myT KRAS Protocol - Swift Biosciences
Contents
1. Setup Run method k 2 3 4 5 Select Tabular View Reaction Volume Per Well 25ul Holding Stage 1 step 95 C 10 minutes ramp rate 100 Cycling Stage 2 steps Number of Cycles 45 or 60 cycles 95 C 14 seconds ramp rate 100 65 C 1 minute ramp rate 100 collect data on hold 45 cycles of Cycling Stage are required for Locus specific reactions and 60 cycles for Allele specific reactions 16 Run Method iT Review the reaction volume and the thermal profile for the default run method If needed edit the default run method or select a run method from the library SAF Experiment Properties Graphical View Tabular View Plate Setup Reaction Volume Per Well 25 uL Expert Mode SclectView Fiters mon nen 1 Collect Data w i Open Run method Save Run Method Revertto Defaults x Number of Cycles 60 44 5 45 cycles of Cycling E Enable AutoDelta samc I Stage are required for Locus specific reactions and 60 cycles for Allele specific reactions Reaction Setup 7 PEGLA Ramp Rate f 100 0 E Temperature C 95 0 Time 10 00 AutoDelta Temp AutoDelta Time Collect Data on Ramp m i Collect Data on Holdi i Step 1 Step 1 Step 2 6 Open the door on the ABI 7500 Insert your plate Close the door 7 Click on START RUN in the uppe2. 28 samples plus 2 control wells 2 Invert the cocktails repeatedly to mix reagents and briefly centrifuge to collect contents 3 Dispense 20 ul cocktail into each reaction well Suggested 96 well plate layout place the seven allele specific assays in rows and up to 10 samples plus controls in columns 4 For each sample add 5 ul DNA that corresponds to 10 amplifiable copies into each of the 7 allele specific reaction wells DNA amount determined from the Locus specific qPCR above 5 For each allele specific cocktail include a no template control NTC by adding 5 ul Nuclease free Buffer to one reaction well 6 For each allele specific cocktail include a 10 copy positive control by adding 5 ul mixed DNA Standard to one reaction well 7 Seal plate and briefly centrifuge 1000 2000 RPM for 15 seconds to collect contents 8 Load plate into the selected thermocycler and follow run instructions for details see Appendix for ABI 7500 instructions Cycling Temperature Cycling Time 05 n d with FAM read disable any reads for passive reference dyes such as ROX Determination of KRAS mutation status for each sample For each Allele specific myT KRAS qPCR either a positive or negative amplification signal will be obtained If 10 amplifiable copies are analyzed a 1 sensitivity limit which represents 10 mutant copies in 10 wild type copies can be achieved If only 10 amplifiable copies are ana
3. Recommended Vendor EagleTaq Master Mix Roche part number 05529085 190 Dual Labeled Probe IDT PrimeTime Dual Labeled Probe Free of charge voucher provided Note myT KRAS has been optimized for use with the above reagents Reagents from other vendors may be substituted but substitutions may result in reduced assay performance or require the user to modify assay conditions to achieve maximal performance Probe sequence 5 56 FAM AGCTGTATCGTCAAGGCACTCTTGCC 3IABKFO 3 When ordering this probe please include an internal Zen quencher gt Details on how to redeem the free of charge voucher for the dual labeled probe from IDT were sent with your order acknowledgement If you have any questions please contact Swift Technical Support at 734 330 2568 or technicalsupport swiftbiosci com Instructions for re suspension of probe Spin lyophilized probe to collect contents Resuspend in Nuclease free Buffer provided to achieve a 100 uM stock based on actual yield obtained Make a 3 uM working dilution of the probe Distribute 72 ul each to the Locus specific and seven Allele specific myT Primer stocks The final volume for each stock will be 198 72 270 ul Y VV VV WV Probes are light sensitive Avoid prolonged exposure to light once probe has been added 96 well plates are not supplied but the following have been tested using myT KRAS gt ABI 7500 Order from Applied Biosystems Life Technologies o 96 well optical reac
