Mentype® DIPscreen
Contents
1. Figure 8 at a 3 IE l 8 al si 8 8 E E a ge i 12 z ag at g Bg 5 p z aa J gA ge g EEEE i i fee g 8 8 se Fig 8 Electropherogram of the Mentype DiPscreen using 1ng Control DNA XY13 Analysis was performed on an ABI PRISM 3130 Genetic Analyzer with the DNA Size Standard 550 BTO Allele assignment was performed using the GeneMapper ID Software and the Mentype DiPscreen template file Mentype DIPScreen April 2013 Figure 9 40 osc 000r 008E OOS OOre ooze 00 008Z 0 092 OOS 0 0 Z ooze 0 00Z 0084 0 094 Oth oazi ooo O06 0 08 000 0002 0008 991 LE LG POE 8 000 87 10 Sd 1080 290 L01 ecd 160 821q Pesta Festa 2602. LEUGADISv2en July 2015 o oog 002 oo S0 1G 89 orta Kz Porna oreg 2060 zea 6010 010 029 3010 e9 q sg qj 0 d S01q 620 EE10 CE1G II 01 d OLEG 2080 Z LLG 9 b LG EM 0 1G E010 9d 0zd S01q x 0 0002 000 oor 008 ooz oo Fig 9 Electropherogram of the allelic ladder Mentype DiPscreen Analysis was performed on an Mentype DiPscreen ABI PRISM 3130 Genetic Analyzer with the DNA Size Standard 550 BTO Allele assignment was performed using the GeneMapper ID Software and the Mentype DiPscreen template file Table 3 Fragment lengths of the Mentype DiPscreen allelic ladder analysed on an ABI PRISM 3130 Genetic Analyzer with POP4 FAM BTG BTY panel Marker FAM DIP bp DIP bp Marker BTG DIP bp DIP bp AM 77 x 80 Y HLD91 84 88 HLD106 91 98 HLD23 107 13 HLD70 04 08 HLD88 118 28 HLD84 12 17 HLD101 131 35 HLD103 29 38 HLD67 140 48 HLD104 53 1157 HLD301 172 82 HLD116 70 92 HLD53 190 94 HLD112 99 204 HLD97 214 228 HLD307 228 236 HLD152 239 250 HLD310 248 257 HLD128 258 266 HLD110 264 270 HLD134 296 312 HLD133 278 288 HLD305 375 401 HLD79 294 299 HLD105 302 310 Marke
3. In the Protocol Manager of the Data Collection software click on New in Instrument Protocol to open the Protocol Editor dialog box Performing a spectral calibration run Once the multiwell plate containing the spectral calibration mixture is placed in the autosampler tray the spectral calibration process can be started 1 To access the Spectral Calibration screen select Maintenance on the Dashboard of the 3500 Series Data Collection software 2 The number of wells in the spectral calibration plate and their location in the instrument must be specified 3 Select Matrix Standard as a chemistry standard and BT5 for dye set 4 Optional Enable Allow Borrowing 5 Click Start Run Mentype DiPscreen July 2015 LEUGADISv2en 31 Intensity vs Scan Number Calibrated Data a Bo BE 0 400 3200 4000 3000 2000 1000 0 Intensity vs Scan Number Fig 6 Electropherogram of spectral calibration with matrix standard BT5 on an ABI 3500 Matrix check The quality value Q value of each capillary must be greater than 0 8 and the condition number range C value must be between 1 and 20 Check the matrix samples for a flat baseline As shown in the figure above there should be five peaks with peak heights of about 1000 5000 RFU Y axis in each matrix sample optimal range 2000 4000 RFU A successful calibration will be displayed in green in Overall and for each capillary If al
4. contains Mg2 dNTPs BSA 24 0 jl All components should be mixed vortex and centrifuged for about 10 s before preparing the master mix The DNA volum concentration For reference samples 1 pl samples the amount of template can be in e applied to the assay depends on its is mostly sufficient For critical patient creased appropriately Fill up the final reaction volume to 25 ul with nuclease free water Generally DNA templates shall be stored i 10 mM Tris HCI pH 8 0 and 1 mM EDTA n nuclease free water or in diluted TE buffer e g 0 1x TE buffer The primer mixes are adjusted for balanced peak heights at 28 PCR cycles and 1 ng Control DNA XY13 in a reaction volume o 25 ul lf more DNA template is applied higher peaks can be expected for small PCR fragments and relatively low peaks for large fragments Reduce the amount of DNA template to correct this imbalance Positive control For the positive amplification control dilute the Control DNA XY13 to 1 ng l Instead of the template DNA pipette the d containing the PCR master mix Negative control iluted Control DNA into a reaction tube For the negative amplification control pipette nuclease free water instead of template DNA into a reaction tube that contains the Template DNA Sometimes measured DNA concentration PCR master mix varies depending on the quantification method used It might thus be necessary to adjust the optimal DNA amou
5. HLD163 HLD91 HLD23 HLD88 H HLD101 HLD67 HLD301 HLD53 H HLD97 HLD152 HLD128 HLD134 HLD305 HLD48 HLD114 HLD304 HLD131 zJ HLD38 HLD82 The reference DNA K 562 is available from ATCC http atcc org Produtcs PurifiedDNA cfm celllines DNA 9947A 9948 and 3657 are available from Coriell Cell Repositories CCR http locus umdnj edu nigms Mentype DiPscreen July 2015 LEUGADISv2en 38 7 3 Lengths of fragments and alleles Table 3 show the fragment lengths of individual alleles that refer to the DNA Size Standard 550 BTO All analyses have been performed on an ABI PRISM 3130 Genetic Analyzer with POP4 polymer Different analysis instruments DNA size standards or polymers may result in different fragment lengths In addition a visual alignment with the allelic ladder is recommended Scaling Horizontal 70 430bp see Fig 8 and 9 Vertical Depending on signal intensity Mentype DiPscreen July 2015 LEUGADISv2en 39
6. 2q11 2 17p13 2 9q34 3 7q36 2 1q32 2 7q21 3 GACT TCCTATTCTACTCTGAAT GAGCTGCTCAAGAGAGAGG TTGGGCTTATT TAGT ACCTCCTACTCCTTGGTCTATTCCTGGTCACATGTACT Motive DIP DIP AATGCGT AGCA CTTTC GCTTATAA ACTC AGGTGTCGAACAACATGATAC TTGTA TCAACCAA GTCTGGTT TCCCTG CAACCTGGATT AATCT ATAGACAA GGTAGTATGGGCCT AACTACGGCACGCCC GATA CTTTAA CCACAAAGA GTAG CTACTGAC CAGGGGCTC ATGT AGAGAAAGCTGAAG TGGTCAAAGGCA ATTAAATA ATGATGGTTCTTCAGA CAAGGTCCCACCACACTCGCGTGGGA Abbreviations HLD Human Locus DIP DIP Deletion DIP Insertion Table 1 shows the chromosomal position motif and respective reference allele of DIP loci addressed by Mentype DiPscreen Mentype DiPscreen July 2015 LEUGADISv2en Kit Content Mentype DiPscreen 100 Reactions Nuclease free water 3 0 ml Reaction mix A 500 ul Primer mix 500 ul Multi Taq2 DNA polymerase 60 ul Control DNA XY13 2ng l 10 ul DNA Size Standard 550 BTO 50 ul Allelic ladder 25 ul Ordering information Mentype DiPscreen 25 reactions Cat No Mentype DiPscreen 100 reactions Cat No Mentype DiPscreen 400 reactions Cat No Storage 45 45410 0025 45 45410 0100 45 45410 0400 Store all components at 20 C and avoid repeated thawing and freezing Primer mix and allelic ladder must be stored protected from light The DNA samples and post PCR reagents allelic ladder an
