Home

CLONTECH

1. 250 mM Sodium Phosphate 1 5 M Sodium Chloride pH 8 25 ml 10X Elution Buffer 1 5 M Imidazole pH 7 2 ml Disposable Gravity Columns 1 10 ml Disposable Gravity Column CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 8 Version PR16704 TALON Metal Affinity Resins User Manual ll List of Components continued e TALON Buffer Kit K1252 1 160 ml 5X Extraction Wash Buffer 250 mM Sodium Phosphate 1 5 M Sodium Chloride pH 7 160 ml 5X Extraction Buffer 250 mM Sodium Phosphate 1 5 M Sodium Chloride pH 8 25 ml 10X Elution Buffer 1 5 M Imidazole pH 7 e TALON 2 ml Disposable Gravity Columns 8903 1 lll Additional Materials Required If you have not purchased the TALON Purification Kit K1253 1 or the TALON Buffer Kit K1252 1 we recommend preparing the following buffers for purify ing polyhistidine tagged proteins under native or denaturing conditions See Section IV for preparing buffers with TALON Purification Kit or Buffer Kit Before preparing other buffer compositions please consult Appendix A to evaluate resin compatibility Choosing Buffers To decrease the amount of nonspecifically bound proteins we recommend using the Extraction Wash Buffer at pH 7 0 during purification however if your target protein is more stable at pH 8 0 or if it does not adsorb at pH 7 0 use the Extraction Buffer at pH 8 0 in place of the Extraction Wash Buffer during all extraction and wash
2. 50 mM Sodium Phosphate 6 M Guanidine HCl 300 mM NaCl CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 10 Version PR16704 TALON Metal Affinity Resins User Manual Ill Additional Materials Required continued Native purification of soluble Denaturing purification of insoluble polyhistidine tagged protein polyhistidine tagged protein Equilibrate resin l Apply to TALON resin Wash nonadsorbed material Wash Elute Imidazole pH elution Imidazole elution Buffer at pH 5 0 elution Buffer at pH 7 0 Buffer at pH 7 0 150 mM imidazole 150 mM imidazole 5 4 M guanidinium Pure native protein Pure denatured protein Figure 4 Purification of polyhistidine tagged proteins using TALON The protocols in this User Manual are designed using the Extraction Wash Buffer at pH 7 0 If your target protein is more stable at pH 8 0 or if it does not adsorb at pH 7 0 use the Extraction Buffer pH 8 0 instead of the Extraction Wash Buffer during the extraction and wash steps Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 11 TALON Metal Affinity Resins User Manual Ill Additional Materials Required continued 1X Extraction buffer pH 8 0 50 mM Sodium Phosphate 6 M Guanidine HCl 300 mM NaCl 1X Imidazole Elution buffer pH 7 0 45 mM Sodium Phosphate 5 4 M Guanidine HCl 270 mM NaCl 150 mM _ Imidazole C Additional Buffers amp Reagents e MES Buff
3. Mix or vortex contents briskly for 1 2 sec completely resuspending the resin in the lysate Gently agitate the suspension for 5 min to allow polyhistidine tagged protein binding Do not vortex Remove both caps from column and place column inside the 2 ml microcentrifuge tube Centrifuge at 700 x g for 2 min Remove the column and microcentrifuge tube from the centrifuge rotor making sure that all of the sample has passed through the resin bed Note Viscous samples may require additional centrifugation Discard the flowthrough but save the 2 ml tube Place microcentrifuge tube in rotor Place white end cap on the column and add 1 ml of 1X Extraction Wash Buffer Close the column with the clear top cap Allow the buffer to passively wet the resin bed for 30 sec Agitate or vortex briskly for a few seconds until the resin is completely resuspended Gently agitate for 5 min Remove both caps and centrifuge at 700 x g for 2 min CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 26 Version PR16704 TALON Metal Affinity Resins User Manual VIII Protein Purification Protocols continued 25 26 27 28 29 30 31 32 33 34 35 36 37 Repeat Steps 18 24 Repeat twice for particularly concentrated ly sates or if necessary to improve purity Examine the resin bed to ensure that it appears semi dry and to ensure that all wash buffer has drained from the resin be
4. D 13 Elute the polyhistidine tagged protein by adding 5 bed volumes of Elution Buffer 14 Gently agitate suspension at room temperature for 5 min 15 Apply vacuum and collect the purified polyhistidine tagged protein 16 Repeat Steps 13 15 two times collecting separate fractions 17 Use spectrophotometric and SDS PAGE analyses to determine which fraction s contain s the majority of the polyhistidine tagged protein Note Samples containing 6 M guanidinium must be dialyzed overnight against buffer containing 8 M urea before loading on a gel C Medium Pressure Column Purification using TALON Superflow 1 Assemble column according to the manufacturer s instructions 2 Thoroughly resuspend TALON Superflow resin Slowly pour the slurry into the column and avoid introducing air bubbles 3 Allow resin to settle Accelerate this process by allowing the buffer to flow through the column with a peristaltic pump attached to the output of the column Do not exceed a flow rate of 5 ml min cm Do not allow the resin to dry out If this occurs resuspend the resin and repack the column 4 Insert and adjust the top adaptor and connect the column to the chromatography system according to manufacturer s instructions Note Avoid trapping air between the adaptor and the resin surface 5 Equilibrate the column with 1X Extraction Wash Buffer Do not exceed a 5 ml min cm flow rate Monitor the eluant at 280 nm the baseline should
5. Free 8916 1 e 6xHN Polyclonal Antibody 8940 1 e ProTet 6xHN Bacterial Expression System K1628 1 e HAT Protein Expression and Purification System K6050 1 e HAT Polyclonal Antibody 8909 1 e pHATZ20 Vector 8921 1 e HAT Sequencing Primers 6468 1 e HAT Polyclonal Antibody 8909 1 e Glutathione Uniflow Resin 8912 1 2 e Glutathione Superflow Resin 8911 1 2 e GST Purification Kit K1251 1 e Thiophilic Uniflow 8913 1 2 CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 34 Version PR16704 TALON Metal Affinity Resins User Manual Appendix A Reagent Compatibilities and Incompatibilities A Compatible reagents Table Il shows the maximum concentrations of each reagent tested at CLONTECH Higher levels may be acceptable but they should be tested before use Note that some of these reagents may partially or completely denature your protein TABLE Ill REAGENT COMPATIBILITY Reagent Acceptable Concentration B Mercaptoethanol 10 mM with caution CHAPS 1 with caution Ethanol 30 Ethylene glycol 30 HEPES 50 mM Glycerol 20 Guanidinium 6M Imidazole 200 mM at pH 7 0 8 0 for elution KCl 500 mM MES 20 mM MOPS 50 mM NaCl 1 0M NP 40 1 SDS 1 with caution TRIS 50 mM Urea 8M a Use resin immediately after equilibrating with buffers containing these reagents Otherwise the resin will change color Do not store resin in buffers containing these reagents lonic detergents
6. and permit higher flow rates you may need to incubate your sample with the adsorbent for 5 minutes before letting it flow through If necessary pass the sample through the column a second time The technique of expanded bed chromatography works well with these resins as the material can flow through the resin more effectively Flow rates may have to be adjusted to get the maximum binding efficiency when using this technique F Protein Purification methods using TALON The following general guidelines are used for purifying polyhistidine tagged protein from transformed E coli cultures Table provides an overview of TALON protein purification methods and applications Choose a method that best suits your research needs Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 17 TALON Metal Affinity Resins User Manual VI General Considerations continued Use 2 ml of resin suspension per 3 mg of anticipated polyhistidine tagged protein 2 ml of homogeneously resuspended resin will provide 1 ml bed volume of TALON Resin The buffers and purification conditions should work well for most soluble monomeric proteins expressed in E coll Initially test each different expression system and polyhistidine tagged protein in small scale batch purification to determine expression levels and to optimize the protocol A mini scale batch purification protocol is provided in Appendix B alternatively you
7. can use a TALONspin column Purification methods that work with Nickel or Zinc based IMAC resins should also work with TALON Resins Some optimization however may be required TABLE I TALON RESIN CHARACTERISTICS Feature TALON TALON TALON TALONspin Superflow CellThru Capacity 5 10 5 14 5 10 2 4 mg protein ml adsorbent Matrix Sepharose CL 6B Superflow Uniflow Silica Bead size um 45 165 60 160 300 500 16 24 Max Linear 75 150 3 000 800 n a flow rate cm hr Max Vol 0 5 1 0 50 13 n a flow rate ml min Max Pressure 2 8 psi 140 psi 9 psi n a 0 2 bar 10 bar 0 62 bar 0 02 MPa 0 97 MPa 0 02 MPa pH stability 2 14 2 hr 2 14 2 hr 2 14 2 hr 2 8 5 2 hr 3 14 24 hr 3 14 24 hr 3 14 24 hr 2 7 5 24 hr Protein exclusion 4x 107 4x 10 2x 107 n a limit Da determined on a 5 x 1 cm column n a not applicable CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 18 Version PR16704 TALON Metal Affinity Resins User Manual VI General Considerations continued TABLE Il PROTEIN PURIFICATION USING TALON PRODUCTS Method Application Key Benefit TALON or TALON Superflow Resins Mini Scale e Check for presence of tagged protein Fast Appendix B e Estimate expression levels e Requires only 1 ml of cell e Test buffer conditions culture 1 ml of TALON Batch Gravity Purify gt 5 mg of tagged protein e Very high purity Flow Column using 1 ml of TALON Does not req