4. and follow run instructions for details see Appendix for ABI 7500 instructions Cycling Temperature Cycling Time Cycles E with FAM read disable any reads for passive reference dyes such as ROX 11 Determination of amplifiable copy number for the allele specific assay 1 The control DNA Standard has 10 amplifiable KRAS copies per 5 ul and should have a Ct value as specified in the table below if using the ABI 7500 10 is the recommended amplifiable copy number to place in the Allele specific assay Limiting the assay to 10 amplifiable copies reduces the likelihood of PCR inhibition and detection of low level cross contamination that can be present in FFPE samples Thermocycler Expected Average Ct value for Locus specific 10 copies ABI 7500 2 If samples have a Ct value less than the control DNA well dilute with Nuclease free Buffer to 10 amplifiable copies per 5 ul assuming that a 2 fold dilution will increase the Ct value by 1 Example If a Ct of 27 4 is obtained 28 4 27 4 1 Ct so dilute sample 2 fold 3 If samples have a Ct value greater than the control DNA well add up to 10 amplifiable copies per 5 ul assuming that a two fold increase in DNA will decrease the Ct value by 1 Do not exceed 20 DNA per reaction volume as PCR inhibitors are present in FFPE preparations Example If a Ct of 30 4 is obtained 30 4 28 4 2 so add 4 fold more DNA if possible 4 If samples have insufficie
5. completely at room temperature Once thawed invert repeatedly or gently vortex and briefly centrifuge to collect contents To avoid cross contamination always briefly centrifuge DNA Standard and DNA samples prior to opening caps Also gently mix reactions containing EagleTaq Master Mix to avoid formation of bubbles that can interfere with fluorescence detection Each reaction contains KRAS Locus specific Primers Probe EagleTaq Master Mix DNA Template Total Volume 25W si Remember to add 72 ul of resuspended 3uM probe to the myT Primer tube before initial use 1 Make a cocktail with KRAS Locus specific primers and EagleTaq Master Mix in the amount needed for the number of reactions to be run plus up to 5 extra volume to compensate for pipetting loss maximum 28 samples plus 2 control wells 2 Invert tube with the cocktail repeatedly to mix reagents and briefly centrifuge to collect contents 3 Dispense 20 ul cocktail into each reaction well 4 Add 5 ul sample DNA corresponding to 5 ng high quality DNA or 10 to 50 ng of FFPE DNA If necessary use Nuclease free Buffer provided to dilute samples Include a no template control NTC by adding 5 ul Nuclease free Buffer to one reaction well Include a 10 copy positive control by adding 5 ul KRAS DNA Standard to one reaction well Seal plate and briefly centrifuge at 1000 2000 RPM for 15 seconds to collect contents oe n Load plate into the selected thermocycler
6. copies 1000 WT copies genomic DNA E 750 000 500 000 250 000 a 5 14 15 20 25 Si an Amplification Plot 1 900 000 2000 mutant copies G13D 1 250 000 200 mutant copies 013D E 20 mutant copies G13D 1 000 000 MO mutant copies 1000 WT copies genomic DHA te 750 000 500 000 250 000 5 10 15 20 25 a0 a5 a 25 SO 55 a Cycle Amplification plots qPCR reactions containing mutant genomic DNA at the specified quantity in a background of 10 wild type genomic DNA red n 16 replicates per assay resulted in KRAS mutant specific amplification 50 mutant content green n 4 replicates per assay 10 mutant content yellow n 12 replicates per assay and 1 mutant content blue n 24 replicates per assay Assays performed on an ABI 7500 Conclusion These results demonstrate mismatch discrimination with very high specificity The results are clear and unambiguous eliminating the need for ACt analysis to distinguish specific from non specific amplification This high confidence Yes No clarity is a feature that is exclusive to myT Primer reagents Protocol The myT KRAS kit provides sufficient reagents to perform a total of 30 assays to assess KRAS codon 12 13 mutations using the ABI 7500 Real Time PCR System Mutation detection with myT KRAS consists of two steps 1 Locus specific qPCR A non allele specific qPCR is performed to assess total mutant wild type amplifiable KRAS for e