7. A Default Run Current A Default Voltage Tolerance kV Default Pre Run Voltage kV Default Pre Run Time s Default njection Voltage kV 3 0 njection Time s 10 Run Voltage kV Default umber of Steps Default Voltage Step Interval Default Data Delay Time s Default Run Time min 25 Deviating from the standard settings the injection time may range between 1 and 20 s depending on the type of sample If reference samples with very high signal intensities are recorded a shorter injection time may be selected in order to avoid pull up peaks For samples with low DNA content an injection time of up to 20 s may be necessary Depending on the analysis conditions the Run Time for Mentype DiPscreen was modified in order to be able to analyse fragments with lengths of up to 450 bp Click on Save As enter the name of the new module e g 3kV_10s_450bp and confirm with OK Click on Close to exit the Run Module Editor Starting the run Place the prepared 96 well plate on the autosampler tray Run the ABI PRISM 3100 Data Collection software In Plate View click on New to open the Plate Editor dialog box Enter a name of the plate Select GeneScan Select 96 Well as plate type and click on Finish Mentype DiPscreen July 2015 LEUGADISv2en 20 Plate Editor Parameter Set up Sample Name enter a name Dyes 0 Colour Info Ladder or sample Project Name e g 3100_Project1 Dye Set G5 Run Module 3kV_1
8. For detailed instruction please refer to the instruction Biotype Template Files fiir GeneMapper which can be downloaded from our homepage www biotype de Important Note Import and allele calling with provided template files is only guarantied using GeneMapper ID ID X software If GeneMapper software is applied you may experience import problems using some template files You may have to adjust Panels and Bins with one ore more runs of the allelic ladder on your specific instrument setup Contact us for support Support biotype de General procedure for the analysis 1 Check the DNA size standard 2 Check the allelic ladder 3 Check the positive control 4 Check the negative control 5 Analyse and interpret the sample data Mentype DiPscreen July 2015 LEUGADISv2en 7 2 Controls The Control DNA XY13 of the test kit and other commercially available DNA from standard cell lines represent the following alleles Table 2 Allele determinations of Mentype DiPscreen Control DNA ATCC CCR CCR CCR Locus XY13 K 562 9947A 9948 3657 AM XY XX XX XY XY HLD106 HLD70 HLD84 sfs HLD103 HLD104 HLD116 HLD112 HLD307 HLD310 HLD110 HLD133 HLD79 HLD105 f HLD140
9. is a registered trademark of Biotype Diagnostic GmbH ABI PRISM GeneMapper GeneAmp and Applied Biosystems are registered trademarks of Applied Biosystems LLC Under the law of Europe POP4 is registered trademark of Applied Biosystems LLC The PCR is covered by patents Patentees are Hoffmann La Roche Inc and F Hoffmann La Roche Roche Mentype DiPscreen July 2015 LEUGADISv2en Outline of working steps performed with Mentype DIP products Sampling DNA Isolation Genotyping for Informative Alleles Identify Recipient Specific Alleles Relative Quantification of Alleles Mentype DIPquant Analysis of Chimerism Status From sample to analysis Monitoring chimerism with the Mentype DiPscreen and the Mentype DIPquant assay Mentype DiPscreen July 2015 LEUGADISv2en 2 PCR amplification 2 1 Master mix preparation Protocols for PCR amplification electrophoresis and analysis The table below shows the volumes of all PCR reagents per 25 ul reaction volume including a sample volume of 1 0 ul temp Component late DNA The number of reactions to be set up shall be determined taking into account positive and negative control reactions Add one or two reactions to this number to compensate the pipetting error Volume uclease free water Reaction mix A Primer mix ulti Taq2 DNA polymerase hot start 2 5 U l 13 4 ul 5 0 ul 5 0 ul 0 6 pl Volume of master mix
10. at 95 C Cool down to 4 C and place the samples on the autosampler tray Since injections take place simultaneously on all capillaries 4 or 16 samples must be pipetted on the plate of multi capillary analyzers If fewer samples are analysed the empty positions must be filled with 12 ul Hi Di Formamide To ensure a reliable allelic assignment on multi capillary analyzers several ladders should be run Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur especially at low temperatures Pay attention to keeping ambient conditions as recommended by the instrument manufacturer Optimal will be a stable room temperature gt 22 C Mentype DiPscreen July 2015 LEUGADISv2en Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR products before starting the analysis 4 3 Setting up the Data Collection Software Edit the default run module in Dye Set G5 once for the first run Select Module Editor to open the dialog box Select the appropriate Run Module as template from the GeneScan table Modify the Injection Voltage to 3 kV and the Injection Time to 10 s Run Module 3kV_10s_450bp Parameter Set up Run Temperature C Default Cap Fill Volume Default aximum Current A Default Current Tolerance
11. calibration was not successful try to re inject the samples with higher injection voltage or injection time Editing of the Spectral Run Module will be necessary You can re inject the same samples up to three times Otherwise use more matrix standard for spectral calibration Check the new matrix with your current samples There should be no pull up peaks between the dye panels B G Y R O with the new matrix Mentype DiPscreen July 2015 LEUGADISv2en 24 Sample preparation Component Volume Hi Di Formamide 12 0 ul DNA Size Standard 550 BTO 0 5 ul Prepare 12 ul of the mix formamide DNA size standard for all samples Add 1 ul PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C Cool down to 4 C and place the samples on the tray Since injections take place simultaneously on all capillaries 4 or 16 samples must be pipetted on the plate of multi capillary analyzers If fewer samples are analysed the empty positions must be filled with 12 ul Hi Di Formamide To ensure a reliable allelic assignment on multi capillary analysers several ladders should be run Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur especially at low temperatures Pay attention to keeping ambient conditions as recommended by the instrument manufacturer Optimal will be a stable room temperature gt 22 C S
12. e g 3200 Enter the calculated difference under Points e g 2300 Click on OK to calculate the new matrix Matrix BT5 mtx xi Reactions B G R 0 B ME Jois Jooos Jooss Jo oooe G foseo1 hoooo Jo 2ose Joszsa fooo17 Y Jo aes7 ososs hoooo Joste foooz29 H fo1saa fose19 os211 ft c000 o nas o footso foosca fooar7 fo20e2 1 0000 Fig 3 New matrix BTS Save the matrix in the matrix folder File gt Save as e g Matrix BT5 Matrix check Check the new matrix with current samples File gt New gt Project open folder of the respective run gt Add Sample Files Select sample s in the Sample File column Sample Install New Matrix open matrix folder and select new matrix Re analyse your samples There should be no pull up peaks between the dye panels B G Y R O with the new matrix Mentype DiPscreen July 2015 LEUGADISv2en 14 3 2 Sample preparation Component Volume Hi Di Formamide 12 0 ul DNA Size Standard 550 BTO 0 5 ul Prepare 12 ul of the mix formamide DNA size standard for all samples Add 1 ul PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C Cool down to 4 C and place samples on the autosampler tray Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR
13. 0s_450bp Analysis Module 1 DefaultAnalysis gsp parameter see above Complete the table in the Plate Editor and click on OK Click into the column header to select the entire column and select Edit Fill Down to apply the information of the selected samples Link your reaction plate on the autosampler tray with the created plate ID and start the run On completion of the run view data as Color Data in Array View of the 3100 Data Collection software or as Analyzed Sample Files under D AppliedBio 31 00 DataExtractor ExtractRuns 4 4 Analysis parameter analysis method The recommended analysis parameters are Analysis Range Full Range Data Processing Baseline Checked Multicomponent Checked Smooth Options Light Peak Detection Peak Amplitude Thresholds B Y G R Ors Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 15 pts Size Call Range Min 60 Max 550 Size Calling Method Local Southern Method Split Peak Correction None The peak amplitude threshold cutoff value corresponds to the minimum peak height that will be detected by the GeneScan or GeneMapper ID software Thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times as high as the background noise of the baseline Mentype DiPscreen July 2015 LEUGADISv2en 21 5 Electrophoresis using the ABI PRISM 3130 3130xI
14. ADISv2en 18 Matrix check Select Tools Display Spectral Calibration Dye Set G5 to review the spectral calibration profile for each capillary The quality value Q value must be greater than 0 95 and the condition number C value must be between 1 and 20 Both values must be within the previously determined range Check the matrix samples for a flat baseline There should be five peaks with peak heights of about 1000 5000 RFU Y axis in each matrix sample optimal range 2000 4000 RFU If all capillaries have passed the calibration the last calibration file for Dye Set G5 must be activated manually under Tools Set Active Spectral Calibration Rename the calibration file under Set Matrix Name e g BT5_Date of calibration If calibration was not successful try to re inject the samples with higher injection voltage or injection time The editing of the Spectral Run Module will be necessary You can re inject the same samples up to three times Otherwise use more matrix standard for spectral calibration Check the new matrix with your current samples There should be no pull up peaks between the dye panels B G Y R 0 with the new matrix 4 2 Sample preparation Component Volume Hi Di Formamide 12 0 ul DNA Size Standard 550 BTO 0 5 ul Prepare 12 ul of the mix formamide DNA size standard for all samples Add 1 ul PCR product diluted if necessary or allelic ladder Denaturation for 3 min
15. Genetic Analyzer For detailed instructions on instrument setup spectral calibration or application of the ABI PRISM Data Collection software version 3 0 and the GeneMapper ID ID X software refer to the AB PRISM 3130 3130x Genetic Analyzers Getting Started Guide The system with 4 capillaries is named ABI 3130 and the system with 16 capillaries is named ABI 3130xI The virtual filter set Any5Dye shall be used for the combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT5 hereinafter Material Capillary 36 cm Capillary Array for 3130 3130xl Polymer POP4 Polymer for 3130 Buffer 10x Genetic Analyzer Buffer with EDTA 5 1 Spectral calibration matrix generation Prior to conducting DNA fragment size analysis it is necessary to perform a spectral calibration with the five fluorescent labels 6 FAM BTG BTY BTR and BTO for each analyzer The calibration procedure creates a matrix which is used to correct the overlapping of fluorescence emission spectra of the dyes Spectral calibration comprises the following steps Preparation the spectral calibration standards Loading the standards to the 96 well reaction plate one sample per capillary Creating the instrument protocol for spectral calibration Protocol Manager Defining the plate composition in the plate editor Plate Manager Performing a spectral calibration run and checking the matrix M
16. ID X software The thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times higher then the background noise of the baseline All DIPs will be examined by GeneMapper ID ID X software like Amelogenin Mentype DiPscreen July 2015 LEUGADISv2en 28 6 Electrophoresis using the ABI PRISM 3500 3500xL Genetic Analyzer For detailed instructions on instrument setup spectral calibration or application of the Applied Biosystems 3500 Series Data Collection Software version 1 0 and the GeneMapper ID X software version 1 2 refer to the Applied Biosystems 3500 3500xL Genetic Analyzers User Guide The system with 8 capillaries is named AB 3500 and the system with 24 capillaries is named AB 3500xL The virtual filter set Any5Dye shall be used for the combined application of five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT hereinafter Material Capillary 36 cm Capillary Array for 3500 3500xL Polymer POP 4 Polymer for 3500 3500xL Buffer 10x Genetic Analyzer Buffer with EDTA for 3500 3500xL 6 1 Spectral calibration matrix generation Prior to conducting DNA fragment size analysis it is necessary to perform a spectral calibration with the fluorescent labels 6 FAM BTG BTY BTR and BTO for each analyzer The calibration procedure creates a matrix that is used to correct the overlap of flu
17. Mentype DiPscreen Manual The entry to a quantitative chimerism analysis In Vitro Diagnostics C no 7z 400 Ti Version July 2015 45 45410 0025 45 45410 0100 45 45410 0400 LOT Batch Code Biotype Diagnostic GmbH Moritzburger Weg 67 D 01109 Dresden Germany Made in Germany we Bio ah elek Diagnostic GmbH Biotype Diagnostic GmbH develops produces and markets their PCR based rapid Mentype Detection Kits Our products provide customers with fast and reliable testing methods for professional medical diagnostics Our Mentype Test Kits guarantee highest quality standards for clinical research and diagnostics For information and enquiries about the Mentype DiPscreen please do not hesitate to get in touch or visit www biotype de en home html Mentype DiPscreen July 2015 LEUGADISv2en Mentype DiPscreen 3 Product description Mentype DiPscreen is a multiplex PCR application developed to identify DIP polymorphisms that individually occur in donor or recipient and constitute informative loci In a single multiplex PCR 33 DIP loci are simultaneously screened together with the gender specific locus Amelogenin Mentype DiPscreen is a multiplex PCR application that mediates monitoring of chimerism samples after stem cell transplatation The flexible assay format allows an individual diagnostics at any time required Analysis of molecular chimerism resulting from allogeneic stem cell t