8. extraction Before application of the sample to the TALON adsorbent EDTA must be removed by gel filtration chromatography PD 10 Amersham Pharmacia equilibrated with the Extraction Wash Buffer for IMAC Centrifuge the cell extract at 10 000 12 000 x g for 20 min at 4 C to pellet any insoluble material Carefully transfer the supernatant to a clean tube without disturbing the pellet This is the clarified sample Reserve a small portion of the clarified sample at 4 C for SDS PAGE analysis If this is the first time you have prepared clarified samples from cells expressing a particular recombinant protein we recommend that you estimate the protein s expression level in that host strain To do so perform a small scale purification and then analyze a portion by SDS CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 20 Version PR16704 TALON Metal Affinity Resins User Manual Vil Sample Preparation continued PAGE in parallel with protein standards Once expression is observed proceed with the appropriate purification protocol below B Sample Preparation to Isolate Denatured Proteins 1 Harvest 20 25 ml of cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C 2 Resuspend the pellet in 2 ml of Denaturing 1X Extraction Wash Buffer pH 7 0 per 20 25 ml of culture 3 Gently agitate or stir the sample until it becomes translucent 4 Centrifuge the sample at 10
9. flow column method In this hybrid procedure the binding and initial washing steps are performed in a batch format to save time eliminate extraneous debris and avoid column clogging After the initial washes the resin is transferred to a column for additional washing and protein elution 1 2 A 00 Thoroughly resuspend the TALON Resin Immediately transfer the required amount of resin suspension to a sterile tube that will accommodate 10 20 times the resin bed volume Centrifuge at 700 x g for 2 min to pellet the resin Remove and discard the supernatant Add 10 bed volumes of 1X Extraction Wash Buffer and mix briefly to pre equilibrate the resin Re centrifuge at 700 x g for 2 min to pellet the resin Discard the supernatant Repeat steps 5 and 6 Add the clarified sample from Section VII A or B to the resin Gently agitate at room temperature for 20 min on a platform shaker to allow the polyhistidine tagged protein to bind the resin 10 Centrifuge at 700 x g for 5 min 11 Carefully remove as much supernatant as possible without disturbing the resin pellet CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 22 Version PR16704 TALON Metal Affinity Resins User Manual VIII Protein Purification Protocols continued 12 13 14 15 16 17 18 19 20 21 22 Wash the resin by adding 10 20 bed volumes of 1X Extraction Wash Buffer Gently agitate th
10. nitro can be competitively eluted by adding imidazole gen electron density with the electron deficient to the elution buffer orbitals of the metal ion HAT a novel IMAC affinity tag With the advent of recombinant genetic technologies the design and production of recombinant proteins containing novel polyhistidine tags on their N or C termini has become more straightforward Hochuli et al 1987 Hochuli et al 1988 The HAT sequence patent pending is a novel IMAC affinity tag derived from a unique natural protein sequence Chaga et al 1999 It contains six histidines unevenly interleaved by other amino acid residues see Appendix C The HAT amino acid sequence is derived from the N terminus of chicken muscle lactate dehydrogenase a sequence that is unique among reported protein sequences The novel tag does not have the excessive positive charge charac teristic of the commonly used 6xHis tag thus contributing to better solubility of HAT fusion proteins and similar affinity towards immobilized transition metal ions and zinc CLONTECH offers the HAT Protein Expression and Purification System K6050 1 a complete system containing reagents and vectors de signed for bacterial expression and purification of HAT histidine affinity tag proteins Each of the three vectors pHAT10 pHAT11 and pHAT12 contain a multiple cloning site MCS in all three frames to allow cloning of target cDNA For vector map and MCS s
11. steps Note that at elevated pH values amino acids other than histidine as well as the peptide bond contribute to protein adsorption Thus proteins without a polyhistidine tag can also adsorb to TALON Resins which decreases resin capacity and the final purity of your target protein You may choose to use either native or denaturing buffer conditions depending on the solubility of your protein Figure 4 outlines the TALON purification procedure A Native Buffers Native protein purification regimens use buffer conditions that preserve the native three dimensional structure and surface charge characteristics of a selected soluble protein during harvest from an expression host TALON s low affinity for nonpolyhistidine tagged proteins minimize contaminant carryover In addition increasing buffer ionic strength can minimize non specific interactions Regardless of the conditions used and the nature of the polyhistidine tagged protein being purified most applications will benefit from the presence of 100 500 mM NaCl in the IMAC buffer In many cases adding glycerol or ethylene glycol neutralizes nonspecific hydropho bic interactions Small amounts of nonionic detergent may also dissociate weakly bound species Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 9 TALON Metal Affinity Resins User Manual lll Additional Materials Required continued Phosphate buffered saline PBS pH 7 5 Fina
12. when compared with nickel IMAC resins For example nickel based IMAC resins often exhibit an undesirable tendency to bind unwanted host CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 4 Version PR16704 TALON Metal Affinity Resins User Manual l Introduction continued H C coo Sepharose Bead Figure 1 Schematic diagram of the TALON IMAC System Part A TALON Metal Affinity Resin A Sepharose bead bearing the tetradentate chelator of the Co metal ion Part B The polyhistidine tagged recombinant protein binds to the resin proteins containing exposed histidine residues Kasher ef al 1993 While TALON binds polyhistidine tagged proteins with enhanced selectivity over nickel based resins it exhibits a significantly reduced affinity for host proteins This behavior offers two practical advantages First virtually no background proteins are bound to TALON when the sample is applied consequently cumbersome washing procedures are not generally required before protein elution Second polyhistidine tagged proteins elute from TALON under slightly less stringent conditions a slightly higher pH or lower imidazole concentra tion than with nickel IMAC resins Elution occurs when the imidazole nitrogen pKa of 5 97 is protonated Figure 2 generating a positively charged ammo nium ion which is repelled by the positively charged metal atom Alternatively the bound polyhistidine tagged protein ca
13. 000 12 000 x g for 20 min at 4 C to pellet any insoluble material 5 Carefully transfer the supernatant to a clean tube without disturbing the pellet This is the clarified sample 6 Set aside a small portion of the clarified sample for SDS PAGE analysis Then proceed with the appropriate purification protocol below Note Samples containing 6 M guanidinium must be dialyzed overnight against buffer containing 8 M urea before loading on a gel C TALON CellThru Sample Preparation Native Protein 1 Harvest the cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C Remove the supernatant 2 Resuspend the cell pellet by vortexing in 2 ml of chilled 1X Extraction Wash Buffer 4 C per 25 ml of culture lt 100 ml For cultures gt 1 L resuspend the pellet in 1 2 of the original culture volume Note You may omit Steps 3 4 if lysozyme treatment interferes with your protein s function 3 Add lysozyme to the 1X Extraction Wash Buffer for a concentration of 0 75 mg ml To reduce the chance of introducing proteases use the highest purity lysozyme available 4 Incubate at room temperature for 20 30 min Note Incubations at room temperature result in elevated proteolytic activities Alterna tively you can use lysozyme at 4 C with lower efficiency If this treatment hydrolyzes the target protein use the method described in Step 6 Alternatively disrupt the cells by repeated freeze thaw cycles that is fl
14. 2 22 23 24 25 28 29 33 34 35 36 38 Version PR16704 TALON Metal Affinity Resins User Manual Table of Contents continued List of Figures Figure 1 Schematic diagram of the TALON IMAC System 5 Figure 2 Elution mechanism of recombinant polyhistidine tagged proteins from TALON Resin 6 Figure 3 Binding of histidines to TALON s metal ion 6 Figure 4 Purification of polyhistidine tagged proteins using TALON 11 Figure 5 pHAT10 11 12 combined vector map and MCS 38 Figure 6 pHAT20 combined vector map and MCS 39 List of Tables Table TALON resin characteristics 18 Table Il Protein purification using TALON products 19 Table Ill Reagent Compatibility 35 Notice to Purchaser The use of TALON products are covered under U S Patent 5 962 641 HAT TALON TALONspin TALON NX and ProTet are trademarks of CLONTECH Laboratories Inc Sepharose is a registered trademark of Pharmacia LKB Biotechnology Triton is a registered trademark of Rohm and Haas Co Superflow and Uniflow are trademarks of Sterogene Bioseparations Inc This product is intended to be used for research purposes only It is not to be used for drug or diagnostic purposes nor is it intended for human use CLONTECH products may not be resold modified for resale or used to manufacture commercial products without written approval of CLONTECH 2001 CLONTECH Laboratories Inc All rights reserved Protocol P