7. non template containing reagents e Maintain separate work areas for template and non template containing reagents e Routinely decontaminate work areas with 10 bleach and or UV light e Never open PCR reaction wells that resulted in allele specific amplification myT KRAS Workflow Isolate genomic DNA from samples 4 Obtain UV absorbance readings 4 Perform 1 Locus specific qPCR reaction per DNA sample Determine amplifiable copy number from Ct values 4 Perform 7 Allele specific qPCR reactions per DNA sample 4 Determine KRAS mutant status for each DNA sample The contents provided are sufficient to perform 240 reactions consisting of 30 Locus specific and 30 Allele specific reactions per allele for seven different mutations 8 X 30 This enables testing of up to 28 samples when including a positive control and NTC if performed as a single qPCR run If testing is split into multiple batches total samples tested will be less since a positive control and NTC are required for each run For example if testing is batched into 3 qPCR runs the total number of samples analyzed will be 24 8 per run where 3 positive control and 3 NTC reactions are also run Positive control template mixed DNA Standard is provided in sufficient quantity for up to 4 separate batch runs per kit For all included reagents a 10 excess volume is included to compensate for pipetting loss 10 Step 1 Locus specific KRAS qPCR Thaw reagents
8. Quencher Color r BRAF Fan one Reaction Setup Matenals List 2 15 Define Targets and Samples Define Samples Name your samples Reagents TaqMan Reagents stanton y on Experiment Properties l Ge l Reaction Setup w Materials List Assign Targets and Samples Select each well containing a reaction in View Plate Layout and assign Target KRAS Assign your particular samples the same way Select the dye to use as a passive reference None Define Targets and Assign Targets and Samples To set up standards Click Define and Set Up Standards 8 instructions To set up unknowns Select wells assign target s select L Unknown as the task for each target assignment then assign a sample To set up negative controls Select wells assign tanpet gsi N Negabve Control as the task for each target assignment Assign target s to the selected wells lt View Plate Layout View Well Table gt D showin weis v PE View Legena 2 3 4 ee ew Mixed m Unknown E Standard J Negative Control Assign sample s to the selected wells T Assign Sample Sample 1 Assign sample s of selected well s to biological group Assign Biological Group m p De Select the dye to use as the passive reterence era E arar Wells JJ 96 Unknown E 0 Standard Z 0 Negative Control dtt
9. Swifty STOSCIENCES AD E Primers myT KRAS qPCR primers for detection of seven human KRAS codon 12 13 mutations KRAS G12D Gly12Asp GGT gt GAT KRAS G12A Gly12Ala GGT gt GCT KRAS G12V Gly12Val GGT gt GTT KRAS G12S Gly12Ser GGT gt AGT KRAS G12R Gly12Arg GGT gt CGT KRAS G12C Gly12Cys GGT gt TGT KRAS G13D Gly13Asp GGC gt GAC For Research Use Only Swift Biosciences Inc All rights reserved Version 07581301 Notice to Purchaser Limited License This product is for research use only and is licensed to the user under Swift Biosciences intellectual property only for the purchaser s internal research Purchase of this product does not convey to the purchaser any license to perform the Polymerase Chain Reaction PCR process under any third party rights PCR probes can be purchased from a variety of vendors including Applied Biosystems Life Technologies Roche Molecular Systems Inc F Hoffman La Roche Ltd Integrated DNA Technologies Biosearch Technologies Nanogen Inc and others The use of certain probes including TaqMan MGB FAM TAMRA FAM BHQ VIC MGB in connection with PCR process may require a license from one or more of these vendors Please contact individual vendors for the necessity of obtaining licenses The purchase of myT KRAS or any other items delivered by Swift Biosciences hereunder does not either expressly or by implication provide a license to use any proprietary technology of t
10. ach sample This determines the quantity of DNA to be used in the allele specific PCR for each sample Reagents for 30 reactions including controls are included One locus specific PCR reaction per DNA sample is performed 2 Allele specific qPCR gt gt gt gt A mutant allele specific KRAS qPCR is then performed to assess presence of codon 12 13 mutations Results are reported as positive or negative for mutant KRAS for each sample with a sensitivity limit of 1 10 mutant copies in 10 wild type copies Reagents for 30 reactions per allele including controls are included For each DNA sample seven separate allele specific PCR reactions are performed Reagents Included KRAS G12R Primers 198 ul Allele specific myT KRAS primers KRAS G12C Primers 198 ul Allele specific myT KRAS primers KRAS G12S Primers 198 ul Allele specific myT KRAS primers KRAS G13D Primers 198 ul Allele specific myT KRAS primers Nuclease free Buffer For DNA sample dilution and NTC reactions NTC no template control Shipped in a separate box KRAS mixed DNA Standard 180 ul KRAS mixed mutant DNA 200 copies ul total Store all reagents at 20 C upon arrival To avoid cross contamination store the myT Primers box separately from the DNA Standard box gt Refreeze unused myT Primers and DNA Standard at 20 C gt For best performance limit freeze thaw cycles to 4 E RE Ree SEE en enn Reagents not included Reagents
