Metadata Import Plugin
Contents
1. 20 TACGATC Primer2 TGCATGCATGCAAATTCGAT 20 I Primer16 GATTTAGCTAGCTGAATGCT Boa aBaaYy gt Sequence layout gt Annotation layout gt Annotation types gt Restriction sites m gt Motifs gt Residue coloring gt Nucleotide info a gt Find a 14 Figure 3 8 Import Sequences in Table Format output The imported tabular data presented in the Sequence Table top A sequence list containing the selected subset of the sequences bottom Chapter 4 Associate with Metadata 4 1 What is the Associate with Metadata tool The Associate with Metadata tool enables addition of metadata to existing objects In order to associate metadata to existing objects identical names are required in the two datasets 4 2 How to run the Associate with Metadata tool The Associate with Metadata tool is found under File see Figure 4 1 File Associate with Metadata H Edit View Download Toolbox Workspace Help E Show Ctrl O YF New Close Ctrl W ira Close Other Tabs B Close Tab Area A Close All Tabs Ctrl Shift W Save Ctrl 5 E Save As Ctrl Shift 5 ES Import ES Export Ctrl E Export with Dependent Elements Export Graphics Ctrl G i CLC Server Login CLC Server Logoff Manage Server Users and Groups Associate with Metadata Location gP Page Setup cS Print Ctrl P PT Exit Alt Fa2. Import Sequences in Table Format and Associate with metadata These tools allow sequences to be imported from a tabular data source and make it possible to add metadata to existing objects 3 2 1 Configuring which fields should be available To configure which fields that should be available right click the data location Location Attribute Manager This will display the dialog shown in figure 3 1 Click the Add Attribute button to create a new attribute This will display the dialog shown in figure 3 2 If the data location is a server location you need to be a server administrator to do this CHAPTER 3 IMPORT SEQUENCES 9 g Manage attributes Attribute info No attributes are selected dk Add Attribute Figure 3 1 Adding attributes g Create Attribute General attribute info Bounded decimal number Figure 3 2 The list of attribute types First select what kind of attribute you wish to create This affects the type of information that can be entered by the end users and it also affects the way the data can be searched The following types are available e Checkbox This is used for attributes that are binary e g true false checked unchecked and yes no e Text For simple text with no constraints on what can be entered e Hyper Link This can be used if the attribute is a reference to a web page A value of this type will appear to the end user as a hyper link that can be clicked Note
3. Metadata Import Plugin User manual User manual for Metadata Import Plugin 1 0 Windows Mac OS X and Linux August 30 2013 This software is for research purposes only CLC bio Silkeborgvej 2 Prismet DK 8000 Aarhus C Denmark Contents 1 Introduction to the Metadata Import Plugin 1 1 Introduction to the Metadata Import Plugin 04 2 System requirements and installation of the Metadata Import Plugin 5 2 1 System requirements 1 ce a 5 2 2 How to install a plugin 2 2 2 bebe Pe GeReen Be a 5 2 3 How to uninstall a plugin 2 2 ke ew ee ee ee ee a 6 3 Import Sequences 8 3 1 What is the Import Sequences in Table Format tool 8 3 2 Customized attributes on data locations c sceeeee Seat ede eaepe ax 8 3 2 1 Configuring which fields should be available 8 BET E ERR SL eee ee te ee eee eee eee eee ee ee ee 10 22 0 memo NUNDU 4 4 re eee bee ee eee ee eee wee 10 3 2 4 Changing the order of the attributes 0 2 0 eee ee ee 11 3 3 How to run the Import Sequences in Table Format tool 11 4 Associate with Metadata 15 4 1 What is the Associate with Metadata tool 2 0 0 0 0 0 eee 15 4 2 How to run the Associate with Metadata tool 200004 15 Chapter 1 Introduction to the Metadata Import Plugin 1 1 Introduction to the Metadata Import Plugin The Metadata Import Plugin has been developed to facilitate the import sto