15. CLONTECH Innovative Tools to Accelerate Discovery TALON Metal Affinity Resins User Manual PT1320 1 PR16704 Published 01 October 2001 See List of Components for storage conditions FOR RESEARCH USE ONLY TALON Metal Affinity Resins User Manual Table of Contents Vil VIII IX X xI xII Introduction List of Components Additional Materials Required Buffers for TALON Purification amp Buffer Kits Transformation amp Protein Expression General Considerations General Information Choosing the buffers imidazole vs pH gradient Elution strategy step vs linear gradients Reusing TALON Resins TALON CellThru Considerations Protein Purification methods using TALON Tom O OTU gt Sample Preparation A Sample Preparation to Isolate Native Proteins B Sample Preparation to Isolate Denatured Proteins C TALON CellThru Sample Preparation Protein Purification Protocols A Batch Gravity Flow Column Purification B Large Scale Batch Purification C Medium Pressure Column Purification using TALON Superflow D TALONspin Column Purification Resin Washing Reuse and Storage Troubleshooting Guide References Related Products Appendix A Reagent Compatibilities and Incompatibilities Appendix B Mini Scale Protein Purification Protocol Appendix C Vector Information CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 2 13 14 15 15 16 16 16 17 17 20 20 21 21 2
16. T1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 3 TALON Metal Affinity Resins User Manual l Introduction Proteins have evolved very complex structures in order to perform a diverse array of functions As a result their physicochemical properties vary greatly posing difficulties for developing versatile purification protocols One way to circumvent this problem is to incorporate a purification tag into the primary amino acid sequence of a target protein thus constructing a recombinant protein with a binding site that allows purification under well defined generic conditions Immobilized Metal Affinity Chromatography IMAC IMAC was introduced in 1975 as a group specific affinity technique for separating proteins Porath et al 1975 The principle is based on the reversible interaction between various amino acid side chains and immobilized metal ions Depending on the immobilized metal ion different side chains can be involved in the adsorption process Most notably histidine cysteine and tryptophan side chains have been implicated in protein binding to immobilized transition metal ions and zinc Figure 1 Porath 1985 Sulkowski 1985 Hemdan amp Porath 1985a Hemdan amp Porath 1985b Zhao et al 1991 TALON IMAC Resins TALON Resins are durable cobalt based IMAC resins designed to purify recombinant polyhistidine tagged proteins Bush et al 1991 These resins are compatible with many
17. Wash resin with 6 M guanidinium pH 5 0 1 Triton X 100 or SDS and re equilibrate before use XI References Bradford M M 1976 A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding Anal Biochem 72 248 254 Bush G L Tassin A M Friden H amp Meyer D I 1991 Secretion in yeast purification and in vitro translocation of chemical amounts of prepro alpha factor J Biol Chem 266 1381 1 13814 Chaga G Bochkariov D E Jokhadze G G Hopp J amp Nelson P 1999 Natural poly histidine affinity tag for purification of recombinant proteins on cobalt I carboxymethylaspartate crosslinked agarose J Chromatogr 864 247 256 Hemdan E S amp Porath J 1985a Development of Immobilized Metal Affinity Chromatography Il Interaction of amino acids with immobilized nickel iminodiacetate J Chromatogr 323 255 264 Hemdan E S amp Porath J 1985b Development of Immobilized Metal Affinity Chromatography Ill Interaction of oligopeptides with immobilized nickel iminodiacetate J Chromatogr 323 265 272 Hochuli E D beli H amp Schacher A 1987 New metal chelate adsorbent selective for proteins and peptides containing neighboring histidine residues J Chromatogr 411 177 184 Hochuli E Bannwarth W D beli H Gentz R amp St ber D 1988 Genetic approach to facilitate purification of novel
18. all washing steps For example slightly increase the pH of the wash buffer or lower its imidazole concentration Protein degraded during extraction a Use mild extraction conditions in the presence of protease inhibi tors e g B ME and EDTA at 4 C Be sure to remove EDTA before applying to TALON b Make C terminal construct c Work quickly at 4 C to reduce the time for initial purification steps Reagent interferes with binding See Appendix A for reagent compatibilities Dilute an aliquot of lysate 1 10 or sonicate and check binding on a small scale Try using a different polyhistidine tagged protein as a control Tag is not accessible under native conditions If the protein fails to bind under native conditions treat a small aliquot lt 1 ml with 6 M guanidinium and bind to 50 ul of TALON Then follow the mini scale procedure in Appendix B If the target protein binds to Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 29 TALON Metal Affinity Resins User Manual X Troubleshooting Guide continued the resin under the denaturing conditions then try to move the tag to the other terminus of the protein where it may be more exposed 2 High back pressure during load of sample High viscosity due to presence of DNA Use DNase or dilute sample five fold Section VI A 8 C Elution 1 High amount of co eluted impurities Insufficient wash Use larger volumes of Extractio
19. aride composition that resists biological degradation Superflow 6 beads are also stabilized by a chemical cross linking reaction that allows flow rates up to 10 times higher than are possible with regular cross linked beads TALON CellThru is a novel IMAC resin for purifying polyhistidine tagged proteins from crude cell lysates sonicates and fermentation liquids The larger bead size of TALON CellThru 300 500 um permits cellular debris to flow through the column eliminating the need for high speed centrifugation With TALON CellThru destabilizing factors are removed more quickly than with other resins because the number of steps are reduced CellThru 2 ml amp 10 ml Disposable Columns have a large filter pore size 90 130 um that allows cellular debris to flow through the column during the purification process The 2 ml columns are suitable for 1 2 ml bed volumes while the 10 ml columns are suitable for 5 10 ml bed volumes TALONspin Columns are ideal for rapidly and simultaneously purifying small amounts of polyhistidine tagged proteins TALONspin Columns are recommended for single use applications or for use as mini gravity flow columns Each column contains 0 5 ml of TALON NX Resin which is optimized for performance in a spin column Each column will yield 2 4 mg of polyhistidine tagged protein exact yields will vary with conditions used and polyhistidine tagged protein characteristics In addition yield and purity
20. ash freezing the cell suspension in a dry ice ethanol bath and thawing in chilled H O 5 If your sample is lt 50 ml sonicate it 3 x 10 sec with a pause for 30 sec on ice between each burst If your sample is gt 200 ml sonicate it 3 x 30 sec with a 2 min pause on ice between each burst Note Excessive sonication can destroy protein functionality 6 Store a small portion of the clarified sample at 4 C for SDS PAGE analysis Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 21 TALON Metal Affinity Resins User Manual Vil Sample Preparation continued Denatured Protein 1 2 Harvest 20 25 ml of cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C Resuspend the pellet in 2 ml of Denaturing 1X Extraction Wash Buffer pH 7 0 per 20 25 ml of culture Gently agitate or stir the sample until it becomes translucent Set aside a small portion of the clarified sample for SDS PAGE analysis Then proceed with the appropriate purification protocol below Note Samples containing 6 M guanidinium must be dialyzed overnight against buffer containing 8 M urea before loading on a gel VIII Protein Purification Protocols A Batch Gravity Flow Column Purification For column IMAC using TALON we recommend a hybrid batch gravity flow procedure This method combines the speed and convenience of a batch procedure with the exceptionally high purity of the gravity
21. be stable after washing with 5 10 column volumes 6 Apply the clarified sample to the column after filtering it through a 0 22 um filter and wash with Extraction Wash Buffer until the baseline 280 nm is stable Monitor column backpressure during sample appli cation Start collecting fractions Note If the sample is very viscous the column pressure may exceed the recommended value 150 psi 1 0 MPa Reduce the flow rate or dilute the sample to bring the pressure into an acceptable range CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 24 Version PR16704 TALON Metal Affinity Resins User Manual VIII Protein Purification Protocols continued Load the sample at a flow rate of 0 5 1 0 ml min cm to ensure that the polyhistidine tagged protein will bind to the resin If the protein does not bind reduce the flow rate further If desired increase the flow rate for washing and protein elution If the target protein is unstable at room temperature perform the chromatography at 4 C Alternatively use flow rates up to 5 ml min cm to load wash and elute the protein Capacity will decrease by 10 15 but on average a chromatography run should only take 15 20 min 7 Wash column with 10 20 column volumes of Extraction Wash Buffer or until the baseline at 280 nm is stable If necessary add 5 10 mM imidazole to the Extraction Wash Buffer 8 Elute the polyhistidine tagged protein with 5 10 column vo