11. hese vendors Trademarks Used in this Manual myT is a trademark of Swift Biosciences Inc EagleTaq Master Mix is a registered trademark and product of Roche Diagnostics Corporation TaqMan is a registered trademark of Roche Prime Time qPCR Probes is a registered trademark and product of Integrated DNA Technologies QIAamp is a registered trademark and product of Qiagen GmbH ABI 7500 Real Time PCR System is a trademark and product of Applied Biosystems now part of Life Technologies Corp myT Primer Technology myT Primers have unique structural and thermodynamic properties that make them highly sensitive to mismatch discrimination myT Primers are comprised of Primer and Fixer oligonucleotides with three functional domains the long Fixer domain provides a high level of specificity for genomic DNA templates the Primer domain is highly sensitive to single base mutations due to its very short length and the double stranded stem links the Fixer and Primer domains When a mutant specific myT Primer is combined with a reverse primer and hydrolysis probe myT Primers can detect 1 mutant KRAS codon 12 13 mutations present in a background of 10 wild type genomic DNA copies without non specific amplification from wild type either a positive or negative amplification signal is generated and a delta Ct method to distinguish specific from non specific amplification is not required see data on page 4 Mutant Template Primer Fixe
12. lyzed a reduced 10 sensitivity limit can be achieved which represents 10 mutant copies in 107 wild type copies The cut off Ct values for detection of 10 mutant copies for the thermocycler tested are in the table below Thermocycler 10 Copy Ct Cut off os 45 44 44 40 45 47 47 47 ABI7500 45 44 4 pa 45 47 20 copy Ct cut off If a Ct value is obtained that exceeds the cut off it is scored as negative or below the limit of detection for this assay Occasionally when amplifiable copy number is limiting a Ct value near the cut off will be obtained In this case the assay can be repeated to confirm a positive amplification signal If positive the Allele specific Ct value will be dependent on the percent tumor cell content and the tumor heterogeneity of the sample from which the DNA was derived Low percentage tumor cell samples will have limited sensitivity 14 Appendix Life Technologies ABI 7500 Run protocol 1 Turn on the ABI 7500 2 Open ABI7500 software on your computer 3 Select Advanced Setup Setup Experiment properties 1 Name your experiment 2 Select 7500 96 Wells Quantitation Standard Curve TaqMan Reagents Standard 2 hours to complete a run Experiment Menu 1 Type Standard Curve Reagents TaqMan Reagents Experiment Properties g g Enter an experiment name select the instrument type select the type of experiment to set up the
13. n select materials and methods for the PCR reactions and instrument run Plate Setup How do you want to identify this experiment Experiment Name BRAF Run Method Barcode Optional Reaction Setup User Name Optional Comments Optional Materials List r Which instrument are you using to run the experiment f m a N Setup run and analyze an experiment using a 4 or 5 color 96 well system What type of experiment do you want to set up C AG AA a A A CEA CC Use standards to determine the absolute quantity of target nucleic acid sequence in samples Which reagents do you want to use to detect the target sequence a The PCR reactions contain primers designed to amplify the target sequence and a TaqMan probe designed to detect amplification of the target sequence Which ramp speed do you want to use in the instrument run For optimal results with the standard ramp speed Applied Biosystems recommends using standard reagents for your PCR reactions Setup Plate Setup 1 Define Targets and Samples Define Targets Target Name Reporter Quencher Color KRAS FAM None your choice Experiment BRAF Type Standard Curve Experiment Properties H Run Method Q instructions Define the targets to quantify and the samples to test in the reaction plate Define Targets Target Name Reporter