4. Figure 4 1 Click on Associate with metadata 15 CHAPTER 4 ASSOCIATE WITH METADATA 16 This opens the dialog shown in figure 4 2 m g Associate with Metadata 1 Select objects to associate the data with Navigation Area Selected elements 1 3 CLC_Data IE Primer Sequences Demo data Example Data Xx ATP8al genomic sequence xx ATP8al mRNA fhs ATP8a1 Cloning gt Primers 3 pcDNA3 atp8a1 Processed data mi ald Protein analyses Protein orthologs RNA secondary structure Sequencing data 4 W P v zenter search term gt Figure 4 2 Select the object to associate data with In this example we wish to add information to a list of primers Select the relevant object s to associate data with and click Next This leads to the step shown in figure 4 3 Note More than one object can be selected however due to the fact that attributes are assigned specifically to the individual data locations the selected objects must be from the same data location to be in concordance with the relevant attributes a g Associate with Metadata 1 Select objects to Serpe anet associate the data with Import 2 Specify parsing File Users boester Documents Primer sequences Primer Sequences Demo data Meta data csv Cs Parameters and map Caa columns to attributes Encoding UTF 8 m Startatrow 0 Parsing Field
5. separator Preview and mappings Name Freezer_lo Name Freezer v Primer 1 1B1C7 Primer 15 2B3E1 Primer2 1B1C8 Primer 16 2B3E2 Primer 13 Fs Primer 14 2B1A9 Primeri7 __ F2B169 _ Figure 4 3 Select the file containing the relevant metadata In this example we wish to add information about the freezer location In order to be able to associate the freezer location information with the existing information in the primer table we need to have an identical and unique identifier that is found in both the original data and the metadata In this case the name is used as identifier Under Import start out by selecting the relevant metadata to import by clicking on the folder FJ The selected data will now be shown in the wizard table Set the Encoding to UTF 8 already selected as default option or change it to the relevant CHAPTER 4 ASSOCIATE WITH METADATA 17 encoding if necessary Select the number of lines to skip before parsing using the Start at row function Next set the Parsing parameters using the Field separator when handling plain text files to specify the character used to separate fields cells and the Quote symbol to specify the type of quote used in the file to escape certain characters such as line breaks newline and others Assign attributes to the relevant columns This can be done manually by clicking on the dropdown lists located over each colu
6. that this attribute can only contain one hyper link If you need more you will have to create additional attributes e List Lets you define a list of items that can be selected explained in further detail below e Number Any positive or negative integer e Bounded number Same as number but you can define the minimum and maximum values that should be accepted If you designate some kind of ID to your Sequences you can use the bounded number to define that it should be at least 1 and max 99999 if that is the range of your IDs e Decimal number Same as number but it will also accept decimal numbers CHAPTER 3 IMPORT SEQUENCES 10 e Bounded decimal number Same as bounded number but it will also accept decimal numbers When you click OK the attribute will appear in the list to the left Clicking the attribute will allow you to see information on its type in the panel to the right 3 2 2 Editing lists Lists are a little special since you have to define the items in the list When you click a list in the left side of the dialog you can define the items of the list in the panel to the right by clicking Add Item sk see figure 3 3 g Manage attributes Attribute info Type List Name My list db Add Value L db Add Attribute Remove Attribute Feb Figure 3 3 Defining items in a list Remove items in the list by pressing Remove Item 3 2 3 Removing attributes To remove an attribute sele
7. Named columns if relevant and assign attributes to the columns Next under Preview and mappings and Use attributes from function specify which attribute location to be used Tick Named columns if the first row contains the name of the columns Finally columns can be assigned to the relevant attributes This can be done manually by clicking on the drop down lists located over each column or when Named columns is ticked automatically using the Auto map button If using the Auto map button manual adjustments can afterwards be made with the drop down lists Note The only column heading that must be assigned is Sequence Assignment of all other attributes is optional Click Next This leads to the Results handling step shown in figure 3 6 In this step the parameters for output handling must be specified Ticking Output sequences separately will import sequences as individual objects Ticking Output sequences in a list will result in the tabular data being imported as a list of Sequences After selecting whether the imported data should be opened or saved click Finish The primers are now imported in the CLC Workbench When the imported data are opened in the CLC Workbench they will per default be opened in the Graphical Sequence List view figure 3 7 Clicking on the icon Show Table H8 will show the imported primers in a table view figure 3 8 top To create a new sequence list containing only a subset of the sequences