22. commonly used reagents Appendix A and allow protein purification under native or denaturing conditions They can be used with all prokaryotic and eukaryotic expression systems in a variety of formats including small or mini scale batch screening large scale batch preparations and methods using gravity flow columns and spin columns In addition protocols used with Ni based IMAC columns usually work with TALON resins Tetradentate metal chelator To overcome the problem of metal leakage encountered with other IMAC resins TALON utilizes a special tetradentate metal chelator for purifying recombinant polyhistidine tagged proteins U S Patent 5 962 641 This chelator tightly holds the electropositive metal in an electronegative pocket Figure 1 which is ideal for binding metal ions such as cobalt The binding pocket is an octahedral structure in which four of the six metal coordination sites are occupied by the TALON ligand This process enhances TALON s protein binding capacity by making the bound metal ion accessible to surrounding polyhistidine tagged proteins The tetradentate metal binding means that no metal loss occurs during protein purification under recommended conditions even in the presence of strong denaturants such as 6 M guanidinium Such durability allows TALON to be reused Cobalt IMAC Resin permits milder elution conditions TALON exhibits subtle yet important differences in binding of polyhistidine tagged proteins
23. d and the column end Discard the used 2 ml microcentrifuge tube If necessary repeat the spin to remove all traces of wash buffer Replace the white end cap on the spin column Add 400 600 ul of Elution Buffer Note Alternatively use 100 mM EDTA pH 8 0 if it does not interfere with downstream applications of the protein Samples eluted with EDTA will also contain cobalt Allow 1 min for Elution Buffer to passively wet the resin bed Briefly agitate or vortex to resuspend the resin Place a fresh 2 ml collection tube into centrifuge rotor Remove both caps and place column into the 2 ml collection tube Centrifuge sample at 700 x g for 2 min Repeat Steps 30 35 Note The polyhistidine tagged protein sample can generally be recovered in 800 1 200 ul of Elution Buffer but it may be necessary to use a larger Elution Buffer volume or repeat Steps 30 35 Determine polyhistidine tagged protein yield using gel or spectrophoto metric analysis Note If the purity of the polyhistidine tagged protein preparation is unsatisfactory refer to the procedure in the Troubleshooting Guide Section X C 2 Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 27 TALON Metal Affinity Resins User Manual IX Resin Washing Reuse and Storage Generally reuse TALON Resins 3 4 times before discarding or complete regeneration The exact number of uses varies among preparations because of differences in redo
24. e a sample after each critical step of the procedure and analyze all samples by SDS PAGE Important e This protocol is not intended for obtaining highly purified polyhistidine tagged protein samples Furthermore protein samples eluted with EDTA Step 19 below will contain cobalt and EDTA which may seriously inhibit enzyme activity and may cause the protein to precipitate e This protocol was optimized using denaturing conditions at pH 8 0 If you wish to obtain native samples then substitute buffers accordingly You may also need to use lysozyme 0 75 mg ml of native buffer to completely disrupt the cells in Step 5 1 Transfer 1 ml of expression culture to a 1 5 ml microcentrifuge tube 2 Centrifuge at 14 000 rpm for 2 min 3 Remove and discard supernatant 4 Add 0 5 ml of Denaturing Extraction Buffer pH 8 0 5 Vortex until cell pellet is completely dissolved 6 Centrifuge at 14 000 rpm for 5 min to pellet any insoluble debris 7 Set aside 50 ul of the supernatant for later analysis Transfer the remainder of the supernatant to a clean 1 5 ml tube containing 50 ul of prewashed TALON Resin prepared as described in Section VIII A steps 1 7 Start with 100 ul of resuspended TALON Resin slurry 8 Agitate sample at room temperature for 10 min o 11 12 13 15 Centrifuge at 14 000 rpm for 1 min to pellet protein resin complexes Carefully remove the supernatant and set aside 50 ul for later analysis A hi
25. e sample buffer will reduce multimers to monomers thus only a single band will be visible on an SDS PAGE gel even for naturally homologous multimeric proteins 21 Heat samples at 95 98 C for 5 min 22 Load samples and analyze on an SDS PAGE gel Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 37 TALON Metal Affinity Resins User Manual Appendix C Vector Information pUC ori pHAT10 11 12 2 8 kb r Amp Hind Ill HAT A AGC TIG AAG GAT CAT CTC ATC CAC AAT GTC CAC AAA GAG GAG CAC GCT CAT GCC CAC AAC AAG Ser Leu Lys Asp His Leu lle His Asn Val His Lys Glu Glu His Ala His Ala His Asn Lys EK cleavage site ATCGATGACGATGACAAAGTCGACGGATCCCCGGGTACCGAGCTCGTAATTAGCTGAATTC Cla Sal BamHI Smal Kpni Saci EcoR Figure 5 pHAT10 11 12 Combined Vector Map and MCS Unique restriction sites are in bold The sequence of pHAT10 is shown The asterisk indicates the insertion point of additional bases in pHAT11 G and pHAT12 GG that alter the reading frame of the MCS These vectors encode a novel polyhistidine epitope tag that enables purification of expressed proteins at neutral pH The pHAT Vectors allow protein purification under both native and denaturing conditions The HAT epitope is a naturally occurring 19 amino acid sequence from the chicken lactate dehydrogenase protein This sequence of nonadjacent histidine residues has lower overall charge than tags with consecut
26. e suspension at room temperature for 10 min on a platform shaker to promote thorough washing Centrifuge at 700 x g for 5 min Remove and discard the supernatant Repeat Steps 12 14 Add one bed volume of the 1X Extraction Wash Buffer to the resin and resuspend by vortexing Transfer the resin to a 2 ml gravity flow column with an end cap in place and allow the resin to settle out of suspension Remove the end cap and allow the buffer to drain until it reaches the top of the resin bed making sure no air bubbles are trapped in the resin bed Wash column once with 5 bed volumes of 1X Extraction Wash Buffer Optional If necessary repeat Step 19 under more stringent conditions using 5 10 mM imidazole in 1X Extraction Wash Buffer Section IV D Elute the polyhistidine tagged protein by adding 5 bed volumes of Elution Buffer to the column Collect the eluate in 500 fractions Note Under most conditions the majority of the polyhistidine tagged protein will be recovered in the first two bed volumes Use spectrophotometric and SDS PAGE analyses to determine which fraction s contain s the majority of the polyhistidine tagged protein Note Use a Bradford protein assay Bradford 1976 or UV absorbance at 280 nm Use UV absorbance only if you are eluting sufficient protein to exceed the absorbance of the imidazole at 280 nm Alternatively dialyze the fractions overnight against the Extrac tion Wash Buffer and then measure their UV absorba
27. ee Appendix C of this User Manual A conveniently located enterokinase proteolytic site between the HAT sequence and the MCS provides a means for removing the affinity tag For more information see the HAT Expression amp Purification System User Manual PT3250 1 which can be downloaded from our web site at www clontech com CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 6 Version PR16704 TALON Metal Affinity Resins User Manual l Introduction continued Overview of TALON Resins The following is a list of different formats that can meet your purification needs e TALON Metal Affinity Resin is useful for batch and low pressure chro matographic applications TALON Resin utilizes Sepharose CL 6B Pharmacia LKB Biotechnology a durable substrate that performs very well under native and denaturing conditions in centrifuge mediated purification schemes The large pore size resin has a high binding capacity e TALON Superflow Resin is useful for a range of applications including medium pressure applications with FPLC systems at back pressures of up to 150 psi 1 MPa and high flow rates up to 5 ml per cm per min This resin is recommended if short purification times are essential or if purification proto cols developed at bench scale will be scaled up for larger volumes TALON Superflow utilizes Superflow 6 Sterogene Bioseparations Inc an agarose based medium featuring a unique polysacch
28. er 20 mM 2 N morpholine ethanesulfonic acid MES pH 5 0 e 5X SDS PAGE sample buffer 15 Mercaptoethanol B ME 15 SDS 50 Glycerol 1 5 Bromophenol blue Imidazole Sigma Cat 10250 for FPLC Applications D Additional Materials required for TALON CellThru e CellThru 2 ml Disposable Columns 8914 1 e CellThru 10 ml Disposable Columns 8915 1 CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 12 Version PR16704 TALON Metal Affinity Resins User Manual IV Buffers for TALON Purification and Buffer Kits If you have purchased the TALON Purification or Buffer Kits prepare buffers as described below To decrease the amount of nonspecifically bound proteins we recommend using the Extraction Wash Buffer at pH 7 0 during purification however if your target protein is more stable at pH 8 0 or if it does not adsorb to the resin at pH 7 0 use the Extraction Buffer pH 8 0 in place of the Extraction Wash Buffer during all extraction and wash steps Note that at elevated pH values amino acids other than histidine as well as the peptide bond contribute to protein adsorption Thus in high pH conditions pH gt 8 0 proteins without a polyhistidine tag can adsorb to TALON Resins and such nonspecific binding decreases resin capacity and the final purity of your target protein A Extraction Buffers 1 Dilute one part of the 5X Extraction Wash Buffer or 5X Extraction Buffer with four parts of deion
