Home

Laboratory Protocols. CIMMYT Applied Molecular

1. 1 M calcium chloride Dissolve 11 0 g CaClz anhydrous MW 110 0 dH2O to a final volume of 100 ml Autoclave DNTP mix 2 5 mM each of dCTP dGTP dATP and dTTP We recommend using a deoxynucleoside triphosphate set PCR grade Roche cat 1969064 Each set comes with 4 individual tubes containing dCTP dGTP dATP and dTTP at 100 mM concentration To mix place 250 ul of each nucleotide in a 10 ml tube and add 9000 pl of sterile ddH O Sigma cat 3500 to obtain a 2 5 mM concentration of each nucleotide Make 1 ml aliquots and label each tube with different color dots red for dTTP blue for dCTP black for dATP and green for dGTP to indicate contents Store at 20 C For individual nucleotide solutions mix 250 ul of each nucleotide separately with 2 250 pl sterile ddH20 Make 200 ul aliquots and label Store at 20 C 0 1 M DTT 0 1 M dithiothreitol in sodium acetate Dissolve 1 55 dithiothreitol in 10 ml of 0 01 M 5 2 Dilute 1 10 with 0 01 M NaOAC 5 2 Sterilize by filtration Store in 100 ul aliquots at 20 C 0 5 M EDTA 8 0 Dissolve 186 12 g Na2EDTA 2H20 MW 372 24 in approx 750 ml of dH20 Add NaOH pellets to bring pH to 8 0 After EDTA is in solution bring to 1000 ml with dH2O Autoclave 10 mg ml ethidium bromide stock Dissolve 100 mg of ethidium bromide 10 ml sterile ddH2O Wrap tube in aluminum foil and store at 4 C CAUTION EtBr is extremely mutagenic 20 Laurylsarcosine Dis
2. PCR amplification labeling of probes amount da0 O eco lOXTaqbuffenMg free IX LGyeo J i9 SU glTagenzje 03U 5 pasma 5ng Bulk mix calculations for PCR amplification 25111 m mm amount 10X Taq buffer Mq free 50 mM 2mM L Glycerol dNTP mix 10 mM ea 0 5 ul 0 125 ea 5 U ul enzyme 05 U ___0 O L2uMpime2 onm 5 plasmid sng o 3 75 ul Bulk mix calculations for PCR amplification amp labeling 5 _____ 463g 1 10XTaqbuffe Mg free 1X 1 22 LsomMMggp sow dWIPmik dTTP omMes SonMexh 15H 5e3 _ 5 plasmid Entered Into Computer 5 5 4 5 E H 50 ml tube or glass bottle 1 ml per membrane per ml Om 8 volumes place 4 volumes at 65 C for Buffer 2 volume needed in each tray for washing detection etc 5 volumes place 3 volumes at 65 C 8 1 __ P mE Date SIVPFRPSSSSCRGAARRARRGFRASSSVSSEVSSSSSRERRAKKRERRB P 25 4 2 u 2 2 v 5
3. 12 Add 80 100 ul of sterile ddH2O to each reaction following completion of amplification Selective DNA amplification 13 Prepare the following 18 ul amplification reaction mix concentrations are based on a 20 ul reaction after adding 2 ul pre amplified DNA FINAL STOCK or amount 18 pl RXN ddH20 to 18 ul 11 65 ul Taq polymerase buffer 10X 1X 2 00 ul Msel select amp primer 5 uM 0 25 uM 1 00 ul Dig P stl select amp primer 2 0 1 uM 1 00 ul dNTP mix 2 5 uM each 0 2 uM each 1 60 ul MgCl 50 uM 1 5 uM 0 60 ul Taq polymerase 5 U ul 0 75 U 0 15 pl Pstl or EcoRI selective primers are commercially labeled with digoxigenin We order them as HPLC purified primers 0 2 moles scale from Operon 14 Add 18 ul of reaction mix and 3 ul of pre amplified product from step 12 and overlay each sample with 25 ul mineral oil if necessary 55 15 Amplify using following program 10 cycles of 23 cycles of 94 C for 60 sec 94 C for 30 sec 65 C to 56 C for 60 sec decreasing 1 C each cycle 56 C for 30 sec 72 C for 90 sec 72 C for 60 sec Check the amplification by loading 5 ul each of amplified DNA 2 ul 5XSGB on a 1 0 agarose gel using 100 ng oX174 Haelll as the molecular weight marker Gel electrophoresis We use a Bio Rad sequencing gel apparatus Gels can be easily poured by attaching a syringe to tubing connected to the bottom of the gel 16 17 18 19 20 21 22 23 24 25
4. Clean plates with three washes with ddH O and two washes with 70 ethanol For each wash squirt solution on the plate and wipe thoroughly with a large Kimwipes Allow to dry 5 min Using a large Kimwipes and working in a fume hood apply 1 ml of freshly prepared Bind Silane solution to the glass plate using gloves Apply 1 ml Sigmacote Sigma Cat SL 2 to the plastic plate using another pair of gloves Allow to dry 10 15 min Clean plates again with one wash of 70 EtOH Allow to dry 3 5 min Set up the mold Seal the bottom part with 5 ml acrylamide solution plus 7 5 ul of 25 APS and 7 5 ul TEMED Let it polymerize for 20 min Prepare or use already prepared 6 acrylamide solution and prepare a fresh 25 ammonium persulphate APS solution Add 80 ul TEMED and 80 pl 25 APS to 80 ml of the 6 acrylamide solution and swirl gently Do not allow bubbles to form Place comb in top in an inverted position teeth facing outward about 5 mm into the glass sandwich Be very careful not to leave any air bubbles Once the glass sandwich is full of gel solution place bulldog clamps across the top of the gel to ensure a close seal Allow at least an hour for the gel to polymerize Remove comb and wash the top of the gel sequentially with ddH5O Pre run gel at 100 W for about 1 h until plates are 50 Meanwhile prepare the samples to be loaded by adding 2 ul of DNA sequencing stop solution to 5 ul of the amplification reaction th
5. Prepare 1 5 dilution of each amplified insert at least 2 ul insert into 8 TE this will bring the concentration of the insert to within the range of the molecular markers used as explained below Load 2 pl of these dilutions with 4 ul of diluted SGB 3 1 TE 5X SGB in a medium sized 1 agarose gel Load one or two wells per comb with a mixture of molecular weight markers covering the expected range of insert sizes and insert concentrations see below A good mixture be made from Lambda HindlII and PhiX174 Haelll Use exactly 60 ng of each of these standards Run the gel at 40 mA for 2 3 h or until the bromophenol blue has migrated about 4 cm Stain well with ethidium bromide and de stain well in water Take a photograph of the gel with the wells and fragments parallel to the UV lamps of the transilluminator The exposure has to be calibrated under your conditions so that the strongest band of the molecular standards almost but does not saturate the film Estimate the amount of insert in each lane by comparing its intensity to two or three standard bands having similar molecular weights Refer to the table below for these comparisons Remember that the concentration of the insert is five times this estimate Calculate the size of the amplified inserts based on the molecular weight standards and compare these sizes with those expected from previous work 30 Molecular Weight Markers of ng band in ng band in Hi
6. The protocols included in this manual are used in CIMMYT s AMG Lab however all labs have their own particular conditions Therefore the protocols should be optimized to fit the needs of each lab We wish to thank staff members of CIMMYT s AMG Lab Seed Inspection and Distribution Unit and Corporate Communications Unit for contributing their time and expertise to producing this updated version of the manual They are Pablo Alva Galindo Claudia Bedoya Salazar Elsa Margarita Crosby Jonathan Crouch Leticia D az Huerta Susanne Dreisigacker Virginia Garc a Reyes Ana Lidia G mez Mart nez Marta Hern ndez Rodr guez Eva Huerta Miranda Hugo L pez Galicia Carlos Mart nez Flores Monica Mezzalama Ma Asunci n Moreno Ortega Silverio Mufioz Zavala Griselda Palacios Bahena Enrico Perotti Pingzhi Zhang Jean Marcel Ribaut Mark Sawkins Alberto Vergara Vergara Marilyn Warburton Manilal William Xia Xianchun and Alma McNab consultant We also recognize the valuable contributions of past CIMMYT staff who were involved in producing previous editions of the manual Diego Gonz lez de L on David Hoisington Mireille Khairallah Scott McLean and Michel Ragot We encourage readers especially those who have found the manual useful to send us their comments We also welcome any corrections and suggestions for improvement that may contribute to the success of future versions of this manual Please address your comments to Applied Mol
7. We currently use SunriseTM 96 SunriseTM 192 electrophoresis tanks from Life Technologies Cat 11068 111 and 21069 133 respectively whose 12x24 and 24x24 cm trays hold four 26 tooth and 52 tooth combs which allows us to electrophorese samples from one or two microtiter plates respectively and to load samples using a multichannel pipettor For STSs load 12 ul of each sample in a 1 5 agarose gel prepared with 1X TBE gel buffer Electrophorese in 1X TBE at 100 V constant voltage until the blue dye has migrated as required For SSRs 1 Add agarose to proper amount of 1X TBE gel buffer and record the weight of both agarose and buffer 2 Melt agarose in microwave oven mixing vigorously several times during heating Make sure all the agarose is dissolved it takes longer to dissolve than lower concentrations Weigh again and make up for the lost weight due to evaporation with ddH O and heat up more time 3 To eliminate very small bubbles created by much mixing apply some vacuum to the flask can be done by placing in a dessicator connected to the vacuum 4 Pour agarose right away into gel tray with taped ends and insert combs Allow to solidify 20 30 min You may want to cool it at 4 C for 15 min before loading your samples We also often prepare such gels one day ahead and keep them covered with Saran Wrap in the cold 5 Remove tape and either load the samples in the dry gel using a Hamilton syringe or
8. We only approximate the final volume using the markings on the Sarstedt tubes Mix the agarose water mixture by heating at 65 70 for 5 10 min Vortex and store at 4 C in tightly sealed tubes Under these conditions inserts are stable for oligolabeling for several years 69 Preparation of Frozen Competent Cells This protocol is recommended for the production of large amounts of competent cells of medium efficiency for rapid subcloning of single inserts 1 2 10 Grow overnight culture of desired strain in 5 ml of LB broth without antibiotic Dilute the overnight culture 1 100 with LB broth without antibiotic and shake at 37 C until the OD600 reaches 0 3 0 4 Transfer the cells to 250 ml centrifuge bottles and chill on ice for 10 minutes Centrifuge the cells for 7 min at 3500 rpm at 4 C Carefully discard the supernatant and re suspend the pellet by gently pipetting 5 ml of sterile ice cold 10 uM MgCl After cells re suspended add an additional 120 ml of 10 uM Centrifuge the cells for 7 min at 3500 rpm at 4 C Carefully discard the supernatant and re suspend the pellet by gently pipetting 5 ml of sterile ice cold 50 uM 20 glycerol After the cells are re suspended add an additional 5 ml of 50 uM CaCh 20 glycerol Place on ice for at least 1 h Transfer 400 ul aliquots of cells to individual sterile 500 ul microfuge tubes Quick freeze cells in a dry 1ce ethanol bath or in ethanol at
9. 25 APS 70ul 140 ul 280 ul 420 ul 560 ul TEMED 10 ul 20 ul 40 ul 60 ul 80 ul 12 Acrylamide solution for non denaturing gels STOCK 1 gel 2 gels 4 gels 6 gels 8 gels 40 acrylamide 6 ml 12 ml 24 ml 36 ml 48 ml 5X TBE 4 ml 8 ml 16 ml 24 ml 32 ml ddH20 10 ml 20 ml 40 ml 60 ml 80 ml 25 APS 70 ul 140 ul 280 ul 420 ul 560 ul TEMED 10 ul 20 ul 40 ul 60 ul 80 ul NOTE The same stock of TBE should be used to prepare both the gel and the running buffer Polymerization is caused by both the APS and TEMED Once you add those components you should quickly pour the gel The amount of APS added may be changed depending on ambient temperature and time required for polymerization 46 CAUTION TEMED is highly flammable and corrosive wear a labcoat eye protection and gloves when handling 6 Acrylamide solution for denaturing gels STOCK FINAL 200 ml 300 ml 600 ml 1000 ml Urea 42 84 09 126 0 g 252 0 g 420 0g 10X TBE 1X 20 0 ml 30 0 ml 60 0 ml 100 0 ml 4095 acrylamide 6 30 0 ml 45 0 ml 90 0 ml 150 0 ml ddH20 to 200 0 ml to 300 0 ml to 600 0 ml to 1500 0 ml Filter in a millipore disposable filter unit Can be kept at 4 C in the dark for future use for 1 2 months We buy 19 1 acrylamide bisacrylamide from Sigma Cat A 2917 and prepare the 40 acrylamide stock in bottle to avoid having to weigh the acrylamide and bisacrylamide separately This is a safer way to prepare the solution 10 Ethanol with 0 5 ml 100 ml acetic ac
10. 80 C and store at 80 C until use 10 mM MgCl STOCK 100 ml 200 ml 300 ml 400 ml 500 ml 1 0 M MgCb 1ml 2ml 3 ml 4 ml 5ml ddH20 99 ml 198 ml 297 ml 396 ml 495 ml 50 mM 20 glycerol STOCK 100 ml 200 ml 300 ml 400 ml 500 ml 1 0 M CaCb 5ml 10 ml 15 ml 20 ml 25 ml Glycerol 20 ml 40 ml 60 ml 80 ml 100 ml ddH20 75 ml 150 ml 225 ml 300 ml 375 ml 70 Preparation of Fresh Competent Cells This protocol is recommended for the production of fairly high efficiency competent cells for reliable cloning of single inserts from digested genomic DNA in library construction experiments If available we also recommend the use of commercially available competent cells for library construction These cells are excellent for subcloning experiments 1 ON 22299 255 Grow overnight culture of desired strain in 10 ml of LB broth without antibiotic 2 days before the intended use of the cells Dilute 1 5 ml of the overnight culture into 40 ml of LB broth preheated to 37 C Shake at 37 C until the OD600 reaches 0 4 0 6 about 2 5 3 0 h Transfer the cells to a 50 ml centrifuge tube e g Corning and chill on ice for 20 min Centrifuge the cell suspension for 15 min at 3000 rpm at 4 C Carefully discard the supernatant and re suspend the pellet by gently pipetting 20 ml of sterile ice cold 50 uM CaCl Use the tip of the pipette to gently re suspend the cells Chill on ice for 20 min Centrifuge the cell suspension for 1
11. Allow to transfer overnight 16 18 hours It is a good idea to carefully remove the bottom layer of wet paper towels after the stack has absorbed 5 8 cm of transfer buffer NOTE If sponge is used remove and wring out buffer after 4 5 hours of transfer Remove matrix and immediately place in 2X SSC With a gloved hand gently rub off any agar particles Wash blot for 15 min shaking in 2X SSC Air or drip dry until moist but not wet usually 2 5 min do not allow to dry Place membrane on a moist filter paper and UV cross link in Stratagene UV Crosslinker using auto setting 120 000 ujoules cm Bake at 95 C on or between clean filter paper for 1 5 2 h Briefly check transfer under UV light If membrane was not previously labeled label with a permanent marker pen or pencil on DNA bound side If blot is not going to be used for a week or more store between clean filter paper in a sealed plastic bag in a cool dry place can be stored at 4 C Denaturation solution 0 4 NaOH 0 6 M NaCl 1 liter gel STOCK 1 liter 5 liters 10 liters 20 liters 40 liters NaOH MW 40 00 16 0g 80 00 160 00 320 0 g 640 0 g NaCl MW 58 44 35 09 175 39 350 60 701 30 1402 6 g Dissolve the NaCl first then the NaOH to avoid precipitate formation Neutralization solution 0 5 M Tris 7 5 1 5 M NaCl 1 liter gel STOCK 1 liter 5 liters 10 liters 20 liters 40 liters Tris HCI MW 156 60 63 50 317 50 630 50 1270 00 2540 0 g Tris base MW 121 10 11 89
12. Load the wells of the gel to the top of the second layer It typically takes 50 to 60 ul to fill each well 6 Run samples into gel at 100 mA for 5 10 min then run at 25 mA constant current until the bromophenol blue dye has migrated to just above the next set of wells Typically the gel will be done after 14 16 hours Resolution can be improved by recirculating the buffer 7 Remove tray from rig Place the double thick gel in a large tray with 1X gel buffer from the run to almost cover the gel Split the gel layers at the corner of the double gel with a thin spatula Then starting at this split slowly run a 1 ml glass pipette between the two layers at a slight angle Hold the pipette firmly at both ends with two hands and slide it until the two gel layers come apart Take care not to break the gel along the wells 8 Stain each gel in 1 ug ml ethidium bromide 100 pl of 10 mg ml ethidium bromide in 1000 ml dH O for 20 min with gentle shaking CAUTION Ethidium bromide is extremely mutagenic so wear double gloves when handling and use extra precaution 9 Rinse gel in dH O for 20 min slide gel onto a UV transilluminator and photograph For a Fotodyne PCM 10 camera with a 20 x 26 cm hood and Type 667 Polaroid film use an f8 or f5 6 1 second exposure 10X TAE gel buffer see previous protocol 19 RFLP Flow Chart Plant Genomic DNA Harvest Leaf Tissue Y Ligation Lyophilization Y Clone into Vector Dried Leaf Tissue Y Transf
13. The default is 1 50 If your samples are diluted to something other than 1 50 enter the correct number and press ENTER To enter the default simply press RNA FACTOR The final DNA concentration is divided by this RNA factor to correct for RNA in the sample The default RNA factor is 1 indicating that RNase was used on the sample and no RNA is present Otherwise a factor of 5 1s generally used for maize Enter the desired number and press ENTER To enter the default simply press ENTER RESUS VOLUME At what volume is your final sample from which the aliquots were taken The default value is 1500 ul Enter the desired number and press ENTER To enter the default simply press FINAL pg pl 77 To what concentration would you like your sample from which this aliquot has been taken to be diluted The default 15 0 2 ug ul Enter the desired number and press ENTER To enter the default simply press ENTER You will be asked to insert a blank The blank is whatever liquid you have used to dilute your sample aliquot This will be used to calibrate the instrument Press This is very important since all future calculations will depend upon it You will then be asked to insert each sample Press and the spectrophotometer will sip the sample calculate concentrations and request the next sample This will continue indefinitely until PROG is pressed Once all of your samples have been chec
14. as it is a very expensive test to run Summary of all transgenic events present in maize approved for field testing and whether each is currently being produced for market in any country as of November 29 2002 Company Gene s Promoter s Terminator s Marketed Event Syngenta cry1Ab 355 355 j 5 EINEN WE DAM 512del al bla bp none X4334CBR cry1Ab 355 NOS X4734CBR 2 1 351 Aventis bar NOS 9 355 bla bp none No ddl DeKalb tDNA Tr7 ppll Monsanto j Monsanto ee cry1Ab EPSPS neo MON802 Monsanto GOXv247 cry1Ab EPSPS neo MON809 Pioneer GOXv247 xs NOS No cry1Ab 35S NOS bp none EPSPS 355 NOS neo bp none neo 355 NOS E barnase 29 Aventis bar 355 bla te EIS ISI EPSPS 355 NOS ee DE 1 bla bp none 1 2 Ubiquitin ORF25 Protocols for detecting transgenic DNA sequences via PCR Populations to be tested are screened for the presence of the CaMV 35S promoter and bar coding sequence which are fragments of DNA found in most commercial transgenic maize and not known to exist naturally in the maize genome Harvest single leaves from each plant in each population and extract DNA from the leaves according to the sap extraction protocol in this manual see p 5 Quantify and mix DNA in the same tube to form bulks of 10 to 15 plants each Amplify the mixtures using the polymerase chain reaction PCR the most
15. 0 ml 21 0 ml 15 0 ml 0 250 1 0g 0 5 ml 1 Use freshly made warm buffer to 60 65 C before adding the CTAB and BME 2 We recommend using Sigma PVP catalog PVP 40 polyvinyl pyrrolidone with 40 000 average molecular weight 3 CTAB Mixed alkyltrimethyl ammonium bromide Sigma M 7635 Add BME B mercaptoethanol just prior to use under a fume hood 100 ml 17 0 ml 10 0 ml 42 0 ml 30 0 ml 0 50 20g 1 0 ml 200 ml 34 0 ml 20 0 ml 84 0 ml 60 0 ml 1 0g 4 0g 2 0 ml Small Scale Extraction of High Quality DNA The grinding of fully lyophilized leaf tissue before extraction can give very high quality DNA in quantities that depend on the methods used The large scale grinding and extraction process used on page for RFLPs can be conveniently scaled down to grinding in a coffee grinder or by using small metal beads in a 1 5 ml tube These methods provide a cheap fast and easy way to obtain small to medium amounts of very high quality DNA Lyophilization 1 Harvest the youngest fully mature leaf from plants grown in the greenhouse or field It is best to use young plants without necrotic or damaged areas but mature plants may be used if they are not yet beginning to senesce The final amount of DNA needed will determine which of the two procedures stainless steel balls or coffee grinder you will use Each uses a different amount of leaf tissue When material is scarce or only very low quantities of DNA are needed from e