18. _450bp and confirm with OK Click on Close to exit the Run Module Editor Starting the run Place the prepared 96 well plate on the autosampler tray In the Protocol Manager of the Data Collection software click on New in the Instrument Protocol window to open the Protocol Editor dialog box Instrument Protocol Protocol Editor Set up Name enter a name Type REGULAR Run Module 3kV_10s_450bp Dye Set Any5Dye parameter see above Click on OK to exit the Protocol Editor Mentype DiPscreen July 2015 LEUGADISv2en 26 Prior to each run it is necessary to create a plate definition as follows In the Plate Manager of the Data Collection software click on New to open the New Plate Dialog box Plate Editor I New Plate Dialog Name Application Plate Type Owner Name Operator Name Set up e g Plate_BT5_Date Select GeneMapper Application 96 Well Click on OK A new table in the Plate Editor will open automatically Plate Editor lI Parameter Sample Name Priori Sample Type Size Standard Pane Analysis Method Snp Set User defined 1 3 Results Group 1 Instrument Protocol 1 Set up Enter name for the samples e g 100 Default Sample or allelic ladder e g SST BTO_60 450bp e g DiPscreen_Panels_vO e g Analysis_DIPscreen_3130_200rfu select results group Run36_POP4_BT5_ 25min setting described before Click into the column header to select the entire column select Edit Fil
19. al time polymerase chain reaction Bone Marrow Transplant 35 283 290 Masmas TN Madsen HO Petersen SL Ryder LP Svejgaard A Alizadeh M Vindelov LL 2005 Evaluation and automation of hematopoietic chimerism analysis based on real time quantitative polymerase chain reaction Biol Blood Marrow Transplant 11 558 566 Mills RE Luttig CT Larkins CE Beauchamp A Tsui C Pittard WS Devine SE 2006 An initial map of insertion and deletion INDEL variation in the human genome Genome Res 16 9 1182 1190 2006 Qin XY Li GX Qin YZ Wang Y Wang FR Liu DH Xu LP Chen H Han W Wang JZ Zhang XH Li JL Li LD Liu KY Huang XJ 2011 Quantitative assessment of hematopoietic chimerism by quantitative real time polymerase chain reaction of sequence polymorphism systems after hematopoietic stem cell transplantation Chin Med J Engl 124 2301 2308 Weber JL David D Heil J Fan Y Zhao C Marth G 2002 Human diallelic insertion deletion polymorphisms Am J Hum Genet 71 4 854 862 Wilhelm J Reuter H Tews B Pingoud A Hahn M 2002 Detection and quantification of insertion deletion variations by allele specific real time PCR application for genotyping and chimerism analysis Biol Chem 383 1423 1433 10 Explanation of Symbols Mentype DiPscreen April 2013 BRE A Am g lt o Manufacturer Date of manufacture Batch code Contains sufficient reagents for lt N gt tests Consult instructions handbook for u
20. ange the parameters according the table below Plate Details Property Set up Name enter a name Number of Wells 96 or 384 Plate Type HID Capillary Lenght 36cm Polymer POP4 Click Assign Plate Contents to confirm the settings Define well position of each sample or ladder for data collection and processing by entering sample names Assign an Assay required a File Name Conventions and a Result Group to all named wells in the plate Click Link the plate for Run and enter Run Name Click Start Run Mentype DiPscreen July 2015 LEUGADISv2en 35 7 Analysis For general instructions on automatic sample analysis refer to the GeneScan or GeneMapper ID or GeneMapper ID X Software User s Manual Note Within the Mentype DiPscreen the red panel should be faded out Finding the exact lengths of the amplified products depends on the device type the conditions of electrophoresis as well as the DNA size standard used The DNA Size Standard 550 BTO shall thus be used with the following lengths of fragments 60 80 90 100 120 140 160 180 200 220 240 250 260 280 300 320 340 360 380 400 425 450 475 500 525 and 550 bp 100 200 300 400 500 1200 1000 600 400 200 J 60 0 80 0 100 oJi20 140 0 160 0 180 0 200 0 220 oJaso 0 260 oJ2s0 0 300 0320 0 340 0 360 0 380 0 400 0 425 0 450 0 475 0 500 0 525 0 550 0 90 0 250 0 Fig 7 Electropherogram of the DNA Siz
21. ates a matrix which is used to correct the overlapping of fluorescence emission spectra of the dyes Spectral calibration comprises the following steps Preparation of the spectral calibration standards Loading the standards to the 96 well reaction plate one sample per capillary Entering the plate composition Performing a spectral calibration run and checking the matrix Setting up the spectral calibration standards Example for 4 capillaries ABI 3100 Avant Component Volume Hi Di Formamide 60 0 ul Matrix standard BT5 5 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 D1 Denaturation for 3 min at 95 C Cool down to 4 C and place samples on the autosampler tray Example for 16 capillaries ABI 3100 Component Volume Hi Di Formamide 204 0 ul Matrix standard BT5 17 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 H1 and A2 H2 Denaturation for 3 min at 95 C Cool down to 4 C and place samples on the autosampler tray Mentype DiPscreen July 2015 LEUGADISv2en Performing a spectral calibration run First of all the parameter file for DyeSetG5 must be modified once to achieve successful calibration with the Data Collection software version 1 0 1 or 1 1 Spectral parameter To change settings in the parameter file go to the following path D AppliedBio Support Files Data Collection Support Files CalibrationData Spectral Calibration ParamFi
22. d This process is necessary if a new capillary array was installed before and is described in detail in the Applied Biosystems 3500 3500xL Genetic Analyzers User Guide Preparation of dye set BT5 Prior to the spectral calibration a dye set for the Matrix Standard BT5 needs to be setup 1 To create a new dye set go to Library and select Analyze followed by Dye Sets and click Create 2 Enter a Dye Set Name e g BT5 3 Select Matrix Standard as a chemistry and AnyDye Template as a Dye Set Template 4 Disable Purple in the field Arrange Dyes Ensure that all other colors are enabled 5 Under Calibration Peak Order the colors need to be arranged as Follows 5 blue 4 green 3 yellow 2 red and 1 orange Do not alter the Parameter settings 7 Click Save to confirm the changes D Mentype DIPscreen July 2015 LEUGADISv2en 30 Setup a Dye Set Dye Set Name BT5 Chemistry Matrix Standard X Dye Set Template AnyDye Template Arrange Dyes Dye Selection Reduced Selection Calibration Peak Order 5 4 Hl 3 Parameters The parameters will be used for instruments configured with 36cm capillary array and polymer POP4 Matrix Condition Number Upper Limit 20 0 Locate Start Point After Scan 300 Before Scan 5000 Limit Scans To 20000 Sensitivity 0 1 Minimum Quality Score Notes Matrix Std BTS multi cap Close Fig 5 Setup for dye set BT5