29. gh protein concentration in this sample indicates a problem with protein binding Add 1 ml of Denaturing Extraction Buffer Vortex for a few seconds Centrifuge at 14 000 rpm for 1 min to pellet resin 14 Remove the supernatant and set aside 50 ul first wash for later analysis Discard the remainder of the supernatant Repeat Steps 11 14 Set aside 50 ul for analysis CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 36 Version PR16704 TALON Metal Affinity Resins User Manual Appendix B Mini Scale Protocol continued 16 Elute bound polyhistidine tagged protein by adding 50 ul of Elution Buffer to the resin protein pellet and briefly vortexing 17 Centrifuge briefly at 14 000 rpm 18 Carefully remove the supernatant containing the polyhistidine tagged protein 19 Repeat the Steps 16 18 Alternatively if you only intend to determine the concentration of polyhistidine tagged protein in your sample you can achieve a more complete elution and thus amore accurate protein quantification by eluting with EDTA as follows a Add 50 ul of 100 mM EDTA pH 8 0 and vortex briefly b Centrifuge briefly at 14 000 rpm c Carefully remove the supernatant containing the 6xHis protein Note EDTA removes bound metal from the resin the protein sample will contain cobalt and the TALON Resin cannot be reused 20 Add 12 ul of 5X SDS PAGE sample buffer to each of the saved samples Note Th
30. he top of the column loses its characteristic pink color and the colorless front moves in the direction of the flow or if you obtain pink fractions during batch adsorption you must equilibrate the sample using a gel filtration column 5 Overexpressed recombinant proteins can accumulate in insoluble inclusion bodies In order to determine optimal extraction purification conditions you must determine the distribution of the protein in soluble and insoluble forms Perform a preliminary SDS PAGE analysis of protein extracts obtained under native conditions followed by extrac tion of the residual proteins under denaturing conditions Take care to use the same extraction volumes for both native and denaturing extracts and run the cell extract before induction as a control in one lane to identify the target protein Use of denaturing conditions is recommended only if the biological activity of the target protein has no relevance It is preferable to use native conditions for extraction even if only 5 10 of the target protein is soluble Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 15 TALON Metal Affinity Resins User Manual VI General Considerations continued 6 The buffer volumes in the following protocols were optimized for purifying the HAT DHFR protein from 20 25 ml of E coli culture Depending onthe expression level and anticipated yield you may need to adjust the buffer volumes for other
31. in bold The sequence of pHAT20 is shown This vector encodes a novel Histidine Affinity Tag HAT that enables purification of expressed proteins at neutral pH The pHAT Vectors allow protein purification under both native and denaturing conditions The HAT epitope is a naturally occurring 19 amino acid sequence from the chicken lactate dehydrogenase protein This sequence of nonadjacent histidine residues has lower overall charge than tags with consecutive His residues such as the 6xHis tag As a result HAT protein fusions exhibit solubility that more closely resembles wild type proteins while still possessing strong affinity for immobilized metal ions The unique binding characteristics of the HAT sequence allow both imidazole and pH gradient purification of proteins under native conditions at neutral pH 7 0 as well as under denaturing conditions The HAT sequence and an enterokinase EK cleavage site have been incorporated into the pUC19 backbone The EK site allows for optional removal of the HAT sequence from the purified protein by treatment with enterokinase Restriction sites allow excision of the HAT sequence with or without the EK site for cloning in other vectors Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 39
32. interferes with your protein s functionality Add lysozyme to the 1X Extraction Wash Buffer for a concentration of 0 75 mg ml To reduce the chance of introducing proteases use the highest purity lysozyme available Incubate at room temperature for 20 30 min Note Incubations at room temperature result in elevated proteolytic activities Alterna tively you can use lysozyme at 4 C with lower efficiency If this treatment hydrolyzes the target protein use the method described in Step 6 below Alternatively disrupt the cells by repeated freeze thaw cycles that is flash freezing the cell suspension in a dry ice ethanol bath and thawing in chilled H O If your sample is lt 50 ml sonicate it 3 x 10 sec with a pause for 30 sec on ice between each burst If your sample is gt 200 ml sonicate it 3 x 30 sec with a 2 min pause on ice between each burst Proceed to Step 7 Note Excessive sonication can destroy protein functionality Optional High yield mild extraction method Transfer the cells to a chilled mortar and grind 1 part cells with 2 5 parts Alumina Sigma A 2039 for 2 3 min or until the composition of the mixture becomes paste like Add 2 ml chilled 1X Extraction Wash Buffer 4 C per 25 ml culture Note If there is a high level of proteolytic activity in the cell lysate we recommend adding 1 mM EDTA final concentration to the Extraction Wash Buffer in order to inhibit metalloproteases during the
33. ive His residues such as the 6xHis tag As a result HAT protein fusions exhibit solubility that more closely resembles wild type proteins while still possessing strong affinity for immobilized metal ions The unique binding characteristics of the HAT sequence allow both imidazole and pH gradient purification of proteins under native conditions at neutral pH 7 0 as well as under denaturing conditions The HAT sequence and an enterokinase EK cleavage site have been incorporated into the pUC19 backbone The EK site allows for optional removal of the HAT sequence from the purified protein by treatment with enterokinase Restriction sites allow excision of the HAT sequence with or without the EK site for cloning in other vectors CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 Version PR16704 TALON Metal Affinity Resins User Manual Appendix C Vector Information continued Hind E 141 HAT MCS 221 256 EcoR 262 Apal Apal 481 2224 150 160 170 180 190 200 Hind I HAT A AGC TTG AAG GAT CAT CTC ATC CAC AAT GTC CAC AAA GAG GAG CAC GCT CAT GCC CAC AAC AAG Ser Leu Lys Asp His Leu lle His Asn Val His Lys Glu Glu His Ala His Ala His Asn Lys 204 230 240 250 a EK cleavage site ATC GAT GAC GAT GAC AAA GTT AAC CGG TCC CCG GGT ACC GGG CCC GGC CGG CC Clal Hpal Agel Smal Kpni Nae Eagl Fse Figure 6 pHAT20 Combined Vector Map and MCS Unique restriction sites are
34. ized water 2 Check and correct pH if necessary The 1X Extraction Wash Buffer should be at pH 7 0 while the 1X Extraction Buffer should be at pH 8 0 B Elution Buffer Dilute one part of the 10X Elution Buffer with nine parts of 1X Extraction Wash Buffer pH 7 0 or 1X Extraction Buffer pH 8 0 depending on the solubility of your protein prepared in Step A C Denaturing Conditions Add 6 M Guanidinium to the Extraction Wash Buffer pH 7 0 or Extraction Buffer pH 8 0 and the Elution Buffer prepared in Steps A and B respectively Note Perform all steps during the purification procedure in the presence of 6 M Guanidinium Protein samples containing high guanidinium concentrations form a precipitate when loaded on SDS polyacrylamide gels Therefore dialyze the sample overnight in a buffered solution containing 8 M urea before loading it onto the gel D Wash Buffer e Ingeneral use the Extraction Wash Buffer at pH 7 0 to wash nonadsorbed proteins If the protein is not stable at pH 7 0 then use the Extraction Buffer at pH 8 0 with 5 10 mM imidazole e Ifyourhost cell line produces unwanted multi histidine proteins incorpo rate a more stringent wash Dilute 5X Elution Buffer in either 1X Extraction Wash Buffer or 1X Extraction Buffer for a final concentration of 5 10 mM Imidazole 1 300 1 150 Note If a small amount of precipitate is observed in the buffers warm them at 37 C and stir or shake to dissolve precipitate