16. 100 120V for 3 5 h ATTO AE 6220 electrophoresis system 13 x 14 cm 1 mm thick 1 How to set up glass plates Assemble glass plates and sealers using clamps Be sure the sealers are at the appropriate position between the two glass plates to avoid leaking Two gels can be set in one apparatus Three types of combs are available 14 20 and 28 wells We use combs with 28 wells so that multi channel pipettes fit to every other well This is very convenient when a large number of samples has to be loaded 2 Gel preparation Non denaturing gels Since fragment size by most SSR primers is 80 300 bp we recommend using 12 of 29 1 acrylamide as a starting point Concentration may be reduced e g to 896 or increased e g to 16 for larger or smaller fragments respectively Denaturing gels We use 696 of 19 1 acrylamide with 4296 urea same as in sequencing gels One gel requires 20 ml of acrylamide solution Prepare appropriate amount of acrylamide solution according to the number of gels to be run Insert combs between the plates immediately after casting the acrylamide solution into the assembled plates At room temperature the acrylamide solution is polymerized within 20 min CAUTION Acrylamide is a neurotoxin and should be handled in a fume hood wear a labcoat eye protection and gloves when handling and use extra precaution One electrophoresis tank requires about 1 liter of 1X TBE Place the plates with gels in the appar
17. 268 07 in dH2O to a final volume of 1000 ml Autoclave 75 1 M NaH PO 1 M sodium phosphate monobasic Dissolve 138 g of sodium phosphate monobasic monohydrate MW 137 99 dH20 to a final volume of 1000 ml Autoclave 0 1 M spermidine Dissolve 1 9 spermidine MW 145 2 Sigma 52626 in ddH20 to a final volume of 69 ml Filter sterilize and aliquot into 5 ml tubes Store at 20 C working stock may be stored at 4 C 2X SSC 3 7 M NaCl 0 375 M Na Citrate pH 7 4 STOCK 10 liter 20 liter NaCl MW 58 44 175 20 350 40 Na Citrates2H20 88 00 176 0 MW 294 10 Adjust pH to 7 4 Autoclave 25X SSC 3 7 M NaCl 0 375 M Na Citrate pH 7 4 STOCK 1 liter 2 liter 3 liter 4 liter 5 liter NaCl MW 58 44 219g 438 g 657 g 876 g 1095 g Na Citrates2H20 110g 220 330 g 440 g 550g MW 294 10 Adjust pH to 7 4 Autoclave STE Sodium Tris EDTA buffer pH 8 0 STOCK FINAL 100 ml 200 ml 300 ml 400 ml 500 ml 1M Tris 8 0 10 mM 1 0 ml 2 0 ml 3 0 ml 4 0 ml 5 0 ml 0 5 M EDTA 8 0 1 mM 0 4 ml 0 8 ml 1 2 ml 1 6 ml 2 0 ml 5M NaCl 100 mM 2 0 ml 4 0 ml 6 0 ml 8 0 ml 10 0 ml 1M Tris pH 7 5 8 0 or 9 5 Dissolve 121 g Tris Base in approx 750 ml dH O Add conc until desired pH is reached 75 ml HCI pH 7 5 49 ml HCI pH 8 0 Bring solution to 1000 ml with dH2O Autoclave TE 8 10 mM Tris 8 0 1 mM EDTA pH 8 0 STOCK 50 ml 100 ml 500 ml 1000 ml 1M Tris 8 0 0 5 ml 1 0 ml 5 0 ml 10 0 ml 0 5 M EDTA 8 0 0 1 0 2 1
18. 47 C NOTE Each pair of primers has an optimal annealing temperature that should be determined from their sequences For SSRs we have been able to amplify most at X 60 C annealing temperature with the standard program and Z 57 C for the touchdown program Therefore we start testing new primers at these temperatures If satisfactory amplification does not occur we either reduce or increase the temperature by 4 5 C The touchdown program may eliminate some unspecific bands compared to the standard program 7 Add 3 4 ul 5X SGB to each tube and load on the desired gel system Sigma s Cell Culture Water Cat W 3500 It is essential to determine optimal concentrations of MgClo and Taq with each new lot of enzyme and DNA from species to be analyzed Glycerol is an optional addition to the reaction In general it favors the amplification of large products To make it easier to pipette the required volume warm the tube before pipetting Both forward and reverse primers are present in the same tube Conditions optimized for ERICOMP TwinBlock MJ Research DNA Engine Tetrad System Thermocyclers 39 Gel electrophoresis The choice of the gel electrophoresis system to be used and of its various components depends on the expected size of the amplification product s on the resolution required to clearly see the difference in size among the amplified products and to a lesser extent on the intensity of the amplified products
19. 7 0 ml 14 0 ml 28 0 ml 70 0 ml 84 0 ml 0 5 M EDTA 8 0 50 mM 1 0 ml 5 0 ml 10 0 ml 20 0 ml 50 0 ml 60 0 ml CTAB 1 019 0 5g 109 2 09 5 09 6 09 14 140 mM 0 1 ml 0 5 ml 1 0 ml 2 0 ml 5 0 ml 6 0 ml 1 Use freshly made warm buffer to 60 65 C before adding the CTAB and BME 2 CTAB Mixed alkyltrimethyl ammonium bromide Sigma M 7635 3 Add BME B mercaptoethanol just prior to use under a fume hood WASH 1 76 EtOH 0 2 M NaOAc STOCK 100 ml 200 ml 300 ml 400 ml 500 ml Absolute EtOH 76 ml 152 ml 228 ml 304 ml 380 ml 2 5 M NaOAc 8 ml 16 ml 24 ml 32 ml 40 ml dH20 16 ml 32 ml 48 ml 64 ml 80 ml WASH 2 76 EtOH 10 mM NH OAc STOCK 100 ml 200 ml 300 ml 400 ml 500 ml Absolute EtOH 76 ml 152 ml 228 ml 304 ml 380 ml 1M NH4OAc 1 ml 2ml 3 ml 4 ml 5 ml 23 ml 46 ml 69 ml 92 ml 115 ml CHLOROFORM OCTANOL 24 1 STOCK 100 ml 200 ml 300 ml 400 ml 500 ml Chloroform 96 ml 192 ml 288 ml 384 ml 480 ml Octanol 4 ml 8 ml 12 ml 16 ml 20 ml DNA extraction from small amounts of lyophilized tissue To extract DNA from small amounts of lyophilized tissue 50 mg use 2 ml tubes and proceed as follows 1 Add 1 ml of CTAB buffer 2 Incubate for 60 min with continuous movement 3 Remove tubes from incubator let them cool and add 1 ml of chloroform octanol Mix for 10 min 4 Centrifuge for 10 min 5 Remove 700 ul of the top aqueous layer 6 Add 10 ul of 10 mg ml RNase A Mix and incubate for 30 min 7 Add 1 ml of isopropanol and
20. Adaptors 50 ul Pre amp primers 75 ul Amplification primers 100 ul 27 3 Keep ligations and pre amplifications in the freezer 20 Adaptor sequences Msel 1 5 GACGATGAGTCCTGAG 3 Msel 2 5 TACTCAGGACTCAT 3 EcoRI 1 5 CTCGTAGACTGCGTACC 3 EcoRI 2 5 AATTGGTACGCAGTC 3 Pstl 1 5 GACTGCGTAGGTGCA 3 Pstl 2 5 CCTACGCAGTCTACGAG 3 Primer sequences Pre amplification primers Msel N 5 3 EcoRI N 5 GACTGCGTACCAATTON 3 5 GACTGCGTAGGTGCAGN 3 Selective primers we use 3 3 but you can try 2 3 or 2 2 Msel NNN 5 3 EcoRI NNN 5 GACTGCGTACCAATTCNNN 3 Pstl NNN GACTGCGTAGGTGCAGNNN 3 6 acrylamide solution STOCK FINAL 200 ml 300 ml 600 ml 1000 ml Urea 42 84 00 126 00 252 00 420 00 10 1 20 0 ml 30 0 ml 60 0 ml 100 0 ml 40 acrylamide 6 30 0 ml 45 0 ml 90 0 ml 150 0 ml ddH20 to 200 0 ml to 300 0 ml to 600 0 ml to 1500 0 ml Filter in a millipore disposable filter unit The solution can be kept for 1 2 months at 4 C in the dark for future use We buy 19 1 acrylamide bisacrylamide from Sigma Cat A 2917 to prepare the 4096 acrylamide stock in bottle We thus avoid having to weigh the acrylamide and bisacrylamide separately This is a safer way to prepare the solution Bind Silane solution STOCK FINAL 1 0 ml 2 0 ml 5 0 ml 45 ul 90 ul 225 ul Glacial acetic acid 5 ul 10 ul 25 ul Absolute al
21. DNA by passing through a 22 gauge needle 3 4 times Denature by placing in boiling water for 10 min followed by cooling on ice Aliquot and store at 4 20 SDS 20 sodium dodecyl sulphate Dissolve 200 g lauryl dodecyl sulfate sodium salt MW 288 40 by adding it little by little to 800 ml After complete dissolution adjust to final volume of 1000 ml A low grade Sigma L5750 may be used for HYB washes etc and a better grade Sigma L4390 for HYB solution plasmid preps stop solutions etc Prepare the solution in a fume hood and wear gloves and goggles 5X SGB Sample gel buffer STOCK FINAL 50 ml 100 ml 1M Tris 8 0 50 mM 2 5 ml 5 0 ml 0 5 M EDTA 8 0 5 mM 0 5 ml 1 0 ml Sucrose 25 1259 2509 2 mg ml 100 0 mg 200 0 mg Xylene cyanole optional 2 mg ml 100 0 mg 200 0 mg up to 50 0 ml up to 100 0 ml BPB Bromophenol Blue sodium salt 2 5 M NaOAc 2 5 M sodium acetate Dissolve 20 5 g sodium acetate anhydrous MW 82 03 in dH20 to a final volume of 100 ml Autoclave 5 M NaCl 5 M sodium chloride Dissolve 292 2 g NaCl MW 58 44 in dH20 to a final volume of 1000 ml Autoclave 1 M NaOH 1 M sodium hydroxide Dissolve 40 g NaOH MW 40 00 in dH20 to a final volume of 1000 ml Autoclave Best to weigh approx 40 g of pellets and then determine correct final volume for a 1 N solution 1 M 1 M sodium phosphate dibasic Dissolve 268 g of sodium phosphate dibasic heptahydrate MW
22. DNA with 1 ml 1x original TE volume of chloroform octanol Centrifuge the sample 10 min at 1300 x g in swinging bucket rotor Transfer top aqueous layer to new 5 ml tube Continue with step 15 of OPTION B OPTION B Ethanol precipitation 14 Place hook with DNA in 5 ml plastic tube containing 1 ml of TE gently twirl hook until DNA slides off the hook Cap tubes and rock gently overnight at room temperature to dissolve DNA 15 Precipitate DNA by adding 50 ul of 5 M NaCl and then 2 5 ml absolute EtOH 2 5 original TE volume mix by gentle inversion 16 Remove precipitated DNA with glass hook Continue with step 17 of OPTION C OPTION C DNA washes 17 Place hook with DNA in 5 ml plastic tube containing 3 4 ml of WASH 1 Leave DNA on hook in tube for about 20 min 18 Rinse DNA on hook briefly in 1 2 ml of WASH 2 and transfer DNA to 2 ml microfuge tube preferably Sarsted with screw on lids to avoid possible evaporation of the TE containing 0 3 1 0 ml TE based on experience we use 0 3 0 5 ml for maize and 0 5 1 0 ml for wheat gently twirl hook until DNA slides off the hook Cap tube and rock gently overnight at room temperature to dissolve DNA Store samples at 4 C CTAB extraction buffer 1 RXN 5 RXN 10 RXN 20 RXN 50 RXN 60 RXN STOCK FINAL 10 ml 50 ml 100 ml 200 ml 500 ml 600 ml dH20 6 5 ml 32 5 ml 65 0 ml 130 0ml 325 0 ml 390 0 ml 1M Tris 7 5 100 mM 1 0 ml 5 0 ml 10 0 ml 20 0 ml 50 0 ml 60 0 ml 5 M 700 mM 1 4 ml
23. In our laboratory we have tried horizontal agarose gels of different concentrations and various ratios of higher quality normal quality agarose small polyacrylamide vertical gels with different concentrations and ratios of acrylamide bisacrylamide stained with ethidium bromide and silver nitrate denaturing polyacrylamide sequencing gels with silver staining and separation of fluorescently labeled products through an automatic sequencer The latter two systems have not yet been optimized under our conditions Below are the conditions we have been using for both agarose and small non denaturing denaturing polyacrylamide gel electrophoresis PAGE Some general rules we follow e Use agarose gels for STSs due to the larger fragment sizes e For SSRs used for genetic diversity fingerprinting purposes always use PAGE due to the required higher resolution e For SSRs used in mapping studies we start by screening parental lines for polymorphisms on agarose gels and rerun on polyacrylamide only the SSRs with such small differences or low intensity that they are not clearly seen on agarose gels Agarose gel electrophoresis Factors you should consider when deciding on the type and size of agarose gels to be used e Agarose concentration depending on the size of the amplified products typically we use 1 5 for larger fragments 200 3500 bp such as STSs and 4 for smaller fragments under 400 bp such as SSRs e Migration distance and ratio
24. bag 15 20 leaves can be placed in the same bag Keep the samples cool until they can be frozen but freeze as soon as possible Freeze in the 80 C freezer overnight or using liquid nitrogen For the analysis of populations via bulks we recommend the use of 15 plants which must be the same age Cut the youngest fully mature leaf of each one with a size at 10 cm in longitude The size and maturity of the leaves must be exactly the same as the quantity of DNA depends on both factors and equal quantities of DNA must be extracted from each plant Glassine bags with samples can be stored in a sealed plastic bag at 80 C until lyophilized Keep samples in the freezer for at least 12 h unless liquid nitrogen is used to accelerate the procedure samples can be placed in the lyophilizer directly from the liquid nitrogen Samples must not thaw before lyophilization Transfer samples to the lyophilizer Be sure the lyophilizer chamber is at 60 C at all times Verify the proper vacuum level has been reached after loading the samples and that a vacuum level of 100 microns is maintained Do not overload the chamber Samples typically dry in 72 hours but may take longer if many satellite chambers are placed in the lyophilizer Dried leaf samples may be stored at room temperature for a few days in a sealed plastic bag They may be stored for longer periods at 20 C Grinding Stainless steel balls 1 The stainless steel balls used i
25. dark Filter and save CSPD solution between uses in refrigerator in a bottle wrapped in aluminum foil Remove each membrane from the CSPD tray slowly letting solution drip off the membrane then place DNA side down on top of GladWrap or similar plastic wrapping film You can do several membranes in a row on a long stretch of film secured to a table with tape Blot excess solution with filter paper place another sheet of GladWrap on top back side of membranes and add a sheet of thin acetate to facilitate handling Cut GladWrap between membranes and seal edges on back side of each membrane Place membranes in cassettes and expose to XAR 5 X ray film overnight 15 18 h NOTE When developing this protocol the long exposure was sought to facilitate simultaneous handling of several dozen large membranes it also provides a natural overnight break for the worker in charge Develop X ray film for 6 min in Kodak developer rinse in for 30 sec fix in GBX fixer for 3 min and rinse for 3 min in running H5O NOTE If signal is weak at least some faint bands can be seen the membranes can be incubated higher strength CSPD and re exposed starting with Buffer 3 step 9 wash above To ensure longer life of the membranes as well as successful stripping of the probe immediately remove membranes from their plastic wrap and immerse in 0 1X SSC 0 196 SDS Highest stringency wash or in 2X SSC a tray at RT DO NOT ALL
26. each gel layer contains about the same amount of DNA per lane There are at least two reasons for running double thick gels it cuts in half the number of potential loading mistakes and doubles the output of membranes given a fixed number of double thick gels In our lab one person can load run and blot a maximum of four double thick gels in one and a half working days This represents a total output of 4 x 2 x 120 960 lanes for analysis 1 Add agarose to total amount of 1X TAE gel buffer Gel size Agarose 0 7 Total 1X gel buffer First layer Second layer Sample volume 20 x 25cm 4 62 g 660 ml 280 ml 380 ml 50 ul 2 Meltin microwave oven mixing several times during heating Cool to 55 C container can be placed in cool water to speed cooling keeping covered to avoid evaporation 3 Tape the ends of gel tray so that the tray will be able to accommodate 2 layers Pour the indicated first layer amount of agarose measured in a clean warmed graduated cylinder into tray and then insert combs Allow it to solidify for 20 30 minutes 4 Allow second layer of gel solution to cool to 55 C and pour over first layer Pour the solution slowly gradually moving back and forth across the bottom end of the gel rig so as to avoid melting a hole in the bottom layer Allow it to solidify for 20 30 minutes 5 Remove tape and place tray in rig Pour enough 1X gel buffer into the gel rig to cover the gel then remove combs and load samples into the wells
27. for at least 30 seconds before testing Multiple seed extraction The use of a blender Osterizer or a coffee grinder ball mill etc with an appropriate jar is recommended to grind bulked seed samples Put the number of seed indicated by the kit protocol in the grinding device grind the seed to a powder shake the jar to mix and check for unground seed Transfer the ground powder to a container and weigh the specified amount sub sample add the recommended extraction buffer ratio close the container and shake it for 10 15 seconds Let it sit for at least 30 seconds before testing Use only the supernatant top layer of liquid for testing For better results centrifuge the extracted sample at 5000 g for 5 minutes to obtain a cleaner supernatant Testing protocol Follow the protocol that comes with the kit Read it beforehand and make sure you have everything you need handy buffers controls loading diagram micropipettes etc 64 Sample loading diagram ELISA loading diagram Date Experiment Plate ID Operator Event Kit Sample dilution mommocoonuwuv Sample identification 1 5 9 1B 5B 9B 1C 5 9C 1D 5D 9D 1E 5E 9E 1F 5F OF 1G 5G 9G 1H 5H 9H 2A 6A 10A 2B 6B 10B 2C 6C 10C 2D 6D 10D 2E 6E 10E 2F
28. in a cooler during transportation to the laboratory Individual leaf sample Weigh each leaf sample and place in an extraction bag with the proper amount and type of extraction buffer as indicated by the kit protocol Be sure to label each bag clearly Grind each l Kits are commercially available from AGDIA http www agdia com ENVIROLOGIX http www envirologix com artman publish cat index 2 shtml and NEOGEN http www neogeneurope com 63 sample with the help of a tissue homogenizer pestle until all sap is extracted The extracted sap can be used immediately or stored for a few hours at 4 C or frozen at 20 C for a few days Multiple leaf sample For composite leaf samples up to the number of leaves indicated by the kit protocol taking a representative leaf disk or leaf punch is recommended Stack the leaves on a clean surface and with a cork borer 5 mm diameter punch through the leaves to produce the required number of disks Dislodge the disks from the cork borer with a clean metal wire weigh and transfer the disks to an extraction bag and add extraction buffer according to the recommended ratio The weight of the disks varies with growing conditions age plant variety and origin greenhouse or field Seed extraction Single seed extraction Crush the seed with a seed crusher or a hammer Weigh and place in an extraction bag with the recommended ratio of extraction buffer Let the extract sit
29. mesh 3 Prepare the 10X TBE buffer according to the User s Manual section 2 9 50 Prepare the urea acrylamide solution as described in the ABI PRISM 377 DNA Sequencer User s Manual section 2 22 We modified the procedure by degasifying the solution for 5 min after adding the 10X TBE buffer It s essential that the buffer not come into contact with the resin because it will render the buffer ineffective NOTES The resulting solution is enough to prepare two 36 cm gels Add the polymerizing reagents APS and TEMED just before filling the gel cassette system It is important that all the reagents used to prepare the gel be ultra pure Preparing the gel cassette system Mount the gel cassette system following the four steps below Detailed instructions for each step can be found in section 2 13 of the User s Manual a Clean the glass plates b Mount the plates on the cassette c Attach the gel injection syringe to the cassette d Pour the acrylamide solution into the syringe allow to flow into gel avoiding bubbles by gently tapping the glass plates as the gel flows in NOTE We normally use square tooth combs with 50 or 66 wells Using the ABI PRISM 377 DNA Sequencer When running a gel on the sequencer it is important to refer to section 3 of the User s Manual for detailed steps to be followed during electrophoresis Prepare the gel cassette for the run section 3 5 b Mount the gel cassette in the sequenc
