Home

Posam Manual Chapter 1

1. cmi i Hygrometer oye j SK NOTES Separate pover supply lt rSvdd for droplet detector circuit pe e ao IT ah ele HH N lt els zs EE Gas Solenoid 2 Bee hyay poq po 3 cna ms Droplet Betector fais P ti NEED X Aniz Linear Encoder 2 peel mace 4 fas pe 5 i s 02 Gaz Solenoid 1 Bot aC 23077 a 25 ose 5 3 aer r m ot I s Encoder Signal Conditioning 1641 EE pae ass psal 51 252 E pss I LI 955 956 RA for lt lt F Lend us Sik Sik T Foer psa pes ee toes RK JR P ca MM 0 787082 Droplet Detection Circuit gt n ik e wd Wal tal Te Ra VE ah 2 5 3 1 5 4 4 ua 81418141214 Coax cable to Phatediode ls one 3 E or bn pn 36885850580 Wa 3 45525225442 eras
2. PRINT HEAD LEFT BRACKET Ink Jet Microarrayer Christopher Lausted 8 000 12 October 1999 2 250 0 250 Aluminum 0 375 2 500 1 500 d 00 438 00 250 6 000 NS 1 3 000 4 40 THD 3 000 0 750 1 625 lt y i 0 500 0 500 3 125 0 875 m 0 500 0 125 2 875 6 000 2 875 1 000 32 Inkjet Microarrayer Manual version 1 2 PRINT HEAD RIGHT BRACKET Ink Jet Microarrayer Christopher Lausted 11 October 1999 Aluminum 0 500 2 500 0 25 2 250 0 250 0 123 00 250 1 j 2 BLZ 0 125 x 0 125 Groove i fee 00 438 2 500 1 500 y Ka i 6 000 4 40 THD a 00 375 20 250 2 500 0 750 0 500 1 625 HY 5 y i K d d 1 000 150 20 0 5 in 0 500 1250 135 1 000 3 120 5 000 33 Inkjet Microarrayer Manual version 1 2 A3 Slide Holder O O
3. FRON LEFT 8 O 8 i B Sacr 8 41 00 9 4 i 2 M MICROARRAY COVER MAIN VIEW MICROARRAY COVER 22 MAY 2000 CHRISTOPHER LAUSTE INSTITUTE FOR SYSTEMS BIOLOGY d 30 Inkjet Microarrayer Manual version 1 2 0 37 3 01 15 50 15 50 S He 0 78 0 78 0 78 0 68 1 08 18 00 37 00 FRONT PANEL DOOR MICROARRAY COVER 22 2000 CHRISTOPHER LAUSTI INSTITUTE FOR SYSTEMS BIOLOGY CN gt Y N sss f LEFT PANEL COVER RIGHT PANEL COVER MICROARRAY COVER MICROARRAY COVER 22 MAY 2000 CHRISTOPHER LAUSTE 22 MAY 2000 CHRISTOPHER LAUSTII INSTITUTE FOR SYSTEMS BIOLOGY INSTITUTE FOR SYSTEMS BIOLOGY 31 Inkjet Microarrayer Manual version 1 2 A2 Print Head Mounting Brackets
4. 1 Y r3 9 5 5 E4 5 c ed 9o 5 x 9 ZI 3 3 I e G 9 9 9 o 9 p 4 k 5 9 9 28 od ma go 5 o o FE o 9 9 9 9 2 O Fi No al No E DEBURR AND BREAK ALL SHARP EDGES ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT MINDESBKERHERWISE STATED i i FOLD TO FOLD AND FOLD TO HOLE XXXX 020 EDGE TO HOLE AND HOLE TO HOLE XXX XXXX 44 Institute for Systems Biology 1441 340 Seattle WA 98103 206 732 1200 EDGE TO EDGE OTHERWISE STATED THE SLIDE CHUCK REV ENGINEERING PURCHASING PRODUCTION SALES MARKETING SIZE FINAL APPROVAL SILK SCREEN FILE NAME SLIDE CHUCK dft SHEET 1 OF 7 SCALE1 2 22 MATERIAL Teflon 12 X12 X 2 5 0 20 2 0 0 0 0 9 REFERENCE HOLE 2 0 1020 0 5 gt 0 ey o 0 0 10 0 0 5 0 0 0 0 9 gt eo Oe Ge Oe Or Or 0 0 0 0 o 0 0 0
5. a gt gt gt gt gt OO Q Q 16 8 100 1 578 8000 526 4000 2 0900 5 0800 0 2300 8 9100 49 5000 82 8000 40 9900 3 2500 5 8600 995 00 845 00 95 00 125 00 6 6000 539 9500 5 2000 6 9500 5 0000 5 0000 100 5000 33 6500 15 0000 800 0000 10 0000 100 0000 98 5000 12 0000 20 0000 120 0000 68 0000 26 2500 4 0000 10 8500 3 7500 250 0000 2 0000 2 0000 1 0000 19 5000 98 1200 317 4300 147 0000 10 0000 10 0000 40 0000 10 0000 325 0000 100 0000 0 0000 0 0000 0 0000 57 5700 47 0000 87 0000 85 0900 10 0000 2 5000 12 0000 1 7350 1 2950 321 0000 0 1800 9 9100 79 1000 49 157 60 52 80 8 36 20 32 2 30 8 91 549 50 82 80 540 99 6 50 11 72 995 00 845 00 95 00 125 00 39 60 39 95 0 00 5 20 6 95 20 00 20 00 100 50 33 65 150 00 800 00 10 00 100 00 98 50 0 00 24 00 0 00 120 00 120 00 68 00 26 25 4 00 21 70 3 75 250 00 2 00 2 00 1 00 117 00 598 12 317 43 147 00 530 00 530 00 120 00 530 00 1 950 00 100 00 0 00 0 00 0 00 57 57 94 00 87 00 425 45 10 00 2 50 12 00 27 76 10 36 321 00 18 00 9 91 79 10 Inkjet Microarrayer Manual version 1 2 References AP Blanchard R J Kaiser and L E Hood High density oligonucle
6. 6860060060068 179 eeoooooocooo 3 Q es iy cn 36 58 42 Inkjet Microarrayer Manual version 1 2 B6 More circuit information for boards 1804 and 1901 The print head drive circuit resides on board 1804 It uses two 8 bit ports of the DIO 32HS interface board The lower eight bits connect to a high speed D A converter DAC0802 settling time of 100ns which provides the piezoelectric pulsing voltage 0 30V Current is boosted by a 150mA power buffer LT1010 The higher bits provide the clock latch and signal inputs to the print head ments 5 National Instrui The drive circuit for the teflon reagent solenoids resides also resides on board 1804 It uses three digital output lines to activate the seven solenoid valves which deliver washes reagents and vacuum to the arrayer work area The driver IC DRV101 provides a strong initial 100 ms pulse to open the solenoid valve followed by a 24 kHz square wave with a 20 duty cycle The droplet detection circuit resides on board 1901 Droplet verification uses the high frequency flash of forward scattered laser light to indicate the presence of an ejected droplet The output signal if the photodiode is amplifi
7. BL T9 a G600600660006600600066006506 e eoo a e ooocooocooOnDnOobDODOonODODDODODO e g660656006000000606066006560060000 2 60605000060000000000000000000 ege e 60000000000000000000000000 e 6006000000000000060000000006005 se e60006000600660006000600006006 olla B s e zg Go06000000606000000600009000 H looool 6 6e006060000600000606000000006000 elle as 66000006060000006606000000660 55 eeesosocoossosooosseosooosoo Sth 2000000050000000890000000000 OS 606600000000000000000000000 6 m5 5 eocGooo0000000000000000000090 Ite ge nm e o000090000060000000000009009 Q 69 k 808 00095000008000880008999 i 555 oe sre nos 6606600600060060600600009 B M as Go000000000000000000000 e ae Soe 6 60080050000000600080000000 e a Sou 660000060000000000000600 ol tle pum 5000000000000000000000009 bd 6 2000000000000000000000000000 6 e ge A Fl Sec eoccooooooOoDODOGOODOOODOODOODO 669 a 6060600060000000008006000000 e G60080000000
8. Inkjet Microarrayer Manual version 1 2 APPENDIX A Mechanical drawings eene eene enne 29 PAY COVOES udo 29 A2 Print Head Mounting Brackets QU Sese 32 A3 Slide Hol detec tst t 34 APPENDIX bD EUBC ERIC ALD 38 B1 Electronics a s A CA u u as 38 B3 Board 1509 ee 40 Circuit SChenialle 40 Top view of circult board nuce b uci i Wiest ede ened tendon 40 Mons NE HEP 41 COteult See matte wau 41 Top view Of circuit Board eS 41 B5 Board 42 Circuit i 42 Top view of circuit DOSE uus 42 B6 More circuit information for boards 1804 and 1901 43 B7 Configuration file for Gemini drives esee 45 APPENDIX C LISTS OF COMPONENT S 46 CT RODOtICS san as an kunu aan as vae e bu ee Te E SERE ss 46 C2 Optical Mechanical 46 CS T PEB 5052 46 C4 47 C5 PEB ec 48 C6 Other Parts die bie
9. Play Status Figure 14 The Lombardi main panel Clicking one of the 27 slide buttons brings forth a display of the array contents Clicking the Go button starts synthesis Upon startup of the software the main panel pictured here is displayed The user should first open a lineup Inp file with the Load New Line Up button A Lombardi lineup file also contains information about which bank each phosphoramidite or catalyst is loaded into required and which wash channel each large volume reagent is loaded into optional The first letter of each phosphoramidite is used as a unique designator The catalyst tetrazole is usually designated with an X An unused bank is usually designated with a U The six boxes in the lower left corner of the panel indicate the bank assignments If bank one is unused bank two holds tetrazole and the remaining four banks hold the phosphoramidites then the boxes will read U X A C G and T respectively The black rectangle below the boxes will indicate which nozzles are believed to be functional with colored dots If all nozzles are working 192 6 columns by 32 rows dots will be displayed The user will next load a playbook plb file A playbook can be created or loaded and edited by using the Edit Play Book button The buttons and text boxes in the lower center of the panel can be used to view each command in the playbook file They are also used to set the
10. 49 GRCRE TICES 50 Inkjet Microarrayer Manual version 1 2 INTRODUCTION We all know that despite their inherent problems microarrays have become an important tool in any lab that wants to do cutting edge molecular biology If you didn t think that the technology was important you wouldn t be reading this so we ll will try to keep the rhetoric to a minimum and just tell you what you need to know to build and run the instrument we call POSaM the Piezoelectric Oligonucleotide Synthesizer and Microarrayer We will try to give you a bit of the history of how the instrument came to be and how it turned out the way it is at this time Hopefully those descriptions can be helpful and maybe even amusing We also hope that those of you who actually build one of these will take part in the development of a better instrument and new methods to take advantage of its speed and flexibility In this respect we are following in the steps of Brown DeRisi and their co workers at Stanford who made their pin spotting device available to the scientific public back in the 90s We feel that the early release of these plans helped speed the development the instruments and methods that are now used and that de novo synthesized array development has suffered by not having an open source model to build on Currently microarrays come in several flavors cDNA arrays PCR DNA arrays BAC arrays and oligonucleotide arrays that are constructed using pre ex
11. Near to gloves Home 140000 o Figure 18 This dialog activated by the Move Pos button allows the user to rapidly mvoe the print head to saved coordinates Arrayer File Formats The file formats used by Arrayer are not compatible with those used by Lombardi The lineup file is a simple file of comma separated values CSV This file must contain 70 or fewer columns and 140 or fewer rows of oligo sequence text A sample playbook and a table of commands follow below The Arrayer playbook language is very primitive Each line contains exactly one command and exactly one parameter There is one looping command which must be used in oligo synthesis The LOOP command increments the Down number and restarts execution of the program until the down number exceeds the LOOP count parameter In this example five slides are synthesized They have been placed all in the same row Position 5 has been defined with the coordinates of the right most slide An ftp script has been written to upload the error log to an http server REM REM REM REM REM REM REM REM REM REM REM Beginning of program Set bottle pressure to 3 0 psig Set blower pressure to 15 psig Rain X lin edge of slides Solenoid 1109 71 210 15 311 13 4 1 04 510 15 influenza Be sure FtpScript txt exists Slides will be 32x50 Hyb to our 12mer and H File InkjetErrorLog txt gets uploaded via ftp SETDROP
12. gt gt wait 180 5 DPI 270 x p p C DPI 360 Solenoid Control Inkjet Control Pump 1 6 1 i Bank 1 6 Drops 1 10 1000 PN 2 Slide 1 27 10 Purge Ni 211 Save To LineUp and Exit d urge Nozzles ZEH Duration sec Cancel Changes and Exit n H M Test Nozzles e 5 Run Pump gt Down 25 5 5 5 225 5 55 1 Close Panel Edit Spot E 086 Figure 16 The Lombardi control panel allows robot movement reagent delivery 22 View Spot info and nozzle testing Description 2 Cancel Changes Figure 15 The slide viewer and editor The control panel is used to manually jog the print head and slide holder No damage can be done in the X Y or Z up directions WARNING It is possible to crash the print head into the slide holder with the Z down control The control panel is also used to purge air out of the Teflon nozzles when reagents have been changed Dispense liquid for about 4 seconds to completely change the volume in the tubes The solenoids are identified by number only Usually 1 3 correspond to acetonitrile oxidizer and dichloroacetic acid respectively Solenoids 4 and 5 are intended for capping reagents Solenoid 6 is treated differently by the control panel It doesn t move the solenoid s dispensing nozzle to the specified slid
13. LED 5V Power Supply 30V Power Supply potentiometer resistor resistor resistor resistor resistor resistor resistor array resistor array resistor array Socket Socket Socket File 1804 pcb 4 40 1 long threaded Threaded Threaded 1 5 nF 0 1 uF 8 2 nF Pzt Head Matches CN1 6k4 Trigger Matches CN2 Solenoid Out Matches Amp 2 174225 5 Screw Terminal 1 4007 16 Header mount DACO0802 7404 LM6361 LT1010 PS2502 7408 74138 DRV101T Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key LED RED T1 3 4 W STDDigi Key LED 3MM FLUSH YELLCDigi Key LED GREEN HI BRITE T Digi Key LED 3MM FLUSH GREE Digi Key Linear Dual 5V 91 5 A Digi Key Linear Single 28V 1A 4 7k Ohms 5 6 kOhm 1 8W 1 kOhm 1 8W 10k Ohms 1 8W 100 Ohm 1 8W 2 2 kOhm 1 8W 1 1 kOhm 1 8W 4 7 kOhms 270 kOhms 820 Ohms 16 pin Socket 8 pin Socket 14 pin Socket Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key 8405K ND 67 1148 ND 67 1147 ND PS1H152J ND P5559 ND PS1H822J ND 182 825F ND 1125M ND A2098 1125F ND A2101 2215M ND A29093 ND 277 1257 ND 1N4007DICT ND 283 2111 ND WM6880 ND DAC08