35. l conc To prepare 2 L of solution Na HPO 58 mM 16 5 g NaH PO 17 mM 4 1 g NaCl 68 mM 8 0 g Dissolve the above components in 1 8 L of deionized H O Adjust to pH 7 5 with 0 1 N NaOH Add deionized H O to final volume of 2 L Store at room temperature 1X Extraction Wash buffer pH 7 0 50 mM Sodium Phosphate 300 mM Nacl 1X Extraction buffer pH 8 0 50 mM Sodium Phosphate 300 mM Nacl e 1X Elution buffer See also Section VI B Imidazole Elution pH 7 0 pH Elution pH 5 0 50 mM Sodium Phosphate 50 mM Sodium Acetate 300 mM NaCl 300 mM NaCl 150 mM Imidazole B Denaturing Buffers Denaturants such as 6 M guanidinium enhance protein solubility Be cause proteins overexpressed in prokaryotic systems are sometimes insoluble you may need to purify proteins under denaturing conditions When purifying proteins under denaturing conditions we recommend preparing buffers indicated below In the presence of 6 M guanidinium TALON s color will change from a pinkish mauve to violet due to a change in metal ion hydration in response to the chaotrope After removal of the chaotrope TALON will return to a pinkish mauve color The change to violet does not reflect any change in the physical or chemical properties of the resin In fact the color change can be useful for indicating the buffer in which the resin is suspended and for following the movement of guanidinium through the resin bed 1X Extraction Wash buffer pH 7 0
36. like CHAPS 3 30Cholamidopropyl dimethylammonio 1 propane sulfonate SDS sodium dodecyl sulfate and Sarkosyl are compatible up to 1 However due to their charged nature you should anticipate interference with binding Ethanol may precipitate proteins causing low yields and column clogging Imidazole cannot be used at concentrations higher than 5 10 mM for loading polyhistidine tagged proteins because it competes with the histidine side chains imidazole groups for binding to the immobilized metal ions e TRIS coordinates weakly with metal ions causing a decrease in capacity B Incompatible reagents The following reagents are not compatible with TALON in any concentration e DTT dithiothreitol and DTE dithioerythritol e EDTA ethylenediaminetetraacetic acid and EGTA ethylene glycol bis B amino ethyl ether Note Although you can use EDTA at indicated points it must be removed from the sample by gel filtration prior to applying it to TALON Resins Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 35 TALON Metal Affinity Resins User Manual Appendix B Mini Scale Protein Purification Protocol Mini scale protein purification is ideal for any of the following a checking for a polyhistidine tagged protein b determining expression levels c testing buffer conditions You can also use a TALONspin Column 8902 1 with this procedure We recommend that you set asid
37. lumes of Elution Buffer The polyhistidine tagged protein usually elutes in the second and third column volumes 9 Use spectrophotometric and SDS PAGE analyses to determine which fraction s contain s the majority of the polyhistidine tagged protein Note Samples containing 6 M guanidinium must be dialyzed overnight against buffer containing 8 M urea before loading on a gel 10 If you plan to store regenerate and reuse a TALON Superflow packed column see Section IX C D TALONspin Column Purification Important Points e Before proceeding with purification determine the concentration of polyhistidine tagged protein in your sample using the mini batch screen ing protocol Appendix B Alternatively run a sample of the clarified lysate directly on SDS PAGE and estimate the amount of polyhistidine tagged protein by band intensity e Avoid excessively concentrated or viscous lysates See Troubleshoot ing Section X B 2 for tips on reducing sample viscosity e lf the concentration of polyhistidine tagged protein in the lysate is very dilute use one column to enrich the protein from several 0 6 1 ml lysate aliquots Simply repeat Steps 11 16 below until the desired amount of lysate has been processed Alternatively concentrate the polyhistidine tagged protein by reducing the sample volume The centrifugation rotor and speed may affect your results Ideally you should centrifuge TALONspin Columns in a swinging bucket r
38. mation 1 Perform all manipulations at 4 8 C in order to maintain protein stability and improve yield 2 This protocol is designed using the Extraction Wash Buffer pH 7 0 If your target protein is more stable at pH 8 0 or if it does not adsorb at pH 7 0 use the Extraction Buffer at pH 8 0 instead of the Extraction Wash Buffer during extraction and wash steps 3 A reducing agent such as 10 mM B ME or a protease inhibitor such as PMSF in the Extraction Wash Buffer pH 7 0 may improve the structural stability of fragile proteins during sample preparation See Appendix A for compatibility information Note Depending on the concentration and volume of the additive you wish to use you may need to remake the buffers to preserve the recommended concentration of NaCl and buffering agent DTT and DTE are not compatible with this TALON protocol in any concentration 4 If the cell lysate contains a high level of proteolytic activity we recommend adding 1 mM EDTA to the Extraction Wash Buffer pH 7 0 to inhibit metalloproteases during the extraction However before applying the sample to TALON resin remove EDTA using a gel filtration column PD 10 Amersham Pharmacia equilibrated with the Extraction Wash Buffer In some cases the host cell produces low molecular weight chelators that can also be removed using gel filtration Chelators can be detected easily by applying your sample to a small column packed with TALON Resin If t
39. n Wash Buffer Buffer compositions are not optimal a Check buffers used for sample preparation and wash steps b Check pH The Extraction Wash Buffer should be pH 7 0 Con taminants will co elute in buffers lt pH 7 0 c Increase volume of wash buffer and continue to wash resin bed until the Azgq drops to zero d Increase counterion concentration up to 0 5 M NaCl or KCI to inhibit nonspecific ionic interactions e Add ethylene glycol or glycerol to inhibit nonspecific hydrophobic interactions f Add small amounts of nonionic detergent s this is particularly important when isolating proteins from a eukaryotic expression system g Add 5 10 mM imidazole to the Extraction Wash Buffer and use it as an intermediate wash step before elution Proteolytic product Use mild extraction conditions in presence of protease inhibitors e g B ME and EDTA at 4 C Remove EDTA before applying to TALON Covalent attachment Cys Cys of impurities to the protein Use 5 10 mM of B ME in the Extraction Wash of Buffer Co purifying histidine rich proteins a For HAT proteins use enterokinase to remove HAT tag and rerun IMAC with mixture Target protein will pass through the column while impurities and tag will be adsorbed Note Remove chelating ligands by gel filtration before loading the proteolytic mixture onto TALON resin b Use second purification principle such as size exclusion ion exchange hydrophobic or thiophilic chr
40. n be competitively eluted by simply adding imidazole to the elution buffer because imidazole is identical to the histidine side chain Polyhistidine affinity tags Histidines exhibit highly selective coordination with certain transition metals and have great utility in IMAC Under conditions of physiological pH histidine binds by sharing electron density of the imidazole nitrogen with the electron deficient orbitals of transition metals Figure 3 Although three histidines may bind transition metals under certain conditions six histidines reliably bind transition metals in the presence of strong denaturants such as guanidinium Hochuli et al 1987 Such protein tags are commonly referred to as 6xHis hexaHis or His g Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 5 TALON Metal Affinity Resins User Manual l Introduction continued lt ra lt t Unprotonated Histidine Protonated Histidine binds to metal repelled by metal po Figure 2 Elution mechanism of recombinant a polyhistidine tagged proteins from TALON NA Resin Elution occurs when the imidazole nitro gen pKa 5 97 is protonated generating a positively charged ammonium ion which is re Figure 3 Binding of histidines to TALON s pelled by the positively charged metal ion Alter metal ion Under conditions of physiological natively the bound polyhistidine tagged protein pH histidine binds by sharing imidazole
41. n bed support may be clogged with cellular debris a Remove resin from clogged column and resuspend Then wash it in a batch format and transfer to a fresh column b Use a syringe filled with wash buffer or reverse the pump on the column to gently run the column backwards In addition test for tubing blockages in a similar manner Apply gentle pressure Do not exceed a 1 drop sec flow rate 4 Polyhistidine tagged proteins do not elute e Elution Buffer is less than optimal a Elute with 150 mM imidazole or pH 4 0 buffer b For really tough elution problems you can strip off the protein using 100 mM EDTA pH 8 0 however doing so will remove the cobalt from the resin and deposit it in your protein sample Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 31 TALON Metal Affinity Resins User Manual X Troubleshooting Guide continued c Add 1 5 mM B ME to reduce disulfide linkages Supplement buffer with 1 nonionic detergent d Purify polyhistidine tagged protein under denaturing conditions D Changes in Resin 1 Loss of Co Presence of chelators in sample Remove chelators from sample by gel filtration Regenerate adsorbent as described in Section IX D 2 Gray or brown resin TALON exposed to reducing agents or high concentration of B ME Completely remove reducing agents such as DTE or DTT orif possible by gel filtration with B ME Reduce B ME concentration lt 5 mM 3 Resin par