30. mix 8 Centrifuge tubes for 15 min at 12000 rpm to precipitate DNA 9 Remove the supernatant and dry the DNA at RT 0 Re suspend in 200 pl TE 1902 DNA Extraction Using the Sap Extractor based on method of Clarke et al 1989 Setting up and using the sap extractor Make sure that the rollers are completely clean and that the flushing system for cleaning the rollers between samples is connected to a high pressure source of de ionized water If you can only use tap water to flush the rollers make sure that you finally rinse them thoroughly with de ionized or 4 2 between samples Always wipe the rollers dry using clean soft tissue paper before initiating the following sample extraction Position the buffer feeding tip over the upper half of the rollers to ensure that the buffer will mix effectively with the pressed tissue sample Feed the tissue sample between the rotating rollers at a slight angle to ensure even pressure is applied to a single layer of the tissue the tissue will wrap around one roller in a spiral Use 150 250 mg of freshly harvested leaf tissue kept in ice within a tube or frozen at 80 C within a tube It is critical that as you feed the tissue into the extractor between the rollers the buffer should already be at that position in the rollers So make sure that you synchronize this operation well with the pumping of the buffer otherwise the DNA will be degraded Pump 1 0 ml of extraction buffe
31. ml 30 0 ml 60 0 ml 120 0 ml Buffer 2 STOCK FINAL 500 ml 1000 ml 2000 ml 4000 ml 1M Tris HCl pH 7 5 0 01 M 5 0 ml 10 0 ml 20 0 ml 40 0 ml 5M NaCl 0 15 M 15 0 ml 30 0 ml 60 0 ml 120 0 ml Blocking reagent maize 0 1 500 0mg 1000 0 mg 2000 0 mg 4000 0 mg Roche 1096176 wheat 0 2 1000 0 2000 0 mg 4000 0 mg 8000 0 mg To dissolve the blocking reagent first heat the solution to 65 C before adding it Never heat solution already containing blocking reagent in microwave This solution may be prepared up to a day before use but must be used at room temperature Buffer 3 STOCK FINAL 100 ml 200 ml 400 ml 500 ml 1 M Tris HCl pH 9 5 0 10 M 10 0 ml 20 0 ml 40 0 ml 50 0 ml 5 M NaCl 0 10 M 2 0 ml 4 0 ml 8 0 ml 10 0 ml Autoclave solution before use or use autoclaved stocks and ddH20 Anti Dig 1 15000 Buffer 2 1 1 15 ml anti Dig Anti digoxigenin AP Boehringer Mannheim Cat 1093274 150 Units 200 35 CSPD solution 2 pl ml Buffer 3 2 ul ml CSPDD Tropix Cat No CD100R 10 mg ml NOTES The concentration of CSPD can be increased after a few uses the signal decreases with each re use of the membrane Diluted CSPD solution should be stored at 4 C in a bottle wrapped in aluminum foil The solution can be re used 5 10 times if it is filter sterilized every few uses to avoid contamination CHEMILUMINESCENT PROTOCOL Hybridize 15 18 hrs at 65 Cin Wash 2 x 5 in 0 15X SSC 0 1 SDS at RT Wash x 15 in 0 15X SSC
32. periods of time between projects it can be aliquoted into several tubes and frozen so that each aliquot is thawed only once at the start of each project 10 Quantification and Quality Control of DNA UV Quantification of DNA Add 15 ul of each sample to 735 ul TE mix well and read OD260 and OD280 to determine purity Refer to page 77 for instructions on how to use the Beckman DU 65 spectrophotometer and for program listing for automated sample reading After UV quantification adjust the concentration of each DNA sample to 0 3 ug ul or a concentration of your choice with TE and store at 4 C Sample should be usable for up to 6 months For longer term storage at freezing temperatures is more desirable DNA concentration ug l 00260 x 50 Aution factor x 50 ug ml The ratio OD260 0D280 should be determined to assess the purity of the sample If this ratio is 1 8 2 0 the absorption is probably due to nucleic acids A ratio of less than 1 8 indicates there may be proteins and or other UV absorbers in the sample in which case it is advisable to re precipitate the DNA A ratio higher than 2 0 indicates the samples may be contaminated with chloroform or phenol and should be re precipitated with ethanol OPTION B A program for the Beckman DU 65 Spectrophotometer see p 77 provides automated sample entry with sipper and calculates all appropriate values for each sample DNA Quality Control This step is essential for checking t
33. place tray in rig with 1X TBE gel buffer Remove combs only when ready to load samples Pour enough 1X TBE buffer into the gel rig to cover the gel by at least 0 5 cm 6 Run samples into gel at 100 Volts constant voltage for about 2 3 h until the bromophenol blue dye has migrated to just above the next set of wells 7 Remove tray from rig and stain in 1 ug ml ethidium bromide 100 ul of 10 mg ml ethidium bromide in 1000 ml for 20 min with gentle shaking CAUTION Ethidium bromide is extremely mutagenic wear a lab coat and double gloves when handling and use extra precaution 8 Rinse gel in dH5O for 20 min slide gel onto a UV transilluminator and photograph Polyacrylamide gel electrophoresis Polyacrylamide gel electrophoresis is used when higher band resolution is required We have been using two systems in the lab Although the Bio Rad PROTEAN II system gives better resolution due to the longer migration distance possible we use the Atto AE 6220 system more intensively because it s simple to handle We also use denaturing and non denaturing gels Although the first is somewhat more laborious it results in simpler patterns of amplified fragments 41 PROTEANG II xi electrophoresis system 16 x 20 cm 1 mm thick Bio Rad Laboratories Each tank can hold up to four gels Each gel requires 40 ml polyacrylamide solution 6 12 of 29 1 acrylamide bisacrylamide depending on resolution required The gel is run at constant
34. plates Detection of dig labeled products with CSPD 33 Incubate membrane in 11 buffer for 5 min at RT with shaking 34 Incubate membrane in 11 buffer 2 for 30 min at RT with shaking 35 Incubate membrane in 500 ml anti Dig solution for 30 min at RT with shaking A second or third re use anti Dig solution may be used if kept at 4 C 36 Wash twice in 11 buffer for 15 min at RT with shaking 37 Equilibrate membrane in 11 buffer 3 for 5 min at RT with shaking 38 Incubate membrane in 500 ml CSPD solution for 25 min at RT with shaking and preferably in the dark NOTE Several membranes can be incubated at the same time for detection 39 Remove membrane from CSPD tray slowly letting solution drip off then place DNA side down on top of a GladWrap sheet Place another sheet of GladWrap on top as a support place a clear X ray film the size of the membrane we strip off silver emulsion of non useful X ray films by incubating in chlorine and seal edges on back side of the membrane 40 Place membrane in cassette and expose to XAR 5 X ray film for 4 8 h 41 Develop X ray film for 6 min in developer rinse for 30 sec fix in fixer for 3 min and rinse for 3 min in running Recommendations for AFLPs 1 Keep nucleotides separate and in aliquots of 50 2 Make small aliquots of all reagents enough for only 3 experiments MgCb 100 ul 10X buffer 250 ul Taq polymerase 25 ul Ligation buffer 100 ul
35. sections of this manual except for modifications of the fluorescent primers Examples are shown below Maize STOCK 10uL 1RXN Taq buffer 10X 1 0 dNTP 2 5 uM 1 2 MgCl 50 uM 0 4 Primers 2 uM ddH2O Taq enzyme 0 15 DNA 5ng ul 1 5 1 Amount varies depending on the primer used 2 Adjust to reach 10 ul total volume NOTE In the case of maize up to three primers may be amplified in the same reaction multiplex or two multiplexes may be combined to run as many primers as possible per lane on the sequencing gel 48 Wheat STOCK 20uL 1RXN Taq buffer10X 2 0 dNTP 2 5 2 0 MgCl 50 uM 1 2 Primer 1 3 ddH202 m Taq enzyme 0 6 DNA 5ng ul 5 1 Amount varies depending on the primer used 2 Adjust to reach 10 pl total volume General considerations for multiplexing and multiloading SSR primers SSR primers can be combined either before or after PCR amplification of the DNA If combined before PCR it is referred to as multiplexing and if combined following amplification it is referred to as multiloading Both may be used to increase the efficiency of the fingerprinting reaction We do both multiplexing and multiloading in maize but only multiloading in wheat In maize there are many more publicly available SSR markers so it was easier to find combinations to multiplex whereas in wheat we have not had a sufficient number to choo
36. sensitive method for detecting DNA fragments and a primer specific either to the CaMV 35S promoter or the bar coding region Use the following primer sequences 355 GCTCCTACAAATGCCATCA GATAGTGGGATGTGCGTCA bar GTCTGCACCA TCGTCAACC GAAGTCCAGCTGCCAGAAAC To measure the sensitivity of the analysis DNA isolated from a known transformed plant that does contain the CaMV 35S promoter should also be extracted Mix the DNA from the transformed plant with DNA from a non transformed plant in proportions of 1 14 transformed DNA to non transformed DNA Electrophorese the amplified DNA and visualize on agarose gels also according to procedures found in this manual see p 18 Using this mixed DNA it should be possible to detect the presence of the CaMV 35S promoter This would indicate that in the samples made into bulks it should be possible to detect even one transformed plant out of the 15 in each bulk As a further control that the reactions are working correctly amplify all DNA samples using a primer corresponding to a fragment of DNA known to exist naturally in the maize genome e g one of three SSR markers phi96100 phi056 or ssr64 Finally to test that the CaMV primer sequence does indeed amplify the expected fragment of DNA in transgenic maize amplify the DNA of a positive control known to contain the CaMV 35S promoter and run in every gel where new materials are tested 61 DNA extraction To extract DNA from individual plants take le
37. typically take 14 16 hours for a large gel with four combs and a dye migration of about 6 cm You may run gel at a higher rate however resolution of the samples may suffer Resolution can be improved by recirculating the buffer 6 Remove tray from rig and stain in 1 ug ml ethidium bromide 100 ul of 10 mg ml ethidium bromide in 1000 ml 4820 for 20 min with gentle shaking CAUTION Ethidium bromide is extremely mutagenic so wear double gloves when handling and use extra precaution 7 Rinse gel in dH2O for 20 min slide gel onto a UV transilluminator and photograph For a Fotodyne PCM 10 camera with a 20 x 26 cm hood and Type 667 Polaroid film use an f8 or f5 6 1 second exposure 10X TAE gel buffer 400 mM Tris 50 mM NaOAc 7 7 mM EDTA STOCK 1 liter 2 liters 3 liters 4 liters 5 liters Tris Base MW 121 10 48 40 g 96 80 g 145 20 g 193 60 g 242 09 82 03 4109 8 209 12 30 g 16 409 20 59 Na4EDTA MW 380 20 2 929 5 84 9 8 76 g 11 68 g 14 6 g Adjust pH to 8 0 with glacial acetic acid l Use higher gel concentrations for separation of small fragments such as plasmids and probe inserts 18 Double Thick Gels A double thick gel consists of two layers of agarose poured consecutively into the same mold with combs in position After electrophoresis the two layers are separated and yield two separate duplicate blots Samples should have the exact volume of the resulting double height wells This ensures that
38. ul Msel adaptor 50 uM 50 pmoles 1 ul Pstl or EcoRI adaptor 5 uM 5 pmoles 1 ul T4 DNA ligase 1 U ul 1U 1 ul NOTE Ligation buffer contains 10 mM ATP Keep ligase on ice atall times Add 10 ul of ligation mix to 50 ul or 45 ul if you ran a quality gel of digested DNA Incubate at room temperature for 2 h You are now ready for the pre amplification step If not doing the pre amplification immediately keep the ligation in the refrigerator until you do After pre amplification keep the ligation at 20 C 54 Pre amplification of DNA 9 Prepare the following 21 ul pre amplification reaction mix concentrations are based on a 25 ul reaction after adding the ligated DNA FINAL STOCK or amount 21 pl RXN ddH20 to 21 ul 12 75 ul Taq polymerase buffer 10X 1X 2 50 ul Msel pre amp primer 10 uM 0 56 uM 1 40 ul Pstl pre amp primer 10 0 56 uM 1 40 ul dNTP mix 2 5 each 0 2 mM each 2 00 ul MgCl 25 uM 1 5 uM 0 75 ul Taq polymerase 5 U ul 1U 0 20 pl Same for EcoRI pre amp primer 10 Add 4 ul 66 67 ng of ligated DNA to 21 ul of reaction mix for the pre amp reaction and overlay each sample with 25 ul mineral oil if necessary 11 Amplify using following program 25 cycles of 94 C for 30 sec 56 for 1 min 72 C for 1 min Check the ligation and pre amplification by loading 5 ul each of pre amplified DNA 2 pl 5XSGB on a 1 0 agarose gel using 100 ng 174 as the molecular weight marker
39. ul ml Tropix Cat CD100R 10 mg ml NOTE Diluted CSPD solution should be stored at 4 C in a bottle wrapped in aluminum foil The solution can be re used several 5 10 times and should be filter sterilized after every use to avoid contamination 59 Detecting Transgenic DNA Sequences in Maize Transgenic DNA sequences can be detected via the polymerase chain reaction PCR or if they are expressed via the enzyme linked immunosorbent assay ELISA PCR is run using primers specific for transgenic events such as those listed in the table below All commercially released transgenic maize that was planted on a significant acreage at any time since the first release of commercial transgenics 1996 contain the Bar PAT gene the CaMV 35S promoter or the NOS termination sequence and thus all events can be screened using only these three promoters All but one event GA21 can be identified using Bar and 35S alone Some of the newest lines that will be released in the very near future however do not contain either of these sequences and more primers will have to be tested of one wants to rule out the presence of these DNA sequences as well Regular PCR can be run on sample DNA to test for the presence or absence of transgenic sequences and RealTime PCR can be run to quantify the amount of transgenic DNA present in a sample RealTime PCR should only be run following regular PCR or ELISA to verify that the sample is indeed transgenic
40. 0 1 SDS at 65 C Y 10 mM Tris 7 5 Rinse 1 Buffer 1 150 mM NaCl 10 mM Tris 7 5 150 mM Incubate 30 in Buffer 2 0 1 Blocking Incubate 30 in Anti Dig 15000 Wash 3 x 10 in Buffer 2 Y Wash 3 x 10 in Buffer 1 10 mM Tris 9 5 V 100 mM Naci Wash 1 x 5 in Buffer 50 mM MgCI2 Incubate 20 in CSPD 2 ui ml of Buffer 3 Expose 15 18 hrs to XAR 5 Film 36 Removal of Probe for Re Use of Membranes One of the main problems associated with chemiluminescent detection methods as sensitive as those used in these protocols is that even a very small amount of labeled probe remaining on the blot after stripping can be detected In many cases this carry over signal will add to the complexity of the resulting banding patterns after re probing with a different probe and may hinder proper data capture and interpretation Another problem is that in an effort to avoid carry over it is possible to overstrip the membrane in a way that eliminates the carry over signal but unfortunately also reduces both the overall signal to noise ratio and the life of the membrane The procedure given below only recommended if you have precisely followed the preceding protocols for blotting fixing the DNA hybridizing and detecting works well for at least seven re uses of the membranes with insignificant background noise and either no carry over signal or only a faint tolerable signal Handle memb
41. 0 2 0 ddH20 to volume to volume to volume to volume 10 mM TTP Boehringer Mannheim 104 264 MW 570 2 Dissolve 10 mg in 1753 ul of OLB TE 7 dissolve directly in original bottle Store in 50 pl aliquots at 20 C Mark tubes with red tops 76 Beckmann DU 65 Spectrophotometer DNA Quantification Program The following are instructions for a program written for a Beckmann DU 65 Spectrophotometer The program is designed to enable the user to quickly take A260 and A280 readings of many samples and from these calculate A260 A280 ratios DNA concentrations total DNA and the amount of TE needed to bring the samples to a specified concentration 1 Turn on UV light source for spectrophotometer It takes approximately 1 minute for the UV light to come on however it is best to wait 15 minutes for the lamp to become stable When the light is on it will be indicated by the UV letters in the LCD display changing from lower case to upper case Make sure the printer is also powered and on line Press the PROG button This will display programs available to the user Select Program 0 DNA by pressing either STEP or BSTP When Program 0 DNA is displayed in the LCD display press You will be prompted for the following information STORED INFO Y 1 N 0 Are you re calculating values for previously stored information Press and if Yes or 0 and if No DILUTION What is the dilution factor for the samples you are going to read
42. 0 26 8 g Dissolve in ddH20 to the final volume 45 Alternatively purchase pre mixed acrylamide bisacrylamide from Sigma Cat 2792 and prepare the 40 stock in bottle to avoid weighing acrylamide and bisacrylamide Filter the solution using 0 45 um pore filter and store the solution in dark bottles The stock be stored at 4 C for a few months CAUTION Acrylamide a potent neurotoxin is absorbed through the skin It should be handled in a fume hood wear a labcoat eye protection mask and gloves when handling powdered acrylamide and bisacrylamide and use extra precaution Wear a labcoat and gloves when handling solutions containing these chemicals 25 Ammonium persulfate APS STOCK 10 ml 20 ml 30 ml Ammonium persulfate 25g 5 0g 7 50 Dissolve in ddH20 to the final volume The stock can be stored at 4 C for up to a month CAUTION APS is a hazardous chemical wear a labcoat eye protection and gloves when handling 6 Acrylamide solution for non denaturing gels STOCK 1 gel 2 gels 4 gels 6 gels 8 gels 4095 acrylamide 3 ml 6 ml 12 ml 18 ml 24 ml 5X TBE or 5X TG buffer 4 ml 8 ml 16 ml 24 ml 32 ml ddH20 13 ml 26 ml 52 ml 78 ml 104 ml 25 APS 70 ul 140 ul 280 ul 420 ul 560 ul TEMED 10 ul 20 ul 40 pl 60 ul 80 ul 8 Acrylamide solution for non denaturing gels STOCK 1 gel 2 gels 4 gels 6 gels 8 gels 40 acrylamide 4 ml 8 ml 16 ml 24 ml 32 ml 5X TBE 4 ml 8ml 16 ml 24 ml 32 ml ddH20 12 ml 24 ml 48 ml 72 ml 96 ml
43. 00 ml NaH PO HO MW 137 99 46g 92g 1840 460 g 7 MW 268 07 45g 90g 1800 4500 Adjust pH to 6 5 with NaOH pellets Autoclave Phenol equilibrated Equilibrate melted at 65 C ultra pure molecular biology grade phenol by adding an equal volume of Tris 9 5 Shake well and allow to separate vacuum aspirate off aqueous top layer Repeat equilibration two more times with Tris 9 5 and twice with TE 8 0 Verify using pH paper that the phenol pH is greater than 7 0 Leave a small layer of TE on the phenol Aliquot equilibrated phenol into 50 ml tubes with caps wrap each in foil and store at 4 C 10 mg ml proteinase K Dissolve 100 mg of proteinase BRL 5530UA in ddH20 to a final volume of 10 ml Dispense 200 ul aliquots into 0 5 ml tubes and store at 20 C 74 10 mg ml RNAse Dissolve 100 mg of RNAse Sigma R4875 in 10 ml of 10 mM Tris 7 5 15 mM NaCl Heat in boiling water for 15 min and allow to cool slowly to room temperature Dispense into 1 ml aliquots and store at 20 C Working stock may be stored at 4 C 500 U ml RNAse 1 Dilute RNAse T1 Sigma R8251 with 10 mM Tris 7 5 15 mM NaCl to 500 U ml Heat in boiling water for 15 min and allow to cool slowly to room temperature Dispense into 1 ml aliquots and store at 20 C SS DNA 10 mg ml salmon sperm DNA Dissolve 100 mg salmon sperm DNA Sigma D1626 in TE 8 0 to a final volume of 10 ml by rotating overnight at 4 Shear the