8. able Format tool can be accessed from the toolbar Import Sequences in Table Format File Sequences in Table Format z This opens the dialog shown in figure 3 4 g Sequences in Table Format 1 Select input file and i AJ 2K LES map columns to Import attributes File C Users boester Documents Primer sequences Primer Sequences Demo data csv cH Encoding UTF 8 x Startatrow 0 Parsing Field separator v Quote symbol v Preview and mappings Use attributes from CLC_Data Named columns Auto map Name Description Generic 5 Full Seque Tm GC Generic_Le F Name Descrip w Sequence a Tm v IGC a Primer1 HF _ GATTCTCAT tttccctataga 65 _ 60 22 5 Primer 15 1 F2 AATAGTAG tttccctataga 61 65 23 5 Primer2 1R TGCATGCAT cacgatcgata 63 72 20 5 Primer 16 1 R2 GATTTAGCT cacgatcqata 60 70 20 5 Primer 13 11F GCTAGCTA itttccctataga 62 68 18 5 Primer14 111R ATCGATCG cacgatcgata 63 68 24 5 Primer 17 11 F2 ITTAACCGAT tttccctataga 61 72 20 SPZ 4 Ww b Figure 3 4 Import Sequences in Table Format wizard step 1 Select the tabular data to import specify parsing parameters when handling plain text files and assign columns to the relevant attributes In this example a primer list is imported The list contains different information about the individual primers U
9. click on the rel evant rows in the Sequence Table and the Create New Sequence List button figure 3 8 bottom CHAPTER 3 IMPORT SEQUENCES El Sequences in Table Format 1 Select input file and map columns to attributes 2 Result handling Output options Output sequences in a list Result handling Open Save Log handling Make log 7 Output sequences separately 13 aff Finish 36 Cancel Figure 3 6 Import Sequences in Table Format wizard step 2 Select whether imported tabular data should be presented as individual sequences or as a list of sequences Primer Primer15 Primer2 Primer16 Primer13 i Primer Sequen X 20 GATTCTCATGACTACTACTGAG 20 I AATAGTAGATGACCCTACCATGA 20 TGCATGCATGCAAATTCGAT 20 l GATTTAGCTAGCTGAATGCT GCTAGCTAGCTAGCTCCA BOSOEHBEMO My Sequence LISE SER h ks rE gt Sequence layout gt Annotation layout gt Annotation types gt Restriction sites gt Motifs gt Residue coloring gt Nucleotide info gt Find gt Text format Figure 3 7 Import Sequences output The imported tabular data opens per default in the Grafical Sequence List mode CHAPTER 3 IMPORT SEQUENCES Length citer _ O ap setong r Fy 33 ill v Column width f Automatic A Show column 18 GCTAGCT 24 ATCGATC 20 TTAACGG W Latin name
10. ct the attribute in the list and click Remove Attribute This can be done without any further implications if the attribute has just been created but if you remove an attribute where values have already been given for elements in the data location it will have implications for these elements The values will not be removed but they will become static which means that they cannot be edited anymore They can only be removed see more about how this looks in the user interface below If you accidentally removed an attribute and wish to restore it this can be done by creating a new attribute of exactly the same name and type as the one you removed All the static values will now become editable again When you remove an attribute it will no longer be possible to search for it even if there is static information on elements in the data location Renaming and changing the type of an attribute is not possible you will have to create a new one CHAPTER 3 IMPORT SEQUENCES 11 3 2 4 Changing the order of the attributes You can change the order of the attributes by selecting an attribute and click the Up and Down arrows in the dialog This will affect the way the attributes are presented for the user as described below 3 3 How to run the Import Sequences in Table Format tool The Import Sequences in Table Format tool can be accessed in the following two ways If you are working with the CLC Genomics Workbench the Import Sequences in T