42. nce at 280 nm B Large Scale Batch Purification This method purifies polyhistidine tagged proteins faster than gravity flow columns however batch washes remove impurities less efficiently than gravity flow columns Therefore they require larger wash buffer volumes to obtain pure polyhistidine tagged proteins 1 2 A Thoroughly resuspend TALON resin Transfer required amount of resin to a glass filter with a pore size of 10 20 um Apply a vacuum to the filter to remove excess ethanol Add 5 bed volumes of deionized water to the resin and apply vacuum Add 5 bed volumes of 1X Extraction Wash Buffer to the resin and apply vacuum Repeat Step 5 two times Add crude lysate TALON CellThru or clarified sample TALON amp TALON Superflow to the resin and mix for 3 5 min Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 23 TALON Metal Affinity Resins User Manual Vill Protein Purification Protocols continued 8 Apply vacuum and collect the filtrate 9 Wash the resin by adding 10 20 bed volumes of 1X Extraction Wash Buffer Gently agitate the suspension at room temperature for 10 min on a platform shaker to promote thorough washing 10 Apply vacuum to remove buffer 11 Repeat the above wash Steps 9 10 2 3 times 12 Optional If necessary repeat Step 11 under more stringent condi tions using 5 mM imidazole in 1X Extraction Wash Buffer Section IV
43. omatography Protein sample is too concentrated and or viscous Dilute sample 1 5 or 1 10 with additional buffer and centrifuge again CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 30 Version PR16704 TALON Metal Affinity Resins User Manual X Troubleshooting Guide continued before proceeding Also see the note on reducing sample viscosity after sonication in Section VI A 8 2 Excessive background after TALONspin Column procedure e Sample is too viscous a Reduce the viscosity of the sample Section VI A 8 b Dilute clarified sample with an equal volume of Extraction Wash Buffer and load as two aliquots c Increase number of 1 ml washes d Use Extraction Wash Buffer pH 7 0 e Add 1 5 mM imidazole to Extraction Buffer pH 8 0 and use it as an intermediate wash step before elution f Tore purify a TALONspin sample perform the following after Step 37 in Section VIII D 1 Add 4 volumes of Extraction Wash Buffer to semi purified sample 2 Load sample onto another TALONspin Column 3 Wash twice with 1 ml of Extraction Wash Buffer 4 Elute as before Steps VIIID 30 35 3 Column ceases to flow Filter is clogged with subcellular debris Change column filters and centrifuge sample at 12 000 x g for 20 30 min at 4 C Proteins precipitated on the column Use a mild detergent such as Decanoyl N methylglucamide MEGA 10 Sigma D 6277 in the Extraction Wash Buffer The lower resi
44. or purifying polyhistidine tagged proteins using TALON CellThru is essentially the same as other TALON Resins with the following significant differences 1 Extracellular Proteins If there are no chelating agents in the fermentation liquid and the pH is gt 7 0 youcan apply sample directly onto a TALON CellThru prepacked column Otherwise a desalting equilibration step by ultracentrifugation or gel filtration with Sephadex G25 is necessary 2 Intracellular Proteins For purifying intracellular proteins apply the sonicated sample contain ing your target proteins directly onto a TALON CellThru prepacked column There is no need for centrifugation Electrophoresis will reveal that some of the target protein has passed through the column without adsorption To a large extent the material passing through the column is insoluble protein which would normally have been removed during high speed centrifugation The amount of nonadsorbed target protein will also vary as a function of sonication efficiency 3 Chromatography Considerations TALON CellThru beads have a diameter of 300 500 um therefore use acolumn with a filter pore size of 90 130 um to adequately pass cellular debris We recommend using our CellThru 2 ml amp 10 ml Disposable Columns 8914 1 amp 8915 1 The 2 ml columns are suitable for 1 2 ml bed volumes while the 10 ml columns are suitable for 5 10 ml bed volumes Because the column filters have a larger pore size
45. otor to allow the sample to pass through the resin uniformly However a fixed angle rotor or a microcentrifuge is also acceptable Centrifugation speeds higher than 700 x g may cause irregularities in the flow of solution through the resin bed and thus decrease the performance of the column Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 25 TALON Metal Affinity Resins User Manual VIII Protein Purification Protocols continued 1 oR WO P 12 16 17 18 19 20 21 22 23 24 Hold the TALONspin Column upright and flick it until all resin falls to the bottom of the column Snap off the breakaway seal Place column in the 2 ml microcentrifuge tube Save white end cap for later use Remove the clear top cap and centrifuge column at 700 x g for 2 min to remove the storage buffer from the resin bed Note The resin bed will appear semi dry after centrifugation Remove column from centrifuge and place the white end cap over the male luer fitting Add 1 ml 1X Extraction Wash Buffer and mix briefly to pre equilibrate the resin Re centrifuge at 700 x g for 2 min to pellet the resin Discard the supernatant Repeat Steps 7 and 8 twice 10 11 Add the clarified sample from Section VII A or B to the resin Add 0 6 1 ml of sample to the column and replace the clear top cap Allow sample to passively wet the resin bed for 30 sec 13
46. p the resin of cobalt ions by washing with 10 bed volumes of 0 2 M EDTA pH 7 0 Wash excess EDTA with an additional 10 bed volumes of Milli Q H O Charge the resin with 50 mM CoCl solution 10 bed volumes Again wash with 10 bed volumes of Milli Q H O to remove excess cobalt metal ions Equilibrate the resin with extraction wash buffer 10 bed volumes CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 28 Version PR16704 TALON Metal Affinity Resins User Manual X Troubleshooting Guide A Protein Expression 1 No expression Bad vector construct Check sequence of the vector Bad transformation Make a plasmid miniprep and confirm sequence No inducing agent added to culture to induce expression 2 Apparent low expression e Insoluble over expressed protein Use denaturing extraction and purification conditions or reduce expression levels by lowering the amount of inducer Unsuitable expression conditions Check cell growth and inducer concentration check for wild type nontransformed or antibiotic resistant cells e Protein is secreted Use fermentation liquid as starting sample for IMAC after proper buffering Section VI E 1 B Loading Washing 1 Polyhistidine tagged protein elutes in the wash buffer Problems with vector construction Ensure that protein and tag are in frame Buffer is not optimal Check the pH and composition of all buffers Use a lower stringency wash buffer for
47. prior to diluting and using the buffers Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 13 TALON Metal Affinity Resins User Manual V Transformation amp Protein Expression A Transformation of Host Cells with Expression Vectors The following protocol is for chemically induced transformation of E coli competent cells Perform control transformations in parallel Note Use JM109 or another lac inducible cell line to see induction of expression For tighter control of expression levels use CLONTECH s PROTet 6XHN Bacterial Expres sion System especially recommended for expression of cytotoxic proteins 1 On ice thaw a tube containing 100 ul of 0 5 M B mercaptoethanol B ME and one 50 ul tube of frozen E coli competent cells for each ligation transformation Dispense 2 ul of 0 5 M B ME into each tube of competent cells and mix Dispense 2 ul of DNA directly into the mixture from Step 2 Incubate tubes on ice for 30 min Heat shock for exactly 30 sec in a 42 C water bath Remove tubes from water bath and place on ice for 2 min Add 250 ul of SOC medium to each tube at room temperature Shake the tubes horizontally at 37 C for 1 hr at 225 rpm in a rotary shaking incubator 9 Spread transformation mixtures onto LB ampicillin 50 ug ml agar plates containing X gal 75 ug ml and IPTG 1 mM Incubate the plates at 37 C overnight oo NOORA ORN B Protein Expres
48. proteins As a starting point use 2 ml of buffer per 20 25 ml of culture 7 If you are purifying protein from harvested eukaryotic cells lyse the cells in an appropriate buffer containing a mild detergent Sambrook et al 1989 See Appendix A for compatible buffer additives Note that EDTA and EGTA are not compatible with the TALON protocol because these reagents strip the cobalt from the resin 8 Carefully check the sample s appearance after lysis or sonication Bacterial samples often remain viscous from incomplete shearing of genomic DNA Complete DNA fragmentation improves protein yields and allows efficient removal of cellular debris during centrifugation You may decrease the sample s viscosity by digestion for 20 30 min at room temperature with 2 5 ug ml of DNase Remember that proteolytic activity is much higher at room temperature Alternatively dilute the sample fivefold with Extraction Wash Buffer before applying it to the resin This procedure should not significantly affect recovery B Choosing the buffers imidazole versus pH gradient TALON purification schemes typically use either an imidazole or a pH gradient for washing and elution Imidazole in the Extraction and or Extraction Wash Buffers minimizes nonspecific binding and reduces the amount of contaminating proteins Thus we recommend first purifying polyhistidine tagged proteins using an imidazole gradient However imida zole and polyhistidine tagged protein