44. 1 sheet of blotting paper extra thick in transfer buffer and place on top of sponge NOTE Make sure there are NO air bubbles between blotting paper gel and membrane Use transfer buffer between each layer and roll a glass pipette on the exposed surface to avoid bubble problems Place gel on blotting paper on sponge open side of wells facing down Place cut piece of matrix on gel label side down to identify transfer side of matrix Use a glass rod to smooth matrix on gel surface Place 1 sheet of wetted blotting paper on matrix Carefully place a 10 cm stack of paper towels on top of the blotting paper A light weight can be placed on top if used with a flat surface to apply even pressure to blotting surface NOTE Paper towels do not need to cover entire area of gel However if they extend beyond the sides of the blotting paper a piece of plastic old X ray film works well or Saran Wrap should be placed between the two layers of blotting paper isolating the paper towels from the lower blotting paper and buffer solution This will avoid short circuiting the transfer Instead of paper towels a second 6 8 cm sponge may be used on top Wet the sponge with transfer buffer and wring out as much of the buffer as possible Place on top of the blotting paper and place a light weight on top 24 12 13 14 15 16 17 18 19 Add transfer buffer to tray so that the buffer level remains high during blotting process
45. 45 pore size 20 cm x 3 mrolls available from Fisher Scientific or MSI Cat NJ4 HY000 10 and more recently from Gibco BRL s Biodyne A nylon non charged membrane 20 cm x 10 m rolls Cat 10134 013 1 The best surface of a gel for regular contact with a membrane filter is that which was formed by the bottom of the gel mold It is therefore advisable to flip the gel before constructing a blot and preferably before denaturation Sandwich the gel between two thin acrylic plates hold firmly at the corners and flip it in one swift movement Leave one of the plates under the gel to help in handling the gel in subsequent operations Denature gel for 30 min in 0 4 NaOH 0 6 NaCl treat each gel in about three times its volume of solution Transfer gel to another tray and neutralize for 30 min in 0 5 M Tris 7 5 1 5 M NaCl treat each gel in about three times its volume of solution Construction of Wet Blot Transfer System 4 10 11 Cut nylon membrane to the same dimensions as gel Label S amp S marker pen or nick the upper left corner of the membrane for later identification Place in transfer buffer Place a plastic grid in a shallow tray to allow transfer buffer 25 mM NaPO4 pH 6 5 access to center of sponge Place a 6 8 cm thick clean sponge on the center of the plastic grid sponge surface should be equal to or greater than the gel to be blotted Soak sponge thoroughly in transfer buffer Briefly dip
46. 5 min at 3000 rpm at 4 C Carefully discard the supernatant and re suspend the pellet by gently pipetting 4 ml of sterile ice cold 100 uM Use the tip of the pipette to very gently re suspend the cells Place on ice and keep in the refrigerator for use next morning 50 mM CaCl STOCK 100 ml 200 ml 300 ml 400 ml 500 1 0 CaCb 5 ml 10 ml 15 ml 20 ml 25 ml ddH20 95 ml 190 ml 285 ml 380 ml 475 ml 100 mM CaCl STOCK 100 ml 200 ml 300 ml 400 ml 500 1 0 M CaCb 10 ml 20 ml 30 ml 40 ml 50 ml ddH20 90 ml 180 ml 270 ml 360 ml 450 ml 71 SO 299 SAE GON Uns o gt Bacterial Transformations Add 40 ng of plasmid DNA to 20 ul of thawed competent cells Mix very gently Place on ice for 20 30 min Heat shock at 42 C for 40 seconds in a water bath Place on ice for 10 min Add 80 ul of LB broth without antibiotics Shake for 2 4 h at 225 rpm at 37 C Plate on LB proper antibiotic spreading cells evenly Grow overnight at 37 C or until colonies are distinct NOTE Once frozen competent cells are thawed they should be discarded if not used Do not return to freezer for future use 72 General Stock Solutions 1 M 1 M ammonium acetate Dissolve 7 71 g ammonium acetate MW 77 08 in dH20 to a final volume of 100 ml Filter sterilize 7 5 M NH4OAc 7 5 M ammonium acetate Dissolve 57 83 0 ammonium acetate MW 77 08 in dH20 to a final volume of 100 ml Filter sterilize 1 M
47. 59 0g 118 09 236 09 472 09 NaCl MW 58 44 87 69 438 09 876 00 1752 0 g 3504 00 OR Tris base MW 121 10 60 60 302 8 g 605 5 g 1211 09 2422 09 NaCl MW 58 44 87 70 438 3 g 876 69 1753 29 3506 49 Conc 25 0 125 0 250 0 500 0 1000 0 ml Transfer buffer 25 mM NaPO4 pH 6 5 5 liters gel STOCK 1 liter 5 liters 10 liters 20 liters 40 liters 1 M 04 6 5 25 ml 125 ml 250 ml 500 ml 1000 ml 2X SSC STOCK 250 ml 500 ml 750 ml 1000 2000 ml 25X SSC 20 ml 40 ml 60 ml 80 ml 160 ml 25 PCR Amplification of Inserts from Plasmids 1 Prepare a bulk reaction mix containing all the components listed below except plasmid STOCK FINAL Standard Example of bulk 25 mix for 40 RXNs ddH20 adjust to 25 0 ul variable Taq Buffer 10X Mg free 1X 2 5 ul 100 ul MgCl2 50 mM 2 mM 1 0 ul 40 ul Glycerol 15 3 75 ul 150 ul dNTP Mix 10 mM each 50 each 0 5 ul 0 125 each 20 ul Enzyme 5 U l 0 5 U 0 1 ul 4 yl Primer 1 2 uM 34 0 2 uM 2 5 Ul 100 ul Primer 2 2 uM 34 0 2 uM 2 5 ul 100 ul Plasmid 5 ng l 3 5ng 1 0 ul 2 Pipette the corresponding amount of bulk mix into each tube 3 Add ul of plasmid to each tube Mix briefly and centrifuge 4 Overlay each sample with 25 ul of ultra pure mineral oil 5 Place in PCR machine making sure there is sufficient oil in each well to provide proper contact with tube 6 Amplify using the following program 1 cycle of 25 cycles of 1 cycle of
48. 6F 10F 2G 6G 10G 2H 6H 10H 3A 7A 11 3B 7B 11B 3C 7 11C 3D 7D 11D 3E 7E 11E 3F 7F 11F 3G 7G 11G 3H 7H 11H 65 4 4B 4 4D 4E 4F 4G 4H 8A 8B 8C 8D 8E 8F 8G 8H 66 12A 12B 12C 12D 12E 12F 12G 12H Plasmid Mini Preps based on the method of Birnboim and Doly 1979 1 Grow 10 ml overnight culture in LB broth with the proper antibiotic 2 Harvest cells by centrifuging entire culture in a 15 ml centrifuge tube for 5 min at full speed in a table top centrifuge 1300 1500 x g Discard supernatant 3 Re suspend cell pellet thoroughly by vortexing before adding 200 ul of solution I containing 5 mg ml lysozyme add lysozyme within h of use Vortex and leave at room temperature for 5 min It is easier to re suspend cells if they are vortexed before adding the lysozyme mix 4 Add 400 ul of solution II mix gently no vortex and incubate 10 min on ice solution should be clear 5 Add 300 ul of solution mix gently no vortex and incubate 15 min on ice 6 Centrifuge 15 min at full speed in table top centrifuge pour off supernatant into 1 5 ml microfuge tube 7 Add 600 ul ice cold isopropanol mix and leave at 20 C for h or at 80 C for 30 min Centrifuge 5 min at full speed in microfuge 12 000 rpm drain and dry tube 8 Re dissolve pelle
49. 94 C for 1 min 94 for 1 min 72 C for 1 min 55 for 2 min 72 C for 2 min Note You may need to double the extension time for inserts longer than 1 5 Kb 7 Remove oil by adding 25 TE 25 chloroform Mix and centrifuge Pipette top aqueous layer into new tube 8 Check amplification by loading 5 ul of each sample 1 ul DNA 1 ul 5X SGB 3 ul dH O N 1 0 It may be necessary to determine optimal concentrations of MgCl and Taq with each new lot of enzyme This optional ingredient has been found to help amplify large or difficult inserts Diluted in DNA dilution buffer 10 mM Tris pH 8 0 1 mM EDTA 10 mM Examples of primer sequences pUC and M13 CV72 5 ACGACGTTGTAAAACGACGGCCAGT 3 derived vectors CV76 5 AAACAGCTATGACCATGATTACGCC 3 pBR322 CV236 5 GCGCAACGTTGTTGCCAT 3 inserts CV237 5 CGAGCGTGACACCACGAT 3 Conditions optimized for ERICOMP TwinBlock system thermocycler 26 PCR Amplification of Inserts from Bacterial Cultures 1 Scrape a fresh single colony from a culture plate with a toothpick or use 2 ul of an overnight culture or 2 of a glycerol stab 2 Suspend in 50 ul of TTE buffer in a 0 5 ml microfuge tube 3 Incubate at 95 C for 10 min to produce bacterial lysate 4 Spin down bacterial debris for 5 min and use 2 5 of the supernatant for PCR amplification reaction as indicated in the previous protocol This ly
50. E 95 CALL ASCI dec 010 GOTO LINE 2 CALL BLNK RCL 004 CALL FOUT 3 CALL BLNK RCL 005 CALL FOUT 3 CALL BLNK RCL 004 RCL 005 CALL FOUT 5 CALL BLNK 0 05 RCL 001 004 000 STO 007 CALL FOUT CALL BLNK disp 6 RCL 007 RCL 002 CALL FOUT 5 CALL BLNK 79 RCL 002 RCL 007 RCL 003 RCL 002 CALL FOUT 2 CALL BLNK disp 3 RCL 006 CALL FOUT 1 STO 006 CALL CRLF GOTO LOOP REPEAT Strt Ibl READ disp 3 RCL 006 CALL FOUT disp 6 2 CALL BLNK 10 STO 010 Ibl LINE 95 CALL ASCI dec 010 GOTO LINE 2 CALL BLNK RCL 006 2 STO 009 CALL LOAD STO 004 0 01 y GOTO OK 60 CALL ASCI 0 01 CALL FOUT GOTO LOOP Ibl OK RCL 004 CALL FOUT 3 CALL BLNK RCL 009 1 CALL LOAD STO 005 CALL FOUT 3 CALL BLNK RCL 004 RCL 005 CALL FOUT 5 CALL BLNK 0 05 RCL 001 RCL 004 RCL 000 STO 007 CALL FOUT 5 CALL BLNK disp 6 RCL 007 RCL 002 CALL FOUT 5 CALL BLNK RCL 002 RCL 007 RCL 003 RCL 002 CALL FOUT 2 CALL BLNK disp 3 RCL 006 CALL FOUT Ibl LOOP RCL 006 1 STO 006 CALL CRLF RCL 006 RCL 012 lt GOTO READ rtn Data Sheets On the following pages we have reproduced data sheets that have been found to be quite useful in the AMG Laboratory at CIMMYT They are used to record the various types of information necessary for calculating the required solutions and sup
51. LABORATORY PROTOCOLS C CIMMYT Applied Molecular Genetics Laboratory THIRD EDITION LABORATORY PROTOCOLS CIMMYT Applied Molecular Genetics Laboratory Third Edition CIMMYT www cimmyt org is an internationally funded not for profit organization that conducts research and training related to maize and wheat throughout the developing world Drawing on strong science and effective partnerships CIMMYT works to create share and use knowledge and technology to increase food security improve the productivity and profitability of farming systems and sustain natural resources Financial support for CIMMYT s work comes from many sources including the members of the Consultative Group on International Agricultural Research CGIAR www cgiar org national governments foundations development banks and other public and private agencies International Maize and Wheat Improvement Center CIMMYT 2005 All rights reserved The designations employed in the presentation of materials in this publication do not imply the expression of any opinion whatsoever on the part of CIMMYT or its contributory organizations concerning the legal status of any country territory city or area or of its authorities or concerning the delimitation of its frontiers or boundaries CIMMYT encourages fair use of this material Proper citation is requested Correct citation CIMMYT 2005 Laboratory Protocols CIMMYT Appli
52. LL BLNK 020 4 052 STO 003 084 1 027 MSG cA28 021 CALL BLNK 053 MSG FINA 085 CALL CHAN 028 MSG 0 022 RCL 000 054 MSG L uG 086 rtn 029 CALL COUT 023 CALL FOUT 055 MSG uL 030 5 024 CALL CRLF 056 CALL COUT PROG 1 HEADER 031 CALL BLNK 025 1 057 CALL ENTR 000 Strt 032 MSG 260 026 STO 001 058 STO 003 001 57 033 CALL COUT 027 MSG RNA 059 8 002 CALL BLNK 034 47 028 MSG FACT 060 CALL BLNK 003 MSG cTOT 035 CALL ASCI 029 MSG OR 061 RCL 003 004 MSG AL 036 MSG 280 030 CALL COUT 062 CALL FOUT 005 CALL COUT 037 CALL COUT 78 038 5 039 CALL BLNK 040 MSG cuG 041 CALL COUT 042 4T 043 CALL ASCI 044 MSG cuL 045 CALL COUT 046 5 047 CALL BLNK 048 MSG cuG 049 MSG DNA 050 CALL COUT 051 5 052 CALL BLNK 053 MSG cTO 054 MSG ADD 055 CALL COUT 056 5 057 CALL BLNK 058 35 059 CALL ASCI 060 CALL CRLF 061 CALL LINE 062 CALL CRLF 063 2 064 CALL CHAN 065 rin PROG 2 LOOP 000 Strt 001 1 002 RCL 008 003 004 GOTO LOOP 005 3 006 CALL CHAN 007 Ibl LOOP 008 disp 3 009 RCL 006 010 STO 012 011 MSG INSE 012 MSG RTS 013 MSG AMPL 014 MSGE 015 R S 016 CALL FILL 017 260 018 LMDA 019 READ 020 STO 004 021 RCL 006 022 2 023 024 STO 009 025 RCL 004 044 045 CALL STOR 280 LMDA READ STO 005 RCL 009 1 RCL 005 CALL STOR RCL 006 CALL FOUT disp 6 2 CALL BLNK 10 STO 010 Ibl LIN
53. OW MEMBRANES TO DRY You may keep them for a few days in this solution at 4 C or better still strip them right away see next protocol p 37 HYB solution STOCK FINAL 25 ml 50 ml 75 100 ml 150 ml 25X SSC 5X SSC 5 ml 10 ml 15 ml 20 ml 30 ml 10 laurylsarcosine 0 01 25 ul 50 ul 75 ul 100 ul 150 ul 20 SDS good 0 0296 25 ul 50 ul 75 ul 100 ul 150 ul Blocking reagent 0 2 50 mg 100 mg 150 mg 200 mg 300 mg Roche 0 3 75 mg 150 mg 225 mg 300 mg 450 mg Add after heating the solution to 65 C and checking that the pH is 7 4 We use 0 2 for maize and 0 3 for wheat Membranes may be left in this solution for longer periods of time if necessary 34 0 10X SSC 0 1 SDS Highest stringency wash STOCK 1000 m 2000 3000 ml 4000 ml 5000 ml 6000 ml 25X SSC 4 0 ml 8 0 ml 12 0 ml 16 0 ml 20 0 ml 24 0 ml 20 SDS cheap 5 0 ml 10 0 ml 15 0 ml 20 0 ml 25 0 ml 30 0 ml 0 15X SSC 0 1 SDS Higher stringency wash STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml 25X SSC 6 0 ml 12 0 ml 18 0 ml 24 0 ml 30 0 ml 36 0 ml 20 SDS cheap 5 0 ml 10 0 ml 15 0 ml 20 0 ml 25 0 ml 30 0 ml 0 20X SSC 0 1 SDS High stringency wash STOCK 1000 ml 2000 ml 3000 ml 4000 ml 5000 ml 6000 ml 25X SSC 8 0 ml 16 0 ml 24 0 ml 32 0 ml 40 0 ml 48 0 ml 20 SDS cheap 5 0 ml 10 0 ml 15 0 ml 20 0 ml 25 0 ml 30 0 ml Buffer 1 STOCK FINAL 500 ml 1000 ml 2000 ml 4000 ml 1M Tris HCl pH 7 5 0 01 M 5 0 ml 10 0 ml 20 0 ml 40 0 ml 5M NaCl 0 15 M 15 0
54. STOCK 10 ml 20 ml 30 ml 1 0 M Tris 8 0 250 ul 500 ul 750 ul 0 5 M EDTA 8 0 200 ul 400 ul 600 ul Glucose 90 mg 180 mg 270 mg 40 ml 50 ml 1000 ul 1250 ul 800 ul 1000 ul 360 mg 450 mg NOTE Solution may be prepared as a 10X stock solution and stored 20 C in small aliquots for later use Before using thaw dilute and add lysozyme Solution II 0 2 M NaOH 1 0 SDS STOCK 100 ml 200 ml 300 ml 1 0 M NaOH 20 ml 40 ml 60 ml 20 SDS 5ml 10 ml 15ml Solution Ill 3 M pH 5 5 400 500 ml 80 ml 100 ml 20 ml 25 ml Dissolve 29 5 potassium acetate 60 ml dH O Add enough glacial acetic acid to bring pH to 5 5 approx 11 ml Bring final volume to 100 ml 68 10 11 Isolation of Plasmid Inserts Prepare bulk digestion mix using the appropriate enzyme PstI Sall etc and correct enzyme buffer STOCK FINAL Per 30 pl ddH20 1 75 pl 10X buffer 1X 3 00 pl 0 1 M spermidine 2 5 mM 0 75 ul Enzyme 10 U l 25U 2 50 pl Plasmid 1 ug pl 22 ug 22 00 ul Add bulk mix to a 500 ul microfuge tube containing plasmid and incubate at 37 for 2 3 hours A 37 C oven works best because there is minimal condensation on the sides of the tube Stop reaction by adding 6 ul of 5X SGB which contains only the xylene cyanole dye Remove ul 650 ng of plasmid to use for determining MW of insert Electrophorese in 1 standard agarose gel with digest of 174 as per MW standards see 14 Pr
55. STSs or SSRs We have gotten good results using DNA from large amounts of lyophilized ground tissue as well as DNA extracted from a small frozen leaf portion using the sap extractor method Amplification 1 Prepare a bulk reaction mix containing all the components listed below except DNA or primers depending on whether you are preparing several reactions using the same primers for different DNA samples or different primer pairs for the same DNA samples NOTE The optimum concentrations of various components are slightly different for maize and wheat If you need to prepare the bulk mix in advance we suggest you include all components except the Taq polymerase and keep the mixture at either 4 C or 20 C until needed The enzyme would be added just before aliquoting the bulk mix Maize FINAL STOCK or amount 15 pl RXN 20 pl RXN ddH20 1 40 ul 3 6 ul Taq Buffer 10X Mg free 1X 1 50 ul 2 0 ul MgCl 50 mM 2 5 mM 0 75 ul 1 0 ul dNTP Mix 2 5 mM each 150 each 0 90 ul 1 2 ul Taq Enzyme 5 U ul 1U 0 20 pl 0 2 ul Glycerol 100 optional 10 1 50 ul 2 0 ul Primers F R 1 0 each 4 0 25 uM each 3 75 ul 5 0 ul DNA 10 ng ul 50 ng 5 00 ul 5 0 ul 1 Sigma Cell Culture Water Cat W 3500 2 tis essential to determine optimal concentrations of MgClo and Taq with each new lot of enzyme and DNA from species to be analyzed 3 Glycerol is an optional addition to the reaction In general it favors the amplificati
56. ach individual plant the stainless steel ball procedure is recommended as more samples can be processed at a time If more DNA is needed or if DNA will be extracted from many plants and bulked for population analysis the coffee grinder procedure should be used Stainless steel balls 1 Small portions of the leaf 0 5 1 5 cm are cut from each plant and placed in a 1 5 or 2 0 ml tube Leaves from more than one plant can be placed in the same tube which will accommodate a maximum of 6 leaves Keep tubes of leaves cool until they can be frozen but freeze as soon as possible Freeze in a 80 C freezer overnight or using liquid nitrogen Samples must not thaw before lyophilization Place trays of the open tubes containing frozen leaf materials into the lyophilizer Lids of the tubes must be OPEN Be sure that the lyophilizer chamber is at 60 C at all times Verify that it has reached the proper vacuum level after loading the samples and that it maintains a vacuum level of 100 microns Fortunately the small leaf sizes in each tube makes it hard to overload the machine Typically samples must dry for 72 h but may take less time using this method Dried tissue may be stored in the tubes with the lids CLOSED at room temperature for a few days or can be stored for longer periods at 20 C DNA extraction can be started in the same tubes Coffee grinder 6 Cut one leaf per plant 8 10 cm or so and place the leaves in a glassine
57. ack lanes option is for aligning each lane and can be applied either manually or automatically The extract lanes option is for extracting the fluorescence intensity values for each lane so that when later defining the size standard the program will assign the values of the sizes of the obtained fragments see the User s Manual for more information Automated capillary electrophoresis system the ABI PRISM 3100 Genetic Analyzer How to perform a fragment analysis run 1 Setup the instrument system as described in sections 3 11 and 3 19 of the ABI PRISM 3100 Genetic Analyzer User s Manual 2001 2 Check and refill solutions as necessary Before each run determine whether you have to add or change the polymer and buffer on the instrument as described in sections 2 13 to 2 16 of the ABI PRISM 3100 Genetic Analyzer Quick Start User s Guide 2001 or sections 3 20 to 3 23 of the User s Manual NOTES As indicated in the User s Manual do not leave air bubbles in the upper polymer block Also make sure you remove all air bubbles from the lower polymer block as they can break your electric circuit and overheat and destroy the blocks Replacing the 3100 running buffer daily is recommended but we replace the buffer every second or third day without losing resolution or data quality We add only the amount of polymer necessary for one week Plan your runs well The polymer is the most expensive component of the reaction 3 Pre