11. inux Extract Annotations g Version 1 02 Extracts annotations from one or more sequences The result is a More information is available on the sequence list containing sequences covered by the specified Additional alignments plugin website annotations Additional information z Usage g Aonta MEN GEF ME Located in Toolbox gt Alignments and Trees gt Additional Alignments Version 1 02 Using this plug in it is possible to annotate a sequence From list of annotations found in a GFF file v Additional Alignments Located in the Toolbox x HEE Clustal Alignment Q SignalP HEE Muscle Alignment Version 1 02 Clustal Alignment ht a Figure 2 1 The plug ins that are available for download a S Clicking a plug in will display additional information at the right side of the dialog This will also display a button Download and Install Click the Metadata Import Plugin and press Download and Install A dialog displaying progress is now shown and the plug in is downloaded and installed If the Metadata Import Plugin Plug in is not shown on the server and you have it on your computer e g if you have downloaded it from our web site you can install it by clicking the Install from File button at the bottom of the dialog This will open a dialog where you can browse for the plug in The plug in file should be a file of the type cpa When you close the dialog you will be asked whether you wish
12. lled using the plug in manager Help in the Menu Bar Plug ins and Resources ED or Plug ins 1 in the Toolbar The plug in manager has four tabs at the top e Manage Plug ins This is an overview of plug ins that are installed e Download Plug ins This is an overview of available plug ins on CLC bio s server In order to install plug ins on Windows the Workbench must be run in administrator mode Right click the program shortcut and choose Run as Administrator Then follow the procedure described below CHAPTER 2 SYSTEM REQUIREMENTS AND INSTALLATION OF THE METADATA IMPORT PLUGING e Manage Resources This is an overview of resources that are installed e Download Resources This is an overview of available resources on CLC bio s server To install a plug in click the Download Plug ins tab This will display an overview of the plug ins that are available for download and installation see figure 2 1 Manage Plug ins and Resources i Go va Manage Plug ins Download Plug ins Manage Resources Download Resources Bookmark Navigator g Version 1 03 g ER ora Oo Additional allignments With this extension you can bookmark elements in the Navigation Area Version 1 02 Description Perform alignments with many different programs from within the workbench ClustalW Windows Mac Linux Muscle Windows Mac Linux T Coffee Mac Linux Download and install amp MAFFT Mac Linux Kalign Mac L
13. me you start the Workbench click the Disable button When you close the dialog you will be asked whether you wish to restart the workbench The plug in will not be uninstalled before the workbench is restarted Chapter 3 Import Sequences 3 1 What is the Import Sequences in Table Format tool The Import Sequences in Table Format tool enables import of sequences stored in tabular format Such data can be imported as individual sequences or as a list of Sequences When using the Import Sequences in Table Format tool it is necessary to define input information using the Attribute Manager to create the relevant attributes How to find and use the Attribute Manager is described in detail in section 3 2 Attributes can be defined prior to using the Import Sequences in Table Format tool or after the sequences have been imported If the attributes are defined after the sequences have been imported they can be assigned at a later point using the Associate with Metadata tool 3 2 Customized attributes on data locations The CLC Genomics Workbench makes it possible to define location specific attributes on all elements stored in a data location This could be company specific information such as LIMS id freezer position etc Note that the attributes scheme belongs to a location so if you have added multiple locations they will have their own separate set of attributes Note A Metadata Import Plugin is available The plugin consists of two tools
14. mn or automatically using the Auto map button If using the Auto map button manual adjustments can be made with the dropdown buttons Click Next and after the Result handling step click Finish The metadata has now been added to the primer sequences Note that the metadata is added directly to the existing primer sequences without generating a new object The added metadata can be viewed for each individual sequence by opening it and then clicking the Show Element Info button in the lower right corner in the view area see figure 4 4 CHAPTER 4 ASSOCIATE WITH METADATA 18 Column width a Latinna Modific Length First 50 22 GATTCT 23 AATAGT Show column V Name 20 GATTTA Accession Description Create New Sequence List Y Sl atin name 4 Ms t Latin name Edit Common name Edit Taxonomy name Edit Description Edit Clear Not set Tm Edit Clear 63 0 Primer length Clear E o Not set Direction Edit Clear reverse Exon Clear 15 GC Clear 7213 Group Edit Clear 1 2 Freezer location Clear FABICE vw ace es Em amp FO Figure 4 4 Select the table format and double click on one of the sequences top The attributes and the added metadata can now be viewed for the sequence of interest by clicking on the Show Element Info icon in the lover right corner of the view area buttom