14. PRINT catalyst bank 1 2 3 4 5 6 or 16 PRINT current image Default LOADIMAGE filename CSV WASH pump number 1 2 3 4 5 or 6 DRY use manifold 0 or point 1 0 or 1 WAIT duration real number SETDROPS number of inkjet drops 0 600 integer SETSOL solenoid on duration in seconds 0 15 real number SETSLIDECOUNT number of slides 0 9 integer BLOW on or off ON or OFF MESSAGE text to display string MOVEX relative distance integer MOVEY relative distance integer MOVEZ relative distance integer MOVEABSX absolute position integer MOVEABSY absolute position integer MOVEABSZ absolute position integer HOME Axis X Y orZ PUMP pump number 1 2 3 4 5 or 6 PURGE number of banks 1 2 3 4 5 or 6 SPEED change servo velocity 1 25 or O default 10 LOOP number of downs to loop integer REM comment text string IFFSKIP If no new nozzle failures skip integer this number of lines TESTNOZZLES number of banks to test 1 2 3 4 5 or 6 SHELL DOS shell command string CHECKHEAD deprecated function 1 2 3 4 5 or 6 Table 2 Commands used by the Arrayer script Each command takes exactly one argument 24 Inkjet Microarrayer Manual version 1 2 WHAT S NEXT Improvements to the POSaM hardware and software are underway We are currently adding a new quality control measure to the print head As you may have noted the droplet detector checks which nozzles are working before every round of printing It isn t yet possible to track at
15. 0 0 0 0 fe 6 10 1 245 1 248 ma 495 i mer NC 1 505 1 5054 2500 _ 1749 5 000 6 748 3 344 11 688 ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT STATED FOLD TO FOLD AND FOLD TO HOLE 020 EDGE HOLE AND HOLE TO HOLE XXX XXXX 44 EDGE TO EDGE UNILESS OTHERWISE STATED Institute for Systems Biology 1441 N 34tt Seattle WA 98103 206 732 1200 ENGINEERING PURCHASING PROBUCTION SALESINARKETING SIZE DATE REV 12 0295104 SLIDE CHUCK FINAL APPROVAL SILK SCREEN FILE NAME 1001 BACK PANEL cdr SLIDE CHUCKdt SHEET 3 OF 7 SCALE1 2 22 34 Inkjet Microarrayer Manual version 1 2 o 9 0 o 9 0 0 20 c 0 0 9 209 0 0 0 0 0 e 0 o 1 2387 1 23977 e 9 e 0 e 40 9 20 0 c c c H 3 988 gi o F 090 1 PE 350 600 1 100 2 090 7 2 590 2 840 3 100 3 344 4 339 4 599
16. 2 XTetrazole 3 Adenine 4 Cytosine 5 Guanine 6 Thymine DE12 90 TTTTTCTGGAGGGCCTGTGCGTGAA TTTTTCTGGAGGGCCTGTGCGTGGA Gene001 Gene002 TTTTTCTGGAGGGCCTGGGCGTGGA TTTTTCTGGAGGGAATGTGCGTGGA 003 004 nd of file The following playbook file describes the standard synthesis procedure Comments again begin with the symbol Lombardi has the habit of stripping off the comments when the file is opened and re saved with the playbook editor Using prevents this The first command WASH di 15 then 14 from the sa spenses acetonitrile from nozzle 1 for 0 7 seconds It executes this action over slide then 13 then 12 The next command DRY uses the blower to remove the liquid me slides The PRINT command takes no parameters The WAIT command takes a time parameter in units of seconds This procedure is repeated N times to make an N mer This is an example playbook file WASH WITH ACETONITRILE WASH 1 0 7 15 14 13 12 DRY 15 14 13 12 PRINT PRINT WAIT 50 WASH WITH ACETONITRILE WASH 1 0 7 15 14 13 12 WAIT 2 DRY 15 14 13 12 DOUBLE PRINT PRINT WAIT 50 WASH WITH ACETONITRILE WASH 1 0 7 15 14 13 12 WAIT 2 DRY 15 14 13 12 OXIDIZE WASH 2 2 18 14 13 12 WAIT 30 DRY 15 14 13 12 WASH WITH ACETONITRILE WASH 1 0 7 15 14 13 12 DRY 15 14 13 12 DEPROTECT WASH 3 0 9 15 14 13 12 WAIT 30 DRY 15
17. 73078003 Page Usydeys paysneq 51242 CN9 b 1559959555 1 2 R 91 Fe RS R4 sweyshAs R3 lo g 9 14 40 Inkjet Microarrayer Manual version 1 2 B4 Board 1804 Circuit schematic The Institute for Systems Biology Printed Circuit Board 1984 coe tart o 6 e 9 300 i i 600060665000060 c Malt ule hide e Em i 5 S 00000000000000 e 9 50 Stephen Mordue Chris Lauste gooooc ew Board 1804 2004 eee 99 9 8 86008066600860000000000609 2
18. S Q D dg 2j d C mei IECIT ane i p Stk M meii F The Institute for Systems Biology 1 Printed Circuit Board 1901 Chris Lausted 27247200 Re pe gooooo ea 6 6 6 6 e 5 E 1 FL 5 a Bere 09 E El E a bo otoo o 6 ete oTe oTe Ri Prato Area 1 BB 9159 eC Te as 9800 p8ocoscacosco5cG 0o0000085000000800000000000000008080 eto 259 448 0050000000000000000000600000000006000000000000 98 RIS 298 ooo 0606060000900600600000000000060600000000000006006000050 eje EIS a3 9 68 ET ooo 3 8 oa bG6666600600660006006000060000000060000060500600060006 Bre Lok coce 6500005006506500650000000090000005500050050605500000 5 eoo 806068806066088686006000000080600000606080000066600004 m see DoeoooocoboooDoOcODDOODODODDOODODODOOODODODOOODODODOOO ata 56 pconoocoDDGDOODDODO
19. a computer file and we all know that computer storage has come down in cost faster than the processors have gone up in speed It costs essentially nothing to store and recall a virtual library of sequences from the RW memory of a computer Of course this has some problems as well particularly in designing the appropriate reporter to unambiguously identify each of the genes you want to measure but we ll get to those Affymetrix has now had more than 10 years to develop their product and they haven t been sitting still on their technology There have been lots of reviews and comparisons of Affy arrays and others Islam et al 2002 Kuo et al 2002 Li et al 2002 Relogio et al 2002 Rogina et al 2003 and you should read some of them But one of the problems in our eyes anyway is that the chemistry used by Affy photocleavage of the protecting groups on the dNTP monomers is not all that efficient so the oligos that can be synthesized are relatively short 20 to 25 bases at the maximum It turns out that it takes several to many 25 mers to unambiguously identify any specific gene which means that instead of 30K 40K reporters to cover the genome it takes 10 to 20 times more reporters or 300 to 600 thousand different reporters to identify all the genes expressed in a genome Until recently even the photolitographic technology used by Affy could not put that many features on a single slide Their new masking technologies may be able to put a whole
20. arrays or fuses directly to the board Use sockets instead After testing the board for printing errors and short circuits with a multimeter insert these components into the sockets Figure 6 Top view of the 1804 board after assembly 7 Assemble electronics box 1 Package board 1804 into an aluminum rack mount enclosure First drill or punch holes in the front panel for the 120V power switch and three power indicator LEDs Optionally punch two holes for BNC outputs eight holes for solenoid indicator LEDS and three holes for signal indicator LEDs Next punch holes for the three D style connectors of the circuit board Cut square holes for the 68 pin connector of the circuit board and the 120V combination receptacle fuse holder Drill mounting holes for the circuit board for the 5VDC power supply and for the 30VDC power supply Mount the circuit board power supplies DPDT power switch LEDs and BNCs 13 Inkjet Microarrayer Manual version 1 2 The photo below shows the circuit board alone mounted in place Also shown are the cables connecting the board to the 1501 and the print head Figure 7 View of the 1804 board installed in a 19 rack before installation of the power supply power connectors switch and front panel diodes The 120VAC receptacle the power supplies and the front panel parts are not yet installed Next finish the internal connections This will take a bit of soldering Connect the 120VAC
21. can be connected by a manifold which will automatically switch between tanks minimizing waste Our facility wide vacuum system provides a reliable 15 20 inches of water negative pressure If this is unavailable to you consider a dedicated vacuum system It is also useful to locate the POSaM near a fume hood but the POSaM requires its own ventilation plumbing Provide a 1 5 inch exhaust ventilation pipe and set the flow rate above 80 liters per minute Numerous small tools and fittings are required by this project While we have tried to be detailed in our parts listings it is likely that some small items are not listed but are commonly available around the laboratory or at the local hardware store Useful tools include adjustable wrenches combination wrenches metric and English hex drivers slotted and Phillips drivers a hack saw a file a Dremel style rotary tool a sheet metal nibbler a drill a level soldering irons of 15 and 35 watt size and a multimeter Useful supplies include wire 14 gauge single and multiple strand heat shrinkable tubing wire labels drill bits cap screws 74 inch with 20 threads per inch or quarter twenties of various length a screw kit of various sizes between 4 and 8 and corresponding washers and nuts We have attempted to use commercial off the shelf components wherever possible Nevertheless some of the components must be custom fabricated For the print head bracket and the slide hold
22. center of the panel contains the playbook functions The program or playbook file can be viewed here Oligo synthesis programs can be started and stopped with these buttons The right side contains droplet detection and reagent dispensing functions The user should first open a lineup file with the Load Image button The user can edit the image displayed in the large black box by clicking A left click increments the bank number used to hit that spot For example a spot that had contained an A from bank 2 will be changed to a B from bank 3 A right click resets the spot to zero or no drop The user must check that each bank is assigned a letter In the example above banks 123456 are assigned letters MACGTN The letters used in the lineup file must all be from this set of six letters It does not matter which symbol corresponds to the catalyst The printing of tetrazole is done explicitly in the playbook using the bank number The user can position the print head over a slide by using the jog buttons The lt lt gt gt buttons move the servos farther than the lt gt buttons The three axes can be homed individually by using the Home buttons Once the print head is over a slide the user may click Print to print the image currently displayed The number of drops printed is adjustable If the number specified is one drop then fast fire on the fly printing is used The image displayed is a snapshot of the lineup at a gi
23. genome on a slide now however since you have to make 4 new masks for every position in an oligonucleotide it gets very expensive to change an array and it also takes time to design and manufacture these new masks That really takes this technology out of the reach of most academic labs Xeotron and Nimblegen are now using dynamic micromirror displays for maskless photolithographic oligoarray synthesis but these are also unavailable to most labs Back in the 1990 s Blanchard and Hood demonstrated at the University of Washington that off the shelf inkjet parts might be used to deliver standard phosphoramadite chemistries to the Inkjet Microarrayer Manual version 1 2 modified surface of a slide in order to synthesize new oligoarrays very rapidly and inexpensively Blanchard and Hood actually put together a prototype inkjet arrayer that was used as an asset during the formation of Rosetta Inpharmatics Rosetta and then Agilent went forward and developed an elegant inkjet array synthesizer based on these original plans but because this is a commercial instrument it isn t simple enough to be constructed or maintained by a regular molecular biology lab In addition it has taken more than 5 years of development to get a catalog of inkjet arrrays to the end user This we feel has held up development of new methods that can take advantage of the speed and flexibility inherent in this design So we the Hood Laboratory now at the ISB decided t