58. af cuttings from 3 week old seedlings Extract DNA using the sap extraction method described on p 5 of this manual Run DNA from 65 random plants on a gel and check for DNA quality and quantity compared to a standard amount of DNA from the plasmid Lambda cut with HindIII Use only DNA of the appropriate quantity and quality for PCR amplification PCR conditions Amplify DNA in 20 microliter ul reactions containing the following components ddH20 5 6 ul 10X Taq buffer Mg free 2 0 ul MgCl 50 uM 1 0 ul dNTP mix 2 5 each 1 2 ul enzyme 5 U l 0 2 ul Primers F R 1 0 uM each 5 0 ul DNA 10 ng ul 5 0 ul Amplify DNA using an MJ Research DNA Engine Tetrad System Thermocycler and the following parameters 1 cycle of 30 cycles of 1 cycle of 93 for 1 min 93 for 30 sec 72 C for 5 min 629C for 1 min 72 for 1 min Annealing temperature for 35S promoter primers Amplify the control primer Phi96100 using an annealing temperature of 56 C Electrophoresis conditions Electrophorese amplified DNA in a 2 agarose gel and stain with ethidium bromide for visualization according to standard AMG protocols see STS and SSR Protocols on p 38 Control DNA A positive control e g DNA from a transgenic plant must be used At CIMMYT we use Event 5601 which is known to contain the CaMV 35S promoter as part of the transgenic construct When amplified using the CaMV 35S promoter described above a 195 ba
59. ata Sheets Notes iii vil 48 53 60 67 69 71 72 73 77 80 81 iv Foreword The primary motive for compiling and publishing this manual was to provide scientists researchers and students from national agricultural research systems universities and small private companies in developing countries as well as advanced research institutions in the developed world with a useful guide on the protocols currently in use in the Applied Molecular Genetics AMG Laboratory of CIMMYT s Applied Biotechnology Center a part of CIMMYT s Genetics Resources Program Now in its third edition this manual incorporates the feedback and suggestions sent in by people who have used it in the past Since the first edition of this manual was published more than 1000 copies of both the English and Spanish versions have been distributed Some of the technologies described here are very new others are quite old We have included the latter because though they may be phased out in the future they continue to be useful But people who have older versions of the manual will notice we have eliminated sections on obsolete protocols and have added others detailing new ones The main protocols currently in use in CIMMYT s AMG Lab have to do with molecular marker technology and can be used for mapping molecular marker assisted selection and studies on genetic diversity Many can be applied well beyond maize and wheat the main crops CIMMYT works with
60. ation distances within each lane to facilitate comparisons between lanes on the same or different luminographs in fingerprinting studies End labeled Lambda A DNA as a Molecular Weight Standard for Luminographs Digestion of A DNA with Hindlll FINAL STOCK or amount 50 pl RXN ddH20 31 8 pl 10X Buffer 1X 5 0 ul 0 1 M Spermidine 2 5 mM 1 2 ul 0 45 pg pl 5 ug 11 0 ul Hindlll 10 2 DNA 1 0 ul Check the concentration of commercial and adjust quantities accordingly 1 Allow to digest at 37 C for 2 3 h 2 Check that digestion is complete by running about 50 ng on a 0 7 agarose gel When it is complete move to step 3 or 4 3 Ifyou are going to use the digested 4 DNA as a MW marker without end labeling it inactivate the enzyme by incubating at 65 C for 10 min Then add 110 ul TE and 40 pl 5X SGB to bring to a concentration of 25 ng ul Aliquot and keep at 4 C or in the freezer 4 For end labeling precipitate by adding 5 ul of 2 5 M NaOAc and 125 ul of absolute EtOH mix well by inversion and place at 80 C for 30 min 5 Centrifuge in a microfuge for 10 15 min at full speed Pour off supernatant and invert tubes to drain It is very important to allow the pellet to dry 6 Re suspend the pellet in 15 ul ddH O Assuming little or no DNA was lost during precipitation the concentration should be about 5 ug 15 ul or 0 33 13 10 11 End labeling of DNA with digoxig
61. atus Remove the combs and flush out the wells using a syringe This is a critical step especially for polymorphic bands that are close to each other Otherwise unpolymerized acrylamide solution will be polymerized at the bottom of the wells and will affect the migration of the fragments NOTES For non denaturing gels tris glycine buffer 25 mM trizma base 192 mM glycine can be used This buffer requires a longer time for running but results in better band separation The pH of TBE buffer should be adjusted with acetic acid so that the background of the gels is much reduced after silver staining 3 Sample loading For non denaturing gels add 2 4 ul of 5X SGB with BPB and XC to each sample and load 6 10 ul of each sample using a micropipette Use an appropriate MW marker in one or two wells we use about 100 ng of the 100 bp ladder or Phi 174 plasmid digested with For diversity studies use an internal weight marker in each lane see molecular weight markers protocol 7 Address ATTO Corporation Hongo 1 25 23 Bunkyo ku Tokyo 113 8425 Japan TEL 81 3 5684 6643 FAX 81 3 3814 4868 Email eig atto co jp http www atto co jp 42 For denaturing gels add 5 7 ul of DNA sequence stop solution to each of 15 ul samples and denature at 95 C for 5 min A 100 bp ladder marker should also be denatured Sample should be loaded after pre running the gels 4 Electrophoresis Non denaturing gels Run gels at con
62. c and 125 ul of absolute EtOH mix well by inversion and place at 80 C for 30 min 4 Centrifuge in a microfuge for 10 15 min at full speed Pour off supernatant and invert tubes to drain It is very important to allow the pellet to dry 5 Re suspend the pellet in 500 ul ddH O Assuming little or no DNA is lost during precipitation the concentration should be about 10 ng ul This amount will be enough for at least 150 gels with 120 wells each Isolation and preparation of a bottom MW standard A EcoRI Kpnl 1 5 kb fragment was cloned in pUC18 2686 bp and is available upon request It was originally isolated by digesting with EcoRI and BamHI You can obtain large amounts of this fragment from plasmid minipreps as described elsewhere p 67 Since it is important to obtain a very clean fragment treat the resulting DNA with proteinase K at 37 C for 30 min then perform a phenol chloroform extraction followed by a 15 back extraction to minimize losses of DNA and finally EtOH precipitate before re suspending in TE 6 Digest 10 ug of the plasmid containing DNA in a 30 ul reaction with 2 units each of EcoRI and BamHI same buffer 7 Check digestion by loading 1 ul 1 about 300 ng on a minigel 8 If digestion is complete add 6 ul of 5X SGB and load a 1 2 low melting point LMP agarose gel You can load up to 5 pg lane load in 2 to 4 wells Include EtBr in the gel and running buffer 9 Run the gel i
63. cal density optical density at x nm polymerase chain reaction restriction fragment length polymorphisms ribonucleic acid room temperature reaction s Schleicher amp Schuell sodium dodecyl sulphate second s sample gel buffer salmon sperm DNA saline sodium citrate sodium Tris EDTA also TEN Tris acetate EDTA buffer Tris borate EDTA Tris EDTA buffer N N N N Tetramethylethylenediamine Tris Sodium Na EDTA buffer Tris hydroxymethyl amino methane Triton Tris EDTA buffer thymidine 5 triphosphate unit s of enzyme ultraviolet volts xylene cyanole FINAL concentration stock concentration degree Celsius microgram s 10 gram microliter s 10 liter iii Large Scale DNA Extraction Lyophilization 1 Harvest leaves from greenhouse or field grown plants It is preferable to use young leaves without necrotic areas or lesions although older leaves which are not senescent may be used If the midrib is thick and tough remove it Cut or fold leaves into 10 15 cm sections and place in a plastic screen mesh bag along with the tag identifying the sample Aluminum foil or paper bags may be substituted if holes are punched to allow good air flow Place bags in an ice chest or other container with ice to keep samples cool but do not allow them to freeze Make sure samples do not get wet Place leaf samples in a Styrofoam container or another type container that will to hold liquid nitrogen Add liq
64. cles of 1 cycle of 93 C for 1 min 93 for 30 sec 72 C for 5 min 62 for 1 min 72 C for 1 min 4 Runaminigel to check for amplification and correct size on some of the reactions if there has been amplification of a single 523 bp fragment combine all the reactions into one tube for storage 5 Use about 200 ng of molecular weight standard in each lane of a polyacrylamide fingerprinting gel you can add it directly to the reaction mixture with the loading buffer 17 Neutral Agarose Gel Electrophoresis based on the method of T Helentjaris NPI 1 Add agarose to proper amount of 1X TAE gel buffer The amount prepared will depend on the mold to be used A sample gel size is given below Gel size Agarose 0 7 1X gel buffer Sample volume well 20 x 25 cm 2 10g 300 ml 20 ul 2 Melt agarose in microwave oven mixing several times during heating Cool to 55 C the container can be placed in cool water to speed cooling keeping covered to avoid evaporation 3 Tape the ends of the gel tray pour agarose into tray and insert combs Allow it to solidify 20 30 min 4 Remove tape and place tray in rig with 1X TAE gel buffer Pour enough 1X gel buffer into the gel rig to cover the gel by at least 0 5 cm Remove combs only when ready to load samples 5 Run samples into gel at 100 mA for 5 10 min then run at 15 20 mA constant current until the bromophenol blue dye has migrated to just above the next set of wells This will
65. cohol 950 ul 1900 ul 4750 ul Bind silane 5 ul 10 ul 25 ul 3 Trimethoxysilyl propylmethacrylate from Fluka 58 25 ammonium persulphate APS solution STOCK FINAL 100 pl 200 pl 300 pl 400 pl ddH20 Sigma 100 ul 200 ul 300 ul 400 ul APS 25 25 mg 50 mg 75 mg 100 mg DNA sequencing stop solution STOCK FINAL 1500 pl 5M NaOH 10 uM 3 0 ul 99 formamide 95 1439 0 ul Bromophenol blue 0 05 1 5 mg Xylene cyanol 0 05 1 5 mg ddH20 61 0 ul Aliquot and keep at 4 C Buffer 1 STOCK FINAL 500 ml 1000 ml 2000 4000 ml 1M Tris HCl pH 7 5 0 01 M 5 0 ml 10 0 ml 20 0 ml 40 0 ml 5M NaCl 0 15 M 15 0 ml 30 0 ml 60 0 ml 120 0 ml Buffer 2 STOCK FINAL 500 ml 1000 ml 2000 ml 4000 ml 1M Tris HCl pH 7 5 0 01 M 5 0 ml 10 0 ml 20 0 ml 40 0 ml 5M NaCl 0 15 M 15 0 ml 30 0 ml 60 0 ml 120 0 ml Non fat dry milk 1 296 5 10g 10 20 g 20 40g 40 80 g We use Carnation non fat dry milk low cholesterol natural as a cheaper alternative to Boehringer s blocking reagent Buffer 3 STOCK FINAL 100 ml 200 ml 500 ml 1000 ml 1 M Tris HCl pH 9 5 0 10 M 10 0 ml 20 0 ml 50 0 ml 100 ml 5 M 0 10 M 2 0 ml 4 0 ml 10 0 ml 20 ml Autoclave solution before use or use autoclaved stocks and ddH20 Anti Dig 1 15000 Buffer 2 1 11 15 ml anti Dig Anti digoxigenin AP Boehringer Mannheim Cat 1093274 150 Units 200 ul This solution can be re used up to three times within few days if kept at 4 C CSPD Solution 2 Buffer 3 2
66. digest at 37 C for 2 3 h 2 Check that digestion is complete by running about 50 ng on a 0 7 agarose gel 3 Inactivate enzyme by incubating at 65 C for 10 min Then add 300 pl TE and 150 ul 5X SGB to bring to a concentration of 25 ng ul Aliquot 200 pl per 0 5 ml tubes and keep at 4 C or in the freezer Internal Molecular Weight Markers for Fingerprinting with RFLPs Two markers a top and a bottom DNA fragments are used routinely as internal MW standards in each and every lane of a fingerprinting gel including the MW marker lane s They were chosen because of their easy preparation and detection as well as their convenient size for normalization purposes in most fingerprinting experiments using RFLPs Preparation of a top MW standard 1 Digest A DNA with Xbal to generate 2 large fragments 24 5 and 24 kb that will co migrate after the short migrations used in these protocols see for example the following protocol FINAL STOCK or amount 50 pl RXN ddH20 30 3 ul 10X Buffer 1X 5 0 ul 0 1 M Spermidine 2 5 mM 1 2 ul A DNA 0 4 g l 5 ug 12 5 ul 10 U l 2 Ulug DNA 1 0 ul 1 Check the concentration of commercial A and adjust quantities accordingly 2 Allow to digest at 37 C for 1 2 h Verify the digestion by running a small sample say 0 5 ul in a 0 7 agarose microgel Add more enzyme to digestion reaction and incubate for another hour if necessary 3 Precipitate by adding 5 ul of 2 5 M NaOA
67. e size and the very high level of repetitive sequences Being methylation sensitive PstI results in fewer bands than an enzyme like EcoRI The chemiluminescent system described here consists of using one of the two selective primers labeled with digoxigenin After amplification and electrophoresis on sequencing gels the amplification products are transferred to a nylon membrane and the anti Dig alkaline phosphatase and CSPD system is used to detect the amplification products on X ray film The steps involved are 1 DNA digestion with two enzymes 2 Lagation of adaptors to restriction fragments 3 Pre amplification using primers with one selective base for each restriction enzyme 4 Selective amplification using primers with three selective bases for each restriction enzyme one of which is dig labeled m Electrophoresis on sequencing gels 6 Transfer of amplified fragments 7 Detection exposure of membrane to X ray film and development of X ray film Digestion of DNA 1 Obtain the following components for the sequential digestion of genomic DNA with two enzymes FINAL STOCK or amount 50pl ddH20 to 50 ul to 50 pl 10X buffer for Msel 1X 5 0 ul Msel 5 U ul 2 5 Ulug DNA 0 5 ul Genomic DNA 0 3 ug l 1 ug 15 0 or 4 5 pl 10 2 5 Ulug DNA 0 25 ul NaCl 2 5 M 50 uM 1 ul NOTE Adjust the amount of DNA depending on the type of extraction that was performed 15 ul for sap extraction and 4 5 ul for extrac
68. e used but may cost more The ABI 377 is a polyacrylamide gel based machine that is no longer available for purchase The ABI 3100 is an automated capillary electrophoresis system that can separate detect and analyze several fluorescently labeled DNA fragments in one run In CIMMYT s Applied Molecular Genetics Lab we use the 3100 in the fingerprinting of maize and wheat lines and populations Compared to running manual polyacrylamide gels efficiencies in time and money are gained by running the same 20 120 SSR markers in maize and in wheat under highly multiplexed conditions these efficiencies offset the higher cost of the reagents see discussion below on multiplexing We have also developed a method for maize in which more than one primer is amplified in the same PCR multiplex reaction This allows us to analyze large numbers of SSRs in each lane of the sequencing gel multiloading The sequencer s biggest advantages are its high sensitivity and its high resolution in polyacrylamide gels for separating fragments measuring 50 500 pb Tables of primers can be found at the following web sites Table 1 maize htto www cimmyt org ambionet 85 20coremarkersfordiversitystudy PDF and Table 2 wheat http www cimmyt org english webp support publications support materials pdf SSRs pedigree pdf Polymerase Chain Reaction PCR PCR reactions to amplify the SSRs used in diversity studies are essentially the same as the PCR reactions shown in other
69. ecular Genetics Laboratory CIMMYT Apdo Postal 6 641 06600 Mexico D F Mexico Phone 52 55 5804 2004 Fax 52 55 5804 7558 Email mwarburton cgiar org mwilliam cgiar org svelazquez cgiar org V vi Abbreviations Acronyms Amp AMPPD APS BME BPB BSA CSPD CTAB dATP dCTP dGTP dH O Dig Dig dUTP DNA dNTPs DTT dUTP EDTA EtBr EtOH Ampicillin 3 2 Spiroadamantane 4 methoxy 4 3 phosphoryloxy phenyl 1 2 dioxetane ammonium persulfate B mercaptoethanol bromophenol blue bovine serum albumine Disodium 3 4 methoxyspiro 1 2 dioxetane 3 2 5 chloro tricyclo 3 3 1 1 7 decan 4 yl phenyl phosphate mixed alkyltrimethyl ammonium bromide deoxyadenosine 5 triphosphate deoxycytidine 5 triphosphate double distilled water deoxyguanosine 5 triphosphate distilled water digoxigenin digoxigenin 11 dUTP deoxyribose nucleic acid deoxynucleoside 5 triphosphates dithiothreitol deoxyuridine 5 triphosphate ethylenediaminetetraacetate ethidium bromide ethanol gram s hour s hybridization Kilobases potassium acetate low melting point milli Amperes minute s milliliter s Micron Separations Inc molecular weight sodium acetate ng nm OD ODx PCR RFLPs RT RXN S amp S SDS sec SGB SS DNA SSC STE TAE TBE TEMED TNE Tris TTE TTP U UV V XC FINAL Stock ul vil nanogram s 10 gram nanometer s 10 meter opti
70. ed material will not go into solution upon heating 2 Roll wet membranes on a thick glass pipette on top of a flat clean surface wetted with some of the HYB solution from the tray and insert them into clean hybridization bottles Make sure they do not roll on themselves upon rotation in the oven taco syndrome check direction of rotation of rotisserie mechanism and avoid the formation of air bubbles or any drying of the membranes You can place up to five 500 cm membranes in one bottle Smaller membranes can be placed in 15 or 50 ml Corning polypropylene tubes which can be fitted into sections of common PVC tubing of the right diameter and long enough to take two tubes each 3 Add enough solution to cover the membrane 15 ml adjust the volume accordingly for the small membranes in tubes The HYB solution should contain at least 100 ng ml of 2 5 5 Dig labeled probe denature probe by heating at 95 C for 10 min and quenching on ice If HYB solution containing probe has been previously used and stored frozen thaw and denature for 20 min at 95 C in boiling water NOTE After the first use the intensity of the signal on the membrane will start to decrease it will thus be necessary to gradually increase the concentration of the probe in the HYB solution and or increase the concentration of CSPD see below with each re use 4 Hybridize for 15 18 h overnight at 65 C in bottles in hybridization oven 5 Remove membranes from bott
71. ed Molecular Genetics Laboratory Third Edition Mexico D F CIMMYT ISBN 968 6923 30 6 AGROVOC descriptors chemiluminescence immunoassays DNA DNA hybridization Other descriptors molecular markers PCR RFLPs AGRIS category code F30 Plant Genetics and Breeding Dewey decimal classification 631 523 Table of Contents Foreword Abbreviations Acronyms Large Scale DNA Extraction DNA Extraction Using the Sap Extractor Small Scale Extraction of High Quality DNA Quantification and Quality Control of DNA Molecular Weight Markers for Gel Electrophoresis Neutral Agarose Gel Electrophoresis Double Thick Gels RFLP Flow Chart Restriction Digests of Genomic DNA Southern Blotting onto Non Charged Membranes PCR Amplification of Inserts from Plasmids PCR Amplification of Inserts from Bacterial Cultures Incorporation of Digoxigenin dUTP into Plasmid Inserts Using PCR Relative Quantification of Amplified Inserts in Gel Checking the Activity of Incorporated Digoxigenin dUTP Hybridization and Detection of Dig Labeled Probes Removal of Probe for Re Use of Membranes STS and SSR Protocols DNA Fingerprinting of Maize and Wheat Using an Automatic DNA Sequencer Chemiluminescent AFLP protocol Detecting Transgenic DNA Sequences in Maize Plasmid Mini Preps Isolation of Plasmid Inserts Preparation of Frozen Competent Cells Bacterial Transformations General Stock Solutions Beckmann DU 65 Spectrophotometer DNA Quantification Program D
72. ed formamide e Loading buffer 25 mM EDTA 50 mg ml dextrane blue included in a standard size kit e Size standard GS 350 or GS 500 TAMRA for the ABI 377 or ROX for the ABI 3100 e DNA sample from the PCR reaction To prepare the samples a Prepare a mixture of loading buffer and formamide 5 1 b Prepare a size standard FLS 0 3 ul GS 350 or GS 500 TAMRA or ROX and 1 1 ul loading buffer formamide Prepare samples by mixing 1 0 ul of the sample PCR product and 1 3 ul of FLS Denature the resulting mix at 95 C for 5 min immediately place and keep on ice until loading onto the gel NOTE If sample concentration is very high which will lead to overly intense fragments that cannot be reliably sized by the sequencer it can be diluted using sterile ddH O If it is too low several microlites can be concentrated at 65 C However you adjust it always mix 1 pl of the sample with the FLS Electrophoresis Gel based electrophoresis ABI PRISM 377 Genetic Analyzer Gel preparation To prepare 50 ml of solution for making a 4 5 polyacrylamide gel you need the following components STOCK Amount Urea 18 09 40 acrylamide 29 1 1 5 625 ml ddH20 28 5 ml Resin 0 50 10 5 0 ml 10 APS 250 ul TEMED 30 0 pl 1 Use Bio Rad acrylamide bisacrylamide 29 1 Prepare the 40 stock as described in the User s Manual section 2 9 2 The resin used is Bio Rad s AG 501 X8 20 50