23. d DNA size standard should be stored separately from the PCR reagents The expiry date is indicated on the kit cover Additionally required reagents Additional reagents are required in order to use the Biotype PCR Amplification Kit Reagent Supplier Hi Di Formamide 25 ml Applied Biosystems Matrix Standards BT5 j single capillary instruments 5x25 pl Biotype Diagnostic GmbH Matrix Standards BT5 f i multi capillary instruments 25 pl Biotype Diagnostic GmbH Matrix Standards BT5 Biotype Diagnostic GmbH multi capillary instruments 50 pl Order Number 4311320 00 10411 0025 00 10421 0025 00 10421 0050 Mentype DiPscreen July 2015 LEUGADISv2en Warning and safety instructions The PCR Amplification Kit contains the following potentially hazardous chemicals Kit component Chemical Hazards Reaction mix Sodium azide NaN3 toxic if swallowed develops toxic gases when it gets in contact with acids Observe the Material Safety Data Sheets MSDS for all Biotype products which are available on request Please contact the respective manufacturers for copies of the MSDS for any additionally needed reagents Quality assurance All kit components undergo an intensive quality assurance process at Biotype Diagnostic GmbH The quality of the test kits is permanently monitored to ensure unrestricted usability Please contact us if you have any questions regarding quality assurance Trademarks and patents Mentype
24. dards and click Create Change the parameters according the table below Parameter Set up Size Standard BTO_550 Dye Color Orange The DNA Size Standard 550 BTO should be used with the following lengths of fragments 60 80 90 100 120 140 160 180 200 220 240 250 260 280 300 320 340 360 380 400 425 450 475 500 525 and 550 bp Click on Save to confirm the settings Create QC Size Calling Protocol Go to Library and select Analyze QC Size Calling and click Create Change the parameters according the table below Parameter Set up Protocol Name enter a name Size Standard BTO_550 from above Sizecaller Size Caller v 1 1 0 Go to Analysis Settings Peak Amplitude Threshold and disable purple All other colours should be enabled Keep all other settings as Default Click on Save to confirm the settings Create an Assay Go to Library and select Manage Assays and click Create Change the parameters according the table below Parameter Set up Assay Name e g Mentype DiPscreen Color Default Application Type HID Instrument Protocol e g Mentype DiPscreen QC Protocols e g BTO_550 Click on Save to confirm the settings Mentype DiPscreen July 2015 LEUGADISv2en 34 Starting the run Place the prepared multi well plate on the autosampler tray In the Dashboard of the Data Collection Software click Create New Plate Go to Define Plate Properties and select Plate Details Ch
25. e Standard 550 BTO fragments with lengths in bp Note The provided template files for the DNA size standard SST BTO_60 450bp can be applied for the evaluation and analysis of the Mentype DiPscreen using the GeneMapper ID or ID X Software Mentype DiPscreen July 2015 LEUGADISv2en 36 7 1 Biotype template files Allele allocation should be carried out with suitable analysis software e g the GeneMapper ID ID X software in combination with the Mentype DiPscreen template files from Biotype or the Chimeris Monitor Software of Biotype Diagnostic GmbH Template files are available from our homepage or as CD ROM on request Recommended Biotype templates for GeneMapper ID ID X Software are Panels DlPscreen_Panels_v0 vOX or higher versions BinSets DlPscreen_Bins_vO vOX or higher versions Size Standard SST BTO_60 450bp Analysis Method Analysis_DIPscreen_310_200rfu Analysis_DIPscreen_310_1000rfu Analysis_DIPscreen_3130_200rfu Analysis_DIPscreen_3130_1000rfu Plot Settings PlotsBT5_4dyes Table Settings Table for 2 alleles Panels and BinSets always have to be used whereas the other template files are optional The prepared Biotype templates for GeneMapper ID ID X Software were generated for POP4 runs In case of using other polymer types changes may necessary on Panels and Bins or within the Analysis Method before analyzing the data
26. ed BT5 hereinafter Material Capillary 47 cm 50 um green Polymer POP4 for 310 Genetic Analyzer Buffer 10x Genetic Analyzer Buffer with EDTA 3 1 Matrix generation Prior to conducting DNA fragment size analysis with the Filter Set G5 a matrix with the five fluorescent labels 6 FAM BTG BTY BTR and BTO must be generated Color Matrix standard Blue B 6 FAM Green G BTG Yellow Y BTY Red R BTR Orange 0 BTO Five electrophoresis runs shall be conducted one for each fluorescent label 6 FAM BTG BTY BTR and BTO Use the same conditions as for samples and allelic ladders of the Biotype test kit to generate suitable matrix files Matrix sample Component Volume atric sanble 4 Hi Di Formamide 2 0 j p atrix standard 6 FAM 0 j Hi DiTM Formamide 2 0 p atrix sample 2 atrix standard BTG Op atrix sample 3 Hi Di Formamide 2 0 p p atrix standard BTY 0 j atrix sample 4 Hi Di Formamide 2 0 p p atrix standard BTR 0 j j Hi DiTM Formamide 2 0 p atrix sample 5 atrix standard BTO Oy Denaturation for 3 min at 95 C Cool down to 4 C and place samples on the autosampler tray Create a Sample Sheet choose 5 Dyes and enter a sample designation Mentype DIPscreen July 2015 LEUGADISv2en 12 Injection list for matrix generation Parameter Set up Module File GS STR POP4 1 ml G5 Matrix File NONE Size Standard NONE Injection s 5 Injection
27. entype DiPscreen July 2015 LEUGADISv2en 22 Setting up the spectral calibration standards Example for 4 capillaries ABI 3130 Component Volume Hi Di Formamide 60 0 ul Matrix standard BT5 5 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 D1 Denaturation for 3 min at 95 C Cool down to 4 C and place samples in the autosampler tray Example for 16 capillaries ABI 3130xI Component Volume Hi Di Formamide 204 0 ul Matrix standard BT5 17 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 H1 and A2 H2 Denaturation for 3 min at 95 C Cool down to 4 C and place samples in the autosampler tray Performing a spectral calibration run Place the 96 well plate on the autosampler tray In the Protocol Manager of the Data Collection software click on New in Instrument Protocol to open the Protocol Editor dialog box Instrument Protocol for spectral calibration Protocol Editor Set up Name User e g Spectral36_POP4_BT5 Type SPECTRAL Dye Set Any5Dye Polymer User e g POP4 Array Length User e g 36cm Chemistry Matrix Standard Run Module Default e g Spect36_POP4_1 Depends on the type of polymer and length of capillary used Click on OK to leave the Protocol Editor dialog box In the Plate Manager of the Data Collection software click on New to open the New Plate Dialog box Plate Editor for spectral calibration I New Plate Dialog Set u