24. green LED Nice panel mount 3mm red LED LED Ceramic Disc Capacitor 0 25in Radial Leaded Capacitor 0 2in Electrolytic Capacitor 0 3in Amp 68 connector male BNC connector D SUB 25 pin connector receptacle female D SUB 25 pin connector receptacle male 12 pin Screw Terminal D SUB 9 pin connector plug male D SUB 9 pin connector plug female Connector power jack 1mm Connector power plug 1mm Fuse 0 2in Breakaway square header 80pin Closed end shorting jumper LED LED Potentiometer Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Carbon Film 1 8W 0 25in Relay Socket 14 pin Socket 8 pin Op amp quad D flip flop quad Encoder signal conditioner Humidity Sensor File 1901 pcb 4 40 1 long threaded Threaded Threaded Express PCB File 1901 pcb Digi Key Digi Key Digi Key LED FLUSH GREEDDigi Key LED 3MM FLUSH YELLCDigi Key 1nF 100nF 0 1uF 50V Amp 2 174225 5 Amphenol 31 5431 2010 DB25 PCB mount DB25 solder Screw Terminal DB9 PC mount DB9 solder CUI PJ 014C Matches CN7 and CN8 500mA 250V 0 1inch 0 1inch Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Radio Shack Digi Key
25. routed also use polymer clay Carefully set the main body on the weatherstrip surface Holes in the flanged base match the 1 inch grid pattern of the optical table Gently fasten down the main body using 74 20 screws and 1 inch fender washers MC04 Only tighten the screws finger tight to avoid damaging the flange a M Figure 13 All wires between the rack and the POSaM interior are routed underneath the lower right rear corner of the cover shown here as the lower left corner of the picture Next attach the panels Apply two strips of D profile weatherstrip MC07 around the perimeter of the three holes in the main body Attach the left glove hole and right no glove holes panels with long 6 screws Seal the screw holes by covering them inside the main body with polyethylene tape 09 The front panel door attaches with three hinges on the top and has five latches around the sides and bottom Attach the hinges and latches 01 with more 6 screws from 02 and seal the screw holes with polyethylene tape Last attach gloves and the exhause valve Attach the gloves 8 to the left panel with large worm screw clamps large versions of those used for automotive radiator hose clamps A very low resistance valve MC10 is needed for the exhaust port at the upper left corner of the cover We extracted ours from a dust mask sold by the local hardware store lt is 30mm diameter and fits
26. table Mount the two solenoids to the plate Fasten the plate to the left rear corner of the optical table outside the area enclosed by the acrylic cover 12 Place slide holder Mount the slide holder to the Y axis positioner using four 2 12 long 74 20 screws Use four spacer bushings gt thick 74 hole between the positioner and the holder This gap will allow the bellows of the Y axis positioner to flex without touching the holder Orient the slide holder so that the waste liquid will drain from right to left Figure 9 Teflon slide holder The slide holder is mounted on the X axis positioner 13 Install print head brackets Use four long 4 20 screws to mount the left and right printhead bracket pieces to the Z axis positioner Figure 10 Print head brackets shown with inkjet vials slider rod and teflon tubing installed 14 Install print head and phosphoramidite vials Extract the black plastic print head ink cartridge holder from an Epson Stylus Photo 700 printer Also extract the stainless steel slider rod from the printer Insert the holder between the mounting holes of the right printhead bracket piece Insert the slider rod through all four mounting holes of the left and right printhead brackets passing through the holder Secure the rod with two set screws Cut six 1 lengths of flexible 3 16 OD Pharmed tubing Attach them to the inkjet inlet spikes Cut six 7 length
27. the Z axis positioner to the moving face of the Y axis positioner with four screws This will require turning the Z axis lead screw by hand a few times each direction to expose the mounting holes The motor mount of the Z axis positioner points upward Place the X axis positioner the 20 inch stage on the table underneath the YZ axis assembly Elevate the positioner one inch above the table surface using eight one inch aluminum spacer bushings Fasten the positioner down with eight screws Attach the SM23 servo motors to the positioners according to the manufacturer s instructions Inkjet Microarrayer Manual version 1 2 1 1 45 35 Figure 2 Layout of the servopositioners and other components on the optical table The coordinates of the left rear mounting hole are 1 1 and right front are 45 33 Theses threaded holes are on a one inch grid Point What Coordinates A Screw point for XZ axis support bracket 19 7 B Screw point for XZ axis support bracket 19 13 Screw point for XZ axis support bracket 38 7 D Screw point for XZ axis support bracket 38 13 E Screw point for Y axis 27 12 Screw point for axis 27 17 G Screw point for Y axis 27 22 Screw point for Y axis 27 27 1 Screw point for axis 32 12 J Screw point for Y axis 32 17 K Screw point for Y axis 32 22 K Screw point for Y axis 32 27 M Soleonid tower 17 5 N Photod
28. tightly inside the cover exhaust port tube The mask comes with three such valves We replace them every three months 20 Connect fume exhause hose Connect the exhaust port at the upper left corner of the cover to your fume exhaust system using flexible conduit 1 Overlap the exhaust tube with about 30 mm of conduit and fasten with a worm screw hose clamp Cut a hole 20mm in diameter in the conduit immediately next to the exhaust port tube This leak prevents your building s exhaust system from creating a vacuum inside the POSaM cover Place a cork in the inlet port at the lower left rear corner of the cover To rapidly remove fumes from inside the cover open the inlet port and close the leak hole THE SOFTWARE Two software tools can be used to run the inkjet arrayer Arrayer and Lombardi Both require two types of input data files to work A Lineup file describes the DNA sequences to be printed on 20 Inkjet Microarrayer Manual version 1 2 the slide A Playbook file is used to describe the procedure used to synthesize the DNA Both programs were developed in Visual Basic 6 0 on Windows NT 4 0 And we ve recently started using it on Windows 2000 Both require that Compumotor s Motion Planner and National Instruments NIDAQ Nidaq32 dll specifically be installed A Pentium 500 MHz with 256MB RAM is sufficient Using Lombardi Lombardi currently on version 0 7 3 is intended for the routine production of microarrays I
29. what exact instant a nozzle fails So for now we always need to double print Better droplet monitoring could eliminate this need We are also planning a new slide holder and wash area Our current design holds more slides than we need and the wash dry steps are not as fast as we would like We are working on a new design that might only hold eight slides but will significantly speed washing and drying Changes in the control software are underway The code for Lombardi and Arrayer is let s be honest somewhat ugly Also some routing actions are cumbersome For example swapping different microarray designs in and out of a Lombardi lineup is slow The scripting language could use some new features We will soon be unveiling a new control program called Pogo Pogo will be faster easier to use and it will understand our upcoming hardware changes So before you build be sure to check out our website for the latest versions of the documentation the schematics and the software 28 Inkjet Microarrayer Manual version 1 2 APPENDIX A MECHANICAL DRAWINGS A1 Array Cover Not shown Front door exhaust port top left 1 5 dia inlet port bottom rear 1 5 dia removable glove panels left and right sides 29 Inkjet Microarrayer Manual version 1 2 MATERIAL ACRYLIC 0 25 INCH TOP
30. 02LCN ND 296 1605 5 ND LM6361N ND LT1010CN8 PS2502 4 DM74LS08N SN74HC138N DRV101T ND HLMP3750ACM ND 67 1149 ND P461 ND 67 1148 ND 271 2010 ND 271 2017 ND 3214J 103ECT ND 5 6KEBK ND 1 0KEBK ND 10KEBK ND 100EBK ND 2 2KQBK ND 1 1KEBK ND 4116R 1 472 ND 4116R 1 274 ND 4116R 1 821 ND A9416 ND A9408 ND A9414 ND 2 27 10 10 8 20 NNUNNNNNN 88 6500 0 4850 0 8000 0 8000 0 3500 0 1520 0 3700 2 8700 3 6400 4 8400 4 7600 2 8900 1 9100 20 1900 4 3600 0 1360 1 7300 4 4300 1 5800 0 4400 2 9800 4 3800 21 5000 0 6000 0 4500 7 7000 0 3500 0 8000 0 2750 0 8000 54 8100 37 0300 3 2200 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 6000 0 6000 0 6000 0 8700 0 5700 0 9900 47 177 30 13 10 8 00 8 00 2 80 3 04 1 48 5 74 7 28 9 68 9 52 5 78 3 82 40 38 8 72 2 18 27 68 17 72 3 16 1 76 5 96 8 76 43 00 1 20 0 90 123 20 4 20 9 60 1 40 1 40 1 40 1 40 1 40 1 40 1 20 1 20 2 40 12 18 2 28 5 94 Inkjet Microarrayer Manual version 1 2 C5 PCB 1901 Components for printed circuit board 1901 CN1 CN2 CN3 PLUGO1 CN4 5 CN6 PLUGO2 CN7 8 PLUGO3 1 2 H1 5 JP1 2 LED1 3 LED4 5 Pot1 R1 4 5 R12 R13 14 R15 20 R2 R21 24 R3 R6 R7 R8 R9 11 RLY 1 2 01 2 03 U1 U2 U3 HU1 Circuit board 1901 Aluminum stand off LED Nice panel mount 3mm
31. 14 13 12 WASH WITH ACETONITRILE WASH 1 0 7 15 14 13 12 DRY 15 14 13 12 Using Arrayer Arrayer currently on version 0 9 0 is a more flexible controller intended for testing improvements to the machine Its main advantage is the greater control offered by its playbook language It can print up to 9800 spots 70 by 140 It also has a tool for finding the center of the laser beam used in droplet detection 23 Inkjet Microarrayer Manual version 1 2 Institute for Systems Biology Beta Group Inkjet Microarray Machine P REM sides wil be REM Use for Li Te dsDNA 10 ON I SETDROPS T 4 OS REM Nord tsi ing 16 MOVETO 1 17 TESTNOZZLES 6 13 PURGE SlideJetOn DyerOn 21 REM Midwashandpan PumpDurstion sk 2 MOVETO 5 MONETE Solenoid Pump tt 4 00 sese Test Nozzles Clean Head Reset Center _ Reset Droplet Detector Baek F 2 f Uu aja 5 Load Image lt Home x Get Pos Save Image Ae lea l Phosphoramidite E 17 Main TE of Arrayer v 0 9 software The main panel pictured above is displayed at start up The left side of the panel contains printing functions The large black box displays the image currently available for printing The servo jog buttons are below The
32. 23 00 C2 Optical Mechanical Droplet detector opto mechanical parts Total 583 04 Label Component Description no 1 Filter red glass RG Edmond Industrial OptiK32 755 1 19 0000 19 00 2 Convex lens 50 mm f l 1 dia Edmond Industrial OptiK32 478 1 21 9000 21 90 Post holder dia Edmond Industrial OptiK02 656 2 26 0000 52 00 Laser LED 670 nm 3 mw Red Edmond Industrial OptiK38 922 1 175 0000 175 00 05 Laser diode mount Edmond Industrial OptiK53 264 1 90 0000 90 00 Post clamp right angle 1 2 dia Edmond Industrial OptiK53 357 2 19 8500 39 70 07 Photodiode 1cm x 1cm square area Edmond Industrial OptiK53 373 1 98 0000 98 00 08 Ring nuts 1 1 dia Thor Labs SM1RR 3 5 0000 15 00 09 Mounting ring clamp SM1 style 1 dia Thor Labs SMR1 1 16 0000 16 00 PO10 Barrel SM1 style 1 dia Thor Labs SM1L20 1 18 0000 18 00 PO11 Post 4 long gt dia Thor Labs TRA 2 6 5000 13 00 PO12 Post 8 long 7 dia Thor Labs TR8 2 8 0000 16 00 PO13 BNC cable Digi Key 290 1024 ND 1 9 44 9 44 C3 PCB 1503 Components for printed circuit board 1503 Total 86 52 Componont Description _____ Supplier 2 Cost Ea Circuit board 1503 File 1503 pcb Express PCB File 1503 pcb 3 20 6667 62 00 Aluminum stand off 4 40 1 long threaded Digi Key 8405K ND 8 0 4850 3 88 Aluminum stand off 4 40 1
33. 4 849 5 349 6 339 6 839 7 089 7 349 8 344 8 587 8 847 9 097 9 597 10 587 11 087 11 337 11 597 11 688 NOTE THIS PAGE FINTENDED ROR USE OF NC PROGRAMMING AND INSPECTION REFERENCE ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS SONMESSERRHERWISE STATED Institute for Systems Biology 1441 344 EDGE TO FOLE AND HX Seattle WA 98103 206 732 1200 ENGINEERING DATE SIZE DATE TITLE SLIDE CHUCK REV FINAL APPROVAL SILK SCREEN FILE NAME SLIDE_CHUCK dft SHEET 4 7 SCALE1 2 35 Inkjet Microarrayer Manual version 1 2 o e 8 5 5 5 5 5 5 5 5 5 5 5 9 o o 9 o D 250 479 1 037 1 729 m 2 979 3 344 3 537 4 229 4 787 x 5 479 6 037 6 729 7 287 7 979 8 344 8 537 9 229 9 787 10 442 X DIM FOR RADIUS 10 479 10 938 11 037 NOTE THIS PAGE FINTENDED ROR USE OF NC PROGRAMMING AND INSPECTION REFERENCE ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT 90 DEGREWSESS OTHERWISE STATED _ R Institute for Systems Biology 1441 N 34th St EDGE TO EDGE XX
34. 50000000000000 m 009090000080009050000000 9 56000000000000000000000000005 on 200 Si 91301 9 sy e 9 ative e Cli i Cn 66686660 66006660 6660066 3 ordeo HE 105 5 126 al RL d Ler 566668006 0990608 gs Ic Boos NECEM 55 eee reae T 58686085 Re Rae ro a 25 RE R RB pg us 99 o o o A aa giro Cae x ERR ND 0 56 e e 25 wv Rin mpm scias 8 108 o B 66506060 0000000000000 6 O O s 26 g g 41 Inkjet Microarrayer Manual version 1 2 B5 Board 1901 Circuit schematic