15. nder Import start out by selecting the tabular data to import by clicking on the folder H The selected data will now be shown in the wizard table Set the Encoding to UTF 8 already selected as default option or change it to the relevant encoding if necessary Select the number of lines to skip before parsing This can be done with the Start at row function CHAPTER 3 IMPORT SEQUENCES 12 figure 3 5 Next set the Parsing parameters if handling plain text files using the Field separator to specify the character used to separate fields cells and the Quote symbol to specify the type of quote used in the file er Wo glee Import ThE al File C Users boester Doc fs Primer Seo The enceding of the gl eae Encoding UTF 8 Start at row e of qoute used in the file for escaping certain characters such as line breaks newline and others Parsing Field separator i a Quote symbol a 2 Character used to separate cells fields Preview and mapping Map columns to attributes that are similarly named Use attributes from CLC_Data V Named columns Auto map The location that defines the attributes ton Generics Full seque Tm Gl Generic Le Full Sequence Tm G Primer 15 1 F2 AATAGTAG tttooctataga Figure 3 5 Import Sequences in Table Format wizard step 1 Specify the separator character and quote type as well as the number of lines to skip before parsing Tick
16. rage and handling of sequences and their metadata So far it has only been possible to manually import tabular sequence data to the CLC Workbench one entry at the time With the development of the Meta data Import Plugin simultaneous import of multiple tabular data has greatly been facilitated In addition the Metadata Import Plugin provides a platform that enables handling of stored sequence properties The Metadata Import Plugin is an add on module to the CLC Workbench consisting of the two individual tools that are listed below and described in detail in the following chapters e Sequences in Table Format Imports sequences from a tabular data source e Associate with Metadata Makes it possible to add metadata to existing objects Currently the tools support two types of files e Plain text txt csv e Excel spreadsheet Excel 97 and newer xls xlSx Chapter 2 System requirements and installation of the Metadata Import Plugin 2 1 System requirements The system requirements of the Metadata Import Plugin are e Windows XP Windows Vista or Windows 7 Windows Server 2003 or Windows Server 2008 e Mac OS X 10 6 or later However Mac OS X 10 5 8 is supported on 64 bit Intel systems e Linux Red Hat 5 0 or later SUSE 10 2 or later Fedora 6 or later e 32 or 64 bit e 1 GB RAM required e 2 GB RAM recommended e 1024 x 68 display recommended e CLC Genomics Workbench 2 2 How to install a plug in Plug ins are insta
17. to restart the CLC Genomics Workbench The plug in will not be ready for use before you have restarted 2 3 How to uninstall a plug in Plug ins are uninstalled using the plug in manager Help in the Menu Bar Plug ins and Resources or Plug ins in the Toolbar This will open the dialog shown in figure 2 2 CHAPTER 2 SYSTEM REQUIREMENTS AND INSTALLATION OF THE METADATA IMPORT PLUGIN 7 Manage Plug ins and Resources do Go cd Manage Plug ins Download Plug ins Manage Resources Download Resources Additional Alignments CLC bio support clcbio com Version 1 02 Perform alignments with many different programs from within the workbench ClustalW Windows Mac Linux Muscle Windows Mac Linux T Coffee Mac Linux MAFFT Mac Linux Kalign Mac Linux Annotate with GFF file CLC bio support clcbio com Version 1 03 Using this plug in it is possible to annotate a sequence from list of annotations Found in a GFF File Located in the Toolbox Extract Annotations CLC bio support clcbio com Version 1 02 Extracts annotations from one or more sequences The result is a sequence list containing sequences covered by the specified annotations Figure 2 2 The plug in manager with plug ins installed The installed plug ins are shown in this dialog To uninstall Click the Metadata Import Plugin Uninstall If you do not wish to completely uninstall the plug in but you don t want it to be used next ti
Download Pdf Manuals
Related Search