annealing reaction as follows Materials Amount 10uM Top strand oligo 5 ul 10uM Bottom strand oligo 5 ul Total volume 10 ul Incubate reaction mixture at 95 C for 5 minutes can be done in PCR machine Remove the tube and leave it on bench at room temperature to cool down 10 minutes 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual 2 Ligation of Oligo Duplex into Vector Since the tubes might be placed upside down during the shipping and some of
17. henol chloroform extraction and ethanol precipitation of RNA transcripts is the preferred method a Adjust the reaction volume to 180 ul by adding nuclease free water Add 20 ul of 3M sodium acetate pH 5 2 or 20 ul of 5M ammonium acetate and mix thoroughly b Extract with an equal volume of 1 1 phenol chloroform mixture followed by two extractions with chloroform Collect the aqueous phase and transfer to a new tube c Precipitate the RNA by adding 2 volumes of 100 ethanol Incubate at 80 C for at least 30 minutes and collect the pellet by centrifugation d Remove the supernatant and rinse the pellet with 500 ul of ice cold 70 ethanol e Resuspend the RNA in 50 ul nuclease free water with 0 1 mM EDTA Store the RNA at 80 C D Analysis of guide RNA transcripts The size of the gRNA transcripts can be analyzed by running an aliquot of the reaction on formaldehyde based denaturing agarose gel Page 24 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 The concentration of the gRNA transcripts can be determined by reading the Azgo of a diluted aliquot Typically a 1 100 dilution will give an absorbance reading in the linear range of the spectrophotometer For single stranded RNA 1 Azgo is equivalent to a RNA concentration of 40 ug ml The RNA concentration can be calculated as follows A260 X dilution factor x 40 __ ug ml RNA IV Protocol for Transfection of Cas9 mRNA an
18. immediately following the target sequence The typical length of the target sequence is 20bp as shown here 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual 5 NNNNNNNNNNNNNNNNNNNNNGG 3 In order to enhance genome editing specificity hsoCas9 D10A SmartNickase mRNA CAS504A 1 can be used in complex with two gRNAs to generate double nicking with 5 overhang Please follow the guideline below for paired gRNA selection and design eae IRNAL Jr Targeting site TAGCCGTAACGAATGGCAAT 5 TSS MACERA CGTAAGCTTACGCGATGCAC 5 EEN y caz9 0108 Nickase v Nns 3 a Cas9 D10A Nickase A fae 7 D 3 GGN N TAGCCGTAACGAATGGCAAT N SGCATTCGAATGCGCTACGTG 5 5 CGTAAGCTTACGCGATGCAC gRNA2 qf 5 N 3 3 taoa OSS 5 overhang Choose your gRNA1 from the anti sense strand upstream of your targeting site Choose your gRNA2 from the sense strand downstream of your targeting site Fig 8 Schematic illustration of generating 5 overhang double strand DNA breaks using a pair of gRNAs with hspCas9 D10A Nickase Please note that only gRNA pairs creating 5 overhangs with less than 8bp overlap between the guide sequences were able to mediate detectable indel formation Ran et al 2013 To achieve high cleavage efficiency using Cas9 Nickase with paired gRNAs make sure each gRNA is able to efficiently induce indels when coupled with wide type Cas9 C Design of Gui
19. ing to the foreign DNA is controlled by the non repetitive spacer elements in the pre crRNA which upon transcription along with the tracrRNA directs the Cas9 nuclease to the protospacer crRNA heteroduplex and induces double strand breakage DSB formation Additionally the Cas9 nuclease cuts the DNA only if a specific sequence known as protospacer adjacent motif PAM is present immediately downstream of the protospacer sequence whose canonical sequence in S pyogenes is 5 NGG 3 where N refers to any nucleotide 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Streptococcus pyogenes native type II CRISPR locus Direct repeats tracrRNA x Y Y Cas9 Cast Cas2 Csn2 pe 4 Pre crRNA expression Pre crRNA O_O NANA AS NA 4 crRNA Processing by RNaselll and other enzymes DNA Double stranded Target DNA Cleavage Recognition Mediated by Cas9 Target G Protospacer Locus C tracrRNA Figure 1 Overview of the CRISPR system Figure adapted from Cong et al Multiplex Genome Engineering Using CRISPR Cas Systems Recently it has been demonstrated that the expression of a single chimeric crRNA tracrRNA transcript which normally is expressed as two different RNAs in the native type Il CRISPR system is sufficient to direct the Cas9 nuclease to sequence specifically cleave target DNA sequences By adapting the endogenous type Il CRISPR Cas system in S pyogenes for uti