35. 900 7 UNLESS OTHERWISE STATED TO HOTE 2 20053000 010 ISB Seattle WA 98103 206 732 1200 E PURCHASING 3 AS Di TITLE sLIDE CHUCK REV FINAL APPROVAL SILK SCREEN FILE NAME SLIDE_CHUCK dft SHEET 50F 7 SCALE 1 1 33 36 Inkjet Microarrayer Manual version 1 2 ALL DIMENSIONS IN INCHES ANGULAR 1 ALL BENDS AT STATED FOLD TO FOLD AND FOLD TO HOLE XXXX 020 EDGE HOLE AND HOLE HOLE XXX XXXX 44 EDGE TO EDGE AUNILESS OTHERWISE STATED ENGINEERING PURCHASING PRODUCTION SALES MARKETING Pd DATE DEI TITLE SLIDE CHUCK FILE NAME SLIDE CHUCK dtt SHEET7 OF 7 SCALE FINAL APPROVAL Institute for Systems Biology 1441 N 34tt Seattle WA 98103 206 732 1200 REV B 37 Inkjet Microarrayer Manual version 1 2 APPENDIX B ELECTRICAL B1 Electronics Overview The diagram below provides an overview of the various POSaM electrical interfaces The supervisory computer controls the piezoelectric printhead the solenoid valves and the droplet detection system via two PCI bus interface cards DIO 32HS and MIO 16E The computer commands three axis positioning system via Ethernet connection to the servo controller 6 4 Trigger positions are programmed in to the 6K4 and piezoelectric pulsing is triggered by digital signaling from the 6K4 to the DIO 32HS The solenoid labeled phosphoramidite press
36. Assembly manual for the POSaM THE ISB Piezoelelctric Oligonucleotide Synthesizer and Microarrayer Version 1 2 28 May 2004 The Institute for Systems Biology 2004 1441 North 34 Street Seattle WA 98103 8904 The Hood Laboratory Beta Group Inkjet Microarrayer Manual version 1 2 Table of Contents a c AD anb aus LAC LI ED MMC C 1 Inkjet Microarrayer Manual version 1 2 enne enne 2 4 System OVVIE W Nite bo NRI Sadan dn Canty tutes ou te hdd ides 3 Overview of 5 SOFVO Os eS s 6 Microarrayer electroni S s 6 7 Reagent SOlVent 7 Nitrogen supply and system enclosure 7 Slide 8 Getting Started i ende Dae eise ees 8 Assembling the 8 1 Assemblethe table ieee ee a 8 2 Place servo 9 3 Place servo controller and digital servo 11 4 Connect and configure servo 11 5 Assemble printed circuit board 1501 ee een en tene nette pee 11 6 Assemble printed circuit board 1804 12 7 Assemble electronics box 1 13 5 Assemble printed circuit board 1901 eee RR 14 9 Asse
37. Digi Key Digi Key LED GREEN T Digi Key LED RED T1 3 4 W STDDigi Key 3386H series 10k 10kOhm 100kOhm 1kOhm 33kOhm 1 64MOhm 1kOhm 33kOhm 820kOhm 5 6kOhm 8 2kOhm 1kOhm 0 3inch 0 3inch LM324N 74 175 157183 1520 Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key Digi Key usdigital com Digi Key 8405K ND 67 1148 ND 67 1147 ND 67 1148 ND 67 1149 ND P10461 ND 399 2143 ND P10967 ND A29093 ND ARF 1065NW ND 182 825F ND 1125M ND 277 1257 ND 182 809M ND 2209F ND CP 014C ND NA 283 2111 ND WM6880 ND 9001 ND P461 ND HLMP3750ACM ND 3386H 103 ND 10kEBK ND 100kEBK ND 1 0kEBK ND 1 6MEBK ND 1 0kEBK ND 820kEBK ND 5 6kEBK ND 8 2kEBK ND 1 0kEBK ND HE100 ND A9414 ND A9408 ND 296 1391 5 ND 296 2101 5 157183 HM1520 ND 2 27 10 10 10 10 10 10 NGARANNNNN Total 89 2000 0 4850 0 8000 0 8000 0 8000 0 8000 0 3000 0 1210 0 3600 20 1900 7 5800 2 8700 3 4500 4 3600 1 8300 1 6200 0 4100 0 4900 1 7300 4 4300 0 1160 0 2750 0 3500 1 2900 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 0 0560 1 5900 0 7920 0 5700 0 4900 0 5000 3 0500 49 5000 48 482 08 178 40 13 10 8 00 8 00 8 00 8 00 3 00 1 21 3 60 Inkjet Microarrayer Manual version 1 2 C6 Other Pa
38. ODOOODOODODOOOOODOOGODODOOODODODODOOO eo 6960960569609600006056000000060000600600000006000000 58 IM 660060660060066060600600000000600060000606000006600006 09600000 eoosooo 0O00000000000000000090 5 5 RLv2 oooooco o 6o000000000000 eo 696660666666566068065005 50 m ES ons lium loogco0080008000060909 eo A 5 a 8 969696560669000006 555 sis 66 298 5 uw T e o8 212 90000000 600000000000000000 as Rio pe morar E ees eite eite sl To SS6656565566506065 9 YS oooooocooooooooo o8 67 SP x OMM R3 ea REA ecie 6H Bd 874 E 5 000000000000000000 55556 E Top vu 9988 PIMA
39. S 4 SETSOL 0 71 SETSLIDECOUNT 5 ae Nozzle testing MOVETO 1 TESTNOZZLES 6 WAIT 1 PURGE 6 REM REM MOVE WAS DRY EE Wash and print PUMP 6 WAIT 1 MOV EABSZ 69500 PRINT 1 PRINT Default MOV 52 66000 25 Inkjet Microarrayer Manual version 1 2 REM REPEAT REM Nozzle testing MOVETO 1 EM Wash and print 1 VEABSZ 69500 NT Bank1 INT Default OVEABSZ 66000 AIT 60 EM Oxidize DS tg tg tg U D MOVEY 25000 WAIT 25 REM Wash and acid MOVETO 5 DRY 0 SETSOL 0 71 WASH 1 DRY 0 SETSOL 2 06 PUMP 6 SETSOL 1 04 WASH 3 MOVEY 25000 WAIT 25 REM Extra wash MOVETO 5 DRY 0 SETSOL 0 71 WASH 1 DRY 0 SETSOL 2 06 PUMP 6 SETSOL 0 71 REM REM FTP the error log REM SHELL ftp s FtpScript txt REM REM Looping REM Extra wash at end REM Mid wash REM Maintanence every 20 min MOVEX 25000 MOVEY 10000 PURGE 0 WAIT 1200 PURGE 0 WAIT 1200 PURGE 0 WAIT 1200 Inkjet Microarrayer Manual version 1 2 The contents of FtpScript txt open ftp mywebsite org myname mypassword cd public html put InkjetErrorLog txt bye Command Parameter Acceptable values
40. TLIM 1 2 Torque Limit Nm DMTSCL 1 2 Torque Scaling Nm DMVLIM 100 000000 Velocity Limit rev sec DMVSCL 100 000000 Velocity Scaling rev sec Load Setup LJRAT 0 0 Load to Rotor Inertia Ratio LDAMP 0 0000 Load Damping Nm rad sec Fault Setup FLTSTP 1 Fault on Startup Indexer Pulses Enable FLTDSB 1 Fault on Drive Disable Enable SMPER 4000 Maximum Allowable Position Error counts SMVER 0 000000 Maximum Allowable Velocity Error rev sec DIFOLD 0 Current Foldback Enable Digital Input Setup LH 0 Hardware EOT Limits Enable INLVL 11000000 Input Active Level INDEB 50 Input Debounce Time milliseconds Digital Output Setup OUTLVL 0000000 Output Active Level Analog Monitor Setup DMONAV 0 Analog Monitor A Variable DMONAS 100 Analog Monitor A Scaling of full scale output DMONBV 0 Analog Monitor B Variable DMONBS 100 Analog Monitor B Scaling of full scale ouput Servo Tuning DIBW 1000 Current Loop Bandwidth Hz DVBW 100 Velocity Loop Bandwidth Hz DPBW 25 00 Position Loop Bandwidth Hz SGPSIG 1 000 Velocity Position Bandwidth Ratio SGIRAT 1 000 Current Damping Ratio SGVRAT 1 000 Velocity Damping Ratio SGPRAT 1 000 Position Damping Ratio DNOTAF 0 Notch Filter A Frequency Hz DNOTAQ 1 0 Notch Filter A Quality Factor DNOTAD 0 0000 Notch Filter A Depth DNOTBF 0 Notch Filter B Frequency Hz DNOTBO 1 0 Notch Filter B Quality Factor DNOTBD 0 0000 Notch Filter B Depth DNOTLG 0 Notch Lag Filter Break Fr
41. access door The high pressure inert gas is controlled by a 0 100 Ipm valve rotameter Mini Master type Dwyer Michigan City IN This gas supply serves dual roles it displaces the air inside the enclosure and it powers the air amplifier 1 5 Conveyvac ARTX Cincinnati OH our internal circulation apparatus The apparatus circulates the internal atmosphere through a series of activated charcoal and desiccant filters The system is flushed with nitrogen at a 40 Ipm flow rate for 40 minutes prior to oligo synthesis Assuming good mixing of inert gas with air the time constant T for the flushing process would be approximate 7 9 minutes The observed is slightly shorter 25 6 minutes for oxygen depletion because much of the internal volume of the enclosure is occupied by hardware The air amplifier circulates gas in a horizontal loop The nitrogen fills the enclosure from bottom to top Drying takes a little more time than oxygen depletion r 6 8 minutes While the use of desiccant accelerates the process much water is adsorbed to the surface of the hardware if the enclosure door has been open for a significant period of time Relative humidity was measured using a capacitance hygrometer Model 4187 Control Company Friendswood TX this has since Inkjet Microarrayer Manual version 1 2 been replaced by the smaller Humirel HM1520 and oxygen was measured using an Oxy Plus electrochemical device Brandt Instruments Slidell LA S
42. acturer s instructions Configure the PCI DIO 32HS as device number 1 and the PCI MIO 16E as device number 2 Install and configure two ethernet interfaces Yes this open source project requires some proprietary elements This decision was made early in the project to take advantage of the drivers and setup tools from National Instruments and Compumotor There probably wouldn t be any serious problems converting to all open source elements The OS could be Linux and the interface cards could now use the Comedi drivers The servo controller has standard ethernet and RS 232 interfaces Lombardi could be ported to C or Java with a Java Native Interface Of course this might take some time Configure the three servo amplifiers according to the manufacturer s instructions Install Compumotor Motion Plannner Software on the PC One at a time connect the PC to the servo amplifiers using a crossover RS 232 cable Download the configuration script using Motion Planner An suitable configuration script can be found in the appendix 5 Assemble printed circuit board 1501 The smallest circuit board 1501 is an adapter to connect a DB25 cable to the flexible flat cables of the Epson print head This circuit board is mounted on the back of the X axis positioner and the flexible cable stretches to the print head Perhaps it would be better to mount it right next to the print head Download ExpressPCB software from http www expresspcb com and the latest
43. ard Fit the bottles with 3 port GL45 caps 01 Use 1 8 OD teflon tubes to deliver pressure to the bottles Connect the bottles to teflon solenoids 09 numbers 1 to 5 using 1 16 OD teflon tubing Be sure that tubing reaches to the bottoms of the bottles Run approximately 2 meters of 1 16 OD tubing from the five solenoids to the print head assembly Use 1 meter length of flexible 172 flexible tubing as conduit to hold the cabling to the print head assembly as well as the bundle of reagent tubes Label all five tubes where they emerge from the conduit Insert the tubes into sleeves of 1 16 ID 1 8 OD flexible tubing Press the sleeves into the left five grooves of the print head assembly Hold the sleeved tubing in place with 4 40 screws and washers The solenoids may now be connected to board 1804 Solder a 10 conductor cable approximately 3m in length to pins 1 9 of a DB15 connector PLUGO6 Pins 2 through 6 will connect to reagent solenoids 1 5 Pin 7 will connecto to waste solenoid 5 Pins 1 and 8 are currently unused Pin 9 is common ground to all solenoids 15d Install the slide dryer Microarray slides are blown dry during synthesis by a six jet nitrogen manifold MG10 Bend a 90 angle in a 12 long aluminum tube MG09 using a tubing bender to avoid kinking The bend should be 1 25 from the end of the tube with a radius of about 72 Insert the tube into the sixth groove of the print head assembly T
44. ardware store VWR 56223 154 Small Parts Miami LakB HTT 190532 Instrumentation IndustriBE 131 or similar Clear Cut Plastics SeeContact Dave Ryan Hardware store Hardware store Hardware store Hardware store Small Parts Miami LakB TCNY K5 Various Ashcroft or equivalent Airtronics of Bellevue VE T 2 6 L Various 8067 or equivalent Omnifit 11340 Various iprocessmart com Burkert 450914V Dwyer Michigan City IVFA 27 BV Hardware store NA Small Parts Miami LakB TCM 13 20 6 Small Parts Miami LakB DC 1 4 ARTX Hardware store Hardware store NA Hardware store NA Hardware store NA Westem Analytical 1 72 24 VWR 16157 169 VWR 16157 227 Upchurch Scientific 1509L Upchurch Scientific 06 Upchurch Scientific 300 Upchurch Scientific 1548 Upchurch Scientific 215 Angar 190057 Epson or Ebay Photo 700 Epson Extract from Epson Stylus Phot Epson Extract from Epson Stylus Phot Epson Extract from Epson Stylus Phot Fisher 06 444 Fisher 12712 Fisher 14 825 15AD Agson 057020 Hardware store NA Hardware store Hardware store Hardware store Hardware store Port Plastics 28000190 Small Parts Miami LakB ORS 010 Small Parts Miami LakB ARCH 6 Fisher 09 744 37 63669 M D Building Products M D Building Products or Controls Corp 2023301 580M e g Small Parts LSAT 063 16 1 e g Small Parts B TRX 1420 e g Small Parts B RSA 14 16 e g Small Parts B RSA 14 8 RAND