28. es with the amount of DNA Laboratories should define their individual limits for analysis of the peaks Artefacts Room temperature may influence the performance of PCR products on multi capillary instruments shoulder peaks or split peaks occur Furthermore automated assignment could be influenced in some cases If these effects occur we recommend injecting the sample again at higher room temperature and maybe using more than one allelic ladder sample per run Influence of polymers Mentype DiPscreen was validated and certified for the analysis on POP4 polymer The use of other polymers e g POP7 or POP6 might influence the run behaviour of specific PCR products Furthermore background noise might increase through different behaviour of free fluorescent dyes 43 9 References Alizadeh M Bernard M Danic B Dauriac C Birebent B Lapart C Lamy T Le Prise PY Beauplet A Bories D Semana G Quelvennec E 2002 Quantitative assessment of hematopoietic chimerism after bone marrow transplantation by real time quantitative polymerase chain reaction Blood 99 4618 4625 Chen DP Tseng CP Wang WT Wang MC Tsai SH Sun CF 2011 Real time biallelic polymorphism polymerase chain reaction for chimerism monitoring of hematopoietic stem cell transplantation relapsed patients Clin Chim Acta 412 625 630 Harries LW Wickham CL Evans JC Rule SA Joyner MV Ellard S 2005 Analysis of haematopoietic chimaerism by quantitative re
29. ignal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR products before starting the analysis Mentype DiPscreen July 2015 LEUGADISv2en 25 5 2 Setting up the Data Collection Software Edit the run module as follows for the first run In the Module Manager of the Data Collection Software click on New to open the Run Module Editor dialog box Run Module 3kV_10s_450bp Parameter Set up Oven Temperature C Default Poly Fill Volume Default Current Stability uA Default PreRun Voltage kV Default PreRun Time s Default njection Voltage kV 3 0 njection Time s 10 Voltage Number of Steps Default Voltage Step Interval Default Data Delay Time s Default Run Voltage kV Default Run Time s 1500 Deviating from the standard settings the injection time may range between 1 and 20 s depending on the type of sample If references samples with very high signal intensities are recorded a shorter injection time may be selected in orer to avoid pull up peaks For samples with low DNA content an injection time of up to 20 s my be necessary Depending on the analysis conditions the run time for Mentype DiPscreen was modified in order to be able to analyse fragments with lengths of up to 450 bp Click on Save As enter the name of the new module e g 3kV_10s
30. kV 15 0 Run kV 15 0 Run C 60 Run Time min 24 Prepare matrix standards always without DNA Size Standard BTO Analysis of the matrix samples Run the GeneScan software File gt New gt Project open folder of current run gt Add Sample Files Select a matrix sample in the Sample File column Sample Raw Data Check the matrix samples for a flat baseline As shown in the figure below there should be at least five peaks with peak heights about 1000 4000 RFU Y axis for each matrix sample optimal range 2000 4000 RFU SEC aleiz algixj Y 3200 Data Poin Fig 1 Electropherogram with raw data of the matrix standard 6 FAM Select an analysis range with flat baseline and re inject the matrix sample if necessary Note down start and end value data points of the analysis range e g start value 3200 end value 5500 Calculate the difference e g 5500 3200 2300 data points Mentype DIPscreen July 2015 LEUGADISv2en Generation of a new matrix File New Matrix x Select the Matrix Standard Sample Files Number Of Dyes B 6FAM_080204 fsa Stata 200 G BTG_080204 fsa Stata Boo T7 Y BTY_080204 fsa Statat ROOD A BTR_080204 fsa Stata ooo O BTO_080204 fsa Statat B b 7 Points E00 Cancel OK Fig 2 Matrix sample selection Import matrix samples for all dyes B G Y R 0 Enter a Start At value
31. l Down to apply the information to all selected samples and click on OK In the Run Scheduler click on Find All select Link to link the reaction plate on the autosampler up with the newly created plate record position A or B and start the run During the run view Error Status in the Event Log or examine the quality of the raw data for each capillary in the Capillaries Viewer or the Cap Array Viewer View data as overview in Run History or Cap Array Viewer of the Data Collection software Run data are saved in the Run Folder of the previously chosen Result Group Mentype DiPscreen July 2015 LEUGADISv2en 27 5 3 Analysis parameter analysis method The recommended analysis parameters are Peak Detection Algorithm Advanced Ranges Analysis Full Range Sizing All Sizes Smoothing and Baselining Smoothing Light Baseline Window 51 pts Size Calling Method Local Southern Method Peak Detection Amelogenin Cutoff Heterozygote balance Peak Amplitude Thresholds B Y Ge Re 0 Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 15 pts Slope Thresholds 0 0 Recommend settings in the worksheet Allele are 0 1 Recommend settings in the worksheet Peak Quality are Min peak height ratio 0 1 Allele number Max expected alleles 2 The peak amplitude threshold Cutoff value corresponds to the minimum peak height that will be detected rom the GeneMapper ID
32. l capillaries have passed the test Accept Results If calibration failed Reject Results and refer to spectral calibration troubleshooting of Applied Biosystems 3500 3500xL Genetic Analyzer User Guides 6 2 Sample preparation Component Volume Hi Di Formamide 12 0 ul DNA Size Standard 550 BTO 0 5 ul prepare 12 ul of the mix formamide DNA size standard for all samples add 1 ul PCR product diluted if necessary or allelic ladder Denaturation for 3 min at 95 C Cool down to 4 C and place the samples on the autosample tray Since injections take place simultaneously on all capillaries 8 or 24 samples must be pipetted on the plate of multi capillary analysers If fewer samples are analysed empty positions need to be filled with 12 ul Hi Di Formamide To ensure a reliable allelic assignment on multi capillary analysers several ladders should be run Room temperature may influence the performance of PCR products on multi capillary instruments so that shoulder peaks or split peaks occur especially at low temperatures Pay attention to keeping ambient conditions as recommended by the instrument manufacturer Optimal will be a stable room temperature gt 22 C Mentype DiPscreen July 2015 LEUGADISv2en 32 Signal intensities Options to increase the signal intensity Reduce the volume of the DNA Size Standard 550 BTO to peak heights of about 500 relative fluorescent units RFU Purify the PCR pr
33. les Select MtxStd Genescan_SetG5 to open the PAR file Change Condition Bounds Range to 1 0 20 0 Select File gt Save As to save the parameter file under a new name e g MtxStd Genescan_SetG5_BT5 par Always use this parameter file for spectral calibration runs using Biotype matrix standards BT5 Plate Editor for spectral calibration I Place the 96 well plate on the autosampler tray Run the ABI PRISM 3100 Data Collection software In Plate View click New to open the Plate Editor dialog box Enter a name of the plate Select Spectral Calibration Select 96 Well as plate type and click on Finish Plate editor for spectral calibration II Parameter Set up Sample Name Type name for the matrix samples Dye Set G5 Spectral Run Module Default e g Spect36_POP4 Spectral Parameters MtxStd GeneScan_SetG5_BT5 par parameters created before Click into the column header to select the entire column select Edit Fill Down to apply the information of the selected samples and confirm with OK Link your reaction plate on the autosampler tray with the created plate ID and start run On completion of the run check in the Spectral Calibration Result dialog box if all capillaries have successfully passed calibration label A If individual capillaries are labelled X refer to ABI PRISM Genetic Analyzer User s Manual Click on OK to confirm completion of the run Mentype DiPscreen July 2015 LEUG