73. en denaturing at 95 C for 5 min and place them on ice immediately Reinsert the comb so that the shark teeth are just touching the gel across the top Assemble running apparatus and add TBE to buffer chamber Load 2 5 ul to 3 5 ul samples if using the 72 tooth comb or 5 ul if using 49 tooth comb Run gel at 120 W and remove comb when the samples have migrated 3 cm Maintain temperature at 50 C for at least 3 h When run is complete allow plates to cool before separating them 56 Gel blotting dry blot transfer 26 Cut a 30 x 43 cm non charged nylon membrane we use cheaper membranes such as MST s Magna and presoak in 0 5X TBE 27 Separate plastic and glass plates The gel will be stuck to the glass plate Place it horizontally gel side up Place presoaked membrane over the gel preferably with the help of another person in order to place it at once in the right place avoid moving it around to adjust it 28 Eliminate air bubbles by gently rolling a glass pipette over membrane Place 3 thick filter papers on top then a plastic plate then some weight not too much because it can deform the gel 29 Allow to transfer for 4 h 30 Dismantle the transfer system and rinse the membrane in 0 5X TBE optional 31 Dry the membrane for 15 min at 65 C then crosslink at 120 000 ujoules UV crosslinker or bake at 95 C for half an hour 32 After transfer is done clean plates with NaOH 0 1 M to eliminate the gel bound to the
74. enin dUTP dig dUTP FINAL STOCK or amount 50 pl RXN ddH20 25 0 ul 10X Klenow Buffer 1X 5 0 ul 10 mM dATP 100 uM 0 5 ul 10 mM dCTP 100 uM 0 5 ul 10 mM dGTP 100 uM 0 5 ul 1 mM dig dUTP 40 uM 2 0 ul MHindlll 5 ug 15 0 ul 2U ul Klenow 3U 1 5 ul 1 Check the concentration of commercial and adjust accordingly 2 Purchase from Fisher Scientific cat PR M2201 Promega Biotec or BRL cat 80125B Incubate at 37 C for 1 5 Stop the reaction by placing at 65 C for 15 min EtOH precipitate as in 2 above Re suspend in 250 ul TE to bring to a final concentration of 20 ng ul This stock can then be diluted to 10 or 1 ng ul with TE Verify incorporation of dig dUTP following the protocol Checking the activity of incorporated digoxigenin dUTP p 32 Use 5 ng lane of A DNA digested with Hindlll and end labeled with digoxigenin dUTP 12 Prepare working solutions from the stocks based on the following proportions 1 ng ul 10 ng ul 20 ng ul STOCK STOCK STOCK STOCK DNA end labeled 5 ul 0 50 ul 0 25 ul TE 11 ul 15 50 ul 15 75 ul 5X SGB 4 pl 4 00 ul 4 00 ul Digestion of X174 DNA with Haelll FINAL STOCK or amount 150 pl 68 25 ul 10X Buffer 1X 15 00 ul 0 1 M Spermidine 2 5 mM 3 75 pl 174 DNA 0 25 ug ul 15 ug 60 00 ul Haelll 10 U ul 2 Ulug DNA 3 00 pl 1 Check the concentration of commercial 174 plasmid DNA and adjust quantities accordingly 14 1 Allow to
75. entrifuge in microfuge at full speed 12 000 rpm for 10 15 min 13 Pour off supernatant and invert tubes to drain Evaporate EtOH from samples by placing tubes upright in a vacuum desiccator for 10 15 min under low vacuum or overnight on the l Calculations for maximum DNA digestions per tube size DNA tube size 90 ug 120 ug 300 ug 900 ug FINAL 1 5 ml 2 0 ml 5 0 ml 15 0 STOCK or amount 400 ul 550 pl 1300 ul 4000 pl ddH20 27 5 ul 51 ul 62 5 ul 275 ul 10X Buffer 1X 40 0 ul 55 ul 130 0 ul 400 ul 0 1 M Spermidine 2 5 mM 10 0 ul 14 ul 32 5 ul 100 ul 10 U ul Enzyme 2 5 Ulug 22 5 ul 30 ul 75 0 ul 225 ul 0 3 ug ul DNA 300 0 pl 400 ul 1000 0 ul 3000 ul Do these calculations using Roche brand enzymes which come with the buffer included 22 14 bench Take care to remove all EtOH as this makes samples impossible to load into gels However avoid overdrying as this makes samples difficult to re suspend Dissolve pellet in the proper volume of TE for loading into wells of an agarose gel Typically 16 of TE and 4 ul of 5X SGB per single layer well is sufficient while 40 TE and 10 ul 5X SGB are needed for a double layer well Dissolve DNA in TE first then add 5X SGB Generally pellets are dissolved in 2 3 hours 23 Southern Blotting onto Non Charged Membranes based on the method of T Helentjaris NPI The matrix we use is an MSI Magnagraph Nylon membrane non charged 0
76. epare a 1 196 LMP agarose gel Heat the agarose a little more slowly than regular agarose to minimize foaming Once the gel has set place at 4 C to cool The gel running buffer stain and de staining solutions should be kept at 4 C prior to and during the run Include EtBr in the gel and running buffer Remove the gel from the refrigerator and load the samples can be done at RT Place into pre cooled gel apparatus and run in the cold at 40 mA until the dye has migrated about 2 cm on a 1 1 gel pUC18 2700 bp will run just below the xylene cyanole dye Check separation with portable UV lamp after 30 min if running in a minigel When visualizing the bands it is best to minimize exposure to UV by either using a hand held long wave UV lamp or by leaving the gel on a UV transparent tray and placing on a transilluminator Quickly mark the insert bands by pushing a 1 5 inch section of a plastic soda straw into the gel around each insert Once all the inserts have been marked turn off the UV light Remove each straw from the gel and force the agarose plug into a screw cap tube using a P 200 pipetteman place the barrel into the end of the straw and depress the plunger to force the plug out of the straw into the tube Sarstedt tubes 4 72 694 006 are good because they seal tightly and have a good writing surface Assuming you know the MW of the insert and had 100 digestion dilute each sample in 4 0 to the desired concentration 10 ng ul
77. er c Activate the ABI PRISM software and create a new run by clicking on NEW GEN SCAN RUN d Check the glass plates and the gel to ensure no peaks are produced due to particle fluorescence on the glass plates or the gel use the PLATE CHECK option section 3 11 e Fill the buffer chamber with 1X TBE buffer section 3 15 f Connect the heating plate section 3 15 g Choose the PRE RUN option to balance gel temperature section 3 25 During this phase gel temperature will rise to 51 C The minimum temperature at which the samples can be loaded onto the gel is 38 C h Load the samples and start the run section 3 26 Generally 1 0 to 1 5 ul of each sample is used Once the samples are loaded do a 2 min pre run so that the samples will penetrate the gel Finally execute the RUN option and start collecting the data NOTES The run may take 1 0 to 2 5 h to complete depending on the size of the fragments A gel may be re used to do a test run We recommend re booting the computer and disconnecting from the network during the run Make sure you fill out the data sheet before you begin the run section 3 20 or 4 16 of the User s Manual 51 Cleaning the system after each run To clean the system after each run refer to section 3 32 of the User s manual Gel analysis Once electrophoresis is completed prepare the gel for analysis as follows Open the gel and apply the track lanes and extract lanes options The tr
78. from 50 to more than 100 ug DNA 100 mg dry tissue If higher amounts are needed start with 1 g lyophilized tissue into a 50 ml polypropylene centrifuge tube and triple all the amounts given below If lower amounts are needed then weigh 100 150 mg lyophilized tissue into a 5 ml polypropylene centrifuge tube and use 1 3 of the amounts given below 2 Add 9 0 ml of warm 65 C CTAB extraction buffer to the 300 400 mg ground lyophilized tissue It is best to distribute tissue along the sides of the tube before adding buffer to avoid clumping of dry tissue in the bottom Mix several times by gentle inversion 3 Incubate for 60 90 min with continuous gentle rocking in a 65 C oven 4 Remove tubes from oven wait 4 5 min for tubes to cool down and then add 4 5 ml chloroform octanol 24 1 Rock gently to mix for 5 10 min 5 Spin ina table top centrifuge for 10 min at 1300 1500 x 27 at RT NOTE Below 15 C the CTAB nucleic acid complex may precipitate This could ruin the preparation and damage the centrifuge 6 Pour off top aqueous layer into new 15 ml tubes Add 4 5 ml chloroform octanol and rock gently for 5 10 min 7 Spin a table top centrifuge for 10 min at 1300 1500 x at RT 8 Pipette top aqueous layer into new 15 ml tubes containing 30 ul of 10 mg ml RNase A pre boiled Mix by gentle inversion and incubate for 30 min at RT 9 Add 6 0 ml of isopropanol 2 propanol Mix by very gentle inversion 10 Remove p
79. hat the isolated DNA is of high molecular weight For adequate resolution of RFLPs native DNA should migrate as a tight band of molecular weight gt 40 Kb However degradation of part of the isolated DNA is inevitable and the protocol below is designed to run the DNA under optimal conditions for ascertaining the relative amounts of degraded and high molecular weight DNA The procedure also allows for verifying the UV quantification performed above If you have few DNA samples say less than 25 check all of them Otherwise check only 10 20 of the samples making sure that the selection is totally random 1 Prepare a 10 ng ul dilution of the selected samples e g 4 ul DNA at 0 3 ug ul 116 ul TE 2 Load 100 ng of each diluted sample 10 ul DNA 2 ul 5X SGB in a 0 7 agarose gel Include at least one lane per comb of uncut Lambda DNA A as a molecular weight marker Load 100 ng from a 10 ng ul dilution of this marker to check both quality and quantity of the sample DNAs 3 Runthe gel at 50 mA for about 90 minutes See the section on gel electrophoresis for details about gel preparation running conditions and DNA visualization 11 DNA Digestibility Test This step is essential before setting up large scale digestion experiments A small amount of DNA is digested with restriction endonucleases under the conditions described in the next section in order to check the quality of the digest If you have few DNA samples say les
80. id STOCK 200 ml 400 ml 800 ml Ethanol 20 ml 40 ml 80 ml Acetic acid 1 ml 2 4 ml Dissolve in ddH20 to the final volume Staining solution 0 276 silver nitrate STOCK 1 liter 2 liters AgNOs MW 169 9 2g 4g Dissolve in ddH20 to the final volume CAUTION Silver nitrate is an oxidizing corrosive wear labcoat eye protection and gloves when handling Developer 3 sodium hydroxide 0 5 ml 100 ml formaldehyde STOCK 100 ml 200 ml 400 ml 800 ml 1000ml NaOH 3g 6g 12g 24g 30 g 36 38 formaldehyde 0 5 ml 1 ml 2ml 4 ml 5 ml Concentration of formaldehyde may vary depending on the company you purchase from It should be added immediately before use CAUTION Formaldehyde is a potential cancer hazard a lachrymator and combustible It should be handled in a fume hood wear a labcoat eye protection and gloves when handling and use extra precaution Stop solution 1 5 Na2ZEDTA2H 0 STOCK 1 liter 2 liters 4 liters Naz2EDTA2H20 MW 372 2 15g 30g 60 g 47 DNA Fingerprinting of Maize and Wheat Using an Automatic DNA Sequencer To study the genetic diversity of maize and wheat populations using SSR markers on an automatic DNA sequencer primers labeled with fluorescent dyes are used We use TET green HEX yellow and FAM blue to label the primers run on the ABI PRISM 377 DNA Sequencer and primers labeled in HEX green FAM blue and NED yellow for the ABI PRISM 3100 Genetic Analyzer Other color sets can b
81. inders are modified by taping clear plastic over the lids otherwise leaves will become trapped in the lids during grinding and will not be ground Place the dried leaf tissue in the coffee mill and grind to a fine powder from 30 sec to 2 min The finer the powder the higher the yield of DNA will be Collect leaf powder into a 15 ml tube using a paintbrush and a paper funnel Place the cap on the tube and keep sealed until ready to extract DNA extraction can begin in the same tubes Using a damp cloth fine brush or compressed air clean the coffee grinder after each sample is ground to avoid contamination Genomic DNA Isolation With this method from 50 to 100 ug of DNA per each 100 mg leaf tissue may be obtained When extracting DNA from larger amounts of tissue increase the amounts given below up to 1000 mg 1 2 Preheat the CTAB isolation buffer to 65 C Place 50 mg of lyophilized ground leaf tissue in a 2 0 ml tube if using a 1 5 ml tube all volumes may be scaled down by 25 Add 1 ml of CTAB isolation buffer Mix by gentle swirling to homogenize the tissue with the buffer Incubate the samples at 65 C for 90 min with continuous gentle rocking Remove tubes from the oven and allow them to cool for 5 10 min Add 500 of chloroform octanol 24 1 Mix gently with continuous rocking for 10 min at room temperature Centrifuge at 3500 rpm at room temperature for 10 min to generate a yellow aqueo
82. ked values for re suspension and so forth can be re calculated This is done by re running the PROG 0 DNA When prompted at the beginning of the program about STORED INFO Y 1 N 0 enter a 1 for Yes You will then be prompted as before for information however instead of prompting for the samples the spectrophotometer will re calculate values from figures stored from the last run of samples Program listing PROG 0 DNA 031 CALL ENTR 063 CALL CRLF 006 8 000 Strt 032 STO 001 064 CALL CRLF 007 CALL BLNK 001 disp 5 033 5 065 1 008 MSG cTE 002 ABS 034 CALL BLNK 066 RCL 008 009 CALL COUT 003 1 035 RCL 001 067 010 CALL CRLF 004 STO 006 036 CALL FOUT 068 GOTO READ 011 35 005 MSG cSTO 037 CALL CRLF 069 1 012 CALL ASCI 006 MSG RED 038 1500 070 CALL CHAN 013 5 007 MSG INFO 039 STO 002 071 Ibl READ 014 CALL BLNK 008 MSG 1 040 MSG RESU 072 MSG cINS 015 MSG cSAM 009 MSG N 0 041 MSG 5 VO 073 MSG ERT 016 MSG PLE 010 CALL ENTR 042 MSG L 074 MSG BLAN 017 CALL COUT 011 STO 008 043 CALL COUT 075 MSG 018 1 012 50 044 CALL ENTR 076 R S 019 CALL BLNK 013 STO 000 045 STO 002 077 CALL FILL 020 4 014 MSG DILU 046 2 078 280 021 CALL BLNK 015 MSG TION 047 CALL BLNK 079 LMDA 022 MSG cA26 016 MSG 048 RCL 002 080 CALB 023 MSG 0 017 CALL COUT 049 CALL FOUT 081 260 024 CALL COUT 018 CALL ENTR 050 CALL CRLF 082 LMDA 025 5 019 STO 000 051 0 2 083 CALB 026 CA
83. l 33 ul 300 900 ug 1000 3000 ul 15 0 ml 4000 ul 400 ul 100 ul 21 4 Determine the volume of ddH20 per tube as follows ul ddH O total vol ul buffer ul spermidine ul DNA pl enzyme 5 Calculate a bulk digestion mix containing the total volume of ddH O buffer spermidine and enzyme needed for the total number of different DNA samples to be digested by the same enzyme To allow for pipetting errors prepare extra bulk mix as follows For 1 5 or 2 0 ml tubes prepare bulk mixture for one or two additional RXN tubes For 5 ml tubes prepare 1 4 more bulk mixture For 15 ml tubes prepare 1 10 more bulk mixture Digestion reactions 6 Label the tubes for the reactions and add the proper amount of DNA sample to be digested 7 Prepare bulk mix on ice adding enzyme last mix well 8 Aliquot bulk mix into reaction tubes Mix well do not vortex ul bulk mix tube ul RXN vol tube ul DNA tube 9 Incubate at 37 C for 3 5 h Precipitation of digested DNA 10 Stop the reaction by adding 5 M NaCl to a final concentration of 0 25 M NaCl 11 Add 2 5 volumes of EtOH mix well place at 80 C for 30 min or at 20 C overnight Precipitated DNA can be stored in EtOH at 20 C indefinitely Tube Volume Hl Hl Total volume size of RXN 5M NaCl EtOH after EtOH 1 5 ml 400 ul 20 ul 1000 ul 1420 ul 2 0 ml 550 ul 28 ul 1375 ul 1953 ul 5 0 ml 1300 ul 65 ul 3250 4615 ul 15 0 ml 4000 ul 200 ul 10000 ul 14200 ul 12 C
84. le s and wash together by putting them one by one in trays of adequate size with enough solution to cover all membranes with shaking as follows 2x5min 0 15X SSC 0 1 SDS 3x 15 min 0 15 SSC 0 1 SDS 60 OR for lower stringency 3x 15 min 0 15X SSC 0 1 505 RT 1 15 min 0 15 SSC 0 1 SDS 50 It is essential that the wash temperatures be monitored to make sure the above treatments respected consistently Undue lowering of the temperature or shorter treatment times may result in higher background noise and less predictable results NOTE HYB solution containing probe may be kept at 20 C for re use Clean hybridization bottles immediately to avoid formation of HYB residues 6 Rinse membranes in Buffer 1 at RT membranes may be left in this solution for longer periods if necessary 33 10 11 12 13 14 Incubate membranes in Buffer 2 for 30 min at RT with shaking 5 111 100 Incubate membranes in fresh anti Dig solution 5 ml 100 cm for 30 min at RT with shaking This solution may be re used on the same day or within the next two days of first use Centrifuge anti Dig immediately prior to use and carefully pipette desired amount Wash membranes with shaking as follows 3 x 10 min Buffer 2 RT 0 5 3 x 10 min Buffer 1 RT 0 5 ml cm 1x5min Buffer 3 RT 0 5 ml cm 1 Incubate membranes in CSPD solution 5 ml 100 for 20 min at RT with shaking preferably in the
85. ling temperatures We have mostly used the procedure in duplexing two primer pairs at a time Follow the same procedure as described above but with the following formula FINAL STOCK or amount 25 yl RXN ddH20 0 0 ul Taq buffer 10X Mg free 1X 2 5 ul MgCl 50 mM 25 mM 1 3 ul Glycerol 10096 optional 10 2 1 ul dNTP Mix 2 5 mM each 200 uM each 2 0 ul enzyme 5 U l 1U 0 2 ul Primer 1 F R 1 0 uM each 0 3 uM each 6 0 ul Primer 2 F R 1 0 uM each 0 3 uM each 6 0 ul DNA 10 ng ul 50 ng 5 0 ul NOTE In some cases combining two sets of primer pairs results in the preferential amplification of one of the two products To improve the amplification of the other product suggestions are to increase the amount of primers of the poorly amplified SSR or STS and or decrease the amount of primers of the other SSR or STS decrease the annealing temperature and or use a higher quality Taq polymerase 1 Sigma s Cell Culture Water Cat W 3500 It is essential to determine optimal concentrations of MgCl and with each new lot of enzyme and DNA from species to be analyzed Glycerol is an optional addition to the reaction It generally favors the amplification of large products For wheat we use 2 5 instead of 10 glycerol To make it easier to pipette the required volume warm the tube before pipetting 44 5X TBE gel buffer 0 45 M Tris borate 10 mM EDTA STOCK 1 liter 2 liters 3 liters 4 liters 5 liters Tris Ba
86. n the cold room at 40 mA Check separation with portable UV lamp after 30 min if running in a minigel 10 When plasmid and insert are well separated take out the insert either by cutting it out or by electroelution of the fragment onto DEAE cellulose membrane e g S amp S NA 45 11 Adjust to a final concentration of 10 ng ul If you have cut the fragment out melt the gel at 65 C before adding TE to adjust the concentration Remember that 10 ug plasmid DNA will yield 3 5 ug insert DNA 12 Check on a minigel 50 100 ng are enough for this purpose Use 0 25 ng lane of the 24 5 kb lambda fragment and 0 50 ng lane of the 1 5 kb one and detect by using 500 ng of labeled A DNA per large hybridization bottle Label A by random priming including 1 digoxigenin dUTP see 28 Addition of internal MW standards to plant genomic DNA The appropriate quantities of internal standards should be added to each genomic DNA for fingerprinting analysis The easiest procedure consists of adding these when re suspending the DNAs after restriction digestion p 5 13 Prepare a working bulk of the fragments according to the following Amount to add per single gel lane Fragment Stock ng lane pl stock lane 24 5 kb 10 ng ul 0 25 ng 0 025 1 5 kb 10 ng ul 0 50 ng 0 050 ul Do not forget to add the right amount of 5X SGB to complete the loading mixture of DNA TE and internal MW standards Internal Molecular Weight Markers for Fingerprin