45. arrays and test methods And you can do it fast and inexpensively We generally make 4 to 6 10K feature arrays of 40mer oligos overnight deprotect them the next morning hyb wash and scan them during the day and have some results within 24 hours of putting the slides on the machine We figure the cost is less than 80 dollars per slide including labor costs That s quick and cheap and quickness and cheapness are good when you are designing something new You can test lots of different reporters and protocols and not bust your budget or have to wait weeks or months to do it You need to keep in mind that the printing element used in the POSaM was developed for the low cost commercial color printing market where 100 reliability is not expected therefore the matter of quality control is very important This is the technical and operational manual for the POSaM inkjet oligonucleotide synthesizer is open source and licensed under GNU type licenses The idea is for the community to help make a better machine and better methods by working together using a design funded by the NIH and therefore the public and we believe that instruments developed with public funds should be available to the public If you have questions or problems call us at 206 732 1276 or email us at posam systemsbiology org We actually have some funds for user support and will be happy to try to answer your questions so we can make a better machine together Note that this
46. circuit board files 1501 pcb 1501 sch 1804 pcb 1804 sch 1901 pcb and 1901 sch from the ISB website http projects systemsbiology net inkjet Order two replicates of each board online with ExpressPCB Order the necessary components for all three boards from a vendor such as DigiKey Assemble the circuit board using the layout information in the 1501 schematic sch and circuit board pcb files First screw four stand offs into the corners of the board Second insert the components and check that everything fits properly Third solder the components in place Use a solder iron of smaller wattage with a fine tip 11 Inkjet Microarrayer Manual version 1 2 gt 4 pam 2 i gt gt gt zs 9 5 3 V di MN Le 25 ne WYP 247272 ET we Pl de Dll Ade at et ae DLS Ais SERS Figure 3 Top view of the 1501 board as it arrives in the mail Note that there are 16 holes for the small white 15 pin flexible cable connectors While there are probably lots of errors and omissions yet in the manual this isn t one of them At one time only 16 pin connnectors were available in the U S and that is what we used We simply inserted a 15 conductor cable into the first 15 positions of the 16 conductor connector You may solder the 15 pin connector into the 16 hole position Also note that there are fo
47. e TTL compatible and active high The piezoelectric drive signal resembles a trapezoidal waveform rising from OV to 28V in 5ys holding at 28V for 5us stepping up to 30V for 10us and falling back to OV linearly over 20 Each waveform pulse results in the ejection of one droplet from each selected nozzle Pulse frequencies as high as 14 4 kHz may be used The digital signals are transmitted directly from DIO 32HS output port D Unused digital lines in port D allow for an additional print head to be added if needed The waveform output is provided by output port C and converted to analog by the DAC0802 integrated circuit IC These two 8 bit ports are configured as a single 16 bit output port referred to in software as Group 1 The six PTFE solenoid valves Model 190224530 Florham Park NJ used to control reagent flow are normally closed and require 24V to open Three digital output lines of DIO 32HS port B are used to select the active solenoid via the 3 to 8 decoder IC The solenoid driver DRV101 is a low side power switch employing a pulse width modulated PWM ouput The driver provides a strong initial 100 ms pulse to open the solenoid valve followed by a PWM square wave Inkjet Microarrayer Manual version 1 2 with a 20 duty cycle to hold the solenoid open without generating significant heat During oligo synthesis only one solenoid need be open at any given time The two solenoid valves Model ET 2 6 H Airtronics Be
48. e from Agson Electronics Cherry Hill NJ print head is uniquely suited to inkjet microarraying It contains six fluid channels that can hold the four standard monomers the catalyst and still accept a modified monomer monomer mixture or preformed linker It contains 192 total nozzles The droplet size quoted by the manufacturer is a mere 6 pL Droplet size varies with viscosity and surface tension and consequently temperature but based on solvent consumption for the work described here our droplet sizes are closer to 10 pL The newer Epson print heads actually have more nozzles that squirt smaller volumes 4 pL More nozzles can result in faster synthesis These tiny droplet volumes 4 10 pL enable high spot densities and make consumption of reagents hard to measure but that keeps the costs down Most importantly the F057020 is a piezoelectric print head so it can dispense a fairly wide range of solvents A charge applied across a lead zirconia titanate PZT crystal deforms the crystal and bends a zirconia diaphragm near the nozzle orifice Le 1999 The action of the diaphragm ejects a droplet from the nozzle Solvents of almost any boiling point can be ejected Oligo synthesis requires a solvent of very low volatility so that the coupling step can complete before significant evaporation occurs The thermal print head used in bubble jet printers is more popular in the home office printer however it is only suitable for fairly volatile solven
49. e location because it is used for vacuuming waste from the slide holder The control panel can also be used to purge thousands of droplets from the piezoelectric nozzles When the Purge Nozzles button is clicked the entire bank ejects droplets through the laser beam This is also a way to check the proper operation of the nozzles and the alignment of the laser Lombardi File Formats The following example lineup file has the required information to make an array with four features 2 spots by 2 spots Comment lines start with the symbol The six banks of the piezoelectric are next assigned their reagent XTetrazole indicates the position of the catalyst If an X appears in a sequence two drops of tetrazole will be delivered but no base The slide printed will be in position 12 This is the position third from the left in the middle row The spot density is 90 DPI Rows 1a and 2a contain oligo sequences Rows 1b and 2b contain the corresponding descriptions of the sequences The b rows are optional As many as 27 slides 22 Inkjet Mi may be incl croarrayer Manual version 1 2 uded file In the future we will be using a format interchangeable with our generic array data processing pipeline desribed at http db systemsbiology net software ArrayProcess index html T BAN BAN BAN BAN BAN BAN SLI DPI la 16 2 2 his is example lineup file 1 Unused
50. ed high pass filtered and converted to a digital signal by threshold comparison The state of the droplet detection is held in a D type flip flop The circuit is reset just prior to droplet ejection and the state is read immediately after ejection 43 Inkjet Microarrayer Manual version 1 2 5v 30v Sk T r4 Vr 5 i pag In pevior Dutg 9 solenoido gt gt Leno a 5 ul 3 5 Solenoidl a 800 Duty 2 04 when lt 1 a Solenaide 22 270k uo v 14 lt sotenoiatd EH E Yer z 8 se 8 DRV101 solenoid drivers sS Solenold4 5 30v Gna YS Eo C solenolas Sk Y Solenoids z lt Li a 6 ad e pgevioi Dut g 9 solenoid gt 215 8 5 az 5 ap oj 800 270k 1 luF 7 Solenoid Common AL 4 e 1D ta 107 t 4 1a 10k 21 Lg 9 12 HP E Tk 1 4D 40 ve 49 34 5 H Photodiodgy mel ek i 100nF 33k _ CLR s il 1 Sk POT 1 2106 1 820k 164 Inkjet Microarraye
51. equency Hz DNOTLD 0 Notch Lead Filter Break Frequency Hz SGINTE Integrator Enable 45 Inkjet Microarrayer Manual version 1 2 APPENDIX C LISTS OF COMPONENTS C1 Robotics Components necessary for POSAM robotics Total 23 206 00 Label E Component Description sas rr n an PRO1 Motion controller 4 axis Compumotor 6K Olympic contrc6K4 1 2595 0000 2 595 00 PRO2 Servo drive digital Compumotor GV Olympic contrcGV L3E 3 845 0000 2 535 00 Servo motor NEMA 1 stack SM23 Olympic contrcSM231 AE NGSN 3 732 0000 2 196 00 PRO4 Cables drive to motor Yellow Olympic contrc23GS CABLE 10 3 313 0000 939 00 PROS Cables controller to drive Black Olympic contrc71 016987 10 3 150 0000 450 00 PROG Power supply 24VDC 2 5 24V Olympic contrcPS60W 1 250 0000 250 00 PRO Motion table 24 inch Daedal 506 Olympic contrc506024ST ES D2L2C5M2E3 1 4533 0000 4 533 00 Motion table 20 inch Daedal 506 Olympic contrc506020ST ES D2L2C5M2E3 1 4372 0000 4 372 00 9 Motion table 4 inch Daedal 105 Olympic contrc106004BT ES D2L2C5M1E1 1 1724 0000 1 724 00 PR10 Brackets vertical mounting Anodized aluminum Olympic contrc4990 08 2 250 0000 500 00 PR11 Personal computer Pentium Ill 256 RAM 4 PCI slots various various 1 1000 0000 1 000 00 PR12 Optical Breadboard 35x47x2 inch Lightweight Coherent 61 9312 1 1089 0000 1 089 00 PR13 Breadboard stand Leveling adjustment Coherent 54 0930 1 1023 0000 1 0
52. er this requires the services of a machine shop For the cover we use the services of Clear Cut Plastics of Seattle Washington although any local plastic fabrication shop should work CAD drawings are available for downloading For the printing of the three circuit boards we use the services of ExpressPCB www expresspcb com These boards may be purchased online and delivered within the week ready for soldering ASSEMBLING THE ARRAYER 1 Assemble the table Unpack and assemble the leveling stand Set the optical breadboard on the stand This will require at least two people Place a level along the long direction of the table from this point on Inkjet Microarrayer Manual version 1 2 the X axis and adjust the leveling screws Place the level along the short direction of the table the Y axis and again adjust Place the electronics rack next to the table preferably to its right We previously had a short electronics rack that fit underneath the arrayer The PC sat on a table nearby Figure 1 We recommend placing the electronics rack to the right of the table This allows the operator to access the front door and the gloves on the left 2 Place servo positioners Place the servo positioners on the table using the coordinates given in Figure 2 First mount the two vertical brackets using four screws in positions A D Fasten the Y axis positioner the 24 inch stage to the brackets with four screws Attach
53. er tower is constructed from three black ABS plastic 1 pipe pieces a MG13 4 adapter MG14 and an end cap MG15 The ABS pieces fit together with friction The air amplifier needs a rubber seal to friction fit into the We pour Drierite dessicant and pet store variety charcoal 17 Inkjet Microarrayer Manual version 1 2 into low resistance porous filter bags and pack the bags into the top funnel of the filter tower Place the tower in the left rear corner of the breadboard and connect the 3 8 gas supply tube to the small barbed inlet of the air amplifier When gas flows into the barbed inlet at 10 lpm gas circulates through the tower at rates up to 100 lpm 15c Connect reagent bottles Reagents are delivered to the print head assembly by gas pressure of 3 psi Add a second T to the outlet of the 30 psi regulator and feed this pressure into the 3 psi regulator MG04 We mounted this regulator at the exposed breadboard top at the left rear edge of the table Connect five check valves MG05 to the 3 psi pressure outlet using flexible 3 16 OD tubing and nylon hose barb fittings and connectors The check valves prevent reagent fumes from reaching other bottles or reaching the regulator Place four 500mL bottles 02 and 2L bottle the front left corner of the POSaM We place them inside a polypropylene tray to prevent any spillage from falling into the screw holes of the breadbo
54. he bend should be orthogonal to the print head assembly Coat the inlet tube the large one of the manifold with flexible silicone sealant or another viscous weak glue Insert the inlet into the bottom of tube MGO9 Angle the manifold jets outlet tubes downward at 45 Mount two solenoids near the psi solenoid MG04 Feed 30 psi pressure into the solenoids The second solenoid is reserved for future use The first is used to control the slide dryer Connect the solenoid output to the top of tube MG09 using 3 16 OD flexible tubing Route the tubing through the conduit as in the previous step Make two two conductor cables to connect the solenoids to connectors 7 amp 8 of board 1901 Use two 1mm power plugs PLUGO3 16 Connect the vacuum components Vacuum is used both to chuck the slides into the slide holder and to suck waste from the bottom of the slide holder This requires the use of teflon tubing and fittings a 2L liquid waste bottle a 500mL trap 02 and a charcoal filter cartridge MM10 We monitor vacuum visually with a dial gauge 602 A voltage output pressure transducer is planned for the future 18 Inkjet Microarrayer Manual version 1 2 17 Install hygrometer Connect the Humirel hygrometer to DB9 connector PLUGO2 via a 2m length of shielded cable Connect wire 1 white to pin 2 ground wire 2 blue to pin 3 voltage source and wire 3 yellow to pin 1 hu