14. nt amplifiable copy number 1 sensitivity is not likely to be achieved as 1 represents 10 mutant copies in 10 total copies Based on Poisson distribution copy number less than 10 is not detected at 100 frequency in a single well reaction 5 If the Locus specific Ct value is gt 35 the amplifiable copy number is too low to proceed 6 Regarding the NTC either no amplification or an occasional Ct gt 38 may be obtained If the NTC or DNA Standard positive control fails contact technical service 12 Step 2 Allele specific KRAS qPCR Thaw reagents completely at room temperature Once thawed invert repeatedly or gently vortex and briefly centrifuge to collect contents To avoid cross contamination always briefly centrifuge DNA Standard and DNA samples prior to opening caps Also gently mix reactions containing EagleTaq Master Mix to avoid formation of bubbles that can interfere with fluorescence detection Each of the seven allele specific reactions contains KRAS Allele specific Primers G12D G12A G12V 7 5 ul G12S G12R G12C or G13D Probe EagleTaq Master Mix 12 5 ul DNA Template Total Volume 235W Remember to add 72 ul of resuspended 3 uM probe to the myT Primer tubes before initial use 1 Make seven cocktails with each KRAS Allele specific Primer reagent and EagleTaq Master Mix in the amount needed for the number of samples to be run plus up to 5 extra volume to compensate for pipetting loss maximum
15. r gt ven nn 3 Wild Type Template 57 3 Stem no extension myT KRAS Performance G12A Amplification Plot E 1000 mutant copies G12 E 100 mutant copies G12A 10 mutant copies G12A MO mutant copies 1000 WT copies genomic 1 250 000 1 000 000 o 750 000 C 500 000 250 000 0 G12C Amplification Plot 1000 mutant copies G12C 1 250 000 100 mutant copies G12C 10 mutant copies G12C 1 000 000 mo mutant copies 1000 WT copies genomic DNA 750 000 C 500 000 250 000 o G12D Amplification Plat 1 750 000 1000 mutant copies G12D E 100 mutant copies G12D 10 mutant copies G12D 1 250 000 MO mutant copies 1000 WT copies genomic DHAJ 1 000 000 C 1 500 000 750 000 500 000 250 000 o G12R Amplification Plat 1000 mutant copies G12R E 100 mutant copies G12R 1 500 000 7 W 10 mutant copies G12R 1 250 000 1 750 000 c 1 000 000 oF l 750 000 500 000 350 000 o 5 10 15 a 25 a 35 a a5 SO 55 a G125S e EBUEL Bo 2 500 000 1000 mutant copies G125 E 100 mutant copies G125 2 000 000 7 E 10 mutant copies 6125 MO mutant copies 1000 WT copies genomic DNA 1 500 000 E 1 000 000 500 000 a a 5 10 15 2 25 KE 35 di 5 ba 55 a Cycle Amplification Plat 1 500 000 1000 mutant copies G12 E 100 mutant copies G17V 1 260 000 is 10 mutant copies G12 1 000 000 MO mutant
16. r right corner of the screen
17. tion plates cat no 4306737 o MicroAmp optical Adhesive Film cat no 4311971 Notes Regarding DNA Samples For high quality DNA derived from cell lines or fresh frozen clinical samples UV absorbance readings correlate well with amplifiable content gt For DNA derived from formalin fixed paraffin embedded samples FFPE UV absorbance readings determine the DNA concentration but do NOT accurately determine amplifiable content due to DNA damage from fixation gt Itis recommended to obtain UV absorbance readings for each sample in order to determine the amount of DNA to use in the Locus specific qPCR Step 1 gt It is recommended to use 5 ng of high quality DNA or a range of 10 50 ng of FFPE DNA for the Locus specific qPCR gt Inthe case of heavily damaged samples gt 50 ng DNA can be placed into a reaction but inhibition of PCR may occur Similarly it is not recommended to place greater than 20 volume of DNA per 25 ul reaction as PCR inhibitors are present in some FFPE samples This assay has been tested using DNA isolated by the Qiagen QIAamp DNA FFPE Tissue Kit with RNase treatment not included in this kit Since RNA co purifies with DNA RNase treatment provides more accurate DNA quantification based on UV absorbance reading gt To avoid cross contamination that could lead to false positive results e Change gloves frequently e Use aerosol resistant pipette tips e Use pipettes dedicated for template and
Download Pdf Manuals
Related Search