20. injection into a blastocyst generating a chimeric population of cells that eventually develop into an animal with the desired genetic modifications In such applications the use of synthesized mRNA as opposed to plasmid DNA is preferred for efficient generation of transgenic organisms mRNA owing to their smaller size minimal immunogenicity and lack of genomic integration have become the modality of choice for in vivo delivery of Cas9 and targeting guide RNA Wang et al 2013 Bassett et al 2013 Shen et al 2013 The availability of transfection ready Cas9 mRNA and systems for the efficient synthesis of guide RNA will enable advancement of genome engineering for in vivo applications Taken together the RNA guided Cas9 system defines a new class of genome engineering tools creating new opportunities for research across basic sciences biotechnology and biomedicine 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual B Product Information and Vector Maps To make use of the Cas9 system more efficient affordable and convenient for applications requiring RNA based versions of Cas9 and guide RNAs SBI has developed a suite of ready to transfect mRNAs and T7 based systems for in vitro transcription of guide RNAs Table 1 T7 Promoter Kan AAVS1 gRNA T7 gRNA Cloning and Production Vector cat CAS510A 1 gRNA Scaffold Fig 2 Vector map of SmartNuclease T
21. lity in mammalian cells several groups have independently shown that RNA guided Cas9 is able to efficiently introduce precise double stranded breaks at endogenous genomic loci in mammalian cells with high efficiencies and minimal off target effects Cong et al 2013 Mali et al 2013 Cho et al 2013 Page 4 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 In addition several mutant forms of Cas9 nuclease have been developed to take advantage of their features for additional applications in genome engineering and transcriptional regulation One mutant form of Cas9 nuclease D10A functions as a nickase Jinek et a 2012 generating a break in complementary strand of DNA rather than both strands as with the wild type Cas9 This allows repair of the DNA template using a high fidelity pathway rather than NHEJ which prevents formation of indels at the targeted locus and possibly other locations in the genome to reduce possible off target toxicity effects while maintaining ability to undergo homologous recombination Cong et al 2013 Most recently paired nicking has been shown to reduce off target activity by 50 to 1 500 fold in cell lines and to facilitate gene knockout in mouse zygote without losing on target cleavage efficiency Ran et al 2013 An important application of the Cas9 CRISPR system is site specific transgenesis which allows targeted modification of embryonic stem ES cells for
22. ll RNAs for adaptive defense and regulation Annu Rev Genet 2011 45 273 97 doi 10 1146 annurev genet 110410 132430 Terns MP Terns RM CRISPR based adaptive immune systems Curr Opin Microbiol 14 321 2011 Curr Opin Microbiol 2011 Jun 14 3 321 7 doi 10 1016 j mib 2011 03 005 Epub 2011 Apr 29 Makarova KS et al Evolution and classification of the CRISPR Cas systems Nat Rev Microbiol 2011 Jun 9 6 467 77 doi 10 1038 nrmicro2577 Epub 2011 May 9 Wiedenheft B et al RNA guided genetic silencing systems in bacteria and archaea Nature 2012 Feb 15 482 7385 331 8 doi 10 1038 nature1 0886 Jinek M et al A programmable Dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 2012 Aug 17 337 6096 816 21 doi 10 1126 science 1225829 Epub 2012 Jun 28 Barrang ou R RNA mediated programmable DNA cleavage Nat Biotechnol 2012 Sep 30 9 836 8 doi 10 1038 nbt 2357 Mali P et al RNA guided human genome engineering via Cas9 Science 2013 Feb 15 339 6121 823 6 doi 10 1126 science 1232033 Epub 2013 Jan 3 Cong L et al Multiplex genome engineering using CRISPR Cas systems Science 2013 Feb 15 339 6121 819 23 doi 10 1126 science 1231143 Epub 2013 Jan 3 Shen B et al Generation of gene modified mice via Cas9 RNA mediated gene targeting Cell Res 2013 May 23 5 720 3 888 266 5066 Toll Free 650 968 2200 outside US Page 29 System Biosciences SBI User Manual Bassett AR et al
23. nuclease free water at a concentration of 0 5 1 yg pl Note Occasionally DNA from some miniprep procedures may be contaminated with residual RNase A Also restriction enzymes occasionally introduce RNase or other inhibitors of transcription When transcription from a template is suboptimal it is often helpful 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual to treat the template DNA with proteinase K 100 200 yg mL and 0 5 SDS for 30 min at 50 C followed by phenol chloroform extraction using 1 1 ratio and finally ethanol precipitation 100 ethanol of the DNA See Section III C below B in vitro transcription of gRNA construct 1 Thaw the frozen reagents Place the RNA Polymerase Enzyme Mix on ice it is stored in glycerol and will not be frozen at 20 C Vortex the 2X NTP Buffer Mix until they are completely in solution Keep the 2x NTP Buffer Mix at room temperature while assembling the reaction All reagents should be microfuged briefly before opening to prevent loss and or contamination of material that may be present around the rim of the tube 2 Assemble the transcription reaction at room temperature in the following order Reagent Amount Page 22 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Nuclease free water x ul 2x NTP Buffer Mix 10 ul Linearized Template DNA from Section III A ae T7 RNA