55. inear encoder It monitors analog voltage levels from the hygrometer and the droplet detector power supply Four digital lines and six analog inputs remain available for future use We intend to use the additional analog inputs to monitor pressure levels at the source dewar the reagent bottles and the vacuum 9 jet o c 1 Argon jet 0 Gas solenoids Phos pressure 2 2 L 3 Port A 4 Digital VO i 5 gt 120V ss Relays 5m 6 Reset dd 6 gt Read dd 7 amp Droplet Detector gt TEN 0 Solenoid Driver 1 m MIO 16E Port 3 Counter 1 Reagent Solenoids 4 Counters X axis encoder 5 4 e Device 2 Counter 2 7 DIO32 HS LSBO 7 2 m 1 Device 1 5 a 2 Port C 4 P InketD A Analog Inputs 4 5 6 6 lt Hygrometer MSB 7 7 Group 1 gt QK1 gt SIG12 _________ SIG2 3 n Inkjet nozzle POND 9634 __ NCHG5 6 7 Trigger 1 MI 64 ouput 1 39 Inkjet Microarrayer Manual version 1 2 B3 Board 1503 Circuit schematic Top view of circuit board 15 pin o a Molex Institute for Systems Biology Board 1503 Stephen ordue Chris Leusted Rev 1 1
56. iode post 37 28 Laser post 37 2 Table 1 Coordinates of mounting screws on the optical table given in 1 units 10 Inkjet Microarrayer Manual version 1 2 3 Place servo controller and digital servo amplifiers Mount the 6K4 servo controller and its 24VDC power supply inside the electronics rack and connect the power supply wires according to the manufacturer s instructions We cut 18 inches of aluminum DIN mounting rail and fastened it near the inside top of the rack with self tapping screws The controller and the power supply both clip onto the rail We placed an inline fuse holder between the power supply and the controller Place a rack mount shelf one foot below the rail to hold the supervisory PC Mount and wire the three GV servo amplifiers according to the manufacturer s instructions Mount them to a large 19 rack panel that can accommodate the amplifiers an emergency shutoff Switch two panel mount fuse holders and an optional neon power indicator lamp Place the panel near the bottom of the rack Connect the servo amplifiers to the servo controller It is convenient to place a rack mount 120V outlet power strip and surge protector just below this panel 4 Connect PC and configure servo system Prepare the supervisory PC First install Windows 2000 if necessary Install the National Instruments PCI DIO 32HS and the PCI MIO 16E cards and the supporting Ni daq software according to the manuf
57. ircuit and a set of relays Although it is large in size there isn t much on it It primarily provides input output connections and a lot of prototyping area The encoder signal conditioning circuit is not required by the current Lombardi software Screw terminals allow additional voltage signals to be connected to the POSaM This board uses two 5VDC power supplies Most components use the 5V supplied by the PC The droplet detection circuit uses a separate 5VDC supply 14 Inkjet Microarrayer Manual version 1 2 9 Assemble electronics box 2 Package board 1901 into an aluminum rack mount enclosure As with the previous box drill or punch holes first insert the board insert sockets LEDs and the power switch and make the internal connections The inside of the box contains only the circuit board a 5VDC power supply and two solid state relays Mount the relays to the side wall of the box and make a thermal connection with heat conducting grease Connect the relay to screw terminals 4 amp 5 signal inputs and 3 amp 6 signal ground Connect the 120VAC output sockets to the 120VAC receptacle via the solid state relays The front panel requires a SPST 120VAC power switch and a power indicator LED The back of the box requires the following holes for the 1901 board two D connectors a 68 pin connector a BNC and two round sockets The box requires holes for the 120VAC input receptacle fuse holder and two 120VAC solid state
58. is the first edition of the user manuals and while it makes perfect sense to us we are familiar with the instrument It is possible that some of the instructions are really as clear as mud to everybody else we are counting on your input to make this a better document SYSTEM OVERVIEW Here is a quick overview of how we built the arrayer We tried to use off the shelf components wherever possible and we tried to keep the size reasonably compact As a very rough estimate it can take one person three months to assemble this machine This is based on the time spent by students here on our second machine and includes purchasing lead time Overview of the arrayer The arrayer is build around a three axis servo positioning system mounted to an 89x119cm optical table and enclosed within a sealed acrylic cover Array substrates are chucked into a Teflon slide holder mounted to the Y axis stage A piezoelectric print head and six valved wash Inkjet Microarrayer Manual version 1 2 nozzles are mounted to the X and Z axis stages which move above the slide holder Reagent and waste bottles also remain inside the cover Servo amplifiers the servo controller 6K4 power supplies the supervisory computer PC and most electronics are packaged in a 19 rack outside the cover All processes of the arrayer are directly controlled by the PC except the basic motion control functions that are handled by the 6K4 The Epson F057020 print head availabl
59. isting libraries of characterized DNA molecules These are usually pin spotted onto glass slides or membranes although some non contact printing systems are available One of the problems with these arrays is that you have to collect all those clones amplify them and store them in freezers where they can be collected by a dedicated grad student technician or post doc before they can be printed onto the glass slides That means that you have to have a complete library for every organism you want to study stored in a freezer somewhere in your lab area and then you have to keep track of where every clone is in that library If you want to expand the array to include new genes you first have to acquire physical copies of those genes Any of you involved in the Human Genome Project know that this is really a nightmare of book keeping and lots of mistakes can happen as you are getting that well characterized clone onto a microarray in the spots you want it in SPOTS not singular you want replicates You need replicates The more replicates the better both of the specific gene and the experiment itself There is also a fair amount of cost both initial and continuing that goes along with acquiring replicating storing and retrieving these libraries Wouldn t it be nice to be able to do without them Of course That s one of the reasons that Afffymetrix started making in situ synthesized oligonucleotide arrays They could store all their sequences in
60. lator and rotameter The POSaM requires a high purity inert gas source capable of providing 30 psi of pressure at flow rates of at least 40 Ipm We recommend installing a pair of liquid nitrogen dewars connected by an automatically switched manifold in a separate room This allows the gas provider to replace an empty dewar without interrupting DNA synthesis The output of the manifold is regulated at 60 psi Copper pipe carries to gas to a wall mounted valved outlet in our array room Mount a regulator MGO06 to the breadboard stand PR13 and connect its input port to the nitrogen supply Set the regulator to 30 psi Alternatively a single dewar can be placed next to the POSaM and regulated to 30 psi Connect a T to the regulator output Mount the 120VAC solenoid 07 on the breadboard stand We also attached a heatsink to the solenoid with thermoconducting grease Mount the rotameter to the breadboard stand and connect its input to an output from the T via the solenoid Run a length of 3 8 O D tubing from the rotameter output to the left read corner of the breadboard This tube will be used to fill the working area of the POSaM with inert gas 15b Install the air amplifier The inert gas enters the POSaM cover through the air amplifier MG11 The air amplifier is a flow powered blower that uses the inflow of fresh gas to recirculate the POSaM atmosphere through a filter of calcium sulfate and activated charcoal Our home built filt
61. let detection photodiode assembly as seen by the laser In the same manner mount the laser diode at the rear of the POSaM at Position O of Figure 2 coordinates 37 2 Attach the laser to a 5VDC power supply Align the laser with a bank of 32 nozzles The laser needs to point at the center of the blocking strip Focus the laser just below the print head nozzles The laser elevation should be close to 7 5 inches 19 Install cover The custom plexiglas acrylic glass cover is delivered in four pieces the main body the front panel door the left panel with glove holes and the right panel Installation of the cover involves making a seal to match the main body base placing the main body making panel seals attaching the panels and attaching gloves 19 Inkjet Microarrayer Manual version 1 2 The main body has a footprint 41 inches wide and 35 inches deep compared with the optical table dimensions of 47 inches wide and 35 inches deep The cover and the table are aligned on their right edges leaving 6 inches of table width exposed on the left side Prepare the seal between the table and the cover Attach two continuous strips of 5 16 thick weatherstrip foam MCO6 to the table top to match the flanged base of the cover main body On the right rear corner of the table where the cables are routed use polymer clay instead of weatherstrip to form the seal On the left rear corner of the table or where ever gas tubing or other wires are
62. lide holder The slide holder was custom machined from solid 30 x 30 x 5 cm block of PTFE Slides are arranged in three rows of nine with a center to center spacing of 31 75 mm 1 25 The slides are secured by vacuum Two 9 52 mm 0 375 O rings form a gas tight contact the bottom surface at the ends of the slides Three inclined channels underneath the slides collect the reagent wash waste While this design works for us it could be improved We rarely synthesize more than eight microarrays at a time A redesign of the slide holder is planned for the near future GETTING STARTED BEFORE BEGINNING ASSEMBLY CONSIDER THE LOCATION OF THE ARRAY MACHINE ALTHOUGH WE HAVE ATTEMPTED TO KEEP THE PHYSICAL DIMENSIONS OF THE MACHINE REASONABLE IT REQUIRES A FAIR BIT OF OPEN FLOOR SPACE TO BE ACCESIBLE FROM ALL SIDES PROVIDE AN AREA AT LEAST 7 FEET BY 9 FEET THE MAIN TABLE IS AN OPTICAL BREADBOARD 4 FEET WIDE BY 3 FEET DEEP WE PACKAGED THE ELECTRONICS AND THE SUPERVISORY PC IN A 19 INCH FREE STANDING RACK ABOUT 2 FEET WIDE AND 2 FEET DEEP Consult with your facility manager about providing electricity high purity nitrogen vacuum and fume ventilation The electrical needs are easily met with a 120 volt 15 amp connection A nitrogen dewar may be placed adjacent to the POSaM but that requires additional floor space We recommend placing two or more nitrogen dewars in a separate room and plumbing the inert gas into the arraying room The dewars
63. llevue WA controlling nitrogen flow are normally closed and require 3V to open Two output lines of the MIO 16E digital port are used to activate the two TTL compatible relays that power the solenoids Proper function of each of the 192 piezoelectric nozzles is verified by the laser droplet detection subsystem A red laser diode is mounted orthogonally to the direction of print head motion such that the droplet stream of each bank of nozzles can intersect the beam The print head is positioned 10 mm above the beam Nozzles are fired in series through the beam and the forward scattering of each droplet is detected by the photodiode A red bandpass filter is used with the photodiode The output signal is amplified highpass filtered and converted to a digital signal by threshold comparison Nozzles fail due to bubbles or plugging and are taken offline during synthesis The 10 mm distance is chosen so that partial nozzle occlusion which deflects droplet trajectory also registers as a nozzle failure Phosphoramidite delivery The six fluid channels of the inkjet print head each contain a needle inlet a filter an ink cavity and a nozzle plate The needle inlet normally punctures a protective membrane beneath the ink cartridges The volume between the inlet and the nozzle is approximately 25 uL In the design presented here two multi well ink cartridges are replaced by six glass vials The vials are 1 mL clear conical Reacti vials and capped with