87. n this procedure are 5 32 4 mm and may be purchased by the thousand at Baleros y Bandas Sanchez Juarez Sur No 340 Texcoco Mex tel 9540687 If leaves were dried in glassine bags before grinding they may still be cut and placed into 1 5 ml tubes however once the leaves are dry cutting them is difficult as they tend to disintegrate Place 2 3 stainless steel balls 4 mm in diameter into each tube and close securely Place the tubes in a Styrofoam holder and secure the lid of the holder with several strong rubber bands Place the Styrofoam holder with tubes on an orbital shaker and secure to the shaker with rubber bands or laboratory tape Keep the tubes in constant vibration on the shaker at 400 rpm for 2 h or until leaf tissue is ground to a fine powder Alternatively the Styrofoam holder can be taped or secured to a vortexer which should be left on for 1 2 h until samples are finely ground Use a magnet to remove the stainless steel balls from the powder before beginning extraction Leaf powder can be stored in the closed tubes or DNA extraction can begin immediately in the same tubes If samples are not fully dried before grinding grinding will be inefficient and DNA yield will be poor The finer the powder the higher the yield of DNA will be 8 Coffee grinder 9 Coffee grinders can be any brand but we buy Braun grinders in Texcoco at Carrillo Alonzo Art 123 No 7 Col Centro tel 55123046 Coffee gr
88. ndlll total 60 ng total 100 ngtotal 200 ng total 6557 14 8 14 27 4361 9 5 9 138 Hind Ill 48373bp 1 60 100 200 real size 48502 bp 174 Haelll of ng band in ng band in Haelll total 60 ng total 100 ng total 200 ng total ___ 281 5 3 5 10 2n 5 3 5 10 234 4 3 4 9 194 4 2 4 2 1 2 __72 1 1 1 as seen on 2 gel total 5386bp 60 100 31 Checking the Activity of Incorporated Digoxigenin dUTP This can be achieved by using the quantification gel for PCR labeled inserts in which case start with step 2 If other labeling procedures have been used start with step 1 1 5 Load 1 5 of each labeled reaction in a 1 medium sized agarose gel Run gel at 40 mA for 2 3 h then stain and de stain Remember that a smear sometimes quite faint is expected when labeling by nick translation or random priming NOTE Denaturation and neutralization of the gel are not necessary since there is no hybridization step in this procedure Construct a dry blot transfer as follows Lay a piece of Saran Wrap on a level clean bench larger than the size of the gel Place two layers of blotting paper extra thick soaking wet in transfer buffer slightly larger than the size of the gel Place the gel upside down on the filter paper and lay a piece of blotting membrane on top of it making sure there a
89. of DNA migration and separation in gels is required as for example in the case of molecular diversity comparisons or fingerprinting work The tables given in this protocol assume a DNA concentration of 0 3 ug ul and an enzyme concentration of 10 U l The information given is for the maximum quantities that can be processed for any given reaction tube size Bulk Digestion of DNA Samples Calculations NOTE We routinely digest 10 ug maize DNA or 15 ug wheat DNA per single layer gel lane 1 Determine the total ug and volume of each DNA sample to be digested with an enzyme in a single tube as follows Total ug DNA amount of DNA per lane x number of lanes of sample Total ul DNA Total ug DNA DNA concentration ug ul 2 Determine the units U and volume of enzyme necessary to digest each DNA sample In general it is best to use 2 5 U ug DNA to prevent partial digestions Total U Enzyme Total ug DNA x 2 5 Total ul Enzyme Total U enzyme enzyme concentration U l 3 Basedon the DNA and enzyme volumes determine the total reaction volume and therefore the tube size to use The maximum reaction and corresponding maximum DNA volumes possible for different tube sizes are given below DNA Range of Tube Vol 10X 0 1 M at 0 3 g l DNA vol size of RXN buffer spermidine 10 90 ug 35 300 ul 1 5 ml 400 ul 40 ul 10 ul 90 120 ug 300 400 ul 2 0 ml 550 ul 55 ul 14 ul 120 300 ug 400 1000 ul 5 0 ml 1300 ul 130 u
90. of better quality agarose to normal quality agarose are the factors involved in the resolution of the differences in amplification product sizes The larger the distance the better the resolution see point below on choice of electrophoresis tanks For best resolution we use 4 Metaphor agarose gels then 2 1 Metaphor SeaKem agarose gels slightly lower resolutions are obtained with 2 1 Metaphor Seakem Weuse TBE buffer both to prepare the gel and run it rather than TAE for better resolution This buffer can be re used once or twice with no problem since the running time is usually short An alternative to re using the buffer is to try using 0 5X TBE e We have been using the same electrophoresis tanks as the ones we use for RFLPs namely 20x25 cm gel trays where we insert 2 4 or even 8 30 tooth combs depending on the difference in size of the amplification products For very small differences 2 combs 12 5 cm migration distance become necessary but if the difference 15 large 8 combs or 3 cm migration distance are enough 6 There are several brands of agarose for high resolution applications Metaphor agarose is an excellent but expensive product FMC Rockland NY Cat 50184 however it can be re used at least four times after running off the DNA samples by continuing the electrophoretic run and then remelting and adding hot dH2O to ensure that the initial volume is recovered Seakem LE Cat 50004 40
91. on of large products To make it easier to pipette the required volume warm the tube before pipetting 4 Both forward and reverse primers are present in the same tube 38 Wheat FINAL STOCK or amount 15 pl RXN 20 pl ddH20 222 ul 4 7 yl Taq Buffer 10X Mg free 1X 1 50 ul 2 0 ul MgCl 50 mM 2 5 mM 0 75 ul 1 0 ul dNTP Mix 2 5 mM each 200 each 1 20 ul 1 6 ul Taq Enzyme 5 U ul 1U 0 20 ul 0 2 ul Glycerol 100 optional 2 5 0 38 pl 0 5 ul Primers F R 1 0 each 4 0 25 each 3 75 ul 5 0 ul DNA 10 ng ul 50 ng 5 00 ul 5 0 ul 2 Add primers or DNA sample to each labeled tube or microtiter plate cell 3 Aliquot bulk mix into each labeled tube or into the microtiter plate 4 Overlay samples with 1 drop or 20 30 ul of ultrapure mineral oil if necessary if no heating lid is used 5 Place in PCR machine making sure there 1s sufficient oil in each well when necessary to provide proper contact with tube 6 Amplify using either of the following programs Standard PCR program 1 cycle of 30 cycles of 1 cycle of 93 C for 1 min 93 C for 30 sec 72 for 5 min for 1 min X ranges between 50 68 72 C for 1 min Touchdown PCR program 1 cycle of 7 cycles of 35 cycles of 1 cycle of 94 C for 2 min 94 C for 1 min 94 C for 1 min 72 C for 5 min for 1 min Z C for 1 min decreasing 1 per cycle 72 C for 1 min 72 C for 1 min Y 69 64 59 or 54 C Z 62 57 52 or
92. ormations Tissue Grinding Y Plasmid Inserted in Host Ground Leaf Tissue Mini Preps DNA Isolations Plasmid DNA Genomic DNA POR Restriction Digests Y Restriction Digests 9 Isolated Insert Digested DNA PCR Oligolabelling Gel Electrophoresis Y Nick translations DNA Fragments Separated in Gel Southern Blotting Membrane with DNA Labeled Insert Probe Hybridization Probe Hybridized to Blot Chemiluminescent Autoradiography Detection Luminograph Autoradiograph Stripping Probe Removed From Blot 20 Restriction Digests of Genomic DNA based on the method of T Helentjaris NPI Typically two situations arise when setting up large scale digestion experiments On the one hand there may be a few lt 10 DNA samples to be digested in large quantities for screening purposes say 24 to 48 repetitions On the other there may be a large number of samples e g a mapping population to be digested for a specific number of gel separations say 4 to 10 repetitions In both cases the large amount of DNA in each sample is digested all at once with each enzyme in a greater volume than the gel loading volume Thus after digestion is complete the DNA is ethanol precipitated then re suspended in the proper loading volume The protocols below therefore include reaction volumes and the corresponding tube sizes for practical purposes Phenol extraction after digestion is necessary only when the highest quality
93. p 1 of previous protocol or store at 4 C or air dry thoroughly on clean filter paper and store in sealed plastic bags at RT or in the refrigerator 0 1X SSC 0 1 SDS Strip wash also Highest stringency wash STOCK 1000 ml 2000 3000 ml 4000 ml 5000 ml 6000 ml 25X SSC 4 0 ml 8 0 ml 12 0 ml 16 0 ml 20 0 ml 24 0 ml 20 SDS 5 0 ml 10 0 ml 15 0 ml 20 0 ml 25 0 ml 30 0 ml 37 STS and SSR Protocols Modified from various sources Sequence tagged sites STSs are typically based on sequence information derived from RFLP probes The terminal sequences of a given probe may be available and primers may have to be designed for amplification of the intervening sequence several computer programs are available for this purpose both commercially and in the public domain Sometimes there are published sequences of usable primer pairs STSs may also be developed from cloned RAPD or AFLP fragments Simple sequence repeats SSRs or microsatellites have become easily accessible over the past few years Increasing numbers of primer pairs for detecting SSR loci in a wide variety of crops are being published or made available through other means Good sources of sequence information for both marker systems can be accessed via the Internet For maize consult MaizeDB at http www agron missouri edu query html For wheat consult GrainGenes at http wheat pw usda gov Unlike for RFLPs or AFLPs the quality of the template DNA is less critical for
94. pare the samples as described in the Quick Start Guide sections 2 4 to 2 6 and the User s Manual sections 3 8 to 3 10 NOTES To prepare the formamide size standard mix we use 1000 ul of Hi Di formamide and 30 pl instead of 50 ul GS 350 or GS 500 ROX For loading we mix 0 5 1 0 ul of pooled PCR products with 8 ul instead of 10 ul of formamide size standard mix 4 Start and monitor the run as described in the Quick Start Guide sections 2 18 to 2 32 and the User s Manual sections 3 27 to 3 60 NOTES We use a run module with a shorter run time than specified in the default module to gain efficiencies in time 5 To keep our Genetic Analyzer in good working condition we follow the suggestions given in Chapter 5 of the Quick Start Guide or Chapter 8 of the User s Manual GENERAL NOTE Neither of the ABI PRISM 3100 Genetic Analyzer manuals is complete some procedures are described in more detail in the Quick Start Guide some in the User s Manual It s always a good idea to check both 52 Chemiluminescent AFLP protocol based on protocols from Vos et al 1995 Nuc Acid Res 23 4407 4414 Greg Penner AAFC Winnipeg and the Digoxigenin system of Enrico Perotti CIMMYT This AFLP protocol has been optimized for hexaploid bread wheat but has also worked very well for maize rye tetraploid durum wheat and Tripsacum The use of PstI instead of EcoRI is especially useful for hexaploid wheat due to its very large genom
95. plies as well as the results obtained for several of the major steps in RFLP analyses Since RFLP analyses generally involve processing many samples and probes we strongly recommend that everyone develop a set of sheets to record all of the information during the analyses Please feel free to copy the ones provided or use them as examples on which to base your own 80 Notes mes SS Harvesting and Grinding Records Germplasm Surveys Summary d Plart Fungus Insect Material Available mots Pme M Full History of Harvested Material one list per harvest We 2 NOTES harvesting method me Se Harvesting and Grinding Records Mapping Populations Summary Cf Plart Fungus Insect Material Available Parental Genotype Descriptions ful infomation please Shere d Population Develaarrert roe Pme Ackiticral Notes an Parental Acessions and Population Develaprrert Gel Format Agarose Membrane Type Transfer Quality Date Power Supply Roll Comments Project Volts amp mAmps Time Blot Labels of Layers of Gels Erteredin Gorputer 9 10 11 12 13 1 15 6 17 18 19 20 21 2 23 24 25 26 27 28 Lares 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 lares 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 8 85 86 87 88 80 90
96. r and collect the extract in 2 ml tubes at the tips of the rollers Incubate the extracts in a water bath or an oven at 65 C for 20 40 min mix gently twice or continuously during this incubation Remove the tubes from the heat and let cool for 5 10 min Extract the samples with 1 ml of octanol chloroform 1 24 Mix by inversion for 5 min then spin in a table top centrifuge at 3200 rpm for 10 min Transfer the aqueous supernatant containing the DNA to 2 0 ml Eppendorf tubes If the DNA has to be quantified precisely at the end of the extraction add 10 20 ul of RNAse A 1 see other protocols in the tube and incubate for 30 min at 37 C or for one hour at RT Add 75 ul of 5M NaCl and precipitate DNA with 1 ml of cold absolute ethanol Spin DNA down decant ethanol and dry under a weak vacuum for 30 min Re suspend overnight in the cold room in 200 500 TE pH 8 0 Quantify using a gel method or a TKO fluorometer With this method a minimum of 15 ug of DNA can be obtained Clarke B C L B Moran and R Appels 1989 DNA analyses in wheat breeding Genome 32 334 339 Sap or juice extractor MEKU Erich Poll hne G m b H 3015 Wennigsen Am Weingarten 14 Germany 5 Extraction buffer STOCK 1 Tris 8 0 5 NaCl 0 5 8 0 PVP CTAB 14 M BME4 FINAL 100 mM 2100 mM 150 mM 0 596 2 096 140 mM 10 ml 1 7 ml 1 0 ml 4 2 ml 3 0 ml 0 05 9 0 20 0 1 ml 50 ml 8 5 ml 5
97. ranes with extreme care by the top or bottom edges using clean filter forceps Nalgene and never let them dry The duration and temperature of the wash are the key factors for successful repeatable stripping Strip Washes Using a Homemade Washing Tank To scale up this delicate operation we constructed a washing tank fitted with a water heater circulating unit in one corner e g Cole Parmer s Polystat Immersion Circulator It is large enough to loosely fit a flat stack of large blots say 50 in the space left by the heating unit The bath is also fitted with a draining outlet to facilitate changing the solution and cleaning 1 Immediately after exposing the membranes to film transfer them to 2X SSC or TE to avoid over drying or to prevent mold growth if left in the exposure cassettes 2 Preheat stripping solution 0 1X SSC 0 1 SDS to 93 C in the water bath 3 Wash membranes in tank for 4 6 min maximum at 90 93 C NOTE To quickly place the membranes into the heated solution first lay them as a flat stack ina plastic mesh 1 cm holes basket constructed for this purpose The basket s string handles facilitate introducing and removing it After placing the membranes in the solution use forceps to keep them from rolling or sticking together allow the solution to circulate freely within the basket 4 Quickly transfer the membranes to a container with TE or 2X SSC at RT Proceed immediately with the next re hybridization see ste
98. re no bubbles between the layers Place a thin dry filter paper of the same size as the matrix and finally a small stack of dry paper towels cut to the size of the gel Place a weight on this construction and leave to transfer for 4 h or overnight Dismantle the blot construction and wash the membrane in 2X SSC for 5 min Drip dry and either UV cross link in Stratagene UV Crosslinker using auto setting 120 000 ujoules cm or bake for 1 h at 90 C Detect the incorporated digoxigenin following the protocols of Detection of Dig labeled Probes p 33 except that the time of each step can be shortened as indicated below Solution Operation Buffer 1 rinse Buffer 2 wash 5 min Anti Dig incubate 10 min Buffer 1 wash 5 min Buffer 3 rinse CSPD incubate 5 10 min Expose the membranes to an X ray film for 45 60 min at 37 C 32 Hybridization and Detection of Dig Labeled Probes These protocols have been optimized for hybridizations in siliconized glass bottles e g Robbins Scientific Corp or similar and in polypropylene Corning tubes Handle membranes with extreme care by their top or bottom edges using clean filter forceps Nalgene and make sure they never dry 1 Prehybridize blots for 1 3 h at least 2 h the first time in an oven at 65 C in a tray with enough HYB solution to cover all the blots well The HYB solution used for pre hybridization can be stored frozen or at 4 C and be re used 3 4 times or until precipitat
99. recipitated DNA with glass hook Continue with OPTION A B or C OPTION A Phenol extraction to obtain DNA of higher purity This option is usually not necessary for RFLP analyses unless DNA does not digest properly In fact it is better to perform phenol extraction only after restriction digestion this improves DNA band separation and resolution after electrophoresis see later sections for details 11 Place hook with DNA in 5 ml plastic tube containing 1 ml of TE gently twirl hook until DNA slides off the hook Cap tubes and rock gently overnight at room temperature to dissolve DNA Saghai Maroof Soliman Jorgensen R W Allard 1984 Ribosomal DNA spacer length polymorphisms in barley Mendelian inheritance chromosomal location and population dynamics PNAS 81 8014 8018 2 3000 3200 rpm in a Beckman GP or GPR centrifuge with swinging rotor holding 56 x 15 ml tubes Prepare glass hook by first sealing the end of a 23 cm glass transfer pipette by heating in a flame for a few seconds Then gently heat the tip 1 cm while twirling the pipette When soft allow the tip to bend into a hook Cool before use Used hooks can be cleaned by washing in 2 and EtOH 2 12 Phenol extract each sample with 1 ml 1x original TE volume of equilibrated phenol or 1 1 phenol chloroform Centrifuge the sample 10 min at 1300 x g1 in swinging bucket rotor 13 Transfer top aqueous layer to new 5 ml tube Extract
100. s of buffer between amplified products so there is no confusion about which fragment belongs to which SSR When multiloading single PCR products or multiplexed PCR products or a combination of both may be added to the same tube for sample preparation prior to loading a gel The same considerations on size apply to multiloaded fragments as to multiplexed fragments above Furthermore since all fragments must be of approximately the same signal strength in both multiplexed and multiloaded reactions it is necessary to do a test gel of products in order to dilute or concentrate them as necessary until all fragments are of optimal concentration If some are too dilute they will not be easily read or analyzed following electrophoresis if some are too concentrated their peaks will exceed the maximum the camera can read This will cause a flattened wide top and sizing will be inaccurate it will also cause more pull up peaks 49 of other colors Once a test gel is run approximate strengths of that SSR primer batch will probably be constant for at least six months after that strengths may diminish and need to be increased The relative strengths of the fluorescent dyes most commonly used in our labs are 6 gt gt This is reflected in the amounts of primer typically used in each reaction see Tables 1 and 2 on the CIMMYT website Sample preparation The following reagents are needed to prepare the samples Deioniz