34. lymer Development manufacture and distribution of Biotype products are certified according to DIN EN ISO13485 Mentype DiPscreen July 2015 LEUGADISv2en Content il Outline of working steps performed with Mentype DIP products 2 8 9 Electrophoresis using the ABI PRISM 310 Genetic Analyzer Description of the Mentype DIPSCreen c ccscscesceestssestesestssestsssstssesteseseesees PER amiplitication A s czssccr Xi nc y yuk elek cerd le RE S R d 2 1 Master mix preparation 2 2 PCR amplification parameter 31 a tiiX Gel r ali0 i sa Au A a n2n die dehan e Ge la 3 2 Sample preparation eee 3 3 Setting up the Data Collection Software 3 4 Analysis ParaMe ter aerer a 1 Electrophoresis using the ABI PRISM 3100 Avant 3100 Genetic Analyzer 16 4 1 Spectral calibration matrix generation 16 4 2 Sample prepala l0l iki o ae od bedel dadi Sere ne dR WA n AN 18 4 3 Setting up the Data Collection Software ha NEYA 19 4 4 Analysis parameter analysis method E EEE 20 Electrophoresis using the ABI PRISM 3130 3130xl Genetic Analyzer 21 5 1 Spectral calibration matrix generation eU UUUU U U U UL L UHU U UEU E 21 Sample preparatiON 5 ts any hal ke le E sek ee r ra k nan d d n 24 5 2 Setting up the Da
35. nt Mentype DiPscreen July 2015 LEUGADISv2en 10 2 2 PCR amplification parameter Perform a hot start PCR in order to activate the Multi Taq2 DNA Polymerase and to prevent formation of non specific amplification products The number of cycles depends on the amount of DNA applied 28 PCR cycles are recommended for all samples Standard method Recommended for all DNA samples Temperature Time 94 C 4 min hot start for activation of the Multi Taq2 DNA polymerase 94 C 30s 60 C 120s 28 cycles 7296 758 68 C 60 min 10 C oo hold Note To provide an optimal kit balance the ramping rate of the thermal cycler should be adjusted to 4 5 C s Very small amounts of DNA may result in statistical dropouts and imbalances of the peaks Increasing numbers of PCR cycles raise the risk of cross contamination caused by minimal amounts of impurities Furthermore unspecific amplification products could appear Mentype DiPscreen July 2015 LEUGADISv2en 3 Electrophoresis using the ABI PRISM 310 Genetic Analyzer For general instructions on instrument setup matrix generation and application of the GeneScan or GeneMapper ID software refer to the ABI PRISME 310 Genetic Analyzer User s Manual Electrophoresis using the GeneScan software is described below The virtual filter set G5 shall be used for combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be call
36. oducts before starting the analysis 6 3 Setting up a run For the first run using the Mentype DiPscreen Kit you will need to setup a number of protocols within the 3500 Series Data Collection Software Create Instrument protocol Go to Library and select Analyze Instrument protocol and click Create Change the parameters according the table below Instrument protocol for Mentype DiPscreen Parameter Set up Application Type HID Microsatellite Capillary Length Default Polymer Default Dye Set BT5 Run Module Default Protocol Name e g Mentype DIPscreen Oven Temperature C Default Run Voltage kV Default injection Voltage kV 3 0 Run Time s 1500 PreRun Time s Default Injection Time s 10 Data Delay Time s Default Advanced Options Default Deviating from the standard settings the injection time may range between 1 and 20 s depending on the type of sample If reference samples with very high signal intensities are recorded a shorter injection time may be selected in order to avoid pull up peaks For samples with low DNA content an injection time of up to 20 s may be necessary Depending on the analysis conditions the run time for Mentype DiPscreen was modified in order to analyse fragments with lengths of up to 450 bp Click on Save to confirm the settings Mentype DiPscreen July 2015 LEUGADISv2en 33 Create Size Standard Go to Library and select Analyze Size Stan
37. orescence emission spectra of the dyes Spectral calibration comprises the following steps Preparation of spectral calibration standards Loading the standards to the multi well reaction plate one sample per capillary Preparation of instrument and creating a Dye Set BT5 Performing a spectral calibration run and checking the matrix Mentype DiPscreen July 2015 LEUGADISv2en 29 Setting up the spectral calibration standards Example for 8 capillaries ABI 3500 Component Volume Hi Di Formamide 108 0 ul Matrix standard BT5 9 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 H1 Denaturation for 3 min at 95 C Cool down to 4 C and place samples in the autosaple tray Example for 24 capillaries ABI 3500xL Component Volume Hi Di Formamide 300 0 ul Matrix standard BT5 25 0 ul Load 12 ul of the mix to a 96 well reaction plate e g position A1 H1 A2 H2 and A3 H3 Denaturation for 3 min at 95 C Cool down to 4 C and place samples in the autosample tray When using a 384 well plate load 10 ul of the mixtures to columns 1 3 and 5 in rows A C E G K M and 0 Performing a spectral calibration run Place the multi well plate on the autosampler tray Now prepare the instrument and specific spectral calibration run settings Preparation of the instrument Before starting the spectral calibration process ensure that the spatial calibration has been performe
38. p Name e g Spectral_BT5_date Application Spectral Calibration Plate Type 96 Well Owner Name Operator Name Click on OK A new table in the Plate Editor will open automatically Mentype DiPscreen July 2015 LEUGADISv2en 23 Plate Editor for spectral calibration Il Parameter Set up Sample Name Enter name for the matrix samples Priority e g 100 Instrument Protocol 1 Spectral36_POP4_BT5 setting described before Click into the column header to select the entire column select Edit Fill Down to apply the information to all selected samples and click on OK In the Run Scheduler click on Find All select Link to link the reaction plate on the autosampler up with the newly created plate record position A or B and start the run Fig 4 Electropherogram of spectral calibration with matrix standard BT5 on an ABI 3130 Matrix check The quality value Q value of each capillary must be greater than 0 95 and the condition number range C value must be between 1 and 20 Check the matrix samples for a flat baseline As shown in the figure above there should be five peaks with peak heights of about 1000 5000 RFU Y axis in each matrix sample optimal range 2000 4000 RFU If all capillaries have passed the test the last calibration file for the Dye Set AnySDye is activated automatically in the Spectral Viewer Rename the calibration file e g BT5_Date of calibration using the respective button If