64. long threaded Digi Key 8405K ND 8 0 4850 3 88 CN8a CN8b Molex micro connector 15 conducter 15 pin Mouser 538 52806 151 8 0 7100 5 68 D25 D SUB 25 pin connector plug male D25 Digi Key A2098 2 4 8400 9 68 R1 R6 resistor 2 2 kOhm 1 8W Digi Key 2 2KQBK ND 25 0 0560 1 40 46 Inkjet Microarrayer Manual version 1 2 C4 PCB 1804 Components for printed circuit board 1804 Total 703 03 Express PCB File 1804 pcb 13 16 C1 C8 C10 C12 c9 C11 CN1 PLUGOA CN2 PLUGO5 CN3 PLUGO6 4 5 01 08 F1 F4 H1 H2 1C15 1C16 2 104 165 6 IC7 IC14 L17 L19 L21 L23 L25 L27 L18 L20 L22 L24 L26 L28 L1 L8 19 116 51 52 R1 R10 R13 R14 R25 R2 R3 R4 R5 R6 R9 RA1 RA2 RA3 RA4 1 54 56 17 20 52 53 55 515 516 Circuit board 1804 Aluminum stand off LED Nice panel mount 3mm green LED Nice panel mount 3mm red plastic film capacitor aluminum electrolytic capacitor plastic film capacitor D SUB 25 pin connector receptacle female D SUB 25 pin connector male D SUB 25 pin connector plug male D SUB 25 pin connector female D SUB 15 pin connector receptacle female D SUB 15 pin connector male Amp 68 connector male 12 pin Screw Terminal diode Fuse Breakaway header mounts Digital to analog converter NOT gate hex Op amp Follower Optoisolation quad darlington AND gate quad Decoder Solenoid driver LED LED LED
65. mble electronics box 2 15 10 Place reagent RM 15 11 Place gas P ERE Tan 15 12 Place slide ua qu 16 13 Install print head brackets a a 16 14 Install print head and phosphoramidite 16 15 Assemble pressurized gas and liquid plumbing 17 15a Install pressure regulator and 17 Install theat amplifier a 17 15c Connect reagent bottles e ete 18 15d Install the Side 18 16 Connect the vacuum components 18 17 Install hygpromet r nn eet eel 19 18 Install droplet detection laser and 19 ON ES ee nkhu u aty Sa ah 19 20 Connect fume exhause 20 aps 20 Using Tom bard 21 Lombardi File Formats ooh aei de oo educ RS 22 Using Araye ect itte ida ePi aetna ose aee due 23 Arrayer File Porimats esae 25 Coria tee p 27 WHA PS q p 28
66. midity signal Mount the hygrometer on the XZ axis vertical bracket PR10 near the slide holder Plug the sensor in to board 1901 18 Install droplet detection laser and photodiode The droplet detection laser sends a beam from behind the print head to the photodiode detector in front of the print head The beam is aligned so that all droplets fired downward from the 32 nozzles in any one bank will intersect the beam Light from the beam is normally blocked from reaching the photodiode by a black tape blocking strip Light refracted by the droplets passes around the strip and reaches the detector Place a post mount POO3 to support the photodiode at Position of Figure 2 coordinates 37 28 Insert a 8 post PO12 and attach a right angle clamp PO06 Attach a ring clamp 09 to the end of a 4 post PO11 and insert the post in the clamp Insert the photodiode into the bottom of the 1 SM1 barrel PO10 and secure it with a ring nut POO8 Use a pair of ring nuts to secure the red filter POO1 in the middle of the barrel Use another pair of ring nuts to secure the lens 02 at the end of the barrel Since a large area photodiode is used precision focusing and alignment is not necessary Cut a srip of electrical tape 6mm thick and 50mm long Place the strip on the end of the SM1 tube barrel as shown below Place the barrel in the ring clamp and tighten the clamp The lens faces the rear of the POSaM Figure 12 Drop
67. o develop an inkjet arrayer that almost anybody can build and operate That is where the POSaM platform came from We were not trying to compete with the throughput of the industrial size Agilent Rosetta arrayer It would cost too much to build that into a machine for the end users at this stage at least We just wanted to make an instrument that could be built and used by anybody interested so that new methods and designs could be investigated to make better in situ synthesis array much as the release of the plans for the pin spotter did for more traditional arrays We are not guaranteeing this instrument or the arrays it makes It is an academic instrument that works fairly well It is good for prototyping arrays and designing and testing reporters You might want to start the design for your arrays on this machine and when they work the way you want have Agilent or Nimblegen or Xeotron or Affymetrix make them for you in large enough quantities and in high enough quality that you can do all your experiments You could also use the arrays from the POSaM platform itself and not order commercially made arrays That is up to you and how comfortable you feel with the results you have gotten Presently we feel most array results need to be confirmed using different methods anyway The bottom line is that you any good molecular biology lab with some organic chemistry experience and a little engineering help can build and run this instrument You can make
68. otide arrays Biosensors amp Bioelectronics 1996 11 687 690 J DeRisi V lyer PO Brown The MGuide A complete guide to building your own microarrayer http cmgm stanford edu pbrown mguide TC Islam J Lindvall A Wennborg LJ Branden H Rabbani CI Smith Expression profiling in transformed human B cells influence of Btk mutations and comparison to B cell lymphomas using filter and oligonucleotide arrays Eur J Immunol 2002 32 4 982 93 WP TK Jenssen AJ Butte L Ohno Machado IS Kohane Analysis of matched mRNA measurements from two different microarray technologies Bioinformatics 2002 18 3 405 12 HP Le Progress and trends in ink jet printing technology In Book Recent Progress in Ink Jet Technologies Editor E Handson City Springfield VA 1999 J Li M Pankratz JA Johnson Differential gene expression patterns revealed by oligonucleotide versus long cDNA arrays Toxicol Sci 2002 69 2 383 90 A Relogio C Schwager A Richter W Ansorge J Valcarcel Optimization of oligonucleotide based DNA microarrays Nucleic Acids Res 2002 30 11 e51 A Roda M Guardigli C Russo P Pasini M Baraldini Protein microdeposition using a conventional ink jet printer Biotechniques 2000 28 492 6 AT Rogojina WE Orr BK Song EE Geisert Jr Comparing the use of Affymetrix to spotted oligonucleotide microarrays using two retinal pigment epithelium cell lines Mol Vis 2003 9 482 96 DI Stimpson PW Coole
69. r Manual version 1 2 B7 Configuration file for Gemini drives Download and install this file to all three Gemini digital servo amplifiers using Motion Planner or a serial terminal communication program This requires an RS 232 cable to be connected one at a time to each amplifier Gemini GV Servo Drive Setup File name Gemini GV SM231AE config prg otor Setup TR 1303 Motor ID SM SE231AE TIC 1 98 Continuous Current Amps RMS TICD 22 90 Continuous Current Derating derating at rated speed TKE 17 7 otor Ke Volts 0 to peak krpm TRES 5 22 otor Winding Resistance Ohm TJ 51 970 otor Rotor Inertia kg m m 10e 6 POLE 2 Number of Motor Pole Pairs TW 100 0 Motor Rated Speed rev sec TIP 5 94 Peak Current Amps RMS TLMN 2 2 inimum Motor Inductance mH TLMX 2 9 aximum Motor Inductance mH TD 0 000017 otor Damping Nm rad sec oo agog ggo ogg goog g g TRWC 0 85 Motor Thermal Resistance degrees Celsius Watt TTCM 20 0 Motor Thermal Time Constant minutes TTCW 0 33 Motor Winding Time Constant minutes TAMB 40 00 Motor Ambient Temperature degrees Celsius TMAX 125 00 Maximum Motor Winding Temperature degrees Celsius Drive Setup DMODE 2 Drive Control Mode DRES 4000 Drive Resolution counts rev DPWM 0 Drive PWM Frequency kHz ERES 4000 Encoder Resolution counts rev ORES 4000 Encoder Output Resolution counts rev DMEPIT 0 00 Electrical Pitch mm DM
70. re Gas pressure Gas pressure Gas pressure Gas pressure Gas pressure Gas pressure Gas pressure Gas pressure Gas pressure Gas circulation Gas circulation Gas circulation Gas circulation Reagent handling Reagent handling Reagent handling Reagent handling Reagent handling Reagent handling Reagent handling Reagent handling Reagent handling Print head Print head Print head Print head Print head Print head Print head Print head Conduit Solenoid tower Solenoid tower Spacer Spacer Teflon block 12x12x2 raw material for machineSlide holder O rings 3 8 OD 1 4 ID Machine shop fabrication slide holder Machine shop fabrication print head holder Punch arch 3 8 inch Slide holder Labor Labor Tool Filter Whatman P N 6704 1500 a Carbon CapFume filter Mouser Manfield TX 63 CH 14404 Mouser Manfield TX 563 C 14432 Mouser Manfield TX 161 0717 187 Mouser Manfield TX 642 631H2 Digi Key Thief River FeF952 Mouser Manfield TX 651 5602100 Mouser Manfield TX 563 POS 1295 S Mouser Manfield TX 563 SA1278 BT Mouser Manfield TX 546 PBPA19014BK2 Digi Key Thief River Fe1125M ND Digi Key Thief River Fe970 25MP ND National Instruments 777314 01 National Instruments 777383 01 National Instruments 184749 01 National Instruments 183432 01 Small Parts Miami LakB LD 1 Digi Key Thief River Fe1607 KIT ND Small Parts Miami LakB WXF 1 4 Small Parts Miami LakB WXF 3 8 Hardware store H
71. relay output sockets A connector for the droplet detector laser 5DVC supply is also usefule The photo below shows all of the connectors at the rear although some placement has changed with the current board 1901 Insert the box into the electronics rack between the PC shelf and the servo amplifier panel Figure 8 View of the rear of the rack mount enclosure housing the predecessor of the 1901 board From the left one 120VAC receptacle two 120VAC sockets hygrometer D connector Unused D connector gas solenoid power jacks 5VDC supply for the droplet detector laser 5VDC BNC for the the droplet detector photodiode and 68 pin interface board connector 10 Place reagent solenoids Construct a the solenoid tower and place at position M coordinates 17 5 of Figure 2 To construct the tower cut a 12 inch length of 1 inch square aluminum tubing Using the base of an Angar teflon solenoid as the template drill and tap 4 40 threads for mounting holes Mount six solenoids with 4 40 screws Cut a 14 inch length of 74 20 threaded rod Use the rod a 175 inch fender washer and 74 20 nut to fasten the tower in place 11 Place gas solenoids Make a 2 x6 mounting plate for the ET 2 solenoids from gt thick PVC sheet Drill and counterbore four mounting holes for the two solenoids in the plate Drill two 72 holes 5 inches 15 Inkjet Microarrayer Manual version 1 2 apart for mounting the plate to the optical
72. rts Miscellaneous POSaM components Total 8 663 05 1 2 4 5 06 7 08 09 ME10 ME11 ME12 ME13 ME14 ME15 MCO1 MC02 MC03 MC04 MC05 MC06 MC07 MC08 MC09 MC10 MC11 MG01 MG02 MG03 MG04 MG05 MG06 MG07 MG08 MG09 MG10 MG11 MG12 MG13 MG14 MG15 MR01 MR02 MR03 MR04 MR05 MR06 MR07 MR08 MR09 MP01 MP01a MP01b MP01c MP02 MP03 MP04 MP05 MM01 MM02 MM03 MM04 MM05 MM06 MM07 MM08 MM09 MM10 MM11 Rack mountable case 19 Chassis cover 19 AC power inlet with fuse holder Power switch SPST Fuse 5x20mm 5A 250V DIN rail Power strip and surge protector rack mount Shelf 19 Panel 19 Connecter DB 25M Hood DB 25 connector Digital O board PCI 6533 a k a DIO 32HS Multi VO board PCI 6040E a k a MIO 16E Cable 68 pin for 16 Cable 68 pin for PCI DIO 32HS Draw Latch Type 304 SS Hardware stainless steel Hinges Fender washers 1 dia hole 25 pk Fender washers 172 dia 25 pk Weather seal 5 16 thick 19 32 wide Weather seal 5 16 thick D profile Box gloves and fastening clamps Polyethylene tape 18m roll 2 wide Valve low resistance air 22 30mm diameter Shop to fabricate cover Tubing 3 8 OD Polyethylene or copper Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Elec
73. s of 1 16 ODthick wall teflon tubing Insert them in the Pharmed tubing Cut the luer ends off six 20 gauge non coring 4 needles leaving the needle 3 16 Inkjet Microarrayer Manual version 1 2 in length Deburr the needles and wash in an ultrasonic bath Insert the cut end of the needles into the teflon tubing Carefully insert the needles into the phosphoramidite vials In the illustration below we have made a reagent rack from a sheet of aluminum The vials may also be placed in the ink holder e Figure 11 Phosphoramidite is fed from the vials through 20 gauge needles and teflon tubing to the inkjet Pharmed tubing is used to attach the teflon tubing to the inkjet 15 Assemble pressurized gas and liquid plumbing Gather together the components needed to complete the POSaM fluid system diagrammed below Most of the components are listed in Appendix C6 but part numbers for metal and plastic tubing fittings connectors and adapters will vary between hardware stores We purchased an assortment of 1 4 and 1 8 NPT brass fittings T connectors adapters hose barb connecters compression fittings and quick disconnect couplings from our local Mom and Pop hardware store It s useful to have extra supplies We took 100 feet of 3 8 O D polyethylene tubing rated with a working pressure of 87 psi We also got our 1 5 1 0 flexible tubing there for use as an exhaust hose and as cable conduit 15a Install pressure regu