24. of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein 888 266 5066 Toll Free 650 968 2200 outside US Page 31 System Biosciences SBI User Manual Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet
25. own for illustration purposes D Applications of the Cas9 SmartNuclease Expression System The Cas9 RNA Expression System can be used by researchers who are interested in the following but not limited to research areas e Genome editing and engineering of model organisms e Synthetic biology applications e Gene Cell based therapy 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual E Additional Materials Required 1 LB Agar and Broth containing 50ug m Kanamycin 2 Any high transformation efficiency E coli competent cells 3 Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 4 High Fidelity DNA polymerase 5 PCR purification kit 6 RNA clean up kit 7 Transfection reagent F Related Products SBI offers a number of Homologous Recombination HR Donor Vectors please review the selection of HR Donor vectors at http www systembio com qgenome engineering precisionx HR vectors ordering Cas9 SmartNuclease AAVS1 Positive Control kit CAS605A 1 would be a good option for you to be familiar with the CRISPR Cas9 system and optimize your assay condition G Shipping and Storage Conditions for Kit PrecisionX Cas9 SmartNuclease RNA components are shipped on blue ice or dry ice depending on the components CAS510A 1 CAS510A KIT These components are shipped on blue ice and upon receiving should be stored at 20 C Shelf life of the product is 1 year after re
26. tembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 HR Integration at AAVS1 Images Bright Field Phase GFP Fluorescence hspCas9 mRNA AAVS1 gRNA T7 Donor Cas9 Nickase mRNA paired AAVS1gRNAs Donor EF1 hCas9 H1 AAVS1gRNAvector Donor Fig 5 HDR efficiency of donor EGFP fragment for Cas9 mRNA gRNA system top panel and Cas9 SmartNickase mRNA paired gRNAs middle panel compared to all in one Cas9 plasmid system bottom panel as measured by GFP positive clones at day 3 post transfection into EGIP cell line 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Cas9 T2A GFP mRNA GFP Fluorescence Bright Field 1 day post transfection 2 days post transfection Cas9 T2A RFP mRNA RFP Fluorescence Bright Field 1 day post transfection 2 days post transfection Fig 6 Transfection efficiency of hspCas9 T2A GFP top panel and hspCas9 T2A RFP mRNA bottom panel in HEK293T cells measured at day 1 and day 2 post transfection Page 12 ver 3 140402 www systembio com PrecisionX Cas9 RNA Expression System Cat CAS5xxA 1 Bright Field Phase GFP Fluorescence 2 days post transfection 5 days post transfection Fig 7 Evidence for HDR of EGFP donor vector co transfected into EGIP cell line with hspCas9 T2A RFP mRNA and AAVS1 gRNA HDR was assessed at days 2 and 5 post transfection Only the GFP channel is sh
27. these specifications SBI will replace the Product or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2014 System Biosciences SBI All Rights Reserved Page 32 ver 3 140402 www systembio com
28. tion c Align your raw sequencing data with the top strand primer sequence If sequence is verified please go to Section Ill for in vitro synthesis protocol Protocol for T7 based in vitro synthesis of guide RNA A Preparation of custom gRNA construct for in vitro transcription There are two approaches to prepare DNA template made in Section II for in vitro synthesis of the guide RNA outlined below 1 PCR of guide RNA Template The template for gRNA jn vitro transcription can be generated using a PCR reaction with the primer mix provided in the SmartNuclease T7 gRNA Synthesis kit Cat CAS510A KIT and positive gRNA_ construct generated using the SmartNuclease T7 gRNA vector in Section II Cat CAS510A 1 We recommend a typical setup with Phusion enzyme NEB as shown below in a 50 ul reaction 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Reagent Amount 5xHF Buffer 10 pl dNTP Mix 1 ul T7 gRNA PCR primer mix 5uM 5 ul aa positive T7 gRNA 10 20 ng Phusion DNA Polymerase 0 3 ul Nuclease Free H2O to 50 ul The PCR conditions for the above setup should be Cycle s Temperature Time 1 98 C 3 min 98 C 30s 30 56 C 30s 72 C 10s 1 72 C 10 min 4C hold Post reaction PCR products should be examined on an agarose gel before use to verify that the products are unique and at expected size 13
Download Pdf Manuals
Related Search