39. products before starting the analysis 3 3 Setting up the Data Collection Software Create a Sample Sheet and enter a sample designation Injection list Parameter Set up lodule File GS STR POP4 1 ml G5 atrix File e g Matrix BT5 Size Standard e g SST BTO_60 450bp Injection s 5 Injection kV 15 0 Run kV 15 0 Run C 60 Run Time min 26 Deviating from the standard settings the injection time may range between 1 and 20 s depending on the type of sample If reference samples with very high signal intensities are recorded a shorter injection time may be selected in order to avoid pull up peaks For samples with low DNA content an injection time of up to 20 s may be necessary Depending on the analysis conditions the run time for Mentype DiPscreen was modified in order to be able 0 analyse fragments with lengths of up to 450 bp Mentype DiPscreen July 2015 LEUGADISv2en 3 4 Analysis parameter The recommended analysis parameters are Analysis Range Full Range Data Processing Baseline Checked Multicomponent Checked Smooth Options Light Peak Detection Peak Amplitude Thresholds Bi ye G R OF Min Peak Half Width 2 pts Polynominal Degree 3 Peak Window Size 15 pts Size Call Range Min 60 Max 550 Size Calling Method Local Southern Method Split Peak Correction None The peak amplitude threshold cutoff value corresponds to the minimum peak height that will be detected b
40. r BTY DIP bp DIP bp HLD140 318 333 HLD48 78 83 HLD163 344 358 HLD114 159 177 HLD304 184 203 HLD131 208 220 HLD38 234 240 HLD82 314 352 rounded to integer Mentype DIPScreen April 2013 41 43 8 Interpretation of results As mentioned above post PCR analysis and automatic allele allocation with suitable analysis software ensure a precise and reliable discrimination of alleles The automated identification of informative DIP loci directly from raw data of fragment analysis runs and the selection of suitable DIPquant assays for monitoring could be performed by using Chimeris Monitor Software from Biotype Diagnostic GmbH Pull up peaks Pull up peaks may occur if peak heights are outside the linear detection range gt 3000 RFU or if an incorrect matrix was applied They appear at positions of specific peaks in other colour channels typically with lower signal intensities Peak heights should not exceed 3000 RFU in order to prevent pull up peaks Template independent addition of nucleotides Because of its terminal transferase activity the Multi Taq DNA Polymerase tends to add an adenosine radical at the 3 end of the amplified DNA fragments The artefact peak is one base shorter than expected 1 bp peaks All Biotype primers are designed to minimise these artefacts Artefact formation is further reduced by the final extension step of the PCR protocol at 68 C for 60 min Peak height of the artefact correlat
41. ransplantation has become a well established method to control the course of transplant engraftment and to assess the risk of threatening relapse Molecular chimerism analysis can be performed on diverse DNA sequence motifs of which biallelic short insertion deletion polymorphisms DIPs INDELs offer substantial benefits Polymerase mediated amplification of DIP markers does not result in formation of stutter peaks that can hamper clear analysis Moreover these polymorphisms are best suited for allele specific quantitative approaches Mentype DiPscreen is a DIP based chimerism analysis and therefore accounts for an unambiguous donor recipient differentiation and highly clear chimerims monitoring Identified informative DIP loci can subsequently be addressed by Mentype DIPquant specific real time PCR assays to approach highly quantitative chimerism monitoring The 33 DIP loci addressed by Mentype DIPscreen are distributed over 18 chromosomes and are at least separated by 10 Mbp each see Tab 1 The detection limit of Mentype DiPscreen is about 200 pg genomic DNA The optimal range under standard conditions is 1 0 2 0 ng DNA For fast and sensitive fragment length analysis primers are fluorescence labelled with 6 FAM BTG or BTY The test kit was validated and evaluated using the GeneAmp 9700 Silver Eppendorf Mastercycler ep S Biometra T1 ABI PRISM 3130 Genetic Analyzer running with 36 cm capillary array and POP4 po
42. se Use by Temperature limitations Catalogue number In Vitro Diagnostics Mentype DiPscreen April 2013 Notes Mentype DiPscreen April 2013 45 46 Notes Mentype DiPscreen April 2013
43. ta Collection SoflWare EeeeE 25 5 3 Analysis parameter analysis Method Eee E 27 Electrophoresis using the ABI PRISM 3500 3500xL Genetic Analyzer 28 6 1 Spectral calibration matrix generation 6 2 Sample preparation 6 3 Setting up a run ANAYSSI S as e 2 eS E KN KA EKA HEKA E A VEKE a kad ad 7 1 Biotype template files T2 COMTO SA a Kay d n sera e y n ben e k n 7 3 Lengths of fragments and alleles Interpretation Of RC DIN N YN MN N N gt EHJJN PN DD DD r DD NN 10 Explanation Of SyITIO i lt ziis e 940 kENK ane s9RN aaraa Mentype DIPscreen July 2015 LEUGADISv2en 1 Description of the Mentype DiPscreen Table 1 Locus specific information of Mentype DIPscreen DIP Locus FAM Panel AM X AMY HLD106 HLD70 HLD84 HLD103 HLD104 HLD116 HLD112 HLD307 HLD310 HLD110 HLD133 HLD79 HLD105 HLD140 HLD163 BTG Panel HLD91 HLD23 HLD88 HLD101 HLD67 HLD301 HLD53 HLD97 HLD152 HLD128 HLD134 HLD305 BTY Panel HLD48 HLD114 HLD304 HLD131 HLD38 HLD82 Chromosomal position Xp22 1 22 3 Yp11 2 6q13 6q16 1 8924 12 2923 1 3932 1 8p11 22 7p12 Xp11 23 2p22 3 6q22 1 3p22 1 7q31 2 4q24 3 3q23 2q24 31 1q14 1 8p11 32 9q22 33 5q26 1 5q33 3 7q21 32 3q22 1 3q13 1 6p13 2 q31 3 5q11 2 20q11 22
44. y the GeneScan or GeneMapper ID software Thresholds are usually 50 200 RFU and should be determined individually by the laboratory Recommendation The minimal peak height should be three times as high as the background noise of the baseline Mentype DiPscreen July 2015 LEUGADISv2en 16 4 Electrophoresis using the ABI PRISM 3100 Avant 3100 Genetic Analyzer For detailed instructions on instrument setup spectral calibration application of the ABI PRISM 3100 Data Collection Software version 1 01 or 1 1 and the GeneScan software refer to the AB PRISM 3100 Avant 3100 Genetic Analyzer User s Manual For systems with Data Collection Software 2 0 or 3 0 refer to chapter 5 The system with 4 capillaries is named ABI 3100 Avant and the system with 16 capillaries is named ABI 3100 The virtual filter set G5 shall be used for combined application of the five fluorescent labels 6 FAM BTG BTY BTR and BTO the matrix standard will be called BT5 hereinafter Material Capillary 36 cm Capillary Array for 3100 Avant 3100 Polymer POP 4 Polymer for 3100 Buffer 10x Genetic Analyzer Buffer with EDTA 4 1 Spectral calibration matrix generation Proper spectral calibration is critical to evaluate multicolour systems with the ABI PRISM 3100 Avant 3100 Genetic Analyzer and shall be done prior to conducting fragment length analysis with the five fluorescent labels 6 FAM BTG BTY BTR and BTO The calibration procedure cre
Download Pdf Manuals
Related Search