74. silicone Teflon septa Thick wall Teflon tubing 15 cm in length conducts the phosphoramidite or tetrazole solutions from the vials to the needle inlets The tubing connects to the needle inlets with 1 6 mm 1 0 PharMed tubing and to the vials with 20 gauge non coring stainless steel needles 5 cm in length The vials are at neutral pressure during printing Reagent solvent storage Reagents and solvents are stored in 500 mL glass bottles with GL45 screw top caps except for the 2 L acetonitrile and waste bottles All tubing and bottle cap surfaces exposed to chemical vapors or liquid are Teflon Pressurizing nitrogen enters the reagent and solvent bottles through PTFE check valves Vari bore type Omnifit Rockville Centre NY that have a 5 torr 0 1 psi cracking pressure The waste bottle is negatively pressurized with 380 650 torr 15 25 inHg vacuum Nitrogen supply and system enclosure Inert gas and pressurization is supplied to the system by a liquid nitrogen dewar Regulators are set to 50 psi for the inert atmosphere supply to 30 psi for the slide drying jet and to 3 psi for the reagent solvent reservoirs The microarray area is enclosed with a custom acrylic cover with a 89 x 104 cm footprint and an internal volume of approximately 510 liters The cover is transparent and airtight It has a single access door providing a 40 x 70 cm opening A glove panel also allows the operator to work inside the enclosure without opening the
75. socket neutral terminal to the neutral posts of the power supplies using 18 gauge stranded wire Connect the 120VAC receptacle live terminal to the live posts of the power supplies via the DPDT power switch For the other connections smaller wire gauges 22 26 may be used Connect the 5 5 and 30VDC power supply output posts to the appropriate circuit board screw terminals The 30VDC screw terminal is unused Connect the 5VDC and 5VDC indicator LEDs to the 5VDC and 5VDC power supply output terminals through 1k current limiting resistors Connect the 30VDC indicator LED to the 30VDC power supply output terminals through a 6k current limiting resistor The other LEDs are connected to the circuit board without using any extra current limiting resistors Connect the eight solenoid indicator LEDs to connector CN6 The BNCs and the other LEDs may be connected to various optional points in the circuit board such as screw terminal position 3 piezoelectric pulse and CN7 6K4 outputs printhead signals respectively Insert the box into the electronics rack between the PC shelf and the servo amplifier panel 8 Assemble printed circuit board 1901 In the same manner that board 1804 was finished assemble the circuit board using the layout information in the 1901 schematic sch and circuit board pcb files This board connects to the PCI MIO 16E multifunction board and contains the droplet detection circuit an encoder signal conditioning c
76. starting point of synthesis when the Go button is clicked Usually the synthesis will begin from the first play of the first down They play is the command indicated on a line in the playbook file such 21 Inkjet Microarrayer Manual version 1 2 as PRINT or WASH The down refers to which base monomer is being synthesized The first or 3 base is coupled on first down The second base is coupled on second down A 25 mer oligo will require 25 downs The sports analogy breaks down here Synthesis can be paused by using the Abort button Synthesis can be resumed because the last down and the last play are remembered If synthesis is to be restarted from the beginning the current down and the current play must be manually reset by the user Buttons representing each of the 27 slide positions occupy most of the space on this panel Clicking on a button will open the slide editor This is mostly used to view the slide and ensure that the correct lineup file has been selected The user also has the ability to edit the contents of a slide Each spot or feature of the slide can be selected and the sequence modified The slide editor also shows the spot density chosen This is usually 90 DPI The higher resolutions have not been well tested and should be avoided p Servo Control 5 B MoveX gt gt wait 2 lt lt 4 Move gt gt o weit Home All 2 3 n lt lt 4 Movez
77. surization is currently unused PCI bus Desktop PC lt Ethernet PCI bus Multifunction 10 High speed 6K4 Servo Board Digital IO Board lt Dig Controller MIO16E DIO 32HS Dig Dig Dig Dig Droplet 30 VDC Solenoid X axis Y axis Z axis Solenoid Solenoid Power gt 9 Servo Servo Servo detector Suppl Power Amplifier board Ami Am upply Digital buffer r Anlg ws Mech Mech Mech Argon Phosphoramidite Primary Extra ae Seas Drying jet pressurization Printhead Printhead Solenoids 7 Motor Motor Motor 38 Inkjet Microarrayer Manual version 1 2 B2 PCI Card Interfaces Two National Instruments interface cards are installed in the PCI slots of the PC The high speed digital card DIO32 HS controls the inkjet print head and eight 24VDC solenoids Six Angar solenoids are actually used It also receives a digital trigger signal from the 6K4 motion controller This signal is used to trigger a piezo jet event Thirteen digital lines remain available for future use The multipurpose card MIO 16E connects to the nitrogen solenoids the 120VAC solid state relays the droplet detector and the X axis precision l
78. tronics rack Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Electronics rack Cover Cover Cover Cover Cover Cover Cover Cover Cover Cover Cover Gas pressure Misc brass fittings T connectors and adapteGas pressure Nylon fittings Vacuum gauge 0 30inHg range Solenoid ET 2 6Volt Pressure regulator 0 10psi range Check valves 0 1 cracking pressure Regulator 0 200psi Solenoid valve large 120VAC Rotameter valve 0 100 liters per minute Aluminum tubing 1 8 OD 12 long Manifold Tube clamp valve for flexible tubing 10 pk Air amplifier Blower joint ABS plastic 172 size Adapter ABS plastic 4 to 172 size End cap ABS plastic 11 2 size GL 45 ported caps Bottle GL45 cap 500mL case Bottle GL45 cap 2L case 1 8 OD Teflon tubing 50ft and fittings Teflon fitting nuts 10 pack Ferrules 10 pack 1 16 OD Teflon tubing 20ft Tefzel fitting nuts 10 pack Solenoid valve Teflon 14 DC Epson Stylus Photo 700 printer Cable 15 cond flexible flat Print head amp ink holder black Print head slide silver Vial 1mL clear conical bottom 12 pk Septa Pierce Tuf bond 72 pack Needles non coring 20 x 4 inches Piezoelectric print head Flexible conduit 17 I D 25ft length Aluminum tubing square 1 wide 12 long Threaded rod 14 20 14 inches long Bushing 74 ID 1 long Bushing 1 4 ID 72 long Gas pressure Gas pressu
79. ts It uses a small heating element in the capillary to vaporize solvent and create a bubble The rapid expansion of the bubble ejects a droplet Although they are unsuitable for de novo array synthesis thermal or bubble jets have been used successfully to deliver aqueous solutions of oligonucleotide and of protein for microarraying Stimpson et al 1998 Roda et al 2000 Servo control The three axis positioning system utilizes Parker Daedal 506 series ball screw linear actuators driven by NEMA SM23 servo motors The motors are in turn powered by GV digital servo amplifiers on command from a 6K4 multi axis motion controller The controller interfaces to the PC by Ethernet triggers the actual jetting through one of its eight digital output lines This system can move the print head over a wide 50x60 cm range with 5 micron repeatability Microarrayer electronics Circuit schematics for the print head solenoid and droplet detection interfaces appear in Figure 3 Two PCI interface boards the DIO 32HS and the MIO 16E are used National Instruments Austin TX The F057020 print head requires three data one clock one latch and one piezoelectric drive signals Each of the three data lines programs two banks of 32 nozzles Data is sent serially in 64 bit words to the nozzle selection register and latched with a single pulse of the latch signal The clocking frequency used here is 500 kHz though 3 MHz is possible Digital signals ar
80. ts main advantages are a simple playbook language and the ability to print different sequences on each slide It can print up to 9800 spots 70 by 140 in 90 DPI mode We don t recommend trying 180 270 or 360 DPI mode We do not yet have a substrate that allows us to use 180 or more DPI We once tried a set of amino slides with 180 DPI density but it resulted in about 2096 malformed features Since the print head has 32 rows of nozzles choose a number of rows that is equal to or slightly less than a multiple of 32 For example 70 by 64 or 70 by 128 are recommended for faster cycle times Lombardi E3 Line Up File Edit Slide Slide 1 Slide 2 Slide 3 Slide 4 Slide 5 Slide 6 Slide 7 r Slide 8 Slide 9 i H Use Use Use Use Use Use Use Use Use Slide 10 Slide 11 gt f Slide 12 Slide 135 p Slide 14 gt Slide 15 gt Slide16 p Slide 17 p Slide 18 gt Load New Line Up Use Use Use Use Use Use Use Use Use 2 Edit Line Up Settings E 222 Save This Line Up Slide 195 Slide 205 Slide 21 gt p Slide 22 Slide 23 Slide 24 Slide 25 gt Slide 264 Slide 27 gt Edit Configuration Use Use Use Use Use Use Edit Play Book SS Control Panel Current Down Max Oligo Length hc hoc Current Play 2 Playbook Test Reset J Pause gt
81. ur such connectors when only two are needed The second pair of connectors are reserved for the future use of a second print head As shown in the photo below you do not need to insert the second pair of connectors Figure 4 Top view of the 1501 board after assembly Note that only the two necessary Molex connectors have been installed 6 Assemble printed circuit board 1804 In the same manner as the previous step assemble the circuit board using the layout information in the 1804 schematic sch and circuit board pcb files This board connects to the PCI DIO 32HS board and contains the piezoelectric driver circuit the solenoid driver circuits and an optoisolator for the jetting trigger signal There is an large empty area of solder pads at the upper right corner available for prototyping 12 Inkjet Microarrayer Manual version 1 2 Figure 5 Top view of the 1804 board as it arrives in the mail This board is considerably larger and so it has holes for attaching nine stand off posts Be careful when attaching the cable connectors at the bottom edge of the board The high density 68 pin connector has a conducting metal shell that should not touch the copper pads and tracings of the circuit board s top layer Separate this connector and the three D style connectors from the board by using nylon washers as spacers between the mounting screw holes This will hold the connectors up off the board Do not solder ICs resistor
82. ven down To look at the bases deposited on a different down the user can change the value in the Down text box Since the jog buttons can be very tedious eight frequently used positions can be saved in the Important Coordinates dialog box The first three positions have fixed definitions The droplet detector position 1 must be located where droplets pass through the laser beam The purging area 2 must be chosen to avoid piezojetting onto a slide The cleaning start point 3 is currently not used The other five points are user defined Positions 4 6 should correspond to the right most slides in each row When synthesizing more than one slide operations can be performed on a row of slides from right to left Before using these coordinates the servos must be homed Homing is not done automatically The Arrayer software may be exited and restarted without re homing 24 Inkjet Microarrayer Manual version 1 2 p Position 1 Position 3 Name Name Name Droplet detector Purging area Cleaning start point X 77400 X 77400 X 81800 Y 25000 Y 25000 Y 83000 2 sooo 2 53000 2 63500 Go Go Go p Position 4 Position 5 Position 6 Name Name Name 1 RearRow 7th ___ Middle Row 16 Front Row 25th X o o X m0 X 24500 Y 12000 Y 25000 Y 87000 2 65300 2 66900 55900 Position 7 Position 8 Name Name
83. y SM Knepper DB Wallace Parallel production of oligonucleotide arrays using membranes and reagent jet printing Biotechniques 1998 25 886 90 50

Posam Manual Chapter 1

Contents

Download Pdf Manuals

Related Search

Related Contents