49. recombinant proteins with a novel metal chelate adsorbent Bio Technology 6 1321 1325 Kasher M S Wakulchik M Cook J A amp Smith M 1993 One step purification of recombinant human papillomavirus Type 16 E7 oncoprotein and its binding to the retinoblastoma gene product BioTechniques 14 630 641 Porath J 1985 Immobilized Metal lon Affinity Chromatography A Powerful Method for Protein Purification In H Tschelsche Ed Modern Methods in Protein Chemistry pp 85 95 Berlin amp NY Walter de Gruyter amp Co Porath J Carlsson J Olsson amp Belfrage G 1975 Metal chelate affinity chromatography a new approach to protein fractionation Nature 258 598 599 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbor Laboratory Cold Spring Harbor NY Sulkowski E 1985 Purification of proteins by IMAC Trends Biotechnol 3 1 7 Zhao Y J Sulkowski E amp Porath J 1991 Surface topography of histidine residues in lysozymes Eur J Biochem 202 1115 1119 Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 33 TALON Metal Affinity Resins User Manual XII Related Products For the latest and most complete listing of all CLONTECH products please visit www clontech com e CellThru 2 ml Disposable Columns 8914 1 e CellThru 10 ml Disposable Columns 8915 1 e 6XHis Monoclonal Antibody Albumin
50. s absorb at 280 nm and elution peaks may be difficult to detect spectrophotometrically especially if you are purifying small amounts of polyhistidine tagged proteins In these cases collect the leading edge of the imidazole breakthrough peak and check for polyhistidine tagged proteins by a protein specific assay Bradford 1976 and SDS PAGE Alternatively use a pH gradient to purify polyhistidine tagged proteins that are stable from pH range 5 0 7 0 See Section III for buffer compositions C Elution strategy step versus linear gradients In most cases step gradients are preferred over linear gradients because linear gradients lead to broad elution peaks which can dilute the product and make detection difficult Scaling up step gradients is also less compli cated than scaling up linear gradients D Reusing TALON Resins TALON Resins may be stored and reused up to 3 4 times before discarding or the need for complete regeneration the exact number of uses depends on the application To avoid possible cross contamination use a particular CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 16 Version PR16704 TALON Metal Affinity Resins User Manual VI General Considerations continued aliquot of resin for purifying a single type of polyhistidine tagged protein See Section VIII for important information on washing storing and reusing TALON resins E TALON CellThru Considerations The procedure f
51. sion 1 Grow an overnight culture of E coli transformed with your expression plasmid If you can isolate a sufficient amount of protein from this culture proceed to Step 3 after taking a 1 ml sample for electrophoretic analysis Centrifuge the sample at 1 000 3 000 x g for 15 min at 4 C remove the supernatant and store the cell pellet at 20 C Note If a large scale preparation of the protein is required proceed to Step 2 2 If you need a greater quantity of the target protein use 20 ml of overnight culture to inoculate 1 L of medium Incubate with shaking for another 1 2 hr until the culture has an absorbance of 0 6 ODggpo Remove a 1 ml sample of the culture centrifuge at 1 000 3 000 x g for 15 min at 4 C remove the supernatant and store the cell pellet at 20 C for electrophoretic analysis 3 Induce expression by adding an appropriate inducer For example the lac promoter in the pHAT10 expression vector can be induced with 1 mM IPTG Continue the incubation for another 3 5 hr 4 Remove a 1 ml sample of the culture centrifuge at 1 000 3 000 x g for 15 min at 4 C remove the supernatant and store the cell pellet at 20 C for electrophoretic analysis 5 Proceed with sample preparation CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 14 Version PR16704 TALON Metal Affinity Resins User Manual IV General Considerations PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A General Infor
52. ticles aggregate or exhibit change in consistency DNA cross linking a Increase ionic strength of the buffers by using lt 500 mM NaCl or KCI b Vigorously sonicate sample to shear DNA c Pretreat sample with 100 g ml DNase at 30 C for 30 min d Dilute sample 1 5 1 10 with buffer and repeat e Avoid long term storage in denaturants YS ao wa a E Analysis 1 High background on silver stained gels e Nucleic acid a Supplement buffer with 0 2 0 5 M NaCl or KCI Repeat purification b Shear DNA more vigorously c Use DNase in the extraction procedure 2 Nonfunctional protein Protein was damaged by sonication a Conduct a time course assay to determine the minimum sonica tion time needed to disrupt the cells while maintaining the native protein enzyme function For example sonicate samples at a medium high setting for 0 20 and 30 sec Then perform protein or enzyme function assays and measure the Asg of each sample b Perform the lysis or sonication procedure on ice F Reuse 1 Binding drops below original capacity e Lysate contains naturally occurring reducing agent or a non CLONTECH Laboratories Inc www clontech com Protocol PT1320 1 32 Version PR16704 TALON Metal Affinity Resins User Manual X Troubleshooting Guide continued specific polyanion may be obscuring the metal binding sites a Use a larger volume of previously used resin b Replace used resin with fresh resin c
53. uire Section VIII A pressurized column equipment Large Scale e Large and production scale e Faster than protocols that Section VIII B amp C purification easy to scale up use gravity flow columns e Higher purity than using batch process alone TALON CellThru Batch Gravity For purifying proteins from e Fast Flow Column amp _ nonclarified cell lysates sonicates Does not require high Large Scale or fermentation liquids speed centrifugation Sections VIII A amp B TALONspin Columns Spin Column Process several different samples e Fast 30 min Section VIII D simultaneously e Uses only 0 6 1 ml of e Obtain 2 4 mg of purified protein cell culture per spin column Starting with clarified lysate does not include time to analyze samples Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 19 TALON Metal Affinity Resins User Manual Vil Sample Preparation A Sample Preparation to Isolate Native Proteins 1 Harvest the cell culture by centrifugation at 1 000 3 000 x g for 15 min at 4 C Remove the supernatant If yield is low use the mild extraction method described in Step 6 Resuspend the cell pellet by vortexing in 2 ml of chilled 1X Extraction Wash Buffer 4 C per 25 ml of culture lt 100 ml For cultures gt 1 L resuspend the pellet in 1 2 of the original culture volume Note You may omit Steps 3 4 if lysozyme treatment
54. will depend upon expression level and lysate concentration Beginning with the clarified sample the entire procedure takes approximately 30 minutes Protocol PT1320 1 www clontech com CLONTECH Laboratories Inc Version PR16704 7 TALON Metal Affinity Resins User Manual ll List of Components TALON TALON Superflow and TALON CellThru are supplied as 50 w v slurries in nonbuffered 20 ethanol Please note that during shipping and storage the resin will settle thus we recommend that you thoroughly resuspend it before aliquotting 2 ml of homogeneously resuspended resin will provide 1 ml of TALON Resin with a binding capacity of at least 5 mg of polyhistidine tagged protein Store TALON Resins TALONspin Columns and TALON Buffers at 4 C Do not freeze e TALON Metal Affinity Resin TALON Superflow Resin Cat Amount Cat Amount 8901 1 10 ml 8908 1 25 ml 8901 2 25 ml 8908 1 100ml 8901 3 100 ml 8901 4 250ml TALONspin Columns 8902 1 2 3 4 These columns contain 0 5 ml of TALON NX resin as a 50 suspension in nonbuffered 20 ethanol TALON CellThru Cat Amount 8910 1 10 ml 8910 2 100 ml e TALON CellThru Disposable Columns Size Cat 2 ml column 8914 1 10 ml column 8915 1 TALON Purification Kit K1253 1 10m TALON Metal Affinity Resin 160 ml 5X Extraction Wash Buffer 250 mM Sodium Phosphate 1 5 M Sodium Chloride pH 7 160 ml 5X Extraction Buffer
55. x potential organic complexity and debris content To avoid possible cross contamination use a particular aliquot of resin to purify a single type of polyhistidine tagged protein Important precautions e TALONspin Columns are not reusable Do not store TALON Resin in denaturants such as 6 M guanidinium Do not store TALON Resin with bound imidazole the resin should be washed with MES Buffer pH 5 0 described in Section Ill Additional Materials Required before reuse to remove the bound imidazole A Stringent Wash optional 1 Wash resin with four bed volumes of 6 M guanidinium pH 5 0 1 nonionic detergent 2 Rinse resin with five bed volumes of distilled HO 3 Store resin at 4 C in 20 nonbuffered ethanol containing 0 1 azide B Removing Imidazole 1 Wash resin with five bed volumes of 20 mM MES Buffer pH 5 0 containing 0 1 M NaCl 2 Rinse resin with five bed volumes of distilled H O 3 Store resin at 4 C in 20 nonbuffered ethanol containing 0 1 azide C Regeneration of Superflow Columns Purification of polyhistidine tagged proteins using imidazole gradients will cause the column to take on a purplish hue Washing the column with 5 10 column volumes of 20 mM MES Buffer pH 5 0 will restore the normal pink color and bring the absorbance at 280 nm back to the original baseline level After equilibrating the column with Extraction Wash Buffer the column is ready for reuse Complete Regeneration Stri

CLONTECH

Contents

Download Pdf Manuals

Related Search

Related Contents