101. s than 25 check all of them Otherwise check only 10 20 of the samples making sure that the selection is totally random 1 Put 2 ug of each DNA sample in a 0 5 ml microfuge tube 2 Prepare a bulk digestion mix based on the recipe given below and keep it on wet ice Add 8 ul of this to each of the tubes containing the DNA Mix thoroughly but gently and spin down the tube contents FINAL Example of bulk digestion STOCK or amount Per 15 pl RXN mix for 20 samples DNA 0 3 yg ul 2 ug 7 0 ul 5 6 ul 112 ul 10X Buffer 1X 1 5 ul 30 ul 0 1 M Spermidine 2 5 mM 0 4 ul 8 ul Enzyme 10 U ul 2 5 Ulug DNA 0 5 ul 10 ul Always prepare bulk mixes for the total number of reactions 1 to allow for pipetting errors 3 Incubate at 37 C for 1 5 to 3 h Stop the reactions with 3 ul of 5X SGB 4 Load samples in a 0 7 agarose gel and run the gel at 40 mA for 2 3 h Use Lambda DNA digested with HindIII as a molecular weight marker See the section on gel electrophoresis for details about gel preparation running conditions and DNA visualization 12 Molecular Weight Markers for Gel Electrophoresis Two types of molecular weight MW standards are routinely used The Lambda HindllI and PhiX174 HaellI MW standards provide a useful reference for calculating molecular weights of large and small DNA fragments respectively after electrophoretic separation the internal MW standards provide a means for normalizing fragment migr
102. sate may be kept at 4 C for further uses TTE buffer STOCK FINAL 25 ml 100 ml ddH20 24 15 ml 96 6 ml Triton X 100 1 0 25 ml 1 0 ml 1M Tris HCl 8 5 20 mM 0 50 ml 2 0 ml 0 5 M EDTA 8 0 2mM 0 10 ml 0 4 ml Sterilize and aliquot into 1 5 ml tubes or 2 ml Sarsted tubes Store at 4 C 27 Incorporation of Digoxigenin dUTP into Plasmid Inserts Using PCR 1 Prepare a bulk reaction mix containing all the components listed below except plasmid FINAL 2 5 Dig 5 0 Dig STOCK or amount 100 pl RXN 100 pl RXN dH20 46 5 ul 46 4 ul Taq Buffer 10X Mg free 1X 10 0 pl 10 0 ul MgCl 50 mM 2mM 4 0 ul 4 0 ul Glycerol 15 96 15 0 ul 15 0 ul dNTP Mix dTTP 10 mM each 50 each 1 5 0 5 ul each 1 5 0 5 ul each dTTP 10 mM 48 75 or 47 5 uM 0 4875 yl 0 475 ul Dig dUTP 1 mM 1 25 or 2 5 uM 0 125 ul 0 250 ul Enzyme 50 1 20U 0 4 ul 0 4 ul Primer 1 2 5 0 2 uM 10 0 ul 10 0 ul Primer 2 2 uM 45 0 2 uM 10 0 ul 10 0 ul Plasmid 5 10 ng 2 0 ul 2 0 ul 2 Add 98 ul of bulk mix to each tube 3 Add2 ul of plasmid to each tube Mix briefly and centrifuge 4 Overlay each sample with 50 ul of ultra pure mineral oil 5 Place in PCR machine making sure there 15 sufficient oil in each well to provide proper contact with tube 6 Amplify using the following program 1 cycle of 25 cycles of 1 cycle of 94 C for 1 min 94 C for 1 min 72 for 4 min 55 for 2 min 72 for 2 min Note You ma
103. se MW 121 10 54 0 g 108 0 g 162 0 g 216 0 g 210 0 g Boric acid MW 61 83 2759 55 09 82 5 9 110 0 g 137 5 9 0 5 M EDTA pH 8 0 20 0 ml 40 0 ml 60 0 ml 80 0 ml 100 0 ml pH to 8 0 with glacial acetic acid or HCI acetic acid for PAGE A precipitate may form when stored for long periods of time 10X TBE gel buffer 0 9 M Tris borate 20 mM EDTA STOCK 1 liter 2 liters 3 liters 4 liters 5 liters Tris Base MW 121 10 108 0 g 216 0 g 324 0g 432 0 g 540 0g Boric acid MW 61 83 55 09 110 0 g 165 0 g 220 0 g 275 09 0 5 M EDTA pH 8 0 40 0 ml 80 0 ml 120 0 ml 160 0 ml 200 0 ml pH to 8 0 with glacial acetic acid or HCI acetic acid for PAGE A precipitate may form when stored for long periods of time 10X TG gel buffer for better resolution STOCK 2 liters Tris Base MW 121 10 60 0 g Glycine MW 75 07 288 0 g ddH20 up to 200 0 ml 5X SGB Sample gel buffer STOCK FINAL 50 ml 100 ml 1M Tris 8 0 50 mM 25 ml 5 0 ml 0 5 M EDTA 8 0 5mM 0 5 ml 1 0 ml Sucrose 25 12 50 25 09 Bromophenol blue 2 mg ml 100 0 mg 200 0 mg Xylene cyanole 2 mg ml 100 0 mg 200 0 mg ddH20 up to 50 0 ml up to 100 0 ml DNA sequencing stop solution STOCK FINAL 1500 pl 5M NaOH 10 mM 3 0 ul 99 formamide 95 1439 0 ul Bromophenol blue 0 05 1 5 mg Xylene cyanole 0 05 1 5 mg ddH20 61 0 ul Aliquot and keep at 4 C 40 Acrylamide stock solution 29acrylamide 1bisacrylamide STOCK 500 ml 1000 ml 2000 ml Acrylamide 193 3 g 386 7 g 773 30 Bisacrylamide 6 70 134
104. se from When multiplexing both electrophoresis reagents and PCR reagents are used more efficiently The same amounts of PCR reagents are added to the tube but two or more pairs of SSR primers are added to the mix instead of only one The SSR primers to be amplified simultaneously must first be tested to make sure that they have the same annealing temperature and that they neither interfere with each other s amplification due to annealing with the other primer nor compete with each other so that only one pair amplifies a product or amplifies a product preferentially at the expense of the other pair The amplified products of each pair should not be exactly the same size If they are of a similar size they must be labeled in different colors However even if two products are labeled in different colors we highly recommend never overlapping exactly the same size because pull up peaks may cause the camera to confuse what color the peak actually is For a discussion on pull up peaks and florescent dye spectra please see the ABI PRISM 3100 Genetic Analyzer User s Manual or the ABI PRISM 377 DNA Sequencer User s Manual We recommend as a rule of thumb that different color fragments do not overlap and at least 10 base pairs of buffer are always maintained between the smallest allele of the larger SSR and the largest allele of the smaller SSR For fragments from different SSRs labeled with the same color we recommend maintaining 50 base pair
105. se pair fragment is observed 62 Protocols for detecting transgenic DNA sequences via ELISA Materials required An ELISA kit to detect the event of interest Materials to be tested seed or leaf tissue Grinding and extraction equipment Airtight plastic container humid box Paper towels Distilled water Micropipettes and a multi channel pipette that will measure 50 and 100 ul Sterile micropipette tips Graduated cylinder A 1 500 g scale Rack for sample tubes Centrifuge tubes Extraction bags for samples Centrifuge with 5000 g capacity Microtiter plate reader Wash bottle Orbital plate shaker Sample loading diagram Sampling procedure Proper sampling is the first most important step for the correct use of the commercial kits and for obtaining reliable results Quantitative kits allow bulking a definite number of grains or leaf tissue portions Sampling must be carried out depending on the amount of material to be tested the level of detection desired and the level of detection of the kit The Grain Inspection Packers Stockyards Administration GIPSA of the United States Department of Agriculture USDA provides complete scientific information on seed sampling for detecting genetically modified organisms GMOs at the following web site http 151 121 3 117 biotech sampling grains for biotechnolog htm Leaf extraction Leaves may be collected from the field or the greenhouse In both cases they should be placed
106. solve 200 g of N laurylsarcosine sodium salt MW 293 4 Sigma L5125 dH20 to a final volume of 1000 ml Stir for several hours to dissolve completely Filter sterilize and aliquot in sterile 15 ml tubes e g Corning 73 LB media Per liter 10g Bacto tryptone 5g Bacto yeast extract 10g Adjust pH to 7 5 with 1 M NaOH LB Amp Autoclave and let cool to 50 Add 100 250 mg ampicillin sodium salt Sigma 9518 per liter sterile LB Do not autoclave solution containing antibiotics LB Amp for plates Add 15 g Bacto agar per liter of LB Dissolve agar in microwave autoclave Add Amp pour 25 ml per plate LB Amp for stabs Add 7 g Bacto agar per liter of LB Autoclave Add Amp pour stabs 1 M MgClz 1 M magnesium chloride Dissolve 20 33 g MgClo 6H20 MW 203 30 in dH20 to a final volume of 100 ml Autoclave OLB TE 7 3 mM Tris HCl 0 2 mM EDTA pH 7 0 Add 300 ul of 1 M Tris HCl pH 7 5 and 40 ul of 0 5 M EDTA 8 0 to 90 ml of ddH20 the purest you can get we use Sigma Cell Culture Water Cat W 3500 Check pH by dropping a few ul onto a pH paper Do not contaminate this solution because it is used for PCR reactions If necessary bring pH to 7 0 with and make volume up to 100 ml 1 M NaPO 6 5 Blot transfer phosphate buffer For approximately 1 liter start with 660 ml 1 04 and add 1 NazHP0z to bring pH to 6 5 approx 330 ml STOCK 500 ml 1000 ml 2000 ml 50
107. stant 250V for 2 5 h depending on the acrylamide concentration Generally it takes 2 h for 8 3 h for 12 and 5 h for 16 gels Usually BPB has run out of the gel and the XC has either just run out or is at the bottom of the gel depending on acrylamide concentration Denaturing gels Pre run gels at constant 400V for 30 min so that the temperature of the buffer reaches about 60 65 C Before loading samples flush out the wells again to remove urea in the wells Load 4 ul of denatured samples Run at 350V for 60 70 min until the XC reaches 2 3 cm from the bottom of gels Check temperature of the buffer occasionally and keep at 60 70 C by reducing or increasing voltage accordingly Remove gels from plates and cut one or more corners of the gels so the direction of the gel and the gel number can be identified after silver staining 5 Silver staining modified from Sanguinetti et al 1994 Biotechniques 17 915 919 Trays are gently shaken throughout the steps Wear gloves at all times and handle the gels gently because pressure and fingerprints produce staining artifacts It is also important to use clean glassware and deionized distilled water because contaminants greatly reduce the sensitivity of silver staining a Place gels in 100 ml of 10 ethanol with 0 5 ml 100 ml acetic acid added and shake for 3 5 min b Replace the solution with 0 2 silver nitrate aqueous solution and shake for 5 10 min This solution can be re used many
108. t in 190 ul dH5O It may be placed on a vortex for 45 min but use gentle vortexing 9 Add 5 ul of 1 mg ml RNAse A and 5 ul of 500 U ml RNAse Incubate at 37 C or RT for 15 min 10 Add 10 ul of 5 mg ml Proteinase Incubate at 37 C or RT for 20 min 11 Extract with 200 ul phenol or 200 ul phenol chloroform 1 1 12 Centrifuge for 4 min at full speed in microfuge 12 000 rpm Transfer aqueous upper phase to new microfuge tube 13 Add 100 ul 7 5 M NH4OAc to precipitate the DNA 14 Add 800 ice cold absolute EtOH mix gently and incubate at 80 C for 30 min Centrifuge 5 min at full speed in microfuge and pour off the supernatant 15 Wash pellet with 1 ml 75 EtOH centrifuge 4 min in microfuge Pour off supernatant and dry tube in vacuum desiccator for 20 30 min 16 Dissolve pellet in 50 ul TE 8 0 UV quantification of DNA Plasmid DNA is usually quantified using the mini fluorometer see earlier protocol but a spectrophotometer can also be used as follows l Birnboim H C and J Doly 1979 A rapid alkaline extraction procedure for screening recombinant plasmid DNA Nucelic Acid Research 7 1513 1518 67 Add 5 ul of each sample to 745 ul TE read OD260 and OD280 to determine purity Dilute sample with TE to 1 pg ul or 100 ng ul Store at 20 C Sample should be usable for up to 6 months See Beckman Spectrophotometer program on p 77 Solution 25 mM Tris 8 0 10 mM EDTA 50 mM glucose
109. times by adding 20 ml of 2 silver nitrate to each liter after each use c Rinse gels briefly with ddH5O and transfer to 100 ml of the developer solution d When appropriate development is obtained about 5 15 min discard developer and rinse gels with ddH O Stop reaction by adding about 100 ml of the stop solution or alternatively use 10 acetic acid NOTE Deionized distilled water is recommended for all solutions involved in the staining process Trays should be cleaned by wiping with soft wet paper towels to remove silver If not cleaned the surface of subsequent gels may become black because of the silver residue The weaker the band intensity the longer the developing time resulting in a higher background In this case load more sample or optimize PCR conditions to give better amplification 6 Scoring photos drying Place gel on a light box with fluorescent lamps Score results and photograph at f22 32 and 1 125 second exposure with Type 667 film Polymorphisms should be scored in the gels rather than in the photos If necessary dry gels as follows sandwich gels between 2 layers of cellophane stretch on glass plates with clamps and dry at room temperature A gel dryer may also be used 43 Multiplexing primer pairs For primers pairs resulting in amplification products of distinct sizes a procedure called multiplexing allows the simultaneous amplification of two or more microsatellites provided they have similar annea
110. ting with SSRs A top molecular weight standard is routinely used in every lane of SSR fingerprinting gels both agarose and polyacrylamide It is PCR amplified from the Phi plasmid 174 simple to prepare It is not possible to use a bottom fragment since fragments smaller than about 80 base pairs show up in both agarose and polyacrylamide gels as a smear if they show up at all Larger bottom standards would interfere with the SSR alleles themselves which can often be as small as 80 100 base pairs 16 1 Obtain the following primers from any source that manufactures oligonucleotides we frequently use Operon for this purpose Forward primer 5 3 CGCCAAATGACGACTTCTAC Reverse primer 5 3 GCGCATAACGATACCACTGA These primers correspond to position 1547 and 2050 respectively of the Phi plasmid and amplify a fragment 523 base pairs in length 2 Run the following PCR reaction using uncut Phi 174 plasmid DNA We recommend you do several reactions as you will need a lot of product FINAL STOCK or amount 25 pl 100 pl RXN ddH20 10 3 ul 41 2 ul 10X Taq buffer 1X 2 5 ul 10 0 ul dNTP 2 5mM each 50 uM each 0 5 ul 2 0 ul MgCl 50 mM 1 2 mM 0 6 ul 24 ul Taq polymerase 5U ul 0 5 U 0 1 ul 0 4 ul Phi DNA 5 ng ul 25 ng 5 0 ul 20 0 ul Forward primer 2 0 uM 0 24 uM 3 0 ul 12 0 ul Reverse primer 2 0 uM 0 24 uM 3 0 ul 12 0 ul 3 Amplify using the following program 1 cycle of 30 cy
111. tion on lyophilized tissue 53 FINAL STOCK or amount 50pl RXN ddH20 to 50 ul 39 9 ul 10X buffer for Msel 1X 5 0 ul Msel 5 U ul 2 5 Ulug DNA 0 5 ul Genomic DNA 0 3pg pl 1 ug 3 35 ul EcoRI 10 U ul 2 5 Ulug DNA 0 25 ul NaCl 5 M 100 uM 1 ul Digest DNA with Msel with appropriate buffer and incubate for 3 5 4 0 h at 37 Add NaCl to reach 50 uM for PstI or 100 for EcoRI Digest DNA with PstI or EcoRI at 37 C for an additional 2 h or overnight in the case of wheat if digesting many samples a bulk mix of NaCl with the enzyme can be prepared Inactivate enzymes at 70 C for 15 min Check the digestion quality by loading 5 1 each of digested DNA 21 SXSGB on a 0 7 agarose gel and include one lane with 100 ng 174 as molecular weight marker Ligation of adaptors 6 If the adaptors are not yet annealed i e two single stranded oligos that need to be annealed to form an adaptor they need to be annealed following the steps below This should be done only once Prepare a 50 uM stock of each Msel forward and reverse adaptor Prepare a 5 uM stock of each PstI or EcoRI forward and reverse adaptor Anneal adaptors to make them double stranded as follows 95 for 5 min 65 C for 10 min 37 C for 10 min Remove samples allow them to reach room temperature and store at 20 C Prepare ligation mix as follows FINAL 10 wl RXN STOCK or amount volumes ddH20 5 yl Ligation buffer 5X 1X 2
112. uid nitrogen to quick freeze samples Once frozen do not allow samples to thaw until freeze dried NOTE Leaf samples may be frozen and stored at 80 C until ready to be lyophilized Transfer frozen leaf samples to lyophilizer Make sure the lyophilizer is down to temperature the chamber is lt 50 C and pulling a good vacuum lt 10 microns Hg before loading samples Do not overload lyophilizer make sure the vacuum is always lt 100 microns and condenser temperature is lt 50 C Samples should be dry in 72 hours Typically fresh weight 10X dry weight Dried leaf samples may be stored in sealed plastic bags at room temperature for a few days or preferably at 20 C for several years Fill out a harvesting record sheet Grinding 1 2 Grind to a fine powder with a mechanical mill Tecator Cyclotec Sample Mill Model 1093 into a plastic scintillation vial or any other appropriate plastic container that can be closed airtight NOTE If the plant material weighed less than 4 g fresh weight grind to a powder in a coffee mill or a mortar and pestle with liquid nitrogen The finer the grind the greater the yield of DNA from a given amount of material Store ground samples tightly capped at 20 C Samples are stable for several years Genomic DNA Isolation based on method of Saghai Maroof et al 1984 1 Weigh 300 400 mg of ground lyophilized tissue into a 15 ml polypropylene centrifuge tube DNA yields range
113. us phase and a green organic phase Remove approximately 750 ul of the yellow aqueous phase and place in a new 1 5 or 2 0 ml tube containing 5 ul RNAse Optional step Repeat the chloroform treatment on the aqueous phase This produces cleaner DNA but a lower yield Mix with gentle inversion and incubate at 37 C for 30 min Add volume ice cold 100 isopropanol 2 propanol Mix very gently to precipitate the nucleic acid Optional step Incubate samples at 20 C overnight especially if precipitated DNA is not visible Centrifuge at 3500 rpm at room temperature for 30 min to form a pellet at the bottom of the tube Discard the supernatant Optional step Phenol extract each sample with 0 5 ml 1 1 phenol chloroform according to phenol extraction procedures on page 3 This is rarely necessary when using lyophilized tissue 12 Add 1 ml of 75 ethanol Wash the DNA pellet gently Discard ethanol by decantation Wash once again Allow pellet to air dry until ethanol evaporates completely Any remaining alcohol smell indicates pellet is not completely dry Re suspend the DNA pellet in 1 ml of TE or double distilled water Store samples at 4 C until use if DNA will not be used for a long time store at 20 C NOTE DNA that is re frozen after being thawed begins to break after each freezing session so freeze DNA only for long term storage and preferably after all testing is finished If DNA will be used for multiple projects with long
114. y need to double the extension time for inserts longer than 1 5 Kb A WwW N It may be necessary to determine optimal concentrations of MgCl and Taq with each new lot of enzyme This optional ingredient has been found to help amplify large or difficult inserts Digoxigenin 11dUTP Boehringer Mannheim Cat 1093088 25 1 5 25 1 Diluted in DNA dilution buffer 10 mM Tris pH 8 0 1 mM EDTA 10 mM Examples of primer sequences pUC and M13 CV72 5 ACGACGTTGTAAAACGACGGCCAGT 3 derived vectors CV76 5 AAACAGCTATGACCATGATTACGCC 3 pBR322 P sti CV236 5 GCGCAACGTTGTTGCCAT 3 inserts CV237 5 CGAGCGTGACACCACGAT 3 Conditions optimized for ERICOMP TwinBlock System thermocycler 28 Remove oil by adding 25 ul 50 ul chloroform Mix and centrifuge Pipette top aqueous layer into new tube Quantify yield of insert using the method described in the section on gel quantification Gel quantification is a good choice since it also allows checking the amplification product and the incorporation of Dig dUTP into this product Details of these protocols are given in the Gel Quantification section 29 Relative Quantification of Amplified Inserts in Gel After PCR amplification it is essential to determine whether the reactions were successful what their yield was and if digoxigenin labeling has been performed whether the incorporated label has the expected activity 1

Laboratory Protocols. CIMMYT Applied Molecular

Contents

Download Pdf Manuals

Related Search

Related Contents